Phylogenetic relationships in Apocynaceae based on both nuclear and plastid molecular datasets

A Dissertation Submitted in the Partial Fulfilment of the Requirements for the Degree of Doctor of Philosophy in PLANT SCIENCES

BY

NAZIA NAZAR

DEPARTMENT OF PLANT SCIENCES, FACULTY OF BIOLOGICAL SCIENCES,

QUAID-I-AZAM UNIVERSITY ISLAMABAD, PAKISTAN

2012

Phylogenetic relationships in Apocynaceae based on both nuclear and plastid molecular datasets

Doctor of Philosophy in Plant Sciences

BY

NAZIA NAZAR

DEPARTMENT OF PLANT SCIENCES, FACULTY OF BIOLOGICAL SCIENCES,

QUAID-I-AZAM UNIVERSITY ISLAMABAD, PAKISTAN

2012

Dedicated

To

My Parents

Table of Contents

Index of figures i

Index of tables ii

Acknowledgements iii

List of abbreviations iv

Abstract v

Chapter One — General Introduction 1

1.1 Distribution of Apocynaceae 1

1.1.1 Asclepiadoideae 1

1.1.2 Secamonoideae 2

1.1.3 Periplocoideae 2

1.1.4 Apocynoideae and Rauvolfioideae 3

1.2 Economic importance of Apocynaceae 3

1.3 Apocynaceae ─ since Brown’s treatise 4

1.4 An overview of subfamilies in Apocynaceae sensu lato 7

1.4.1 Rauvolfioideae 7

1.4.2 Apocynoideae 10

1.4.3 Periplocoideae 13

1.4.4 Secamonoideae 15

1.4.5 Asclepiadoideae 17

1.5 The use of molecular data in cladistic analysis 20

1.6 Utility of plastid and nuclear regions for phylogenetic reconstruction in plants 21

1.7 Nuclear gene (Phytochrome A) 22

Chaper two — Materials and Methods 25

2.1 Taxon sampling 25

2.2 DNA extraction 25

2.3 Polymerase chain reaction (PCR) 34

2.3.1 trnL-F intron-spacer region 37

2.3.2 Nuclear gene PHYA 37

2.3.3 Promoter region of atpB gene 37

2.4 Purification of amplified products 37

2.5 Sequencing 38

2.6 Data analysis 38

2.6.1 Parsimony analysis 38

2.6.2 Bayesian analyses 38

Chapter three — Results 55

3.1 DNA extraction and PCR 55

3.2 Purification and sequencing of amplified products 55

3.3 Phylogenetic analysis based on plastid trnL-F intron region sequences 55

3.4 Phylogenetic analysis of Apocynaceae by using nuclear region (PHYA) 63

3.5 Combined phylogenetic analyses (PHYA and trnL-F) of Apocynaceae 64

3.6 Phylogenetic analysis based on promoter region of atpB gene promoter 79

Chapter four — Discussion 82

4.1 Incongruence 82

4.2 Asclepiadoideae 83

4.2.1 Fockeeae 83

4.2.2 Ceropegieae 83

4.2.3 Marsdenieae 87

4.2.4 Asclepiadeae 88

4.2.5 Asclepiadeae – ACT group 88

4.2.6 Asclepiadeae ─ MOG group 88

4.3 Secamonoideae 91

4.4 Periplocoideae 92

4.5 Apocynoideae 93

4.5.1 APSA clade 93

4.5.2 Nerieae 96

4.5.3 Malouetieae 96

4.5.4 Odontadenieae 97

4.5.5 Mesechiteae 97

4.5.6 Echiteae 98

4.5.7 Apocyneae 98

4.5.8 Baisseeae 98

4.6 Rauvolfioideae 99

4.6.1 Alstonieae and Aspidospermeae 100

4.6.2 Alyxieae 100

4.6.3 Vinceae 100

4.6.4 Plumerieae 103

4.6.5 Tabernaemontaneae 103

4.6.6 Melodineae 104

4.6.7 Carisseae 104

4.7 Phytochrome A 104

4.8 Conclusion 105

Chapter five — References 106

Appendix One 128

QIAquick PCR purification kit protocol 128

Appendix two 129

Cycle sequencing 129

Purification of cycle sequencing product 129

i

Index of figures

Figure 1.1 A summary of the relationships among five subfamilies and twenty two

tribes of Apocynaceae..................................................................................................24

Figure 2.1 Map showing the areas of plant collection in Pakistan..............................32

Figure 2.2 Map showing different countries of the world, from where different taxa of

Apocynaceae were collected and stored in herbarium or as living collection in The

Royal Botanic Gardens, Kew, London.........................................................................33

Figure 2.3 Showing locations of primers used to amplify different regions of plastid

and nuclear genomes....................................................................................................35

Figure 3.1 Extraction of genomic DNA and amplified products of different plastid

and nuclear regions.......................................................................................................56

Figure 3.2 One of the most parsimonious trees for Apocynaceae based on the

sequences of plastid trnL-F region...............................................................................58

Figure 3.3 The Bayesian tree resulting from the analysis of the trnL-F sequences for

Apocynaceae................................................................................................................60

Figure 3.4 Parsimony analysis of only PHYA sequences from different taxa of

Apocynaceae................................................................................................................65

Figure 3.5 Bayesian tree based on only PHYA sequences...........................................67

Figure 3.6 Parsimony analysis of trnL-F sequences of taxa present in combined

analyses........................................................................................................................69

Figure 3.7 Bayesian analysis of trnL-F sequences of taxa present in combined

analyses....................................................................................................................... 71

Figure 3.8 One of the most parsimonious trees for Apocynaceae based on sequences

of the combined dataset (PHYA and trnL-F)................................................................73

Figure 3.9 Bayesian analysis of Apocynaceae by using combined datasets (PHYA and

trnL-F)..........................................................................................................................75

Figure 3.10 Parsimony tree generated by using molecular combined data set (trnL-F,

atpB and PHYA)...........................................................................................................80

Figure 3.11 Majority rule consensus tree based on the Bayesian analysis of the

combined molecular datasets (trnL-F, atpB and PHYA)..............................................81

ii

Index of tables

Table 2.1 A list of the samples from Pakistan and The Royal Botanic Gardens Kew,

London with vouchers information and place of collection.........................................26

Table 2.2 Sequences and sources of different primers used in this study...................36

Table 2.3 A list of taxa with GenBank accession numbers used in trnL-F and PHYA

analyses........................................................................................................................39

Table 4.1 Current phylogenetic positions of taxa in different groups of

Asclepiadoideae............................................................................................................84

Table 4.2 Phylogenetic position of taxa in different groups of Apocynoideae in

comparison with previous studies................................................................................94

Table 4.3 Comparative overview of phylogenetic position of Rauvolfioideae’s taxa

within present phylogenetic analyses and previous classifications............................101

iii

Acknowledgment

In the name of Allah, the Most Gracious and the Most Merciful Alhamdulillah, all

praises to Allah for the strengths and His blessing in completing this thesis. First and

foremost I wish to thank my supervisor Dr. Tariq Mahmood (Department of Plant

Sciences) for his guidance, suggestion and encouragement throughout the Ph.D study.

I wish to express my heartfelt appreciation and deep sense of devotion to Prof. Mark

W. Chase (Royal Botanic Gardens, Kew, London) who was a permanent source of

encouragement and guidance for completion of my research work in Jodrell

laboratory. His scholarly ideas beautified the scientific nature of this research work.

He always directed to enlighten the ways of life as well. I would also like to pay my

cordial thanks to James J Clarkson and David Goyder (from Royal Botanic

Gardens Kew, London) for their continuous cooperation, munificent guidance,

moral inputs, support, unconditional help and valuable advices they offered for

completion of my research. Their continuous encouragement and concern are highly

appreciated. It gives me great pleasure to express my gratitude to Higher Education

Commission of Pakistan, for providing Indigenous and IRSIP scholarships.

I would like to express my gratitude to the Dean, Faculty of Biological Sciences,

Prof. Dr. Asghari Bano and also to the faculty members of Department of Plant

Sciences, Dr. Mushtaq Ahmad and Dr. Mir Ajab Khan for their support and help. I

would also like to thanks late Dr. Muhammad Arshad (Cholistan Institute of Desert

Studies, The Islamia University of Bahawalpur) for providing plant specimens from

Pakistan. My acknowledgement also goes to all the technicians and office staffs of

Department of Plant Sciences for their co-operations.

My special thanks to my friends and fellows Sobia Kanwal, Ishrat Naveed, Faiza

Munir, Shazia Rehman and all junior students of the Lab. I am deeply indebted to

my parents for their support, both emotional and financial, over the years. Last, but

certainly not least, I would like to give special thanks to Muhammad Sarfraz, who is

a great listener and has always been at my side during the highs and lows of this

project.

Nazia Nazar

iv

List of Abbreviations

ACT Asclepiadinae, Cynanchinae and Tylophorinae

AIDS Acquired Immunodeficiency Syndrome

APG Angiosperm Phylogeny Group

APSA Apocynoideae, Periplocoideae, Secamonoideae and

Asclepiadoideae

bp Base Pair

BP Bootstrap

BSA Bovine serum albumin

CI Consistency Index

CsCl-EtBr Cesium Chloride Ethidium Bromide

CTAB Cetyl Trimethyl Ammonium Bromide

EDTA Ethylene diamine Tetra Acetic Acid

ITS Internal Transcribed Spacer

MCMC Monte Carlo Markov chain

MCMC Monte Carlo Markov Chains

Mgcl2 Magnesium Chloride

ML Maximum Likelihood

MOG Metastelmatinae, Oxypetalinae and Gonolobinae

MP Maximum Parsimony

NJ Neighbour Joining

PAUP Phylogenetic Analysis Using Parsimony

PCR Polymerase Chain Reaction

PHYA Phytochrome A

PP Posterior Probability

RI Retention Index

SSC single-site catalysis

TBR Tree Bisection-Reconnection

TE Tris Ethylene Diamine Tetra Acetic Acid

UPGMA Unweighted Pair Group Method with Arithmetic Means

UV Ultra Violet

v

Abstract

The phylogenetic relationships within Apocynaceae were investigated in the present

study. In addition trnL-F intron-spacer region and atpB promoter, a part of PHYA

exon, a low-copy nuclear gene were sequenced from Apocynaceae. Different taxa of

the family were collected from Pakistan and different regions of the world,

representing major groups of the family. Separate phylogenetic trees were constructed

using trnL-F and PHYA sequences and then combined datasets were used for

simultaneous analysis. In the separate trnL-F analyses (comprised of 178 taxa with

updated nomenclature) both parsimony and Bayesian, yield a number of stable clades,

but placement of tribes (Vinceae, Tabernaemontaneae, Hunterieae and Melodineae) in

Rauvolfioideae is uncertain and lack high level of support. A clade comprising

Ceropegieae and Marsdenieae receives good support confirming the monophyly of

both tribes. The grouping of taxa in Asclepiadeae is not satisfactory to define a

subtribal classification. Malagasy Cynanchum group forms a separate clade in both

analyses while the monophyly of New World Cynanchineae is not supported here.

In the combined phylogenetic analyses, 112 taxa were included representing most

major caldes in Apocynaceae. The study confirms that Periplocoideae are nested

within Apocynoideae. The APSA clade (Apocynoideae, Periplocoideae,

Secamonoideae and Asclepiadoideae) is strongly supported here, but the crown clade

of Apocynaceae (comprised of subfamilies Asclepiadoideae, Secamonoideae,

Periplocoideae and Echiteae, Mesechiteae, Odontadenieae and Apocyneae of

Apocynoideae) has only moderate support. The present study places Periplocoideae as

part of the sister group to the rest of the crown clade and the tribe Baisseeae emerges

as sister group of Secamonoideae-Asclepiadoideae clade. Old World Cynanchinae

form a well-supported clade with the New World MOG (Metastelmatinae,

Oxypetalinae and Gonolobinae) tribes rather than with the largely Old World

Asclepiadinae and Tylophorinae, as suggested by earlier studies. By addition of atpB

promoter sequences of Rauvolfioideae’s taxa in combined dataset (trnL-F and PHYA),

the inter-generic resolution was not improved in the subfamily.

In the present study, resolution among most groups (such as inter-tribal relationships

of Asclepiadoideae) is improved in combined analyses as compared to previous

phylogenies, based on only plastid regions. However, there is a need to sequence

vi

more nuclear loci like PHYA from greater number of taxa to further improve

relationships in the family.

Chapter 1

1

Introduction

The traditional family Asclepiadaceae (Milkweed family) according to APG

(Angiosperm Phylogeny Group) II (2003) and III (2009) is now included in

Apocynaceae (dogbane family). The Apocynaceae sensu lato is found throughout the

world, although is very much more diverse in tropics. Species range from large forest

trees to small under storey trees and shrubs and from small twiners to large lianas. It

is one of the ten largest angiosperm families with ~5100 species distributed among

375 genera (Meve, 2002; Rapini et al., 2002; Endress, 2004; Endress et al., 2007a).

1.1 Distribution of Apocynaceae

Species of Apocynaceae are mainly distributed in tropical regions such as rainforest

and swamps, northern Australia, forest of Africa and India, tropical, central, South and

North America, Mediterranean region and continental southern Africa. Good (1947,

1952) was first who mapped the distribution of traditional Asclepiadaceae

(Asclepiadoideae, Secamonoideae and Periplocoideae). He suggested that

Asclepiadaceae is much more diverse in southern Africa and Madagascar regions.

Goyder (2006) after 50 years of Good’s publications re-examined the origin and

region of diversity of the major groups in the traditional Asclepiadaceae.

1.1.1Asclepiadoideae

The subfamily comprises of ~3000 species distributed all over the world, with three

main centres of generic diversity: tropical central and South America, tropical Asia,

eastern and southern Africa (Goyder, 2006). In Madagascar region, generic diversity

is comparatively low with only 12 genera of the subfamily. Meve and Liede (2002)

studied the phytogeographic relationships between genera of African and Madagascar

origin. They concluded that except Cynanchum where events of dispersal are directed

from Madagascar to mainland Africa, all other species which are common in both

regions, pointing the dispersal events in both directions. In a recent study (Rapini et

al., 2007), it is estimated that the subfamily originate in the Old World and then

disperse in New World.

Chapter 1

2

All members of tribe Marsdenieae are largely distributed in Southeast Asia except

Marsdenia, the only genus of the tribe found in New World with few species in

Madagascar and continental Africa (Rapini et al., 2003). Although centre of diversity

of Ceropegieae is southern Africa, but genera are also found in tropical Asia and

Madagascar regions (Goyder, 2006). Asclepiadeae, the largest tribe of the subfamily

has divided into two vicariant groups by Rapini et al. (2003). One clade comprises of

subtribes Asclepiadinae, Cynanchinae and Tylophorinae (ACT) centred in Old World

eastern and southern Africa. Only two genera — Asclepias and subgenus

Mellichampia of Cynanchum are found in New World. The Second vicariant clade

encompasses subtribes Metastelmatinae, Oxypetalinae and Gonolobinae (MOG) is

restricted to central and South America with exception of Gonolobus, most probably

this genus recently radiated to West Africa (Goyder, 2006). Early-divergent clades

Fockeeae, Eustegia and Astephaninae of the subfamily are found in arid regions of

Africa and Arabia, suggesting that this dispersal occurred very early during the

evolution of Asclepiadoideae (Court, 1987; Goyder, 2006).

1.1.2 Secamonoideae

Genera of the subfamily are restricted to the Old World and main centre of diversity is

Madagascar and the species moved into Southeast Asia and then Africa (Klackenberg,

1992a, b, 1995a, 2001). Secamone is the diverse genus of the subfamily, mainly found

in Madagascar, Mascarene Islands, Africa, Australia and Asia (Forster and Harold,

1989; Goyder, 1992; Klackenberg, 1992a, b; Klackenberg, 1996a; Klackenberg, 2001;

Bruyns, 2004). Toxocarpus and Genianthus have centred in Asia (Klackenberg,

1995a), while other genera are restricted to Madagascar to Mascarene Islands

(Friedman, 1990; Klackenberg, 1995b; Civeyrel and Klackenberg, 1996; Klackenberg,

1996a, b, 1997, 2005).

1.1.3 Periplocoideae

The subfamily is also entirely exist in Old World’s Asia, Madagascar, Africa,

Australia and Europe (Goyder, 2006). Most of the genera in the subfamily are woody

climbers and found in tropical rain forest, some shrubs inhabiting semi-arid savannah,

herbaceous geophytes dwell in grassland, savannah, semi-desert, and desert and

epiphytes occupy tropical forest (Venter and Verhoeven, 1997, 2001).

Chapter 1

3

1.1.4 Apocynoideae and Rauvolfioideae

The subfamilies are distributed in all over the world. Tribe Wrightieae is exclusively

restricted in Old World (Endress and Bruyns, 2000) also reported in the study of

Livshultz et al. (2007). Whereas Apocyneae and Malouetieae are mainly Old World

tribes with exception of Odontadenia, Apocynum, and Trachelospermum found in

New World and Malouetia in West Africa and central and South America (Zarucchi et

al., 1995; Endress and Bruyns, 2000; Livshultz et al., 2007). Mesechiteae are

completely part of the New World Apocynoideae (Endress and Bruyns, 2000), while

Echiteae have genera endemic both in New and Old World (Morales, 1997). Tall

evergreen tree forest such as Alstonia and Dyera are found in rainforests and swamps

of Indomalaya. India, Malaya in Asia and tropical America are inhabited by shrubs of

Rauvolfioideae (Rauvolfia, Tabernaemontana and Ackokanthera) and Plumeria is

endemic in central America (cited in Middleton, 2007).

1.2 Economic importance of Apocynaceae

The members of this family are economically very important in medicinal industry.

Forest trees such as Alstonia and Dyera species are source of lightweight hardwood

used in the manufacturing of match boxes, drawing boards, pencils etc. (cited in

Soerianegara and Lemmens, 1994). This family is also a rich source of various

alkaloids, like herb ‘Madagascar periwinkle’ is a source of nearly more than 100

alkaloids. Two of them, vinblastine and vincristine’ are also very useful in modern

medicine and used against Hodgkin’s disease and lymphocytic leukaemia,

respectively (Alan and Wilkes, 1964). This plant had also been traditionally used in

Madagascar and Jamaica for the treatment of diabetes (Chin et al, 2006).

Calotropis procera is another well-known medicinal plant and has been used in the

preparation of various Ayurvedic, Unani, Homeopathic medicines (Oudhia et al.,

1999). Different parts of this plant have been reported to exhibit anti-inflammatory,

analgesic, and antioxidant properties (Deepak et al., 1997). Whereas, latex of C.

gigantea have glycoside ‘giganteol’ and is useful in curing leprosy, scabies, ring

worm of the scalp, piles, eruptions on the body, asthma, enlargement of spleen and

liver and cause of vasodilatation effect (Kirtikar and Basu, 1999; Sheelaa et al., 2010).

Another example of medicinal value of this family is the genus Caralluma, the species

Chapter 1

4

are widely exploited for investigation of medicinal properties. Various studies

reported different species of the genus can significantly decrease the glucose level in

blood ultimately control diabetes (Habibuddin et al., 2008).

Ethnobotanically, Caralluma species in Pakistan have been used to cure fever and

rheumatism, while C. tuberculata is consumed as vegetable (Khan and Khatoon,

2008). Beside this other medicinal important genera are Asclepias, Leptadenia,

Pergularia, Cynanchum have also been tested for medicinal properties (Thankamma,

2003). The roots of Rauvolfia serpentine for centuries had been applied for the

treatment of mental diseases and dysentery in India. Recently in an ethnobotanical

survey in India by Dey and De (2011), reported other ethonobotanical use of the plant

such as schizophrenia, hypertension, blood pressure, gastrointestinal diseases,

circulatory disorders, pneumonia, fever, malaria, asthma, skin diseases, scabies, eye

diseases, spleen diseases, AIDS (Acquired Immunodeficiency Syndrome),

rheumatism, body pain, veterinary diseases etc. Almost 50 alkaloids are isolated from

this species and most important are yohimbine, reserpine, ajmaline, deserpidine,

rescinnamine, serpentinine (cited in Dey and De, 2011).

1.3 Apocynaceae ─ since Brown’s treatise

Robert Brown in 1810 segregated Asclepiadeae (Asclepiadaceae) from Jussieu’s

(1789) Apocineae (Apocynaceae) (Brown, 1810) on the basis of Pollinia and attached

translator in the former and their absence in latter (Brown, 1811). Before this

separation, the family Apocineae contained only 24 genera as described by Jussieu

(1789). Three groups were identified by Jussieu using gynoecium, fruit and seed

character in Apocineae. Taxa in Groups 1 and 3 have anthers free from style-head and

non-comose seeds, representing Rauvolfioideae in modern classification (Endress,

2004). Whereas, taxa in the Group 2 showed complicated flowers having anthers

united with the style-head and comose seed. They constitute all other subfamilies in

recent classification and recognised as APSA (Apcynoideae, Periplocoideae,

Secamonoideae and Asclepiadoideae) clade in cladistic analysis (Livshultz et al.,

2007). At that time, Brown was attracted toward complex floral morphology of

Jussieu’s Group 2 and observed ‘the essential characters’ such as pollen coalesced in

to masses (pollinia) and these pollinia are attached to a translator. On the basis of

these characters, Brown excluded some of the genera and then raised the Group 2 to a

Chapter 1

5

separate family ‘Asclepiadeae’. It was realized that pollinia are produced in anthers,

until that it was a common opinion that pollinia are produced by style-head (Brown,

1833).

Despite the fact that Brown’s classification has been universally accepted and

implemented, but the controversies over the delimitation of families has never been

put into rest. Though, they have more similar characters than rest of Gentianales.

Since Brown’s delimitation, three suggestion have appeared to described the

relationship of both families: reunite them as single family (Hallier, 1905; Demeter,

1922; Safwat, 1962; Stebbins, 1974; Stevens, 1976; Thorne, 1976, 1992; Judd et al.,

1994; Struwe et al., 1994; Takhtajan, 1997), as a separate order (Tsiang, 1934;

Hutchinson, 1973) and as a suborder within the Gentianales (Rosatti, 1989; Nicholas

and Baijnath, 1994; Omlor, 1998). After two hundred year later of Brown’s time, new

evidences from more detailed morphological studies either alone or in combination

with molecular information (Judd et al., 1994; Endress and Albert, 1995; Sennblad

and Bremer, 1996; Sennblad, 1997; Civeyrel et al., 1998; Sennblad et al., 1998;

Potgieter, 1999) support the recognition of two families as single entity.

Another significant contribution of Brown was his subdivision of Asclepiadeae into

three groups on the basis of floral characters (Brown, 1833). This infra-familial

subdivision is still valid after 200 year later. The ‘Asclepiadeae verae’ has two pollen

sac and thus two pollinia. This group is known today as the Asclepiadoideae. Another

unnamed group known as Secamonoideae today, has four pollen sacs in each anther

and thus produces four pollinia. The Periplocoideae represent the Brown’s group

‘Periploceae’ has pollen in tetrad or rarely in pollinia, are shed onto a sticky spoon-

like translator (Endress and Bruyns, 2000). Fishbein (2001) generated tree, based on

matK gene, which reflect Brown’s accuracy in recognising subfamilies

Periplocoideae, Secamonoideae and Asclepiadoideae.

Prior to the implementation of modern cladistic analysis, it was considered that

Apocynaceae sensu stricto are not monophyletic without Asclepiadaceae (Schumann,

1895; Demeter, 1922; Macfarlane, 1933). The highly complex flowers of

Asclepiadaceae are believed to be evolved from least modified flowers of

Rauvolfioideae in Apocynaceae (Endress and Bruyns, 2000). The floral characters of

Apocynoideae, Periplocoideae and Secamonoideae represent a series of transition

Chapter 1

6

between traditional Apocynaceae and Asclepiadaceae (Demeter, 1922; Safwat, 1962;

Cronquist, 1981; Rosatti, 1989; Endress, 1994, 2001, 2004; Endress and Bruyns,

2000; Wyatt et al., 2000).

Apocynum with pollen born in tetrads and attached to simple translator are often

regarded as the first stage in this evolution mechanism (Demeter, 1922; Safwat, 1962;

Nilsson et al., 1993). Pollens in tetrads and spoon shaped translators in Periplocoideae

represent next stage in the series. Some Periplocoideae have tetrads coherent into four

pollinia, suggesting an advanced stage of pollen aggregation (Nilsson et al., 1993;

Verhoeven and Venter, 1998). Presence of four pollinia attached to a clip-like

translator (Civeyrel, 1994) and plesiomorphic characters such as four sporangia per

anther, non-linear microspore tetrads (Safwat, 1962) and absence of pollinial wall in

Secamone proposing its intermediate stage between Periplocoideae and

Asclepiadoideae. Whereas, Asclepiadoideae have anthers with two sporangia, and

presence of caudicles (two arms to which translator are attached) connected to a clip-

like corpusculum, linear microspore tetrads, and a pollinial wall (Frye, 1901; Safwat,

1962; Dan Dicko-Zafimahova, 1978; Verhoeven and Venter, 2001; Verhoeven et al.,

2003).

However, nearly two hundred year later, with the introduction of phylogenetic

reconstruction in systematics on the basis of molecular data, brought changes in

Suchmann’s (1895) classification. Now authors (Goyder, 1999, 2001; Endress and

Bruyns, 2000; Endress and Stevens, 2001; Endress, 2003) have united the two

families, as this is the simple way to achieve the monophyly of Apocynaceae. The

most recent and unified classification of Apocynaceae which is accepted today is that

of Endress et al. (2007a). The APSA clade (Livshultz et al., 2007), comprised of

subfamilies Asclepiadoideae, Secamonoideae, Periplocoideae, Apocynoideae of

Apocynaceae has been resolved as a monophyletic group in all cladistic analysis of

the family (Judd et al., 1994; Sennblad and Bremer, 1996, 2002; Civeyrel et al., 1998;

Potgieter and Albert, 2001).

Apocynaceae have been traditionally divided into two subfamilies, the Plumerioideae

(= Rauvolfioideae) and Apocynoideae (named Echitoideae by Schumann, 1895)

which are still exist in classifications (Endress and Bruyns, 2000; Endress et al.,

2007a). Additional subfamilies, such as Tabemaemontanoideae Stapf (1902),

Chapter 1

7

Apocynoideae sensu Woodson (1930), Cerberoideae Pichon (1948a), Carissoideae

Endlicher (1838), have also been described. However, these subfamilies are not

recognised today in Apocynaceae sensu lato due to the ambiguous data.

1.4 An overview of subfamilies in Apocynaceae sensu lato

1.4.1 Rauvolfioideae

The subfamily comprised of taxa having least modified flowers and ecomose seeds.

To delimit the tribes in Apocynoideae, the structure of retinacle (the region of the

stamens by which it attaches to the style-head forming gynostegium) have been used

in Pichon (1950a) and Endress and Bruyns (2000) classification, while retincale are

absent in Rauvolfioideae. However in earlier classifications, systematists had used

fruit characters to delimit tribes in Rauvolfioideae (e.g. Leeuwenberg, 1994).

Rauvolfioideae are characterised by having sinistrorse aestivation of the corolla lobes

in buds and anthers not attached to style-head (cited in Endress and Bruyns, 2000). In

the subfamily, oscillatory evolution has seemed between fleshy and dry, dehiscent and

indehiscent fruit in response to environmental factors. However Endress and Bruyns

(2000) supported the use of the fruit character in classification, but in conjugation with

other characters to reduce weight on a single character.

The most detailed and significant information of the Rauvolfioideae was produced by

Pichon (1948a, b, 1949, 1950a) over the findings presented by Schumann (1895). The

Rauvolfioid were divided into two groups mainly based on single fruit characters.

Carisseae, Ambelanieae, and Macoubeeae are possessing fleshy, indehiscent berry

fruit, while dehiscent follicle with arillate seeds, are characteristic of Chilocarpeae and

Tabernaemontaneae, they all are placed in one group. Pichon’s second group

comprised of ‘Alostonieae’ with paired dehiscent follicles and seed usually winged,

‘Rauvolfieae’ having indehiscent drupe with stony endocarp and ‘Allamandeae’

having characteristic fruit, unilocular capsule with spines. This characterization is so

authentic that the classification of Leeuwenberg (1994) is rarely differing.

Leeuwenberg (1994) classified the Rauvolfioideae and identified nine tribes within the

subfamily: Allamandeae, Alyxieae, Ambelanieae, Carisseae, Cerbereae, Chilocarpeae,

Macoubeae, Tabernaemontaneae and Plumerieae. Prior to the classification of Endress

Chapter 1

8

and Bruyns (2000), the traditional Carisseae was considered the basal most tribe by

reason of syncarpy. However in the molecular phylogenetic analysis (Civeyrel, 1996;

Endress et al., 1996; Sennblad and Bremer, 1996; Sennblad, 1997; Civeyrel et al.,

1998) the traditionally defined Carrisseae does not form natural group. Rather, it was

suggested that syncarpy is not basal condition and has evolved independently in

various groups, thus, this is not a reliable characters to define tribe (Endress et al.,

1996; Potgieter, 1999). However, in the treatment of Endress and Bruyns (2000) the

taxa of traditional Carisseae are dispersed into three new tribes. Carissa and

Acokanthera (Sennblad and Bremer, 2002) are placed into new Carisseae, based on

having hard placentas in the fruit while in other Carisseae placentas are pulpy in the

fruit. The subtribe Pleiocarpinae is also separated from Carisseae and is treated as a

separate tribe ‘Hunterieae’ as was suggested earlier (Fallen, 1986). The rest of the taxa

of Carisseae are grouped together in a new tribe ‘Willughbeeae’. Willughbeeae’s

circumscription by Endress and Bruyns (2000), get strong support in later studies

(Potgieter and Albert, 2001; Sennblad and Bremer, 2002). Floral characteristics of

Willughbeeae such as congenitally syncarpus ovary, fleshy indehiscent fruit having

numerous seeds with horny endosperm had already been defined in previous studies

(Fallen, 1986; Person et al., 1992).

In the revision of Endress and Bruyns (2000), the monotypic Chilocarpeae is

abandoned and Chilocarpus is included into Alyxieae. They also circumscribed

traditional Ambelanieae and Macoubeeae to Tabemaemontaneae by reason of

lignified guide rails of the anthers. This treatment is strongly supported by

morphological/ molecular and chemical evidences (Fallen, 1986; Zhu et al., 1990;

Endress et al., 1996; Sennblad and Bremer, 1996; Sennblad, 1997; Civeyrel et al.,

1998; Potgieter and Albert, 2001; Sennblad and Bremer, 2002). Tabemaemontaneae is

different in having Apocarpous ovary and arillate seed in contrast to syncarpous

condition in Ambelanieae with seeds embedded in pulp and Macoubeeae with arillate

seeds (Zarucchi et al., 1995).

Pichon’s Alstonieae is illustrated as Plumerieae in Leeuwenberg’s classification are

proved to be most heterogeneous tribe in the later studies (Endress et al., 1996;

Sennblad and Bremer, 1996; Sennblad, 1997). However, in the recent classification of

Endress and Bruyns (2000) the Plumerieae is divided into three different tribes. They

Chapter 1

9

combined the earlier Plumeriinae, the Cerbereae and the Allamandeae into the new

Plumerieae, as suggested in prior studies (Coppen and Cobb, 1983; Fallen, 1986;

Nilsson, 1986, 1990; Endress et al., 1996; Sennblad and Bremer, 1996; Sennblad,

1997; Civeyrel et al., 1998), that these groups have close relation. Another segregated

tribe of Leeuwenberg’s Plumerieae is Melodineae comprised of genus Melodinus and

the subtribe Craspidosperminae. Although, Craspidospermum have dry dehiscent fruit

in contrast indehiscent fruits of Melodinus (as noted by Pichon, 1948b). Despite of

these variations, the close association of these two genera get strong support in

different phylogenetic analysis (Sennblad, 1997; Sennblad and Bremer, 2002).

Finally, the ‘Catharanthinae’ of Leeuwenberg’s Plumerieae are given place in Vinceae

on the basis of seed morphology and molecular analysis (Sennblad and Bremer, 1996;

Sennblad, 1997).

The subtribes Alstoniinae and the Aspidosperminae are grouped together in new

Alstonieae: characterized by alternate whorled leaves, corolla tubes with gaps above

the level of stamen insertion. In subsequent cladistic analyses (Potgieter and Albert

2001; Sennblad and Bremer 2000; Sennblad and Bremer 2002) the reference taxa

Alstonia could not form clade with members of Aspidospermeae. Earlier, Simões et

al. (2007) recommended the recognition of Aspidospermeae as a separate tribe from

Alstonieae. The gaps in the corolla tube were first reported by Woodson (1951) to

delimit Aspidosperma having gaps from the Microplumeria, Geissospermum and

Diplorhynchus, in which gaps are absent.

Likewise, Endress and Bruyns (2000) divided Alyxieae (sensu Leeuwenberg, 1994) in

to two tribes: the Vinceae as having vertically differentiated style-head with functional

zone (Fallen, 1986), fleshy mesocarp, nonruminate endosperm, flat seeds, and

colporate pollen and the Alyxieae with secretory style-head, hard mesocarp, ruminate

endosperm, cylindrical seed, and porate pollen. In all Vinceae the fruits are

apocarpous, but variations are noted in some cases such as in Ochrosia and Rauvolfia

fruits are drupes whereas, in Catharanthus, Vinca, Tonduzia, Neiososperma having

dry fruit walls (Sennblad and Bremer, 2002). Previously, Tonduzia was considered to

be synonym of Alstonia by Pichon (1947) and same is observed in subsequent studies

(Gentry, 1983; Morales, 1995; Williams, 1996; Sidiyasa, 1998). Therefore Endress

and Bruyns (2000) placed this genus in Alstonieae with Alstonia. Later, Tonduzia in

Chapter 1

10

addition Laxoplumeria, are included in Vinceae in phylogenetic analyses of Potgieter

and Albert (2001) and Simões et al. (2007).

However in phylogenetic studies the inter-generic relationship is not clear in Vinceae.

The position of Kopsia in Vinceae is suspected in molecular based phylogenetic

studies (Sennblad and Bremer, 2002; Simões et al., 2007). Whereas, morphological

(Middleton, 2004a, b) and former chemotaxanomic (Kisakürek et al., 1983;

Homberger and Hesse, 1984) studies strongly supporting the placement of genus in

Vinceae. In the cladistic studies (Potgieter and Albert, 2001; Sennblad and Bremer,

2002), Vinceae showed close affinities toward Tabernaemontaneae, whereas Alyxieae

come closer to the Plumerieae and Carisseae. In the classification of Apocynaceae

defined by Endress and Bruyns (2000), nine tribes are recognised in Rauvolfioideae;

Alstonieae, Alyxieae, Carisseae, Hunterieae, Melodineae, Plumerieae,

Tabernaemontaneae, Willughbeieae and Vinceae, based on floral, fruit and seed, and

pollen characters also supplemented by available molecular data. Their

circumscription of tribes was notably different from that of Leeuwenberg (1994).

Since Endress and Bruyns (2000), molecular based phylogenetic studies (Potgieter

and Albert, 2001; Sennblad and Bremer, 2002; Nazar et al., in press) have reported

non-monophyletic groups in Rauvolfioideae. To achieve monophyly in

Rauvolfioideae, recently a comprehensive study was conducted by Simões et al.

(2007) and observed six monophyletic tribes (Alyxieae, Carisseae, Hunterieae,

Plumerieae, Tabernaemontaneae and Willughbeieae) in the subfamily and also

reported the extreme polyphyly of Melodineae. Prior this study, Melodineae has

always been remained poorly understood tribe in Rauvolfioideae even in the ‘series

revisions of Apocynaceae’ by Leeuwenberg (2003).

1.4.2 Apocynoideae

Apocynoideae, are characterised (Endress and Bruyns, 2000) by having the dextrosely

contorted corolla lobes in bud, lignified anthers are attached to the style-head forming

a gynostegium (Bentham, 1876), dry follicle fruit and comose seeds. Tribes in the

subfamily are circumscribed by Pichon (1950b), Leeuwenberg (1994) and Endress

and Bruyns (2000) and they all are very different in their description. Pichon (1950b)

classified the subfamily into four tribes — Parsonsieae, Nerieae, Ecdysanthereae, and

Ichnocarpeae, on the basis of single and very difficult to observe character, termed

Chapter 1

11

retinacle. On the other hand, in the classification of Leeuwenberg (1994) —

Apocyneae, Echiteae and Wrightieae are defined. Echiteae and Wrightieae of

Leeuwenberg's correspond to Pichon's Parsonsieae and Nerieae respectively. While

Apocyneae comprised of genera from Pichon’s Ecdysanthereae and Ichnocarpeae.

The tribe Wrightieae was initially described by Don (1838) due to the presence of

chalazal hairs on the surface of seed and comprised of only two genera Kibatalia and

Wrightia. However, this taxanomic treatment was also observed in successive studies

(Endlicher, 1841; de Candonelle, 1844; Ly, 1986). Pichon (1950b) misinterpreted that

the flowers of Carruthersia, Hollarrhena and Spirolobium lacked a gynostegium and

placed them mistakenly in Plumerioideae as subtribe Holarrheninae. This was later

proved as an unnatural group on the basis of pollen morphology and chemical

evidences (Endress et al., 1990; Leeuwenberg, 1994; Endress and Bruyns, 2000) and

these genera are transferred in the tribe Wrighteae. The phylogenetic analysis of

Sennblad et al. (1998) based on rbcL data and retinacle characters demonstrated that

all tribes recognised by Pichon (1950a) and Leeuwenberg (1994) were non-

monophyletic and suggested the revisions of tribes in the subfamily.

In the reclassification of the subfamily by Endress and Bruyns (2000) five tribes were

recognised; Apocyneae, Echiteae, Malouetieae, Mesechiteae and Wrightieae. This

classification was mainly based on retinacle (Sennblad et al., 1998) that also proved to

be useful characters in Pichon’s classification, along with other morphological

characters such as structure of style-head and theca (Endress and Bruyns, 2000).

However, the composition of tribes here is notably differing from those of Pichon and

Leeuwenberg. They restored Mesechiteae that constitute of only nine genera;

Allomarkgrafia, Galactophora, Macrosiphonia, Mandevilla, Mesechites, Quiotania,

Secondatia, Telosiphonia, and Tintinnabularia, rather than 13 as in classification of

Pichon. They also introduced fifth tribe Malouetieae by segregating genera from

Wrightieae and Echiteae of earlier classifications. However, some of the modifications

have been done by Endress and Bruyns (2000), which are briefly described here.

Leeuwenberg dispersed genera such as Galactophora, Neobracea, and Pachypodium

in Echiteae (Pichon’s Parsonsieae) and Funtumia, Kibatalia, Malouetia and

Mascarhensia in Wrighteae (Pichon’s Nerieae). Sennblad et al. (1998) identified the

presence of calcium oxalate packets in the anther stomium and synapomorphy ‘the

Chapter 1

12

absence of vertical ridges on the style-head’ in the Funtumia, Holarrhena,

Mascarenhasia and Pachypodium. They suggested the grouping of these taxa into a

separate tribe Malouetieae, which is later presented as tribe in the classification of

Endress and Bruyns (2000). Following Pichon’s and Leeuwenberg’s classification the

position of Neobraceae is in Echiteae, however in the recent phylogenetic analysis

(Livshultz et al., 2007) this genus appeared in Malouetia clade near to Pachypodium.

Sennblad and Bremer (2002) proposed a new approach in the classification system

based on Linnaean and phylogenetic nomenclature to get rid of all uncertainties

observed in the classification of Endress and Bruyns (2000). Although Endress and

Bruyns (2000) already suggested that their classification is considered to be

preliminary. However, in combined analysis of ndhF and rbcL by Sennblad and

Bremer (2002) six tribes are ascertained in the subfamily with the introduction of

Nerieae, is strongly supported here. All taxa of Nerieae were previously included in

tribe Wrighteae except Isonema, which Leeuwenberg (1994) described in Echiteae,

while Alafia and Farquharia are given place in Malouetieae by Endress and Bruyns

(2000). However, in the recent phylogenetic analysis by Livshultz et al. (2007)

monophyly of Nerium clade is again equivocal and need to be re-circumscribed.

Moreover, Simões et al. (2004) circumscribed tribe Mesechiteae using morphological

and molecular characters. They broadly defined eight genera in Mesechiteae;

Allomarkgrafia, Forsteronia, Macrosiphonia, Mandevilla, Mesechites, Quiotania,

Telosiphonia, and Tintinnabularia. Simões et al. (2004) excluded Galactophora and

Secondatia from Mesechiteae sensu Endress and Bruyns and transferred Forsteronia

into the tribe from Apocyneae. The significant character in Apocynoideae ‘structure of

retinacle’ is not found to be constant in species of the genus. Other two key characters

such as leaf blades with colleters at the base adaxially and anthers with blunt-cordate

to truncate basal appendages, are shared by Forsteronia to other Mesechiteae. The

longitudinal ribs in some species are very well-developed as characteristic of

Mesechiteae with star-like shape in cross-section. However, F. acouci the ribs are not

conspicuous and style-head have somewhat pentagonal shape as in the taxa of

Apocyneae (Simões et al., 2004). So this genus shared morphological characters with

both the tribes. In the earlier study, only Pichon (1950b) believed that Tintinnabularia

are closely related to Forsteronia and both genera are placed in a separate subtribe

Chapter 1

13

Forsteroniinae of tribe Ichnocarpeae. In later classifications, Forsteronia is included in

Apocyneae and Tintinnabularia in tribe Wrightieae.

Likewise, generic composition of New World Echiteae and Mesechiteae was

improved by Endress et al. (2007a) with the introduction of new tribe Odontadenieae.

The monophyly of New World tribes Odontadenieae and Echiteae was not supported

in the analysis of Livshultz et al. (2007). Only Mesechiteae circumscribed by Simões

et al. (2004) were strongly supported (Livshultz et al., 2007).

Macfarlane (1933) suggested that traditional Asclepiadaceae was polyphyletic, as it

has close relationship with some members (Alafia, Baissea and Oncinotis) of

Apocynoideae. In several analyses, Baissea, Motandra and Oncinotis appeared close

to the Asclepiadoideae-Secamonoideae clade (Sennblad, 1997; Sennblad and Bremer,

2000, 2002; Potgieter and Albert, 2001). The grouping of these three genera (Endress

et al., 2007a, Livshultz, 2010) was recognised and given status of a tribe, Baisseeae.

Since publication of the Endress and Bruyns (2000) classification, three more tribes,

the Nerieae (Sennblad and Bremer, 2002), Odontadenieae (Endress et al., 2007a) and

Baisseeae (Livshultz, 2010), have been recognised in Apocynoideae. Furthermore,

recent phylogenetic analyses (Livshultz et al., 2007; Livshultz, 2010) have suggested

that Echiteae and Mesechiteae sensu Endress and Bruyns (2000) are not

monophyletic.

1.4.3 Periplocoideae

In the preliminary classifications (Brown, 1810, 1811; Bentham, 1876; Schumann,

1895) Periplocoideae was placed with Asclepiadoideae. Later, Schlechter (1914,

1924) was the first who segregated the Periplocoideae, having the pollens in tetrads

and loosely deposit on spoon like translator, from the Asclepiadoideae with the status

of a family. This familial status of the Periplocoideae had also been reported by some

botanists until the last decade of 20th century (Kunze 1990, 1993; Venter et al. 1990;

Dave and Kuriachen 1991; Liede and Kunze 1993; Nilsson et al. 1993;

Swarupanandan et al., 1996). But simultaneously, some authors proposed that

Periplocoideae and Asclepiadoideae are not monophyletic, rather they also stated that

Periplocoideae has close relation with Apocynaceae sensu stricto (Kunze, 1996; Judd

Chapter 1

14

et al., 1994; Struwe et al., 1994; Sennblad and Bremer, 1996; Endress, 1997;

Sennblad, 1997).

However, with the generation of new data on floral characters, fact has came out that

many of the genera have pollinia instead of pollen in tetrads (Verhoeven and Venter,

1998). Pollinia have also been observed in Decalepis, Gymnanthera, and Hemidesmus

by Endress and Bruyns (2000). Venter and Verhoeven (1997) were the first who

divided the Periplocoideae into three tribes: Periploceae, Gymnanthere,

Cryptolepidea. Thus, it is injustice to separate the Periplocoideae as a separate family

from the rest of Asclepiadaceae due to the presence/ absence of pollinia, rather this

segregation should based on the presence of viscidium in Periplocoideae versus harder

corpuscle in Asclepiadaceae.

In addition, Kunz’s (1990, 1996) findings mainly based on the differences in the basal

regions of the stamens between Periplocoideae and Asclepiadoideae that supported the

separate familial status of Periplocoideae. In Periplocoideae, stamina basal tube

(swollen region below the filaments) and interpreted as receptacular is present, while,

in Asclepiadoideae such receptacular base of the staminal column was not observed

(Kunz, 1990). Another striking character identified by Kunz (1996) was that filament

tube in Asclepiadoideae is not of receptacular origin, rather evolved from the inwardly

protruding base of the filaments (1996). Consequently, it was stated that ‘basal tube’

in Periplocoideae has differed in origin to the filament tube in Asclepiadoideae,

providing another suitable reason for separation of Periplocoideae.

Endress and Bruyns (2000) also described the structure of stamens in Periplocoideae.

They elaborated that thickened ridge is present at the base of filament, which they

termed as ‘stamina foot’ and made following statements based on the insertion of

stamina foot on the corolla tube and length of the corolla tube.

Firstly, if the corolla tube is relatively long, then satminal foot runs down the tube and

disappear before the base as observed in Gymnanthera, Raphionacme monteiroae, R.

namibiana. This situation is somewhat similar to Rauvolfioideae and Apocynoideae.

Secondly, corolla tube is much shorter then bases of the staminal feet become swollen

around the neck of style (Cryptolepis grayi, Raphionacme procumbens,

Stomatostemma monteiroae) and if the style is shorter, then the base of feet forms

Chapter 1

15

undulating ring around the top of ovary (Cryptolepis oblongifolia, Ectadium). Their

third observation was that if limb of the foot disappear, then adjacent feet fuse

together and form a ‘staminal tube’ around the style (Hemidesmus indicus). The next

to this stage is the complete fusion of filament and form filament tube or completely

lost of filament as observed in Secamonoideae/ Asclepiadoideae.

Beside this, Kunz (1990) proposed that there are also variations in corona of

Periplocoideae and Asclepiadoideae and also noticed that nectaries in the

Periplocoideae are situated at the side of stamina foot, whereas in the Asclepiadoideae

these are located above the filaments. However, overview of the classification of

Apocynaceae by Endress and Bruyns (2000) is suggested that morphological data

proposed by Kunz is insufficient to delimit the Periplocoideae from the rest of

asclepiads up to the level of family. They were also uncertain about the tribal division

of Periplocoideae (Venter and Verhoeven, 1997) due to two reasons: misinterpretation

of genera in different tribes, although they have quite more similarities in floral

structure (e.g. Ischnolepis tuberose and Petopentia natalensis have almost no

differences in flowers, but they were placed in different tribes), another reason is that

this division does not correspond with the molecular analyses (Civeyral, 1996;

Potgieter and Albert, 2001).

From the above discussion, this fact emerge that Periplocoideae is unique among the

five subfamilies of Apocynaceae, as including taxa with and without Pollinia. In

addition, pollinia structure are different in Asian and African Periplocoideae (Venter

and Verhoeven, 2001) suggesting the independent origin of pollinia at different

occasions in the subfamily (Fishbein, 2001). Phylogenetic relationships based on

nuclear ribosomal DNA and plastids region (Ionta and Judd, 2007), also proposed

either three or four independent origins of pollinia within the subfamily.

Thus, Periplocoideae has commonly regarded as a transitional taxon between

Apocynoideae and milkweeds, but the systematic position of the subfamily in the

APSA (Asclepiadoideae, Periplocoideae, Secamonoideae and Apocynoideae) is still

unclear even in recent phylogenetic analyses (Livshultz et al., 2007; Livshultz, 2010).

1.4.4 Secamonoideae

Chapter 1

16

An unnamed group of Brown comprised of only Secamone, having four pollinia in

each anther, is known today as Secamonoideae (Endress, 2004). Based on

morphological characters, Secamonoideae are given place somewhere between

Asclepiadoideae and Periplocoideae (Endress and Bruyns, 2000). Nine genera are

accepted by Endress and Bruyns (2000); Calyptranthera, Genianthus, Goniostemma,

Pervillaea, Rhynchostigma, Secamone, Secamonopsis, Toxocarpus and Trichosandra.

However Klackenberg (2001), put the monotypic African genus Rhynchostigma, as

synonym under Secamone.

In the phylogenetic analysis of Apocynaceae, subfamily Secamonoideae emerged as

sister group of Asclepiadoideae (Sennblad and Bremer, 1996, 2000, 2002; Civeyrel et

al., 1998; Civeyrel and Rowe, 2001; Fishbein, 2001; Potgieter and Albert, 2001;

Lahaye et al., 2005). Based on the closer relationship of these subfamilies, in the

classification of Swarupanandan et al. (1996), Secamonoideae was reduced as tribe of

Asclepiadoideae.

In Secamonoideae, the pollinarium is constituted of pollinia and corpuscle, as in the

Asclepiadoideae. Previously, it was described that pollinia in Secamonoideae are

directly attached to the corpuscle, but in subsequent studies of Civeyrel (1995, 1996)

on genus Secamone reported the presence of short caudicle in several cases between

the pollinia and the corpuscle. It was already mentioned that in Secamonoideae each

anther has four pollinia (as in the Periplocoideae) in contrast to two pollinia in

Asclepiadoideae. In two consecutive studies of Civeyrel (1995, 1996) two interesting

observations in Secamonoideae are being marked: pollinia are produced by one part

of anther are closely adpressed to one another (as in Periplocoideae) and giving

impression that each anther produce one pollinium on either side and thus each

corpuscle has two pollinia attached to it, on other hand, as observed in Secamone,

Secamonopsis and Trichosandra one of the pollinia in each locule is functional while

the other one is smaller and loosely attached to the corpuscle. In these observations,

each pollinarium has two functionally efficient pollinia, which is distinguishing

feature of Asclepiadoideae.

In more detailed pollinial examination it was observed that in Secamonoideae pollinia

are tetrad and held together by cross wall fusion, as this characters is absent in

Asclepiadoideae. In addition, outer wall enclosing the pollinium is absent and this

Chapter 1

17

character is more similar to those genera of Periplocoideae having pollinia (Civeyrel,

1996; Verhoeven and Venter, 1998). Another significant difference between

Asclepiadoideae and Secamonoideae is that all members of former except Fockea

have pollinium covered by a thick wall (Schill and Jӓckel, 1978; Dannenbaum and

Schill, 1991). While a thin outer wall enclosing the pollinium in Secamone

ligustrifolia has been reported in the study of Schill and Jӓckel (1978). So,

Secamonoideae have characters of both the subfamilies Periplocoideae and

Asclepiadoideae (Klackenberg, 1992a, b; Venter and Verhoeven, 2001; Ionta and

Judd, 2007; Lahaye et al., 2007).

Moreover, Lahaye et al. (2005, 2007) studied the inter-generic relationship of

Secamonoideae using molecular and morphological characters, these studies revealed

that Pervillaea and Secamonopsis are monophyletic groups of Secamonoideae while

the largest genus Secamone is not resolved as monophyletic group.

1.4.5 Asclepiadoideae

Unlike the Secamonoideae, the subfamily Asclepiadoideae has two locules in each

anther and consequently produced two pollinia, and each pollinium is covered with a

thick wall (Schill and Jӓckel, 1978; Dannenbaum and Schill, 1991). In preliminary

studies four tribes were recognised and characterised in the subfamily: Asclepiadeae,

Gonolobeae, Marsdenieae, Stapelieae (Ceropegieae) (Woodson, 1941; Kunz, 1995;

Liede, 1997; Omlor, 1998). Presently, Stapelieae are known as Ceropegieae (Endress

and Bruyns, 2000; Meve and Liede, 2004), and Gonolobeae have been reduced to a

subtribe of Asclepiadeae (Swarupanandan et al., 1996). Initially, Stapelieae and

Ceropegieae were described as two separate tribes (Bentham, 1876) due to the

presence of succulent stems in the former. However, except succulent stem character,

other characters of pollinia and anther are extremely alike, thus in later studies

researchers (Bruyns and Forster, 1991; Liede and Albert, 1994) are agreed to placed

them into the same tribe ‘Stapelieae’. The monophyly of succulent and nonsucculent

group is later confirmed in the molecular analysis of Meve and Liede (2004).

A new tribe, the Fockeeae, is described by Kunz et al. (1994) from the Marsdenieae

due to the absence of caudicles and floor in the lower third of corpuscle. Lack of

caudicles is not striking character to delimit tribe, though this character is also

Chapter 1

18

reported in Genianthus and Secamone (Civeyrel, 1994; Klackenberg, 1995b).

Meanwhile, Kunz et al. (1994) suggested another character, ‘stamens with large apical

appendages,’ that is present in Fockea but not found in Cibirhiza, another genera of

Fockeeae, so again it is definitely not significant character for the delimitation of tribe.

Kunz (1990, 1996) also mentioned intermediate position of Fockea between

Secamone and advanced Asclepiadoideae. It has pollinia without outer covering

resembling taxa of Secamonoideae and Periplocoideae with pollinia, instead of having

thick outer covering as in the rest of Asclepiadoideae (Verhoeven and Venter, 2001).

In the study of Endress and Bruyns (2000), Fockea also separately emerged out at the

basal position in the Asclepiadoideae and this could be enough for the support of tribe

Fockeeae. But they also suggested that inadequate taxon sampling of Marsdenieae

could be one reason of Fockeeae’s isolated position, though the tribe Marsdenieae is

so diverse and have more than 570 species. They supported the placement of Fockea

and Cibirhiza again in the tribe Marsdenieae. Nevertheless, recognition of Fockeeae is

consistent with the results of later analyses, such as Meve and Liede (2004), and they

were recognised as such in the revised classifications proposed by Endress and

Stevens (2001) and Endress et al. (2007a).

Marsdenieae are essentially isolated from the Ceropegieae due to lack of hyaline

insertion crest on outer surface of pollinium and absence of an outer corona (Bruyns

and Forster, 1991; Omlor, 1998). The sister relationship of Eustegia and Marsdenieae-

Ceropegieae group (Rapini et al., 2003) is illustrating the paraphyly of Asclepiadeae.

Odd position of monotypic genus Eustegia with pendent pollinia between Ceropegieae

and Fockeeae may also refers the sharing of some morphological characters, which

are widely elaborated in the study of Bruyns (1999). Eustegia and Fockea had also

been placed in the same subtribe by Decaisne (1844). Since the Endress and Bruyns

(2000) publication, only a few have focused on Ceropegieae (Meve and Liede, 2002),

but recent studies (Meve and Liede, 2004; Meve and Liede-Schumann, 2007;

Surveswaran et al., 2009) on the largest genus, Ceropegia, have indicated paraphyly

of the genus, with both Brachystelma and stapeliad genera nested within it.

Both Marsdenieae and Ceropegieae are basically separated from the tribe

Asclepiadeae due to the difference in the orientation of the pollinia in anther.

Marsdenieae and Ceropegieae have upright directed pollinia above the corpuscle and

Chapter 1

19

this condition is primitive (Kunze, 1993) whereas, Asclepiadeae have pendulous

pollinia below the corpuscle. However, Endress and Bruyns (2000) also focused on

floral character such attachment of the pollinia to the caudicle’ to delimit tribes in

Asclepiadoideae. In Endress and Bruyns (2000) classification system, three tribes

were identified in Asclepiadoideae; Ceropegieae, Marsdenieae and Asclepiadeae, and

abandoned Fockeeae.

Asclepiadeae is the largest tribe of Asclepiadoideae and species mainly localized in

Africa and the New World. It consist a group of taxa having large and conspicuously

flattened and pendulous pollinia. So, in Asclepiadeae there is wide variation between

larger pollinia of Asclepias and the Tylophora, where the pollinia are small and

difficult to distinguish whether they are erect or pendulous. Schumann (1895) defined

five tribes in the Asclepiadeae however his system of classification was based only on

corona characters and has not been generally accepted. Liede (1997) identified six

subtribes in Asclepiadeae: Asclepiadinae, Astephaninae Glossonematinae,

Gonolobinae, Metastelmatinae and Oxypetalinae. Later, Liede (2001) introduced a

new subtribe, Tylophorinae, based on the findings of Omlor (1998). Tylophora was

previously included in Astephaninae (Liede, 1994, 1997), which are sister of rest of

Asclepiadeae (Liede, 2001; Rapini et al., 2003) and comprise only three genera

(Goyder, 2006). In addition, Liede-Schumann et al. (2005) relegated the neglected

tribe, Orthosieae (Malme, 1927), as subtribe Orthosiinae.

Nearly 40 % of the species of Asclepiadoideae are from the New World in origin

(Meve, 2002). In most of the phylogenetic studies, Old World Asclepiadoideae have

mainly been focused (Sennblad and Bremer, 1996; Civeyrel et al., 1998; Potgieter and

Albert, 2001; Liede, 2001; Rapini et al., 2003). While the relationships within genera

of New World Asclepiadoideae, have not previously been evaluated on the basis

phylogenetic analyses. For example, Potgieter and Albert’s (2001) survey had

included just seven New World’s genera. Rapini (2002) attempted to estimate

relationships among genera of New World Asclepiadoideae using corona characters,

and later Rapini et al. (2003) produced a broad overview of New World

Asclepiadoideae using molecular data. Four lineages of New World Asclepiadoideae

have emerged. The most diverse MOG clade, and the representative of two groups

Cynanchum L. Subgenus. Mellichampia (A. Gray) of Cynanchinae and Asclepias L.

Chapter 1

20

of Asclepiadinae are nested among the taxa of Old World ACT clade. The fourth

lineage of New World genera is the New World Marsdenia of Marsdenieae, only this

group posses erect pollinia, while other three lineages are from Asclepiadeae and

bearing pendent pollinia (also reviewed in Rapini et al., 2007). In an earlier study by

Liede and Taüber (2002) on the relationships of genera in MOG clade, proposed that

Metastelminae is not monophyletic without Gonolobinae and Oxypetalinae.

A recent study using morphological, molecular, geographical and environmental

characteristics transferred a group of temperate South American Cynanchum species

to Diplolepis (sister genus of the rest of MOG; Hechem et al., 2011). Intra-generic

relationships of New World Asclepiadeae have been assessed by using plastid (Liede-

Schumann et al., 2005) and ITS markers (Rapini et al., 2006), and most of the genera

were found to be non-monophyletic, prompting a great amount of generic realignment

(e.g. Goyder, 2004; Rapini et al., 2011) in Oxypetalinae. Rapini (2012) presented a

narrative of recent developments in the classification of Apocynaceae, with particular

emphasis on Brazilian Asclepiadoideae. Glossonematinae and Cynanchineae (Liede et

al., 2002; Liede and Taüber, 2002; Rapini et al., 2003) were found not to be

monophyletic. A few genera placed in these two tribes (Glossonematinae and

Cynanchineae) are closely allied: these include such as Glossonema and Odontanthera

that form a clade with Pentarrhinum, an African genus of five species belonging to

the Cynanchinae (Liede et al., 2002).

Cynanchinae are split along geographical lines, and Old World succulent Malagasy

Cynanchum species are monophyletic whereas New World sections of the subtribe are

polyphyletic (Liede and Taüber, 2002; Rapini et al., 2006). Evolutionary relationships

have been estimated for the genera of Asclepiadinae (Goyder et al., 2007, Fishbein et

al., 2011). Fishbein et al. (2011) found moderate support for monophyly of Asclepias

sensu stricto covering the New World species of the genus and a clade including all

but one species of the generic complex around Asclepias in Africa. However,

resolution within this complex was low, and the weakly supported clades identified

cut across genera as currently recognised. These studies concluded that

Asclepiadoideae still needs further investigation to detect monophyletic groups and to

find morphological characters by which to recognise them.

1.5 The use of molecular data in cladistic analysis

Chapter 1

21

DNA sequences are generally viewed as providing less biased characters in cladistic

analyses than morphological data because there is no character selection and all data

are normally used. Also, sequences provide themselves better to phylogenetic analyses

because they are composed of naturally discrete rather than continuous characters.

Since 1981, there has been exponential increase in the number of publications

utilizing molecular phylogenetic techniques (Pagel, 1999).

The principles of the modern subject of cladistics were prepared by Hennig (1950,

1966). The most important cladistic concept from a systematics perspective, is the

development of the concept of monophyly. The taxa of a monophyletic group evolved

from a common ancestor and so share certain derived features. Testing monophyly has

become the basis for all modern natural classifications. Flowering plants were the first

major branch of the tree of life to be classified on the basis of cladistic analyses of

DNA sequences (APG I, 1998; APG II, 2003)

There are an ever-increasing number of tree building methods available within

programs such as PAUP (Swofford, 2001). Distance methods convert aligned

sequences into a pairwise distance matrix and then use these data to build trees,

whereas discrete methods consider each nucleotide site individually. Distance

methods include: neighbour joining (NJ) and unweighted pair group method with

arithmetic means (UPGMA). Discrete methods include: maximum parsimony (MP),

maximum likelihood (ML) and Bayesian. Studies have shown that in datasets with

clear signal and low noise most methods yield remarkably similar results (e.g.

Muellner et al., 2003).

A more recent development in the field of phylogenetics is the use of Bayesian

methods of analysis. Like ML, Bayesian estimation of phylogeny is based on the

likelihood function. Tree building is much more mathematically difficult to visualise

than in MP and utilizes a method from probability theory known as the Monte Carlo

Markov chain (MCMC) for estimating posterior probabilities. The MCMC method

considers many possible histories of substitution, weighted by their probability of

occurring in a specific model of evolution (Huelsenbeck et al., 2001).

1.6 Utility of plastid and nuclear regions for phylogenetic reconstruction in

plants

Chapter 1

22

Nuclear genomes are potentially a rich and diverse source of variable molecular

characters for evolutionary studies (Sang, 2002; Small et al., 2004). In comparison of

chloroplast genes, some nuclear genes evolve more rapidly (Wolfe et al., 1987; Gaut,

1998), suggesting that they are more reliable for evaluating the relationship even

among the more closely related species. Though, the fruitful utility of the ITS (internal

transcribed spacer) regions are not refuted in various phylogenetic studies. But their

use has been critical in some cases because of several reasons including; concerted

evolution, a high degree of intra-specific heterogeneity and often produce

unsatisfactory results even among the species (Alvarez and Wendel, 2003).

Furthermore, low-copy number genes have great potential for the improvement of

phylogenetic relationships, particularly where makers based on plastid and nuclear

ribosomal DNA cannot generate strong phylogenetic hypothesis (Small et al., 1998;

Sang and Zhang, 1999; Doyle, et al., 2000). The utility of low-copy nuclear genes has

been tasted at various levels, e.g., inter-familial relationships (Kolukisaoglu, et al.,

1995; Mathews and Donoghue, 1999), relation at inter-generic level (Mathews and

Sharrock, 1996; Galloway et al., 1998; Mathews et al., 2000), and close relationship

at inter-specific level (Sang et al., 1997a, 1997b; Small et al., 1998; Small and

Wendel, 2000). It is concluded that nuclear gene with low-copy number are

remarkable source for the resolution of relationships among groups with strong

support.

1.7 Nuclear gene (Phytochrome A)

It has already been suggested in various studies (Mathews et al., 2000; Simmons et

al., 2001; Samuel et al., 2005; Bennett and Mathews, 2006) that phytochrome genes

(PHYA, PHYB and PHYC) are useful markers for resolving relationships at the sub-

familial level. It was estimated that phytochrome genes have relatively faster rate of

nucleotide substitution than the plastid sequences particularly those which are used in

various phylogenetic studies of Poaceae (Mathews et al., 1995; Olmstead and Reeves,

1995). In the present study first exon of phytochrome A (PHYA) gene has been used to

construct phylogeny of Apocynaceae.

Up to date all molecular phylogenetic studies of family Apocynaceae, are based on

sequences from plastid genome, either singly, or in combination with morphological

Chapter 1

23

dataset. A summary tree is presented here (Figure 1.1) comprised of five sub-families

and twenty two tribes of the family representing present situation in Apocynaceae. To

acquire the monophyly of groups in the family there is an essential need to sequence

regions from nuclear genome and combined them with data of plastid genome. There

are still several areas in Apocynaceae, where natural relationships among the genera

are uncertain. Hence, satisfactory classification of Apocynaceae is still beyond reach.

Livshultz (2010) presented the first study of a low-copy nuclear gene, PHYA, in

derived members of Apocynaceae. Although this approach proved useful in describing

the status of various groups in Apocynaceae, e.g. tribe Baisseeae as a sister group of

milkweeds (i.e. Asclepiadoideae and Secamonoideae) rather Periplocoideae, there are

still areas where resolution is low. In order to resolve these problems in Apocynaceae,

in the present comprehensive study, phylogenetic trees have been constructed on

chloroplast and nuclear datasets using broadly sampled taxa of Apocynaceae. Our

main goals are 1) to improve infra-familial relationships within Apocynaceae; 2)

improve resolution at the tribal level within all subfamilies; 2) to identify the position

of Periplocoideae in Apocynaceae and 3) to improve resolution within the subfamily

Rauvolfioideae.

Chapter 1

24

Figure 1.1 A summary of the relationships among five subfamilies and twenty two

tribes of Apocynaceae. All clades shown are present in the strict consensus trees of

previous phylogenetic studies (Rapini et al., 2007; Simões et al., 2007; Livshultz et

al., 2007; Livshultz, 2010). Outgroups include the other four families in the

Gentianales order (Gelsemiaceae, Gentianaceae, Loganiaceae, and Rubiaceae)

according to APG III (2009).

Chapter 2

25

Materials and Methods

2.1 Taxon sampling

In the present study, an attempt has made to include taxa of Apocynaceae from all

over the world. Species of different genera belonging to subfamilies of Apocynaceae

for the study were collected from tropical and subtropical regions of Pakistan. Species

name, voucher details and locations of the samples are given in table 2.1 and Figure

2.1. For DNA extraction a small piece of each sample was stored in silica gel (Chase

and Hillis, 1991). The voucher specimens were stored in Plant Biochemistry and

Molecular Biology Laboratory, Department of Plant Sciences, Quaid-i-Azam

University Islamabad, Pakistan. Other taxa of Apocynaceae (from Africa, America,

Asia, Australia, and Europe; Figure 2.2) were provided by the Royal Botanical

Garden, Kew, London. The samples were obtained from different sources such as

DNA bank, herbarium and from living collection of Kew Garden (Table 2.1).

2.2 DNA extraction

The species of Apocynaceae are latex containing and it is difficult to obtain good

quality DNA from these samples. In the present study different protocols were

applied.

1. For the extraction of total genomic DNA from the fresh specimens, CTAB

(cetyl trimethyl ammonium bromide) method by Richard (1997) was used with

few modifications, also described by Nazar and Mahmood (2010). According

to this procedure, fresh specimen (0.3-0.5 g) was ground in 1ml of 2× CTAB

preheated (65 °C) buffer by using sterilized pestle and mortar. The completely

homogenized tissues were then transferred in eppendorf tubes and then

incubate them at 65 °C for 30 minutes. After incubation, an equal volume of

chloroform isoamylalcohol (24:1) was added and then followed by

centrifugation at 13,000 rpm for 10 minutes. The transparent supernatant was

then transferred to a new tube, and DNA was precipitated by adding an equal

volume of chilled isopropanol and centrifuged. After washing in 70 % ethanol,

the pellets were dried and DNA was resuspended in 0.1× TE (Tris ethylene

diamine tetra acetic acid) buffer.

Chapter 2

26

Table 2.1 A list of the samples from Pakistan and The Royal Botanic Gardens Kew, London with vouchers information and place of collection.

Taxa Voucher detail Country Regions sequenced

Asclepiadoideae – Asclepiadeae: Metastelmatinae

Blepharodon lineare (Decne.) Decne. Forzza et al. 2027 Argentina trnL-F and PHYA

Asclepiadoideae – Asclepiadeae: Oxypetalinae

Araujia sericifera Brot. Forster 7656 Australia PHYA

Funastrum clausum (Jacq.) Schltr. Mello- Silva et al. 1919 Argentina PHYA

Oxypetalum capitatum Mart. Mello- Silva et al. 1924 Argentina PHYA

Philibertia discolor (Schltr.) Goyder Mello- Silva et al. 1887 Argentina PHYA

Philibertia lysimachioides (Wedd.) T. Mey. Mello- Silva et al. 1886 Argentina PHYA

Asclepiadoideae – Asclepiadeae: Gonolobinae

Matelea pseudobarbata (Pitter) Woodson M. Endress 97-08 Costa Rica PHYA

Schubertia grandiflora Mart. M. Chase South Africa PHYA

Asclepiadoideae – Asclepiadeae: Asclepiadinae

Calotropis procera (Aiton) W. T. Aiton Naz001* Pakistan trnL-F and PHYA

Kanahia laniflora (Forssk.) R. Br. Goyder et al. 3931 Tanzania PHYA

Margaretta rosea Oliv. Goyder et al. 3791 Tanzania PHYA

Pergularia daemia (Forssk.) Chiov. Naz024* Pakistan PHYA

Pergularia tomentosa L. Naz012* Pakistan trnL-F and PHYA

Stenostelma corniculatum (E. Mey.) Bullock Balkwill 10908 South Africa PHYA

Chapter 2

27

Xysmalobium parviflorum Harv. ex Scott-Elliot Killick & Vahrmeijer 3658 South Africa PHYA

Asclepiadoideae – Asclepiadeae: Cynanchinae

Cynanchum viminale (L.) Bassi Chase 731 ** PHYA

Cynanchum jacquemontianum Decne. Naz010* Pakistan trnL-F and PHYA

Cynanchum obtusifolium L.f. P. Bruyns Vch? South Africa PHYA

Asclepiadoideae – Asclepiadeae: Tylophorinae

Tylophora hirsuta (Wall.) Wight Naz014* Pakistan trnL-F, PHYA and atpB

Unplaced genus

Oxystelma esculentum (L. f.) Sm. Naz020* Pakistan TrnL-F and PHYA

Asclepiadoideae – Asclepiadeae: Astephaninae

Eustegia minuta (L. F.) N. E. Br. P. Bruyns 4357 South Africa PHYA

Oncinema lineare (L. F.) Bullock P. Bruyns Vch? South Africa PHYA

Microloma tenuifolium K.Schum. Irwin et al. 31285 Brazil PHYA

Asclepiadoideae – Marsdenieae

Dischidia lanceolata Decne. Chase 734 Indonesia PHYA

Dregea abyssinica K.Schum. Goyder et al. 3918 Tanzania PHYA

Gymnema sylvestre (Retz.) Schultz. Chase 3902 India trnL-F and PHYA

Hoya finalasonii Wight Chase 17138 India PHYA

Hoya manipurensis Deb. Chase 733 Thailand PHYA

Marsdenia carvalhoi Morillo & Carnevali Chase 3904 Brazil trnL-F and PHYA

Rhyssolobium dumosum E. Mey. P. V. Bruyns 3948 South Africa PHYA

Chapter 2

28

Stephanotis floribunda Brongn. Chase 732 Senegal trnL-F and PHYA

Wattakaka volubilis (Linn.f.) Stapf. Naz006* Pakistan trnL-F and PHYA

Asclepiadoideae – Ceropegieae

Boucerosia frerei Dalzell Chase 2861 India PHYA

Caralluma edulis (Edgew.) Hook. F. Naz016* Pakistan trnL-F

Caralluma tuberculata N.E. Br. Naz019* Pakistan trnL-F and PHYA

Ceropegia sandersonii Decne.ex Hook. Chase 17507 ** PHYA

Duvalia polita N. E. Br. Kew ** PHYA

Leptadenia pyrotechnica Decne. Naz018* Pakistan trnL-F, PHYA and atpB

Neoschumannia kamerunensis Chase 3903 Cameroon PHYA

Quaqua incarnata (L. f.) Bruyns Chase 9818 South Africa PHYA

Orthanthera jasminiflora N. E. Br. ex Schinz Chase 3902 South Africa PHYA

Secamonoideae

Pervillaea phillipsonii Klack. Phillipson 4132 Madsgascar trnL-F

Secamone alpini Schult. P. Bruyns Vch? South Africa trnL-F and PHYA

Secamone parvifolia (Oliv.) Bullock Goyder & Masinde 3960 ** trnL-F

Periplocoideae

Cryptolepis buchananii Roemer & Schult. Naz002* Pakistan trnL-F, PHYA and atpB

Cryptolepis decidua (Planch. ex Benth.) N. E. Br. P. V. Bruyns s.n. (east of Fish R.) Namibia trnL-F, PHYA and atpB

Cryptolepis sp. Naz011* Pakistan trnL-F

Hemidesmus indicus (L.) R.Br. ex Schult. Chase 725 Tamil Nadu PHYA

Chapter 2

29

Periploca aphylla Decne. Naz004* Pakistan trnL-F and PHYA

Raphionacme hirsuta (E.Mey.sec.N.E.Brown) R.

A.Dyer CFR 15 South Africa PHYA

Schlechterella abyssinicum (Chiov.) Venter & R. L.

Verh. Chase 720 Ethopia trnL-F and PHYA

Apocynoideae - Malouetieae

Kibatalia gitingensis (Elmer) Woodson Liede 3268 ** trnL-F and PHYA

Pachypodium leallii Welw. Chase 735 South Africa trnL-F and PHYA

Apocynoideae - Nerieae

Adenium obesum (Forssk.) Roem. & Schult. Chase 727 Somalia trnL-F and PHYA

Nerium oleander L. Naz015* Pakistan trnL-F and PHYA

Apocynoideae - Apocyneae

Beaumontia grandiflora (Roxb.) Wall. Naz008* Pakistan trnL-F, PHYA and atpB

Trachelospermum jasminoides (Lindl.) Lem. Naz022* Pakistan trnL-F, PHYA and atpB

Apocynoideae - Echiteae

Fernaldia pandurata (A.DC. ) Woodson M Endress, Zurich ** PHYA and atpB

Apocynoideae – Wrightieae

Pleioceras barteri Baill. Endress, P. 99-10 Ivory Coast PHYA

Rauvolfioideae - Carisseae

Carissa spinarum L. Naz017* Pakistan trnL-F and PHYA

Rauvolfioideae – Plumerieae

Chapter 2

30

Anechites nerium Urb. Bremer et al. 3386 UPS ** PHYA

Plumeria obtusa L. Naz021* Pakistan trnL-F

Plumeria rubra L. Naz009* Pakistan trnL-F

Skytanthus acutus Meyen M. Endress, Zurich ** PHYA

Thevetia peruviana (Pers.) K. Schum. Naz013* Pakistan trnL-F and PHYA

Rauvolfioideae – Vinceae

Catharanthus roseus (L.) G. Don Naz005* Pakistan trnL-F and atpB

Petchia ceylanica (Wight) Livera R. Olmor s. n Germany trnL-F, PHYA atpB

Rauvolfia hirsute (L.) Benth. Naz003* Pakistan trnL-F, PHYA and atpB

Vinca major L. Naz025* Pakistan trnL-F and atpB

Rauvolfioideae: Vinceae Unplaced Genera

Amsonia hurbritchii Woodson Chase 19252 USA PHYA

Rhazya orientalis A.DC. M. Endress s.n. Zurich PHYA and atpB

Rauvolfioideae – Tabernaemontaneae

Tabernaemonta divericata (L.) R. Br.

exRoem.Schult Chase 5571 Bangladesh PHYA and atpB

Rauvolfioideae – Hunterieae

Gonioma kamassi E.Mey. Chase 5806 South Africa trnL-F, PHYA and atpB

Rauvolfioideae – Alyxieae

Alyxia buxifoliaR. Br. Smith, R.J. (RJS202) Australia PHYA

Rauvolfioideae – Alstonieae

Chapter 2

31

*Vouchers specimens are preserved in the Plant Biochemistry and Molecular Biology Laboratory of Quaid-i-Azam University, Islamabad, Pakistan. ** Information not present in Kew’s databases.

Alstonia scholaris (L.) R. Br. Naz007* Pakistan trnL-F, PHYA and atpB

Chapter 2

32

Figure 2.1 Map showing different areas of plant collection in Pakistan.

Chapter 2

33

Figure 2.2 Map showing different countries of the world, from where different taxa of Apocynaceae were collected and stored in herbarium or as living collection in Royal Botanic Gardens, Kew, London.

Chapter 2

34

2. To extract quality DNA from old specimens of herbarium, Doyle and Doyle

(1987) 2× CTAB protocol was used. The herbarium material was ground by

beating the specimen with metal beads in tubes using a GenoGrinder® (SPEX

CertiPrep, Inc.) An equal volume of chloroform isoamylalchol (24:1) was

added in each tube. After centrifugation at 8000 rpm for 10 minutes, aqueous

top layer containing DNA was transferred to new tube. For precipitating DNA

2/3 volume of chilled isopropanol was used and samples were refrigerated for

two weeks. To collect precipitate, the samples were centrifuged at 3000 rpm

for 5 minutes. To purify the DNA, the pellet was dissolved in 70 % ethanol for

30 minutes following centrifugation at 3200 rpm for 3 minutes. The liquid was

poured off and left the tubes with DNA pellet in fume cupboard overnight to

evaporate alcohol completely. The DNA pellet was resuspended in CsCl-EtBr

(cesium chloride ethidium bromide) solution and held at room temperature for

several hours until the pellet was completely dissolved.

Further, for CsCl-gradient purification of DNA, the samples were transferred

into rotor tubes and centrifuged at 5800 rpm for 5 hours. A florescent band

was appeared in each tube when visualized under UV light. Small amount of

solution was discarded above the band and 1.2 ml of band was carefully

removed from each rotor tube and transferred to new transparent, 5ml tubes.

An equal volume of SSC (single-site catalysis) saturated butanol was added for

removal of EtBr. Further for dialysis, dialysis tubes were cut into small strips,

each strip was loaded with DNA sample and clamped lower and upper end. All

the strips were kept in water that was being stirred for 4 hours. The samples

were concentrated by transferring them to a tray and adding sugar for 20

minutes. At end dialysis buffer was added in water and strips were put under

water followed by stirring for overnight. The purified DNA samples were

transferred into new tubes for further processes.

2.3 Polymerase chain reaction (PCR)

For the analysis of phylogenetic relationships in Apocynaceae different regions of

plastid (trnL-F and atpB promoter) and nuclear genomes (PHYA) were sequenced (see

Figure 2.3 for detail). To amplify the target regions, PCR protocols were optimized at

different conditions and temperatures. Primers details of trnL-F region, first exon of

PHYA and atpB gene promoter region are given in table 2.2.

Chapter 2

35

trnL-F intron-spacer region

atpB gene promoter region

First exon of PHYA gene

Figure 2.3 Showing locations of primers used to amplify different regions of plastid and nuclear genomes.

Chapter 2

36

Table 2.2 Sequences and sources of different primers used in this study. Primer region Primer name Primers sequence (5’-3’) Source

trnL-F (~ 900) c (Forward) CGAAATCGGTAGACGCTACG

Taberlet et al. (1991) d (Reverse) GGGGATAGAGGGACTTGAAC

e (Forward) GGTTCAAGTCCCTCTATCCC

f (Reverse) ATTTGAACTGGTGACACGAG

PHYA (~ 1500bp)

2059F GCCTTACGAAGTTCCAATGACTGCTGC

Livshultz (2010) 2971R CAAGCTATCCGTACTYAGMCCHGTTG

2745F ACTCAGACACTYTTGTGTGATATGCTSAT

3560R TACCTTGCAATGCCAATTCCAACATCTTG

atpB gene Promoter (~ 990) Forward CCAGAAGTAGTAGGATTGATTCTCA Designed by using

program Primer3 Reverse TTGGACCTCAAGGTGGACTTCT

Chapter 2

37

2.3.1 trnL-F intron-spacer region

The target region was amplified by using ReddyMix PCR Mastermix (AB Gene,

Epsom, Surrey, UK), in Gene Amp 9700 thermocycler (ABI, Applied Biosystem,

Warrington, Cheshire, UK). The following temperatures were standardized; initial

melting step at 94 °C for 1 minute, followed by 35 cycles of 1 minute at 94 °C, 1

minute at 50 °C , and 3 minutes at 72 °C , with a final extension of 7 minutes at 72 °C.

2.3.2 Nuclear gene PHYA

The region was amplified by using same ReddyMix PCR Mastermix in 25 μl of

reaction mixture. Degraded DNA in some samples did not give amplified product by

using ReddyMix PCR Mastermix (AB Gene, Epsom, Surrey, UK). To amplify the

target regions from degraded DNA especially from herbarium samples, Platinum® taq

DNA polymerase (Invitrogen) was used. Reaction mixture of 25 μl consisted of 2.5 μl

10× buffer, 2 μl MgCl2, 1 μl of BSA (Bovine serum albumin), 0.6 μl of each primer

(0.1 ng/μl), 0.2 μl of 5U/μl of Platinum taq DNA polymerase was prepared and made

up to volume with nuclease free water. The following PCR program was adjusted;

initial denaturation at 94 °C for 2 minutes, followed by 35 cycles of denaturation at 94

°C for 20 seconds, annealing at 50 °C for 30 seconds and extension at 72 °C for 2

minutes. Final extension was carried out at 72 °C for 7 minutes.

2.3.3 Promoter region of atpB gene

The specific region was targeted by using a pair of primers, designed from tobacco

chloroplast genome. A 25 µl PCR mixture containing 25 pmol of each primer, 2.5 µl

of 10× taq buffer, 1.5 µl of 2 Mm dNTPs, 1.5 µl of 25 Mm MgCl2 and 5U of taq

polymerase (MBI Fermentas). The PCR temperatures were optimized using gradient

PCR system (Multigene, Labnet). Following temperature settings were used; pre-

denaturation at 94 °C for 5 minutes, followed by 35 cycles of denaturation at 94 °C

for 45 seconds, primer annealing at 57 °C for 40 seconds and extension at 72 °C for

40 seconds. The final extension occurred at 72 °C for 20 minutes. After PCR, contents

were held at 4 °C till further used.

2.4 Purification of amplified products

Chapter 2

38

PCR products were purified using QIAquick kit following the manufacturer’s

protocol (Appendix I).

2.5 Sequencing

Sequencing reactions were performed on a 3730 automated sequencer using Big Dye

terminator v3.1 chemistry, according to the manufacturer’s protocols, Applied

Biosystems, Inc. For cleaning of cycle sequencing products, precipitation in ethanol

was preferred (Appendix II).

2.6 Data analysis

The electropherograms were edited and assembled using Sequencher version 4.1

(Gene Codes, Inc., Ann Arbor, Michigan, USA). They were aligned by eye in the

matrix following the guidelines provided by Kelchner (2000). To improve the picture

of phylogeny in Apocynaceae, additional genera from previous studies were included

in datasets. In trnL-F based sequence analysis, 143 sequences were added and 45

sequences (Livshultz, 2010) were included in PHYA based sequence matrix

(www.ncbi.nlm.nih.gov; accession numbers are given in table 2.3).

2.6.1 Parsimony analysis

For maximum parsimony (MP) analysis PAUP version 4.0b10, (Swofford, 2002) was

used. The data matrix of trnL-F region comprised of 178 sequences including one

outgroup (Chelonanthus alatus) of family Gentianaceae and the PHYA dataset

consisted of 111 taxa as the ingroup. The gaps were treated in analysis as missing

data. The combined data matrix was analysed using tree bisection-reconnection (TBR)

swapping and 1000 replicates of random taxon addition, holding 10 trees at each step

to reduced time searching islands of equally parsimonious trees. DELTRAN character

optimization was used to illustrate branch lengths (due to reported errors with

ACCTRAN optimization in PAUP version 4.0b). Using the heuristic search strategy

and by randomly adding taxa the bootstrap values (BP) were measured from 500

replicates analyses and only those values were recorded which were according to the

majority rule consensus tree.

2.6.2 Bayesian analysis

Chapter 2

39

Table 2.3 A list of taxa with GenBank accession numbers used in trnL-F and PHYA analyses, previously published in Rapini et al. (2003), Sennblad and Bremer (1998) and Livshultz (2010) with updated nomenclature.

Taxa Accession numbers

trnL-F PHYA atpB

Asclepiadoideae – Asclepiadeae: Metastelmatinae

Barjonia chloraeifolia Decne. AY163667 – –

Blepharodon lineare (Decne.) Decne. AY163668 ** –

Blepharodon mucronatum Decne. AJ290839 – –

Blepharodon nitidum (Vell.) J. F. Macbr. AY163669 – –

Ditassa banksii R. Br. ex Schult. AY163674 – –

Ditassa cordeiroana Fontella AY163676 – –

Ditassa 39irsute Decne AJ704223 – –

Ditassa tomentosa (Decne.) Fontella AJ704486 – –

Hemipogon acerosus Decne. AJ704290 – –

Hemipogon carassensis (Malme) Rapini AY163692 – –

Hemipogon luteus E. Fourn. AY163693 – –

Metastelma linearifolium A. Rich. AJ428809 – –

Metastelma schaffneri A. Gray AJ410216 – –

Metastelma sp. Indet., aff. Parviflora R. Br. AJ428779 – –

Minaria acerosa (Mart.) T. U. P. Konno & Rapini AJ699287 – –

Chapter 2

40

Minaria decussata (Mart.) T. U. P. Konno & Rapini AJ704219 – –

Minaria ditassoides (Silveira) T. U. P. Konno & Rapini AY163678 – –

Minaria grazielae (Fontella & Marquete) T. U. P. Konno & Rapini AJ410204 – –

Minaria magisteriana (Rapini) T. U. P. Konno & Rapini AY163681 – –

Nautonia nummularia Decne. AJ410228 – –

Nephradenia acerosa Decne. AY163705 – –

Nephradenia asparagoides (Decne.) E. Fourn. AY163707 – –

Peplonia organensis (E. Fourn.) Fontella & Rapini AY163688 – –

Petalostelma sarcostemma (Lillo) Liede & Meve AJ428788 – –

Asclepiadoideae: MOG Unplaced Genus

Tassadia berteroana (Spreng.) W. D. Stevens AJ428791 – –

Tassadia obovata Decne. AJ699283 – –

Asclepiadoideae – Asclepiadeae: Oxypetalinae

Araujia sericifera Brot. AJ704332 ** –

Funastrum clausum (Jacq.) Schltr. AJ428794 ** –

Funastrum odoratum Schltr. AJ290862 – –

Oxypetalum appendiculatum Mart. AJ290871 – –

Oxypetalum banksii R. Br. ex Schult. AY163709 – –

Oxypetalum capitatum Mart. AY163710 ** –

Chapter 2

41

Oxypetalum coeruleum (D. Don ex Sweet) Decne. AJ704356 – –

Oxypetalum insigne (Decne.) Malme AY163711 – –

Oxypetalum minarum E. Fourn. AY163713 – –

Oxypetalum strictum Mart. AY163712 – –

Oxypetalum sublanatum Malme AY163715 – –

Oxypetalum sylvestre (Hook. & Arn.) Goyder & Rapini AJ410246 – –

Philibertia candolleana (Hook. & Arn.) Goyder. AJ410177 – –

Philibertia discolor (Schltr.) Goyder AY163700 ** –

Philibertia lysimachioides (Wedd.) T. Mey. AJ290900 ** –

Philibertia parviflora (Malme) Goyder AJ410225 – –

Philibertia picta Schltr. [P. Vaileae (Rusby) Liede] AJ290905 – –

Asclepiadoideae – Asclepiadeae: Gonolobinae

Gonolobus rostratus (Vahl) Schult. AF214208 – –

Gonolobus parviflorus Decne. AY163689 – –

Matelea pseudobarbata (Pitter) Woodson – ** –

Matelea pedalis (E. Fourn.) Fontella & E. A. Schwarz AY163699 – –

Schubertia grandiflora Mart. AJ428827 – –

Asclepiadoideae – Asclepiadeae: Orthosiinae

Cynanchum morrenioides Goyder AJ428686 – –

Chapter 2

42

Ditassa subtrivialis Griseb. AJ428756 –

Jobinia lindbergii E. Fourn. AY163694 – –

Metastelma scoparium (Nutt.) Vail AY163703 – –

Orthosia urceolata E. Fourn. AJ704325 – –

Asclepiadoideae – Asclepiadeae: MOG, Basal Grade

Diplolepis geminiflora (Decne.) Liede & Rapini AJ410183 – –

Diplolepis nummulariifolia (Hook. & Arn.) Liede & Rapini AJ290851 – –

Diplolepis hieronymi (Lorentz) Liede & Rapini AJ410213 – –

Asclepiadoideae – Asclepiadeae: Asclepiadinae

Asclepias alpestris (K. Schum.) Goyder AY163718 – –

Asclepias curassavica L. AY163664 – –

Asclepias mellodora A. St.-Hil. AY163665 – –

Asclepias syriaca L. AJ410180 – –

Aspidoglossum ovalifolium (Schltr.) Kupicha AY163666 – –

Calotropis procera (Aiton) W. T. Aiton HE805509 ** –

Calotropis procera (Aiton) W. T. Aiton AF214170 – –

Glossostelma spathulatum (K. Schum.) Bullock AY163686 – –

Gomphocarpus fruticosus (L.) W. T. Aiton AY163687 – –

Kanahia laniflora (Forssk.) R. Br. AY163695 ** –

Chapter 2

43

Margaretta rosea Oliv. AY163696 ** –

Pachycarpus 43irsute43 (N. E. Br.) Bullock AY163716 – –

Pergularia daemia (Forssk.) Chiov. AJ290893 ** –

Pergularia tomentosa L. HE805514 ** –

Stathmostelma gigantiflorum K. Schum. AY163721 – –

Stenostelma corniculatum (E. Mey.) Bullock AY163722 ** –

Xysmalobium undulatum (L.) W. T. Aiton AY163725 – –

Xysmalobium parviflorum Harv. Ex Scott-Elliot AM295674 ** –

Asclepiadoideae – Asclepiadeae: ACT clade Unplaced Genera

Cynanchum acutum L. AJ428584 – –

Oxystelma esculentum (L. f.) Sm. AJ290887 – –

Oxystelma esculentum (L. f.) Sm. ** ** –

Solenostemma arghel (Delile) Hayne AJ428833 – –

Asclepiadoideae – Asclepiadeae: Cynanchinae

Cynanchum grandidieri Liede & Meve AJ290856 – –

Cynanchum jacquemontianum Decne. HE805511 ** –

Cynanchum insigne (N. E. Br.) Liede & Meve AJ290906 – –

Cynanchum laeve (Michx.) Pers. AJ428653 – –

Cynanchum montevidense Spreng. AJ290850 – –

Chapter 2

44

Cynanchum obovatum (Decne.) Choux. AJ428803 – –

Cynanchum roulinioides (E. Fourn.) Rapini AJ428734 – –

Cynanchum verrucosum Desc. AJ290879 – –

Cynanchum viminale (L.) L. AJ290912 ** –

Cynanchum obtusifoliumL.f. AJ428692 ** –

Glossonema boveanum (Decne.) Decne. AY163685 – –

Metalepis albiflora Urb. AJ428776 – –

Metaplexis japonica Makino (I) AJ428812 – –

Odonthanthera radians (Forssk.) D. V. Field AJ428815 – –

Pentarrhinum insipidum E. Mey. AJ410234 – –

Schizostephanus alatus Hochst. Ex K. Schum. AJ410248 – –

Asclepiadoideae – Asclepiadeae: Tylophorinae

Biondia henryi Tsiang & P. T. Li AJ410192 – –

Diplostigma canescens K. Schum. AJ410201 – –

Goydera somaliensis Liede AJ410210 – –

Pentatropis nivalis (J. F. Gmel.) D. V. Field & J. R. I. Wood AJ410240 – –

Tylophora hirsute (Wall.) Wight HE805515 ** **

Tylophora flexuosa R. Br. AJ290917 – –

Vincetoxicum hirundinaria Medik. AJ410276 – –

Chapter 2

45

Asclepiadoideae – Asclepiadeae: Astephaninae

Astephanus triflorus R. Br. AJ410189 – –

Eustegia minuta (L. f.) N. E. Br. AJ410207 ** –

Microloma tenuifolium K. Schum. AJ410222 ** –

Oncinema lineare (L. f.) Bullock AJ410230 ** –

Asclepiadoideae – Marsdenieae

Cionura erecta Griseb. AJ410174 – –

Dischidia bengalensis Colebr. AF214189 – –

Dischidia lanceolata Decne. – ** –

Dregea abyssinica K. Schum – ** –

Gymnema sylvestre (Retz.) Schultz. HE805512 ** –

Hoya australis R. Br. ex J. Traill AF214213 – –

Hoya manipurensis Deb. AF214227 ** –

Hoya finlaysonii Deb. AF214227 ** –

Marsdenia amorimii Morillo AF214223 – –

Marsdenia carvalhoi Morillo & Carnevali DQ334521 ** –

Marsdenia glabra Costantin EF456114 GU901360 –

Marsdenia suberosa (E. Fourn.) Malme AY163697 – –

Marsdenia zehntneri Fontella AY163698 – –

Chapter 2

46

Rhyssolobium dumosum E. Mey. AM233378 ** –

Stephanotis floribunda Brongn. HE805517 ** –

Wattakaka volubilis (Linn.f.) Stapf. HE805516 ** –

Telosma cordata Merr. AF102493 – –

Asclepiadoideae – Ceropegieae

Boucerosia frerei Dalzell AF214202 ** –

Caralluma edulis (Edgew.) Hook. F. HE805508 – –

Caralluma tuberculata N.E. Br. HE805510 ** –

Ceropegia sandersonii Decne.ex Hook. AF214179 ** –

Ceropegia saxatilis Jum. & H. Perrier AJ410042 – –

Duvalia polita N. E. Br. AJ488374 ** –

Leptadenia pyrotechnica Decne HE805513 ** **

Neoschumannia kamerunensis Schltr. AJ410054 ** –

Quaqua incarnata (L. f.) Bruyns AJ488455 ** –

Stapelia glanduliflora Mass. AJ402151 – –

Stapelia leendertziae N. E. Br. AF214270 – –

Asclepiadoideae – Fockeeae

Fockea edulis K. Schum. AF214199 – –

Secamonoideae

Chapter 2

47

Secamone glaberrima K. Schum. AF214266 – –

Secamone alpini Schult. HE805519 ** –

Secamone parvifolia (Oliv.) Bullock HE805520 ** –

Pervilaeae phillipsonii Klack HE805518 ** –

Secamone elliptica R. Br. EF456116 GU901389 –

Toxocarpus villosus(Blume) Decne EF456117 GU901399 –

Periplocoideae

Cryptolepis buchananii Roemer & Schult. HE805522 ** **

Cryptolepis deciduas (Planch. Ex Benth.) N. E. Br. HE805523 ** **

Cryptolepis sp. HE805521 – –

Finlaysonia insularum (King & Gamble) Venter EF456105 GU901341 –

Gymnanthera oblonga (Burm. F.) P.S. Green EF456106 GU901348 –

Hemidesmus indicus (L.) R.Br. ex Schult. DQ916877 –

Periploca aphylla Decne. HE805524 ** –

Periploca graeca L. AF214244 –

Petopentia natalensis (Schltr.) Bullock EF456109 GU901376 –

Phyllanthera grayi (P.I. Forst.) Venter EF456103 GU901377 –

Raphionacme 47irsute (E.Mey.sec.N.E.Brown) R.A.Dyer AJ581825 **

Schlechterella abyssinicum (Chiov.) Venter & R. L. Verh. HE805525 ** –

Chapter 2

48

Zygostelma benthamii Baill. EF456109 GU901405, –

Apocynoideae; Baisseeae

Motandra guineensis A. DC. EF456210 GU901361 –

Oncinotis tenuiloba Stapf EF456141 GU901368 –

Baissea multiflora A. DC. EF456199 GU901330 –

Apocynoideae; Echiteae

Angadenia berteroi Miers EF456129 GU901324 –

Artia balansae (Baillon) Pichon ex Guillaumin EF456209 GU901329 –

Echites umbellatus Jacq. EF456237 GU901337 –

Fernaldia pandurata Woodson EF456191 ** **

Laubertia contorta (Mart.& Galeotti) Woodson EF456246 GU901358 –

Parsonsia eucalyptophylla F. Muell. EF456142 GU901372 –

Peltastes isthmicus Woodson EF456179 GU901373 –

Pentalinon luteum (L.) B.F. Hansen & R.P. Wunderlin EF456180 GU901375 –

Prestonia lagoensis (Müll. Arg.) Woodson EF456215 GU901380 –

Rhodocalyx rotundifolius Müll. Arg. EF456186 GU901387 –

Stipecoma peltigera Müll. Arg. EF456193 GU901394 –

Temnadenia odorifera (Vell.) J.F. Morales EF456238 GU901396 –

Apocynoideae; Mesechiteae

Chapter 2

49

Mandevilla boliviensis (Hook. F.) Woodson EF456153 GU901359 –

Forsteronia guyanensis Müll. Arg. EF456134 GU901343 –

Apocynoideae – Apocyneae

Aganosma wallichii G. Don. – GU901319 –

Amphineurion marginatum (Roxb.) G. Don. EF456125 GU901323 –

Anodendron paniculatum A. DC. EF456194 GU901327 –

Apocynum androsaemifolium L. AF214308 GU901328 –

Beaumontia grandiflora (Roxb.) Wall. HE805527 ** **

Chonemorpha fragrans (Moon) Alston EF456132 GU901332 –

Cleghornia malaccensis (Hook. F.) King & Gamble EF456241 GU901333 –

Epigynum cochinchinense (Pierre) D.J. Middleton EF456127 GU901340 –

Ichnocarpus frutescens R. Br. EF456136 GU901356 –

Papuechites aambe Markgr. EF456189 GU901370 –

Parameria laevigata (Juss.) Mold. EF456197 GU901371 –

Sindechites henryi Oliv. & Tsiang: EF456244 GU901393 –

Trachelospermum jasminoides (Lindl.) Lem. HE805531 ** **

Urceola lucida Benth.& Hook. F. EF456226 GU901400 –

Vallaris solanacea (Roth) O. Kuntze EF456162 GU901401 –

Apocynoideae – Malouetieae

Chapter 2

50

Mascarenhasia arborescens A. DC. AF214224 – –

Kibatalia gitingensis (Elmer) Woodson HE805528 ** –

Pachypodium leallii Welw. HE805530 ** –

Apocynoideae – Nerieae

Nerium oleander L. AF214232 ** –

Adenium obesum (Forssk.) Roem. & Schult. HE805526 ** –

Apocynoideae; Odontadenieae

Pinochia corymbosa (Jacq.) M.E. Endress & B.F. Hansen EF456167 GU901378 –

Thyrsanthella difformis (Walter) Pichon EF456171 GU901398 –

Elytropus chilensis Müll. Arg. EF456228 GU901339 –

Cycladenia humilis Bentham EF456211 GU901335 –

Odontadenia perrotteti (A. DC.) Woodson EF456140 GU901367 –

Secondatia densiflora A. DC. EF456177 GU901391 –

Apocynoideae – Wrighteae

Pleioceras barteri Baill. EF456251 ** –

Rauvolfioideae – Carisseae

Acokanthera oppositifolia (Lam.) Codd. AF214148 – –

Carissa spinarum L. HE805533 ** –

Rauvolfioideae – Plumerieae

Chapter 2

51

Allamanda indet. AF214150 – –

Anechites nerium (Aubl.) Urb. AM295087 ** –

Plumeria alba Kunth. AF214254 – –

Plumeria obtuse L. HE805537 ** –

Plumeria rubra L. HE805538 ** –

Skytanthus acutus Meyen AF214269 ** –

Thevetia ahouai (L.) A. DC. AF214281 – –

Thevetia peruviana (Pers.) K. Schum. HE805540 ** –

Rauvolfioideae – Vinceae

Catharanthus roseus G. Don AF214175 – –

Catharanthus roseus G. Don HE805534 ** **

Kopsia fruticosa (Ker. Gawl.) A. DC AM295091 – –

Ochrosia nakaiana (Koidz) Fosberg & Sachet. [Neisosperma nakaiana

(Koidz) Fosberg & Sachet.] AF214231 –

–

Ochrosia coccinea (Teijsm. & Binn.) Miq. AM295092 – –

Petchia ceylanica (Wight) Livera AM295093 ** **

Petchia madagascariensis (A. DC.) Leeuwenb. AM295088 – –

Rauvolfia serpentina Benth. ex Kurz. AF214261 – –

Rauvolfia serpentine Benth. ex Kurz. HE805539 ** **

Chapter 2

52

Vinca minor L. AF214295 – –

Vinca major L. HE805541 –

Apocynoideae: Vinceae Unplaced Genera

Amsonia tabernaemontana Walter AF214153 – –

Amsonia hurbritchii Woodson – ** –

Rhazya stricta Decne. AM295095 – –

Rhazya orientalisA.DC. AM295095 ** –

Rauvolfioideae – Tabernaemontaneae

Molongum laxum (Benth.) Pichon AF214229 – –

Tabernaemontana divericata L. AF214277 ** **

Rauvolfioideae – Melodineae

Craspidospermum verticillatum Bojer ex A. DC. AM295090 – –

Rauvolfioideae – Hunterieae

Gonioma kamassi E.Mey. HE805535 ** **

Rauvolfioideae – Alyxieae

Alyxia buxifolia R. Br. AF214152 ** **

Chilocarpus suaveolens Blume. AM295089 – –

Condylocarpon amazonicum (Markgr.) Ducke AF214183 – –

Lepiniopsis ternatensis Valeton AF214220 – –

Chapter 2

53

**Sequences are under process for submission to GenBank.

Plectaneia stenophylla Jum. AF295094 – –

Pteralyxia kauaiensis Caum AM295094 – –

Rauvolfioideae – Alstonieae

Alstonia boonei De. Wild. AF214151 – –

Alstonia scholaris (L.) R. Br. HE805532 ** –

Rauvolfioideae – Aspidospermeae

Aspidosperma quebrachoblanco Schltdl. AF214165 – –

Vallesia antillana Woodson AF214293 – –

Outgroup - Gentianaceae

Chelonanthus alatus (Aubl.) Pulle AY251775 – –

Chapter 2

54

Bayesian analysis was performed using Mr. Bayes (Huelsenbeck and Ronquist, 2001).

The software judges the maximum possibilities of substitution, weighted by their

probability of occurring in a specific model of evolution (Huelsenbeck et al., 2001).

The HKY85 model was specified for analysis in which all transitions and

transversions have potentially different rates. More complex models were also tested,

but these yielded the same tree with similar posterior probabilities (PP). The analysis

was performed with 500,000 generations of Monte Carlo Markov Chains with equal

rates and a sampling frequency of 10. Microsoft excel was used to plot generation

number against InL to find the ‘burn in’. Trees of low PP were deleted, and all

remaining trees were imported into PAUP 4.0b. A Bayesian tree (i.e. a majority rule

consensus tree) was produced showing PP (i.e. frequencies of all observed bi-

partitions).

Chapter 3

55

Results

3.1 DNA extraction and PCR

Total genomic DNA was extracted from fresh leaf tissues or from herbarium

specimens by using different CTAB protocols. Isolated DNA was run on 1 % agarose

gel after treatment with RNase for determining the quality of DNA (Figure 3.1), as

good quality template is desired for the amplification of plastid and nuclear regions. It

was noticed that DNA from herbarium material is technically more difficult to be used

for amplification of low-copy nuclear genes such as PHYA.

By using the genomic DNA as template, amplification of trnL-F intron-spacer region,

atpB promoter region and first exon of PHYA gene was done by using forward and

reverse primers. To amplify large regions such as trnL-F and PHYA, two sets of

primers were used for each (details are given in Table 2.2 Material and Methods

section). The amplified products of different sizes from different regions were

confirmed on 1 % agarose gel (Figure 3.1).

3.2 Purification and sequencing of amplified products

High quality PCR product was purified by using QIAquick kit following the

manufacturer's protocol. The purified product was sequenced by using 3730

automated sequences. Sequences of amplified fragment were edited and analysed

using MP and Bayesian analyses for phylogeny of Apocynaceae. Separate (trnL-F,

atpB and PHYA) phylogenetic trees were constructed by using different software such

as PAUP 4.0b10 and Mr. Bayes. Results are elaborated here separately on the basis of

different regions.

3.3 Phylogenetic analysis based on plastid trnL-F intron region sequences

To estimate the phylogenetic relationships among groups of Apocynaceae 178 taxa

were used in the parsimony analysis of the trnL-F. Of the 1267 characters, of total 411

variable characters 292 were found to be potentially parsimony-informative. Analysis

yielded 2830 equally most-parsimonious trees 1748 steps long, with a consistency

index (CI) of 0.60 and a retention index (RI) of 0.79. In comparison to parsimony

Chapter 3

56

Figure 3.1 Extraction of genomic DNA and amplified products of different plastid and nuclear regions, M = 50bp ladder (Fermentas). a) Isolated genomic DNA from different taxa of Apocynaceae, b) PCR amplification of trnL-F region by using primer c & d, c) PCR product of atpB promoter region, d) PCR product of PHYA by using 2059F and 2971 R.

Chapter 3

57

consensus tree (Figure 3.2) the Bayesian consensus tree (Figure 3.3) has more

resolved nodes. The subfamilies receive strong support in the Bayesian analysis in

contrast to the parsimony results. The exception to this is subfamily Rauvolfioideae,

which receives low Bayesian support (PP 0.79).

In Rauvolfioideae, largely the resolution is low among groups in both parsimony and

Bayesian analyses. Vallesia and Aspidosperma of Aspidospermeae (BP 98; PP 0.9)

appeared as sister to the rest. Alstonieae and Carisseae are strongly supported in both

analyses (BP 100; PP 1.0 and BP 99; PP 1.0). In the Bayesian tree Plumeria and

Allamanda of Plumerieae receive high support (PP 1.0) (Figure 3.3). Vinceae,

Tabernaemontaneae, Hunterieae and Melodineae are not fully resolved (Figures 3.2 &

3.3).

Genera of Vinceae and Alyxieae do not appear in separate distinct clades (Figures 3.2

& 3.3) and are therefore non-monophyletic groups. In Vinceae, the nodes which

delimit the genera are poorly resolved in both consensus trees. The Alyxieae group

forms two distinct clades — Lepiniopsis, Pteralyxia, Alyxia and Plectaneia receive

strong support (PP 1.0) in the Bayesian analysis and weak support in parsimony,

whereas the Chilocarpus and Condylocarpon clade (BP 100; PP 1.0) appears among

the unresolved tribes of Rauvolfioideae (Figure 3.3). Support values for the

Tabernaemontana and Molongum clade are high, BP 100; PP 1.0 (Figures 3.2 & 3.3).

The APSA clade including all examplers of Apocynoideae, Periplocoideae,

Secamonoideae and Asclepiadoideae get significant support with BP 98 and PP 0.98

(Figures 3.2 & 3.3). Apocynoideae is not monophyletic in our analyses, tribe

Malouetieae in the Bayesian tree appears as the sister group of Secamonoideae and

Asclepiadoideae rather than Periplocoideae with weak support (Figure 3.3). Nerieae

and Apocyneae form well-supported clades of Apocynoideae in the Bayesian tree (PP

0.99; PP 0.98 respectively) while their bootstrap values are lower.

The position of the well-supported Periplocoideae clade (BP 100; PP 1.0) remains

unresolved. In Periplocoideae, values which support the relationships between the

genera also vary between both types of analyses (Figures 3.2 & 3.3).

Chapter 3

58

Figure 3.2 One of the most parsimonious trees for Apocynaceae based on the sequences of plastid trnL-F region. Branch lengths are optimised using DELTRAN and shown above branches; bootstrap percentages > 50 and consistent with the strict consensus tree are indicated below branches. BP > 90 are considered high support and < 80 showing weak support. Groups of Apocynoideae are defined here according to the classification of Endress et al. (2007a). Species with (P) were collected from Pakistan.

Chapter 3

59

Figure 3.2 (Continued)

APSA clade

Chapter 3

60

Figure 3.3 The Bayesian tree resulting from the analysis of the trnL-F sequences for Apocynaceae. Posterior probabilities are shown above branches. Values > 0.95 are considered as strong support, > 0.90 showing moderate support and < 0.90 with weak support.

Chapter 3

61

Figure 3.3 (Continued)

APSA clade

Chapter 3

62

The clade comprising of milkweeds (Asclepiadoideae and Secamonoideae) receives

high support (PP 0.98) in the Bayesian tree in contrast to the parsimony phylogeny

(with low support) (Figures 3.2 & 3.3). In Secamonoideae, species of the Secamone

group (PP 0.99) cluster together, but the embedded position in the clade of the genus

Pervillaea is not evident here (Figure 3.3).

Fockeae appear as sister to the rest of Asclepiadoideae. A clade comprising of

Ceropegieae and Marsdenieae receives good support (PP 0.98) confirming the

monophyly of these two tribes. Eustegia is recovered as the sister of the Marsdenieae-

Ceropegieae clade (PP 0.96). Ceropegieae has highly supported subclade (BP 100; PP

0.98) while the monophyly of Marsdenieae is suspected due to basal position of genus

Fockea (Figures 3.2 & 3.3). In the Marsdenieae Hoya and Dischidia are well-

supported (PP 0.1) sister groups.

The monophyly of Asclepiadeae (PP 1.0) and subtribal relationships are well-

supported in the Bayesian tree. ‘Astephaninae’ the basal most tribe of Asclepiadeae

including Microloma, Astephanus and Oncinema receives strong support in both

analyses (BP 100; PP 1.0). Based on the trnL-F region, the ACT (Asclepiadinae,

Cynanchinae and Tylophorinae) and MOG (Metastelmatinae, Oxypetalinae and

Gonolobinae) clades are not well-resolved in the parsimony analysis. The Malagasy

leafless stem succulent group Cynanchinae (represented in the analyses by the

following species C. grandidieri, C. viminale, C. verrucosum, C. insigne and C.

obovatum) forms both a weakly and strongly supported clade in the two analyses

types (BP 59: PP 1.0). Cynanchinae are not monophyletic since other ‘non-Malagasy’

species of Cynanchinae appear in different tribes in the ACT clade with weak support.

The monophyly of subtribes Tylophorinae (PP 1.0) and Asclepiadineae (PP 0.98) are

confirmed in present study. In Tylophorinae Tylophora and Vincetoxicum showed a

strongly supported relationship, likewise Diplostigma and Goydera receive strong

support (PP 1.0) (Figure 3.3). The other large Cynanchinae group is not well-

supported in both analyses and further bifurcates into two strongly supported

subclades (PP 1.0) — New World Cynanchinae (comprised of C. montevidense, C.

roulinioides, C. leave and Metalepis albiflora) and Old World Cynanchum relatives

(Glossonema boveanum, Odontanthera radians and Pentarrhinum abyssinicum). The

Asian C. jacquemontianum is appeared as a problematic taxon because in both the MP

Chapter 3

63

and Bayesian analyses it is not grouped to the rest of the Cynanchum species.

Likewise Mediterranean C. acutum, the type species of the genus, appears with the

unplaced genera Solenostemma and Oxystelma, not with either of the two principal

Cynanchineae clades.

Pergularia is recovered as sister to the remaining genera of Asclepiadineae (PP 0.92).

Strong support (PP 0.99) for the New World Asclepias is observed while the Old

World species A. alpestre appears with Old World members of Asclepiadineae (Figure

3.3).

Within the MOG clade, members of the new subtribe Orthosiinae occupy a basal

position with moderate support (PP 0.97). Monophyletic Gonolobinae are embedded

in Oxypetalinae with weak support (Figure 3.3). Oxypetalum is an unresolved group

and the Araujia-Philibertia clade receives weak support. The Bayesian analysis

confirms Funastrum is sister to rest of the MOG clade (Figure 3.3). The

Metastelmatinae clade receives strong support (PP 1.0). However, inter-generic

resolution in the MOG and ACT clades is low in places (Figure 3.3).

3.4 Phylogenetic analysis of Apocynaceae by using nuclear region (PHYA)

In both Bayesian and parsimony analyses based on PHYA region, the dataset is

comprised of 112 taxa and 1251 characters. Of total taxa included in PHYA

phylogenetic tree, the targeted region of phytochrome A was sequenced from 67 taxa

belonging to different tribes of Apocynaceae and rest of incorporated taxa are from

the study of Livshultz (2010). In parsimony analysis, of 636 variable characters 479

were parsimony informative. MP analysis produced tree length= 2234, CI= 0.43, RI=

0.72.

In PHYA analysis major lineages receives less support at some places like APSA is

supported by 0.85 PP value. Both the subfamilies Apocynoideae and Rauvolfioideae

are also not recovered monophyletic here. In all subfamilies relationships among

tribes and sub tribes receive either moderate support or less supported. In the separate

trnL-F or PHYA analyses relationships among the major lineages are not well-

supported. So, in the next step an attempt was made to construct a phylogenetic tree

based on combined plastid (trnL-F) and nuclear (PHYA) dataset.

Chapter 3

64

In order to check whether these two regions are congruent or not, an incongruence test

was done. Incongruent clades recovered from parsimony and Bayesian analyses of

separate PHYA and trnL-F sequences, received no or less support in one or both

analyses. In some case, trnL-F provided higher support for certain clades than did

PHYA, but in other cases the reverse was true. Overall resolution produced by trnL-F

for both Bayesian and parsimony analyses, was less than with PHYA (Figures 3.4, 3.5,

3.6 & 3.7). So, results are evaluated only on the basis of combined phylogenetic trees

(Bayesian and MP) because they are better resolved and have higher support.

3.5 Combined phylogenetic analysis of Apocynaceae based nuclear region

(PHYA) and plastid region (trnL-F)

The dataset comprises of 112 taxa and 2325 characters, of which 1251 are contributed

by PHYA and 1070 from trnL-F. In the parsimony analysis 701 characters proved

parsimony informative and 419 variable characters are parsimony un-informative.

Analysis produced equally most-parsimonious trees with a tree length of 3284 steps

and a CI is 0.49 and the RI is 0.71. In both cases Alstonia was taken out as an

outgroup to the rest of the member of Apocynaceae. Rauvolfioideae and

Apocynoideae in both analyses appear as non-monophyletic subfamilies, whereas,

monophyly of each subfamily of traditional Asclepiadaceae (Periplocoideae,

Secamonoideae and Asclepiadoideae) receives strong support in both analyses.

Likewise, in Bayesian trees lineages are relatively supported with high PP value as BP

generated by MP analysis (Figures 3.8 & 3.9).

Different taxa representing seven tribes of Rauvolfioideae (Alstonieae, Alyxieae,

Carisseae, Hunterieae, Plumerieae, Tabernaemontaneae and Vinceae) are included in

the analyses. It was observed that the resolution among the groups is low in both

phylogenetic trees (Figures 3.8 & 3.9). The monophyly of Plumerieae recieves low

support in both analyses (BP 59; PP 0.93) while Vinceae is paraphyletic in the MP

analysis and poorly supported in the Bayesian tree (PP 0.83). In both analyses

Tabernaemontana is closely associated with Vinceae, whereas Hunterieae is closer to

the Amsonia-Rhazya clade (BP 100; PP 1.0) but this relationship is not well-supported

(PP 0.91). The position of Carisseae is found here as sister to the APSA clade with BP

59 and PP 0.91.

Chapter 3

65

Figure 3.4 Parsimony analysis of only PHYA sequences from different taxa of Apocynaceae. Bootstrap percentages > 50 and consistent with the strict consensus tree are indicated below branches. Taxa having odd position in the tree are shown here in bold letters. Asterisk (*) indicating taxa defined incertae sedis in Endress et al. (2007a) classification system. Cynanchum (P) = Cynanchum jacquemontianum.

Chapter 3

66

Figure 3.4 (Continued)

Chapter 3

67

Figure 3.5 Bayesian tree based on only PHYA sequences. PP values are indicated above the branches. Values > 0.95 are considered as strong support, > 0.90 showing moderate support and < 0.90 are weak support. Taxa at odd position are in bold letters. Asterisk (*) indicating taxa defined incertae sedis in Endress et al. (2007a) classification system. Cynanchum (P) = Cynanchum jacquemontianum.

Chapter 3

68

Figure 3.5 (Continued)

Chapter 3

69

Figure 3.6 Parsimony analysis of trnL-F sequences of taxa present in combined analyses. Bootstrap percentages > 50 are indicated below branches. Taxa having odd position in the tree are shown here in bold letters. Asterisk (*) indicating taxa defined incertae sedis in the classification of Endress et al. (2007a). Cynanchum (P) = Cynanchum jacquemontianum.

Chapter 3

70

Figure 3.6 (Continued)

Chapter 3

71

Figure 3.7 Bayesian analysis of trnL-F sequences of taxa included in combined analyses. Values > 0.95 are considered as strong support, > 0.90 showing moderate support and < 0.90 are weak support. Taxa having odd position in the tree are shown here in bold letters. Asterisk (*) indicating taxa defined incertae sedis in Endress et al. (2007a) classification system. Cynanchum (P) = Cynanchum jacquemontianum.

Chapter 3

72

Figure 3.7 (Continued)

Chapter 3

73

Figure 3.8 One of the most parsimonious trees for Apocynaceae based on sequences of the combined dataset (PHYA and trnL-F). Bootstrap percentages > 50 and consistent with the strict consensus tree are indicated below branches. Taxa in bold letters appear at odd places. Incertae sedis are highlighted by adding asterisk (*). Cynanchum (P) = Cynanchum jacquemontianum.

Chapter 3

74

Figure 3.8 (Continued)

Chapter 3

75

Figure 3.9 Bayesian analysis of Apocynaceae by using combined datasets (PHYA and trnL-F). Posterior probabilities are shown above branches. Values > 0.95 are considered as strong support, > 0.90 showing moderate support and < 0.90 with weak support. Taxa having odd position in the tree are shown here in bold letters. Asterisk (*) indicating taxa defined incertae sedis in Endress et al. (2007a) classification system. Cynanchum (P) = Cynanchum jacquemontianum.

Chapter 3

76

Figure 3.9 (Continued)

Chapter 3

77

In the APSA clade (BP 99; PP 1.0), monophyly of Apocynoideae is suspected due to

basal parallel lineages representing tribes Nerieae and Malouetieae of Apocynoideae

and subfamily Periplocoideae. Rhabdadenia form an unsupported clade in the MP

analysis with members of Malouetieae (Figure 3.8) while in the Bayesian tree

Rhabdadenia appears as a separate lineage (Figure 3.9). Periplocoideae form a

monophyletic group (BP 100; PP 1.0) and this clade is embedded in the

Apocynoideae. The rest of tribes of Apocynoideae: Odontadenieae, Mesechiteae,

Echiteae and Apocyneae form a well-supported clade in both the parsimony and

Bayesian trees (BP 100; PP 1.0). Odontadenieae, Mesechiteae and Echiteae are from

the New World and a well-supported relationship among the New World’s tribes is

not noted here. Odontadenieae is monophyletic but not well-supported (PP 0.63) in

Bayesian tree and unsupported by MP analysis. Echiteae is non-monophyletic because

of odd position of Rhabdadenia and appearance of Angadenia, Laubertia and

Pentalinon with members of Mesechiteae and rest of Echiteae form a stable clade with

0.98 PP (Figure 3.9). Monophyly and inter-generic relationships of Apocyneae are

also poorly supported (PP 0.84) and unsupported in parsimony tree. In Apocyneae

further two sub-clades appear, basal sub-clade is less supported (PP 0.72) in

comparison to sub-clade comprises of most evolved genera of Apocyneae (PP 1.0)

(Figure 3.9). In basal subclade relationship of Beamontia, Trachelospermum, Vallaris

and Sindechites receives well PP (1.0) value. Likewise in most evolved lineages of

Apocyneae, Aganosma, Epigynum and Ichnocarpus showing strong relationship (PP

1.0). Apocynum and Cleghornia form sister group of Apocyneae.

In Periplocoideae, the Bayesian analysis produced good inter-generic resolution as

compared to parsimony tree. Grooved translator bearing group form a well-supported

clade with 1.0 PP value and less supported by MP analysis (BP 70). Periploca

emerges as sister to rest of Periplocoids. The newly recognised tribe Baisseeae

(comprised of three genera Baissea, Oncinotis and Motandra by Livshultz, 2010) is

supported by 99 BP and 1.0 PP values with Dewevrella (African monotypic genus) as

its sister group. This clade forms a strongly supported sister to the milkweeds in the

Bayesian tree (PP 1.0) and is relatively less supported in the parsimony tree (BP 78).

Sister group of Asclepiadoideae, subfamily Secamonoideae receives strong support in

both analyses (BP 99; PP 1.0). However the genus Secamone (represented here by S.

Chapter 3

78

alpine and S. elliptica) is recovered here non-monophyletic. The Secamonoideae-

Asclepiadoideae clade receives strong support in both analyses (BP 100; PP 1.0). In

Asclepiadoideae the basal position of Fockeeae is confirmed here with 100 BP and 1.0

PP. Members of Ceropegieae form a well-supported clade (BP 99; PP 1.0) in

Asclepiadoideae. Of four subtribes of Ceropegieae members of three tribes

(Stapeliinae, Anisotominae and Leptadeniinae) are included in the present study.

Leptadeniinae emerges as sister group of Stapeliinae (BP 100; PP 1.0) and

Anisotominae (BP 88; PP 1.0) with good support in both MP and Bayesian trees (BP

99; PP 1.0).

The monophyly of Marsdenieae except Fockea receives strong support in the

Bayesian analysis (PP 0.99) as compared to MP (BP 78). Hoya, Dischidia and

Marsdenia form a strongly supported sub-clade in Bayesian tree (PP 1.0) while less

supported in MP analysis (BP 88). However the strong relationship of Hoya and

Dischidia is also noted in parsimony analysis with 100 BP value. Another sub-clade

comprised of Dregea, Wattakaka, Stephanotis, and Gymnema receive high support in

both analyses (BP 97; PP 1.0). Rhyssolobium in MP analysis (BP 78) appears as sister

to Marsdenieae while its position in Bayesian tree (PP 0.54) emerge with basal sub-

clade in Marsdenieae (PP 0.54). The close relationship between these tribes receives

strong support in the Bayesian tree (PP 1.0) while this relationship is not strongly

supported in MP (BP 53). Eustegia is recovered as sister to the Marsdenieae-

Ceropegieae clade (BP 53; PP 1.0).

The major clades in Asclepiadeae are strongly supported in the Bayesian analysis,

while resolution is relatively poor in the parsimony analysis. Subtribe Astephaninae:

here represented by genera Oncinema and Microloma is sister to rest of Asclepiadeae

(BP 71; PP 1.0). The ACT clade is not recovered here as a monophyletic group due to

the position of Cynanchineae (Figures 3.8 & 3.9). Asclepiadineae and Tylophorinae

form a well-supported clade (the AT clade) (PP 1.0) and this relationship is not

supported by parsimony analysis. The subtribe Asclepiadineae receives less support in

both analyses (BP 53; PP 0.89). The genus Oxystelma is recovered here as a sister

group (PP 1.0) of the AT clade.

Cynanchineae comprised of the Old World genus Cynanchum (here represented by C.

viminale, C. jacquemontianum and C. obtusifolium) forms a strongly supported clade

Chapter 3

79

(BP 100; PP 1.0) that is sister to the MOG clade (BP 84; PP1.0). The MOG clade,

containing taxa from the New World, receives strong support in the Bayesian tree (PP

1.0). Within MOG the Gonolobineae are monophyletic with 1.0 PP. Blepharodon

(Metastelmatinae) is weakly supported (PP 0.61) as sister to Funastrum

(Oxypetalinae) resulting in the Oxypetalinae being non-monophyletic. Blepharodon-

Funastrum comes out as sister to rest of Oxypetalinae. Within the Oxypetalinae,

Araujia, Philibertia and Oxypetalum form a well-supported clade in Bayesian tree (PP

1.0) and receive relatively less support in parsimony analysis (BP 85).

3.6 Phylogenetic analysis based on atpB gene promoter

In the phylogenetic trees based on trnL-F and PHYA regions, low resolution among

the groups in Rauvolfioideae was observed. In order to improve inter-generic

relationship in Rauvolfioideae, in addition to plastid region trnL-F and nuclear locus

PHYA, atpB gene promoter was sequenced from taxa of Rauvolfioideae. The

combined dataset comprised of 30 taxa and 3200 characters from three loci (trnL-F,

atpB gene promoter and PHYA). In MP analysis of total variable character 475 were

parsimony informative and produce parsimonious tree with 1836 tree length, 0.74 CI

and 0.64 RI. The subfamily is still recovered non-monophyletic (Figures 3.10 & 3.11).

Tabernaemontaneae appears with members of Vinceae with less PP (0.86) value as

compared to combined phylogenetic analysis of Apocynaceae. Incertae sedis genera

Rhazya and Amsonia also receive high PP (1.0) value with 100 BP support and does

not form clade with Hunterieae. The monophyly of Plumerieae is supported by 0.89

PP value and unsupported in parsimony tree. Sister position of Carisseae to APSA

clade receives 0.97 PP comparatively high to 0.91 in combined analysis of

Apocynaceae. Inter-generic relationship among the tribes is also not well-supported.

Overall support in both analyses (Bayesian and parsimony) to resolve groups in

Rauvolfioideae is found low. In comparison of combined phylogenetic analyses of

Apocynaceae with more number of taxa, here with more number of loci, the

relationships are not strongly supported in Rauvolfioideae.

Chapter 3

80

Figure 3.10 Parsimony tree generated by using molecular combined data set (trnL-F, atpB and PHYA). Asterisk (*) indicating incertae sedis taxa in Endress et al. (2007a) classification. BP values > 50 are shown below branches.

Chapter 3

81

Figure 3.11 Majority rule consensus tree based on the Bayesian analysis of the combined molecular data set. PP values are indicated above the branches. Values > 0.95 are considered as strong support, > 0.90 showing moderate support and < 0.90 with weak support. Asterisk (*) indicating incertae sedis taxa in Endress et al. (2007a) classification.

Chapter 4

82

Discussion

Endress and Bruyns (2000) recognised five subfamilies in Apocynaceae:

Asclepiadoideae, Secamonoideae, Periplocoideae, Apocynoideae and Rauvolfioideae.

With the introduction of modern cladistic analyses, systematists have endeavoured to

identify monophyletic groups for formal recognition in the classifications, and

modern classifications rely on both traditional taxonomic characters and molecular

data. To find the natural relationships among different groups of Apocynaceae, a

range of molecular based approaches have been used in various studies (Potgieter and

Albert, 2001; Rapini et al., 2003; Rapini et al., 2006; Livshultz et al., 2007; Simões et

al., 2007; Livshultz, 2010). From these studies, it is apparent that both subfamilies

Apocynoideae and Rauvolfioideae are paraphyletic. Moreover, instead of

Periplocoideae, Baisseeae of Apocynoideae have appeared as sister to the

Asclepiadoideae-Secamonoideae clade (Livshultz, 2010). In the present study, infra-

familial relationship among subfamilies, position of Periplocoideae in evolutionary

tree, inter-tribal relationships within the subfamilies are addressed with the help of

plastid and nuclear datasets based phylogenetic trees by using PAUPversion 4.0b10

(Swofford, 2002) and Mr. Bayes(Huelsenbeck and Ronquist, 2001) software.

4.1 Incongruence

Comparison of Bayesian and parsimony trees based on trnL-F and PHYA sequences

did not produced any moderately or well-supported incongruent clades, suggesting

that these two regions are not following variable phylogenetic histories. Otherwise

events such as hybridization, paralogy, lineage sorting, etc. can produce different

phylogenies’ for different data sets (Johnson and Soltis, 1998). Results in present

study correspond to the findings of Livshultz (2010). Simultaneous analysis of

combined data can increase cladistic parsimony than separate analyses as stated by

Nixon and Carpenter (1996)and same is appeared in present phylogenetic study.

Overall resolution produced by separate analyses (both Bayesian and parsimony) of

trnL-F and PHYA was lower than for simultaneous analysis. Moreover resolution

power among the groupshas seemed more in Bayesian trees in comparison to MP

analysis of all datasets. Here subfamilies are discussed separately using broader trnl-F

and combined trnL-F plus PHYA (combined) analyses.

Chapter 4

83

4.2 Asclepiadoideae

The subfamily is monophyletic here (Figures 3.2, 3.3, 3.4, 3.5, 3.8 & 3.9) distributed

all over the world with three main centres of generic diversity; tropical central and

South America, tropical Asia, eastern and southern Africa (Goyder, 2006). Currently,

four tribes are recognised in the subfamily: Fockeeae, Ceropegieae, Marsdenieae and

Asclepiadeae (Endress et al., 2007a; Table 4.1).

4.2.1 Fockeeae

TribeFockeeae (Kunze et al., 1994) are sister to the rest of the Asclepiadoideae as

reported in previous phylogenetic studies (Civeyrel et al., 1998; Fishbein, 2001;

Potgieter and Albert, 2001; Rapini et al., 2003; Livshultz et al., 2007; Livshultz,

2010). This placement of Fockeeae has received strong support in both parsimony and

Bayesian analyses (Figures 3.2, 3.3, 3.4, 3.5, 3.8 & 3.9). Fockeeae have pollinia with

tetrads and outer envelops (Kunze, 1996) and may be an intermediate stage between

Secamone and more specialised Asclepiadoideae (Endress and Bruyns, 2000).

Fockeeae share the character of two pollinia per anther with all Asclepiadoideae, in

contrast to the four pollinia found in Secamonoideae. The two genera of Fockeeae are

also differing from all other genera of Asclepiadoideae by the absence of well-

developed caudiculae, thereby linking the pollinia directly to the dorsal side of the

corpusculum. The corpusculum itself differs structurally from these found elsewhere

in the subfamily, with long undifferentiated flank, the lack of a floor connecting these

flanks in the lower part, and the presence of adhesive basal pads fixing the

corpusculum to the inner side of the anther wings (Kunz et al., 1994).

4.2.2 Ceropegieae

Stapelieae are presently known as Ceropegieae (Endress and Bruyns, 2000; Meve and

Liede, 2004) and mainly distributed in southern Africa, but genera are also found in

tropical Asia and Madagascar regions (Goyder, 2006). Meve and Liede (2004)

recognized four subtribes in Ceropegieae, i.e., Anisotominae, Heterostemminae,

Leptadeniinae and Stapeliinae. In our analyses Leptadeniinae comes out as sister to

rest of Ceropegieae whereas Anisotominae are sister to Stapeliinae. Both subtribes

(Anisotominae and Stapeliinae) have many morphological similarities (Meve, 1995;

Chapter 4

84

Table 4.1Phylogenetic position of genera in different groups of Asclepiadoideae in comparison to Rapini et al. (2003) and more recent classification by Endress et al. (2007a).

Genera Distribution Rapini et al. (2003) Endress et al. (2007a) Present Study

Araujia New World Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Asclepias New World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Aspidoglossum Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Astephanus Old World Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Barjonia New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Biondia Old World Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Blepharodon New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Boucerosia Old World Ceropegieae Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Calotropis Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Caralluma Old World *** Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Ceropegia Old World Ceropegieae Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Cionura Old World Marsdenieae Marsdenieae Marsdenieae Cynanchum Old World Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Diplolepis New World Asclepiadeae – Oxypetalinae Asclepiadeae – incertae sedis Basal genera of MOG Diplostigma Old World Asclepiadeae – ACTG Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Dischidia Old World Marsdenieae Marsdenieae Marsdenieae Ditassa New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Dregea Old World Marsdenieae *** Marsdenieae Duvalia Old World *** Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Eustegia Old World Asclepiadeae – Eustegiinae Asclepiadeae – incertae sedis Asclepiadeae – incertae sedis Fockea Old World Fockeeae Fockeeae Fockeeae Folotsia* Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Funastrum New World Asclepiadeae – MOG Asclepiadeae – Oxypetalinae Asclepiadeae – MOG

Chapter 4

85

Glossonema Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Glossostelma Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Gomphocarpus Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Gonolobus New World Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Goydera Old World Asclepiadeae – ACTG Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Gymnema Old World *** Marsdenieae Marsdenieae Hemipogon New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Hoya Old World Marsdenieae Marsdenieae Marsdenieae Jobinia New World Asclepiadeae – MOG Asclepiadeae – Orthosiinae Asclepiadeae – Orthosiinae Kanahia Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Karimbolea* Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Leptadenia Old World *** Asclepiadeae – Leptadeniinae Asclepiadeae – Leptadeniinae Margaretta Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Marsdenia New World Marsdenieae Marsdenieae Marsdenieae Matelea New World Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Metalepis New World Asclepiadeae – Cynanchineae Asclepiadeae – Cynanchineae Asclepiadeae – Cynanchinae Metaplexis Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Metastelma New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Microloma Old World Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Minaria New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Nautonia New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Neoschumannia Old World Ceropegieae Ceropegieae – Anisotominae Ceropegieae – Anisotominae Nephradenia New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Odontanthera Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Oncinema Old World Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Asclepiadeae – Astephaninae Orthosia New World Asclepiadeae – MOG Asclepiadeae – Orthosiinae Asclepiadeae – Orthosiinae

Chapter 4

86

Oxypetalum New World Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Oxystelma Old World Asclepiadeae – ACTG Asclepiadeae – incertae sedis Unplaced in ACT Pachycarpus Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Pentarrhinum Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Pentatropis Old World Asclepiadeae – ACTG Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Peplonia New World Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Asclepiadeae – Metastelmatinae Pergularia Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Philibertia New World Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Asclepiadeae – Oxypetalinae Platykeleba* Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Quaqua incarnata Old World Ceropegieae Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Rhyssolobium Old World Marsdenieae Marsdenieae Marsdenieae Sarcostemma* Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Asclepiadeae – Cynanchinae Schizostephanus Old World Asclepiadeae – ACTG Asclepiadeae – Cynanchinae Unplaced in ACT clade Schubertia New World Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Asclepiadeae – Gonolobinae Solenostemma Old World Asclepiadeae – ACTG Asclepiadeae – incertae sedis Unplaced in ACT Stapelia Old World Ceropegieae Ceropegieae – Stapeliinae Ceropegieae – Stapeliinae Stephanotis Old World Marsdenieae Marsdenieae Marsdenieae Stathmostelma Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Stenostelma Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Tassadia New World Asclepiadeae – MOG Asclepiadeae– Metastelmatinae Unplaced in MOG Telosma Old World Marsdenieae Marsdenieae Marsdenieae Tylophora Old World Asclepiadeae – ACTG Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Vincetoxicum Old World Asclepiadeae – ACTG Asclepiadeae – Tylophorinae Asclepiadeae – Tylophorinae Wattakaka Old World *** Marsdenieae Marsdenieae Xysmalobium Old World Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae Asclepiadeae – Asclepiadinae

*Genera are now included in genus Cynanchum.***Taxa not present in the study.

Chapter 4

87

Meve and Liede, 2001a, b, 2004) which are considered as an effect of parallel

evolution in response to pollinator pressure (Meve and Liede, 1999, 2001a). Meve

and Liede (2004) delimited the subtribes by using anatomical characters and this

delimitation is confirmed by molecular data in the same study.

In Leptadeniinae, the closer relationship (Figures 3.8&3.9) of Leptadenia and

Orthanthera is supported by their geographic distribution, as both genera are covering

Africa and Asia. Another striking character is the presences of at least one species in

both genera with the erect non-branched shrubby growth form, while this feature is

not found in other Ceropegieae. In the present study, results are congruent to Meve

and Liede (2004) subtribal division of Ceropegieae.

4.2.3 Marsdenieae

The tribe is recovered here monophyletic with strong support in Bayesian analysis

oftrnL-F and combined datasets. Inter-generic relationships are also well-supported

here, the closer relation of Hoya and Dischidia receives high support and this

association has previously been supported byPotgieter and Albert (2001), Livshultz

(2002, 2003),Rapini et al. (2003), Meve and Liede (2004) and Wanntorp et al.

(2006a, b). Another well-supported subclade in Marsdenieae is comprised of Dregea,

Gymnema, Stephanotis and Wattakaka. However, the position of Rhyssolobium

seems unclear in both analyses of combined datasets (Figures3.8 & 3.9). In the

Bayesian analysis this genus is sister to the subclade that is sister to the rest, whereas

with MP it is sister to other members of Marsdenieae; in both analyses, the position of

this genus is poorly supported. This result is congruent with Meve and Liede (2004)

and Wanntorp et al. (2006a).

Monophyly of Ceropegieae-Marsdenieae (which possess erect pollinia, regarded as a

primitive condition in Asclepiadoideae;Kunz, 1993) is well-supported in Bayesian

trees based on of trnL-F and combined datasets (Figures3.3 &3.9). So here

monophyly of both tribes receives signals from trnL-F region whereas PHYA

sequences generate less support (see figures 3.4 & 3.5). In earlier studies (Orbigny,

1843; Decaisne, 1844) Ceropegieae and Marsdenieae sensu Endress and Bruyns

(2000) were regarded as single entity. However Endress and Bruyns (2000) treated

Marsdenieae and Ceropegieae as two tribes, due to the lack of hyaline insertion crest

Chapter 4

88

on outer surface of pollinium and absence of an outer corona and milky latex in

former (Bruyns and Forster, 1991; Omlor, 1998; Meve and Liede, 2004). However,

Swarupanandan et al. (1996) again united these two tribes, and this idea was later

supported by molecular phylogenetic analyses (Potgieter and Albert, 2001; Rapini et

al., 2003; Meve and Liede, 2004 and in the present study).

The monotypic South African genus Eustegia of Asclepiadeae with pendant pollinia

appeared as sister to Marsdenieae-Ceropegieae clade. This sister position of the genus

has been noticed in previous phylogenetic studies based on plastid markers (Liede,

2001: Rapini et al., 2003; Meve and Liede, 2004; Goyder et al., 2007). Odd position

of the genus is making subtribe Asclepiadeae non-monophyletic. The genus is treated

in a separate tribe Eustegiinae by Rapini et al. (2003) but recent classification Endress

et al. (2007a)the genus is regarded as incertaesedis in Asclepiadoideae (Table 4.1).

4.2.4 Asclepiadeae

The largest tribe of Asclepiadoideae is not monophyletic due to odd position of

Eustegia which forms stable clade with Marsdenieae and Ceropegieae. Higher levels

of inter-generic resolution in Asclepiadeae are recovered in the Bayesian analysis as

compared to parsimony (Figures3.2, 3.3, 3.4, 3.5, 3.8 & 3.9). Presently eight subtribes

are recognised in Asclepiadeae: Astephaninae, Asclepiadinae, Tylophorinae,

Cynanchinae, Metastelmatinae, Orthosiinae, Oxypetalinae and Gonolobinae (Endress

et al., 2007a). In a broad overview of Apocynaceae conducted by Rapini et al. (2003),

three main clades were defined — Astephaninae comprising of only three genera

Astephanus, Microloma and OncinemasensuLiede (2001), the ACTG and MOG

clades. In present phylogenetic trees, Astephaninae are well-supported as sister to

other subtribes of Asclepiadeae, a result similar to previous morphological and

molecular studies (Liede and Albert, 1994; Liede, 1997; Liede and Taüber, 2002;

Rapini et al., 2003).

4.2.5 Asclepiadeae – ACT group

Asclepiadineae, Cynanchineae and Tylophorinae are component subtribes of ACT

group. In trnL-F analyses, large number of taxa is included in ACT group (Figures3.2

& 3.3) while sampling in this group is relatively low in combined trnL-F and PHYA

Chapter 4

89

analyses (Figures3.8 & 3.9). Cynanchineae appear in two separate clades in trnL-F

analyses, the Malagasy clade is comprised of leafless stem succulent taxa and the

leafy Cynanchumobovatum. The monophyly of Malagasy group supports the earlier

inclusion of other genera (Folotsia, Karimbolea, Platykeleba and Sarcostemma) in

Cynanchum by Liede and Kunze (2002) based on triterpenoid analysis, stem anatomy

and molecular characters. New World Cynanchineae form a clade with Glossonema

and Odonthanthera (Figures 3.2 & 3.3) and this is congruent to previous studies

(Liede and Taüber, 2002; Rapini et al., 2003). The position of the Asian taxa

Metalepisalbiflora embedded in American Cynanchum indicates that it should be

placed in Cynanchum, but had no support previously from morphological and

chemical data (Liede and Kunze, 2002).

The Asian C.jacquemontianum is another problematic taxon because in both the MP

and Bayesian analyses of trnL-F region it is not sister to the rest of the Cynanchum

species. The Mediterranean C. acutum, the type species of the genus, appears with the

unplaced genera Solenostemma and Oxystelma, not with either of the two principal

Cynanchum clades (Figures 3.2 & 3.3). Although Cynanchineae are circumscribed

broadly (Liede, 1997; Liede and Kunze, 2002; Liede and Taüber, 2002; Rapini et al.,

2003), but this subtribe is still unresolved in ACT clade (Rapini et al., 2003) of

Asclepiadeae. In present combined analyses Cynanchineae comprised of only Old

World taxa (Cynanchum viminale, C. jacquemontianum and C. obtusifolium) appears

as a sister group of the MOG clade (members from the New World) (Figures3.8 &

3.9). Here these results can be contrasted with Rapini et al. (2003) and present trnL-F

analyses where Cynanchinae is embedded in the ACT clade (but without support).

Monophyly of Tylophorinae is well-supported (trnL-F analyses) and these results

strengthen the proposal for Tylophorinae to be recognised as a subtribe (Liede, 2001;

Rapini et al., 2003). But the subtribe is weakly supported as sister to Cynanchineae. In

our study only two species of Tylophora (T. flexuosa and T. hirsuta) are included, but

they appear in different sub-clades. A close association between T. hirsuta and

Vincetoxicum hirundinaria is in agreement with Liede et al. (2002); temperate species

are included in Vincetoxicum, and only tropical species should be in Tylophora. An

alternative would be to broaden the circumscription of Vincetoxicum.

Chapter 4

90

Asclepiadineae are monophyletic (Figures 3.2, 3.3, 3.8 & 3.9) and Pergularia

emerges as sister to the rest of Asclepiadinae, as found in previous studies (Liede and

Albert, 1994; Rapini et al., 2003; Goyder et al., 2007). New World Asclepias forms a

moderately supported clade (Figures 3.2, 3.3), whereas Old World A. alpestris

(synonym Schizoglossumalpestre K. Schum.) appears with other African genera in

Asclepiadineae. There is only weak support along the spine of the Asclepiadinae

clade, and current generic limitation is unsatisfactory, as illustrated by Goyder et al.

(2007). The sister group relationship and uncertain position of Oxystelma and

Solenostemma has also been observed in previous analyses (Rapini et al., 2003),

whereas in older works (e.g. Schumann, 1895) both these genera were placed in

Glossonematinae.

Oxystelmais among the incertae sedis of Asclepiadoideae (Liede and Taüber

2000;Endress et al., 2007a), previously Liede (1997) included it in Metastelmatinae.

In subsequent molecular phylogenetic analyses (e.g., Potgieter and Albert, 2001;

Liede and Taüber, 2002; Liede et al., 2002; Rapini et al., 2003) the genus failed to

form a clade with members of Metastelmatinae. Instead, this genus occupied a

position sister to the rest of the ACT clade, as also observed here; however, in

previous molecular phylogenetic analyses using plastid loci this close relationship was

not well-supported. In combined trnL-F and PHYA analyses, Asclepiadineae and

Tylophorinae (represented here by Tylophorahirsuta)form a well-supported clade (AT

clade) with strong support in both Bayesian and parsimony analyses with Oxystelma

as sister to rest of AT clade (Figures3.8 & 3.9). While in trnL-F analyses and in

analyses by Rapini et al. (2003) this clade is not appeared rather Cynanchineae is

embedded in Asclepiadineae and Tylophorinae. Position of Cynanchineae with

MOG’s subtribes could be reasoned by less number of included taxa in combined

trnL-F and PHYA analyses.

4.2.6 Asclepiadeae – MOG group

The New World MOG clade has been widely assessed in various molecular

phylogenetic studies (Rapini et al., 2003, 2006; Liede-Schumann et al., 2005). The

previous studies in addition to our results (Figures 3.2, 3.3, 3.8 & 3.9) have revealed

that in spite of significant variation (Liede-Schumann et al., 2005) in morphological

characters, MOG (Rapini et al., 2003) and the recently proposed Orthosiinae are

Chapter 4

91

grouped together with high support. In trnL-F analyses, the embedded position of

Gonolobinae in the Oxypetalinae clade is poorly supported. This uncertain position of

the subtribe was also reported by Rapini et al. (2003). While in combined analyses

Gonolobinae appear as sister to rest of MOG with strong support (Figures 3.8 & 3.9).

The subtribe Oxypetalinae is not monophyletic in all analyses (Figures 3.2, 3.3, 3.8 &

3.9) and these results are incongruent to Rapini et al. (2003, 2006) and Liede-

Schumann et al. (2005). Blepharodon lineare and Funastrumclausum were resolved

taxa in the study of Rapini et al. (2006) and appeared as sister to Metastelmatinae and

Oxypetalinae, respectively and also confirmed in present trnL-F analyses (Figures3.2

& 3.3). According to Liede (1997) F.clausum was previously included in

Metastelmatinae on the basis of morphological characters, but in the most recent

classification (Endress et al., 2007a) and also various molecular studies (Liede-

Schumannet al., 2005; Rapini et al., 2006) it is placed in Oxypetalinae. However, in

the combined analyses the relationship between B. lineare and F.clausum is unclear,

but their sister-group position to the rest of Oxypetalinae is well-supported

(Figures3.8 & 3.9). In the present study, Oxypetalum is sister to Araujia-Philbertia,

similar to the result of Rapini et al. (2006). However, in earlier studies (with less data)

a close relationship between Philbertia and Blepharodon (Liede and Taüber, 2000) or

Philbertia and Funastrum (Rapini et al., 2003) was observed. The genus Philibertia

was previously been included in Metastelmatinae but Goyder (2004) recognizes its

relationship, on the basis of morphological features, to members of the Oxypetalinae.

Metastelmatinae are broadly circumscribed in trnL-F analyses and receive strong

support in Bayesian tree (Figure 3.3). Ditassa is still recovered here polyphyletic as

observed by Rapini et al. (2006). As most of the Ditassa species are transferred in

genus Minaria, which is monophyletic in this study (Figure 3.3). Some genera are

found to be non-monophyletic (like Blepharodon and Ditassa in figures 3.2 and 3.3)

and promoting generic realignment in New World Asclepiadeae.

4.3 Secamonoideae

Subfamily Secamonoideae comprisesof eight genera (Calyptranthera, Genianthus,

Goniostemma, Pervillaea, Secamone, Secamonopsis,Toxocarpus andTrichosandra)

and is placed near Asclepiadoideae and Periplocoideae (Klackenberg, 1992a,

Chapter 4

92

b;Endress and Bruyns, 2000; Venter and Verhoeven, 2001; Ionta and Judd, 2007;

Lahaye et al., 2007).To date, cladistic analyses based on molecular data have all

agreed that Secamonoideae are sister to Asclepiadoideae(Sennblad and Bremer,

1996,2000, 2002;Civeyrel et al., 1998; Civeyrel and Rowe, 2001; Fishbein, 2001;

Potgieter and Albert, 2001; Lahaye et al., 2005, 2007; Livshultz et al., 2007). In our

study, this clade (Secamonoideae-Asclepiadoideae) receives strong support in both

Bayesian and parsimony analyses. Although not broadly sampled here, the included

taxa confirm monophyly of Secamonoideae with high support. Secamone is not

recovered in figures 3.8 & 3.9 as monophyletic, which is congruent with the results of

Lahaye et al. (2007).

4.4 Periplocoideae

In combined trnL-F and PHYA analyses (Bayesian and MP), the position of

Periplocoideae in Apocynoideae differs from recent analyses of Livshultz (2010).

However, nested position of Periplocoideae in Apocynoideae has been observed in

other previous studies (Sennbladand Bremer, 2000; Potgieter and Albert, 2001;

Livshultz et al., 2007; Livshultz, 2010). Periplocoideae were recognized until the last

decades of the 20th century as members of Asclepiadaceae (Schlechter, 1914; Kunze,

1990, 1993; Venter et al., 1990; Dave and Kuriachen, 1991; Liede and Kunze, 1993;

Nilsson et al., 1993; Swarupanandan et al., 1996). On the basis of floral morphology,

the subfamily is regarded as an intermediate stage in a transition series between

characters typical of Apocynoideae and those of milkweeds (Demeter,1922; Safwat,

1962; Cronquist, 1981; Rosatti, 1989;Endress, 1994, 2001, 2004; Endress and Bruyns,

2000;Wyatt et al., 2000). Apocynum has pollen in tetrads with simple translators,

which is frequently considered to be the first stage in this series (Demeter, 1922;

Safwat, 1962; Nilsson et al., 1993 and also cited by Livshultz et al., 2007). This is

followed by pollen in tetrads with spoon-shaped translators in some Periplocoideae

and then further aggregation leading to a pollinial stage in Periplocoideae (Nilsson et

al., 1993; Verhoeven and Venter, 1998; Livshultz et al., 2007). Therefore,

Periplocoideae as sister to the milkweeds is a common concept in the literature, but

results of phylogenetic analyses have shown that Periplocoideae are more closely

related to Apocynaceae sensu stricto; instead, Baisseeae are the sister of the

milkweeds (Kunze, 1996; Judd et al., 1994; Struwe et al., 1994; Sennblad andBremer,

Chapter 4

93

1996; Endress, 1997; Sennblad, 1997; Potgieter and Albert, 2001; Sennblad and

Bremer, 2002; Livshultz et al., 2007).

In present study, Periplocoideae are well-supported as observed in Livshultz et al.

(2007) and Livshultz (2010). The grooved translator clade described by Ionta and

Judd (2007) is also well-supported here (Figures3.8 & 3.9). These data show

Periploca (the type genus of subfamily Periplocoideae) is sister to the rest of the

subfamily, which can be contrasted with the findings of Ionta and Judd (2007), in

which Phyllanthera is sister to the rest of Periplocoideae. Note that Phyllanthera is

sister to Petopentia with this data.

Periplocoideae is one of the unique subfamily among subfamilies of Apocynaceae,

having taxa with or without pollinia. In the present study Finlaysonia, Gymnanthera,

Hemidesmus are Asian pollinial Periplocoids and Schlechterella is African pollinial

genus form clades independent of pollinial origin. So these results are corresponding

to Venter and Verhoeven (1997, 2001) findings that pollinia in Periplocoideae

evolved polyphyletically and independently.

4.5 Apocynoideae

In recent classification by Endress et al. (2007a), eight tribes were recognised in the

subfamily: Apocyneae, Baisseeae, Echiteae, Malouetieae, Mesechiteae, Nerieae,

Odontadenieae and Wrightieae. Subfamily is non-monophyletic as observed in

various molecular based approaches (Potgieter and Albert, 2001; Rapini et al., 2003;

Rapini et al., 2006; Livshultz et al., 2007; Simões et al., 2007; Livshultz, 2010).

Apocynoideae is discussed (Table 4.2) in comparison to Endress and Bruyns (2000)

and Livshultz et al. (2007).

4.5.1 APSA clade

In the present study, APSA clade is highly supportedin phylogenetic trees (Figures

3.2, 3.3, 3.10 & 3.11) based on plastids markers (trnL-F and atpB) in comparison to

PHYA

Chapter 4

94

Table 4.2Phylogenetic position of taxa in Apocynoideae, in comparison with Endress and Bruyns (2000) classification and Livshultz et al. (2007) study.

Genera Distribution Endress and Bruyns (2000) Livshultz et al. (2007) Present study

Adenium Old World Wrightieae Nerium clade Nerieae Aganosma Old World Apocyneae Apocyneae Apocyneae Angadenia New World Echiteae Echiteae Echiteae Anodendron Old World Apocyneae Apocyneae Apocyneae Apocynum Old World Apocyneae Apocyneae Apocyneae Artia New World Echiteae Echiteae Echiteae Baissea Old World Apocyneae Baisseeae Baisseeae Beaumontia Old World Apocyneae Apocyneae Apocyneae Chonemorpha Old World Apocyneae Apocyneae Apocyneae Cleghornia Old World Apocyneae Apocyneae Apocyneae Cycladenia New World Echiteae New World clade Odontadenieae Dewevrella Old World Apocyneae Baisseeae clade Baisseeae clade Echites New World Echiteae Echiteae Echiteae Elytropus New World Apocyneae New World clade Odontadenieae Epigynum Old World Apocyneae Apocyneae Apocyneae Fernaldia New World Echiteae *** Echiteae Forsteronia New World Apocyneae Mesechiteae Mesechiteae Ichnocarpus Old World Apocyneae Apocyneae Apocyneae Kibatalia Old World Malouetiea *** Malouetiea Laubertia New World Echiteae Echiteae Echiteae Mandevilla New World Mesechiteae Mesechiteae Mesechiteae Motandra Old World Apocyneae Baisseeae Baisseeae

Chapter 4

95

Nerium Old World Wrightieae Nerium clade Nerieae Odontadenia New World Apocyneae New World clade Odontadenieae Oncinotis Old World Apocyneae Baisseeae Baisseeae Pachypodium Old World Malouetiea Malouetiea Malouetiea Papuechites Old World Apocyneae Apocyneae Apocyneae Parameria Old World Apocyneae Apocyneae Apocyneae Parsonsia New World Echiteae Echiteae Echiteae Peltastes New World Echiteae Echiteae Echiteae Pentalinon New World Echiteae Echiteae Echiteae Pinochia New World *** Odontadenieae Odontadenieae Pleioceras Old World Wrightieae Wrightieae Wrightieae Prestonia New World Echiteae Echiteae Echiteae Rhabdadenia New World Echiteae Unplaced in APSA Unplaced in APSA Rhodocalyx New World *** Echiteae Echiteae Secondatia New World Mesechiteae New World clade Odontadenieae Sindechites Old World Apocyneae Apocyneae Apocyneae Stipecoma New World Echiteae Odontadenieae Echiteae Temnadenia New World Echiteae Echiteae Echiteae Thyrsanthella New World *** Odontadenieae Odontadenieae Trachelospermum Old World Apocyneae *** Apocyneae Urceola Old World Apocyneae Apocyneae Apocyneae Vallaris Old World Apocyneae Apocyneae Apocyneae *** Taxa not present in the study.

Chapter 4

96

analyses. So, in the combined analyses the well-supported clade (Figures 3.8 & 3.9)

receives signals from trnL-F region. Wrighteae occupies the basal position of the

APSA clade as was the case in other phylogenetic analyses of Apocynaceae

(Sennblad and Bremer, 1996, 2002; Sennblad et al., 1998; Potgieter and Albert, 2001;

Livshultz et al., 2007; Livshultz, 2010). Synapomorphies such as gynostegium,

lignified anthers, porate pollen and comose seed have been identified in previous

studies for this clade (Judd et al., 1994; Sennblad and Bremer, 1996; Potgieter and

Albert, 2001; Livshultz et al., 2007). Monophyly of APSA receives high support in

both Bayesian and MP trees as observed in analyses of Livshultz et al. (2007) and

Livshultz (2010). Wrighteae is different from rest of APSA (Except Parameria and

Toxocarpus) due to presence sinistrorse aestivationof corollas (Livshultz et al., 2007).

Another variable character pointed by Livshultz et al. (2007) is micropylar coma, the

most frequent state in APSA except Wrighteae and Malouetia, Kibatalia and

Funtumia.

4.5.2 Nerieae

The tribe is represented here by two genera, Nerium and Adenium and is resolved

monophyletic with strong support in both trnL-F and combined Bayesian analyses

(Figures 3.3& 3.9). However, this clade receives less support in strict consensus trees

(Figures 3.2& 3.8). In previous phylogenetic studies (Sennblad et al., 1998; Potgieter

and Albert, 2001; Sennblad and Bremer, 2002) with more number of taxa the

monophyly of tribe got weak support. Livshultz et al. (2007) identified diagnostic

characters for Nerieae: dextrorsely contorted corolla, micropylar coma and absence of

nectary around the ovary. The closer relationship of Nerium and Adenium is also

based on similar floral morphology, predominantly their long pubescent anther

connectives (Pagen, 1987).

4.5.3 Malouetieae

A strongly supported clade termed as the ‘crown clade’ (including subfamilies

Asclepiadoideae, Secamonoideae, Periplocoideae and tribes Echiteae, Mesechiteae,

Odontadenieae and Apocyneae of Apocynoideae) by Livshultz et al. (2007) received

less support (Figures 3.8& 3.9) as compared to Livshultz et al. (2007) and Livshultz

(2010). However, the moderately supported sister group relationship of Malouetieae

Chapter 4

97

with the crown clade, as illustrated in recent studies (Livshultz et al. 2007; Livshultz

2010), is also confirmed in our analyses.

The presence of a calcium oxalate pocket in anther stomium and absence of vertical

ridges on the style head are considered synapomorphies for this tribe (Sennblad et al.,

1998). Livshultz et al. (2007) identified characters (such as presence of nectary and

self supporting growth form) in this tribe that are similar to the taxa of the crown

clade. Despite their differing geographic distributions, both genera of Malouetieae,

Kibatalia (New World) and Pachypodium (Old World), form a strongly supported

clade. Pachypodium has traditionally been included in Echiteae (Pichon, 1950b), but

Endress and Bruyns (2000) transferred this genus into Malouetieae, and this change

was supported by Livshultz et al. (2007) and our study.

4.5.4 Odontadenieae

One of the New World tribe of Apocynoideae is not well-supported here (Figures

3.8&3.9) as found in Livshultz et al. (2007) and Livshultz (2010). Genera of the tribe

were previously placed in Apocyneae, Mesechiteae (Pichon 1950b) and Echiteae

(Leeuwenberg, 1994). In the most recent classification (Endress et al., 2007a)

Odontadenieae are given a separate tribal position in Apocynoideae. In our study

Odontadenieae do not form clade with either of New World tribes (Echiteae and

Mesechiteae) of Apocynoideae contradicting Livshultz et al. (2007) where New

World tribes form a separate clade.

4.5.5 Mesechiteae

The tribe is represented by two genera (Forsteronia and Mandevilla) is strongly

supported in Bayesian tree (Figure 3.9). Leeuwenberg (1994) placed Forsteroniain

Apocyneae, which was later supported by elaborate study of Endress and Bruyns

(2000). The genus Forsteronia was examined in detailed by Simões et al. (2004) on

the basis of floral morphological and molecular characters. This study illustrated that

Forsteronia is more closely related to genera of Mesechiteae rather Apocyneae and

this was also confirmed by Livshultz et al. (2007), Livshultz (2010) and in the present

study.

Chapter 4

98

4.5.6 Echiteae

A well-supported basal subclade Angadenia, Laubertia and Pentalinon (Figure 3.9)

shows a weak relationship to Mesechiteae while rest of Echiteae form a well

supported clade. Inter-generic relationship is well-resolved here but monophyly of

Echiteae is suspected due to odd position of Rhabdadenia. Results are much

congruent to recent phylogenetic studies by Livshultz et al. (2007) and Livshultz

(2010).

New World Apocynoideae is not resolved in a clade, result here congruent to previous

findings(Sennblad et al., 1998; Potgieter and Albert, 2001; Sennblad and Bremer,

2002). But in the studies of Simões et al. (2004) and Livshultzet al. (2007) New

World Apocynoideae form a weakly supported clade.

4.5.7 Apocyneae

Old World Apocyneae form a well-supported clade with the New World tribes

(Odontadenieae, Echiteae and Mesechiteae) of Apocynoideae in both Bayesian and

parsimony analyses of combined trnL-F and PHYA sequences. In a recent

phylogenetic analysis (Livshultz, 2010), this clade received less support: BP 68

compared to BP 100/ PP 1.0 here (Figures 3.8& 3.9). The monophyly of Apocyneae is

not supported by the MP analysis as compared to 100 BP in Livshultz (2010), but in

the Bayesian tree it receives low support (Figures 3.8&3.9).

The topology in Apocyneae is somewhat inconsistent with that in Livshultz (2010),

only by adding Trachelospermum; a basal clade (PP 0.72) emerges comprising of

Beaumontia, Trachelospermum, Vallaris, Sindechites,Papuechites and Anodendron.

In previous phylogenetic studies (Potgieter and Albert, 2001; Sennblad and Bremer,

2002; Simõeset al., 2004) Beaumontia andTrachelospermum form a clade with

Chonemorpha, but here Chonemorpha is sister to Urceola (Figures. 3.8 & 3.9).

4.5.8 Baisseeae

Livshultz (2010) defined a new tribe Baisseeae comprising three African genera:

Baissea, Oncinotis and Motandra and stated that the tribe is sister to the milkweeds

rather than subfamily Periplocoideae. This relationship was originally suggested by

Chapter 4

99

Macfarlane (1933) on the basis of their geography. In previous phylogenetic analyses,

this relationship has frequently been noted, but with weak support (Sennblad et al.,

1998; Potgieter and Albert, 2001; Sennblad and Bremer, 2002) and more recently

with stronger support (Lahaye et al., 2007; Livshultz et al., 2007; Simões et al.,

2007). In our analysis this sister relationship of Baisseeae receives strong support in

the Bayesian analysis (Figure 3.9) and comparatively weak bootstrap support in MP

analysis (Figure 3.8).

Formerly, Pichon (1950b) placed these three genera in subtribe Baisseinae of

Mesechiteae sensu Pichon based on having glabrous facets retinacles and presences of

colleters on the leaves. Later, Nilsson et al. (1993) concluded that the retinacle in

Baissea is formed by agglutination of trichomes and this is also confirmed by

Livshultz et al. (2007). Baisseeae’s morphological characters such as short stamen-

corolla tube, half inferior ovaries and collarless style-head have frequently been

observed in traditional Asclepiadaceae and Asian taxa of Apocyneae (Leeuwenberg,

1994; Endress and Bruyns, 2000; Livshultz et al., 2007).

In the classification of Endress and Bruyns (2000), Baissea and Motandra are

grouped with Prestonia and Cycladenia on the basis of corona characters (particularly

finger-like projections above the stamens). In molecular phylogenetic analyses

Prestonia forms a group with the ‘core Echiteae’, and Baissea and Motandra form a

separate clade (Baisseeae; Livshultz, 2010). Recently, Livshultz et al. (2007)

identified these genera as having colleters on the adaxial surface of their petiole

(rarely extending onto the base). However, this character is shared by Farquharia

(Malouetieae), Isonema and Nerium (Nerieae). Therefore, morphologically, the

African clade still needs additional characters to justify its separate tribal identity as

the sister group of the milkweeds.

Monotypic genus Dewevrella formerly included in Apocyneae (Endress and Bruyns,

2000; Endress et al., 2007a). While in the study of Livshultz et al. (2007) the genus

appears with member of Baisseeae and receives same position in the present analyses.

4.6 Rauvolfioideae

Chapter 4

100

The structure of phylogenetic trees based on combined molecular data (Figures 3.8,

3.9, 3.10&3.11) is broadly congruent with previously published data of Apocynaceae

(e.g., Civeyrel et al., 1998; Potgieter and Albert, 2001; Sennblad and Bremer, 2002;

Simões et al., 2004). The basal subfamily is forming a grade that is paraphyletic to the

rest of Apocynaceae. Rauvolfioideae is not widely studied for phylogenetic studies,

however recently Simõeset al. (2004, 2007) paid attention toward phylogeny of

subfamily by using sequences from regions of plastid genome. In addition to trnL-F

alone and combined analyses (trnL-F and PHYA), relationships in Rauvolfioideae are

also discussed on the basis of trees constructed by using sequences of trnL-F, PHYA

and atpB gene promoter in combined dataset (Table 4.3).

4.6.1 Alstonieae and Aspidospermeae

In trnL-F study, two clades form the earliest diverging lineages and represent the

separation of the New World tribe Aspidospermeae and Old World tribe Alstonieae,

which corresponds with the findings of Potgieter and Albert (2001) and Simões et al.

(2007). Aspidospermeae (comprising just Aspidosperma and Vallesia) and Alstonieae

(Alstonia alone in our survey) form successive sister groups of the rest of the family.

Similar results were found in the studies of Endress and Bruyns (2000), Sennblad and

Bremer (2002), and recent studies based on molecular and morphological data by

Simões et al. (2007), which were incorporated into the revised classification of

Endress et al. (2007a) (Figures 3.2& 3.3).

4.6.2 Alyxieae

The positions of tribe Alyxieaeis unresolved in both our MP and Bayesian trees of

trnL-F analyses (Figures 3.2& 3.3). Chilocarpus and Condylocarpon of Alyxieae

appeared in the Amsonia clade of Simõeset al. (2007) with weak support. The genus

Pteralyxia appeared in the Alyxieae clade, which differs from the results of Potgieter

and Albert (2001), in which these taxa appeared in the Plumerieae clade, but is

consistent with the results of Livshultz et al. (2007), Endress et al. (2007b) and the

revised classification of Endress et al. (2007a).

4.6.3 Vinceae

Chapter 4

101

Table 4.3 Comparative overview of phylogenetic positionsof Rauvolfioideae’s taxa within present phylogenetic analyses and previousclassifications (Endress and Bruyns, 2000; Endress et al., 2007a).

Genera Distribution Endress and Bruyns (2000) Endress et al. (2007a) This Study

Acokanthera Old World Carisseae Carisseae Carisseae Allamanda New World Plumerieae Plumerieae Plumerieae Alstonia Old World Alstonieae Alstonieae Alstonieae Alyxia Old World Alyxieae Alyxieae Alyxieae clade Amsonia Old World Vinceae Amsonia clade Amsonia clade Anechites New World Plumerieae Plumerieae Plumerieae Aspidosperma New World Alstonieae Aspidospermeae Aspidospermeae Carissa Old World Carisseae Carisseae Carisseae Catharanthus Old World Vinceae Vinceae Vinceae Chilocarpus Old World Alyxieae Alyxieae Unresolved Alyxieae Condylocarpon Old World Alyxieae Alyxieae Unresolved Alyxieae Craspidospermum Old World Melodineae Melodineae Melodineae Gonioma Old World Melodineae Hunterieae Hunterieae Kopsia Old World Vinceae Vinceae Vinceae Lepiniopsis Old World Alyxieae Alyxieae Alyxieae clade Molongum New World Tabernaemontaneae Tabernaemontaneae Tabernaemontaneae Ochrosia Old World Vinceae Vinceae Vinceae Petchia Old World Vinceae Vinceae Vinceae Plectaneia Old World Alyxieae Alyxieae Alyxieae clade Plumeria New World Plumerieae Plumerieae Plumerieae Pteralyxia Old World Alyxieae Alyxieae Alyxieae clad Rauvolfia Old World Vinceae Vinceae Vinceae Rhazya Old World *** *** Unplaced Vinceae

Chapter 4

102

Skytanthus New World Plumerieae Plumerieae Plumerieae Tabernaemontana New World Tabernaemontaneae Tabernaemontaneae Tabernaemontaneae Thevetia New World Plumerieae Plumerieae Plumerieae Vallesia New World Alstonieae Aspidospermeae Aspidospermeae Vinca Old World Vinceae Vinceae Vinceae

***Taxa not present in the study

Chapter 4

103

Vinceae is not resolved as monophyletic group incongruent to Simõeset al. (2007).

The separate position of Amsonia and Rhazya from the rest of Vinceae is in agreement

with earlier DNA based studies (Potgieter and Albert, 2001; Endress et al., 2007b;

Simões et al., 2007). A floral study conducted by Endress et al. (2007b) on Amsonia

and Rhazya suggested that these two genera are more similar to Catharanthus and

Vinca, but results place the former pair with Hunterieae. Endress and Bruyns (2000)

treated Rhazya as a synonym of Amsonia on the basis of similar fruits, seeds and

floral morphology (Pichon, 1949; Nilsson, 1986), and this relationship is also strongly

supported in the present study. However, Endress et al. (2007a) segregated both

genera from the Vinceae and placed them as incertaesedis within Rauvolfioideae. The

Vinceae clade comprises Rauvolfia, Catharanthus, Vinca, Ochrosia (including the

species formerly in Neisosperma), Petchia and Kopsia. Position of Asian genus

Kopsia in Vinceae (Simões et al., 2007) is not well-supported here. The genus shared

a number of morphological characters to Vinceae such as a pair of well-developed

nectary lobes and style-head has a short membranous basal collar, otherwise these

characters are relatively absent in the rest of Rauvolfioideae (Middleton, 2004a, b).

Chemotaxonomic (Kisakürek et al., 1983; Homberger and Hesse, 1984) and

morphological studies prompted Endress and Bruyns (2000) to include the genus in

Vinceae, however this inclusion was later supported by Simõeset al. (2007) and

present study.

4.6.4 Plumerieae

As in Simões et al., (2007), monophyly of Plumerieae did not receive strong support

in our analyses. In trnL-F analysis (Figure 3.3) Thevetia is paraphyletic while in

combined analyses it appears with Skytanthus corresponding to results of Simõeset al.

(2007).

4.6.5 Tabernaemontaneae

Tabernaemontaneae are not strongly supported in previous studies (Endress and

Bruyns, 2000; Sennblad and Bremer, 2002; Potgieter and Albert, 2001) however

received strong support in recent studies by Simões et al. (2007, 2010). However the

inclusion of Molongum in Tabernaemontaneae (Sennblad and Bremer, 2002) receives

strong support in both MP (Figure 3.2) and Baysian analyses (Figure 3.3). The

Chapter 4

104

detailed molecular and morphological study of Tabernaemontaneae by Simões et al.

(2010) using three plastid loci (but not trnL-F) confirmed this. In all analyses (Figures

3.2, 3.3, 3.8, 3.9, 3.10 & 3.11), Tabernaemontaneae shows relationship with members

of Vinceae.

4.6.6 Melodineae

The presence of Craspidospermum in tribe Melodineae (Endress and Bruyns, 2000) is

well-supported in previous analyses (Sennblad and Bremer, 2002; Potgieter and

Albert, 2001). Here the genus receives low support (Figure 3.3) as sister to the major

clade including that of Amsonia, Tabernaemontana and Vinceae. In

Craspidospermum, porate pollen is shed as pantoporate tetrads (Lienau et al., 1986).

This syndrome is unknown in Rauvolfioideae but resembles pollen of some

Periplocoideae (Nilsson et al., 1993).

4.6.7 Carisseae

Tribe Carisseae, comprising Carissaand Acokanthera, emerge as a sister clade

(Figures 3.2, 3.3, 3.8 &3.9) of Apocynoideae, Periplocoideae, Secamonoideae and

Asclepiadoideae (the APSA clade), in agreement with the results of Civeyrel et al.

(1998), Potgieter and Albert (2001), Livshultz et al. (2007) and Simões et al. (2007).

4.7 Phytochrome A

In plants low-copy number nuclear genes are a rich source of evolutionary

information. These genes have great potential to increase the strength of phylogenetic

reconstruction at all taxonomic levels (Sang, 2002). In a broad survey it is estimated

that substitution rate of nuclear genes is five times more than those of chloroplast

genes and twenty times greater than mitochondrial genes (Wolfe et al., 1987; Gaut,

1998). After Livshultz (2010) study, first exon of PHYA gene is sequenced here from

different taxa of Apocynaceae and phylogenetic trees have been constructed. Values

such as BP and PP in parsimony and Bayesian trees respectively, to support the

relationship are much higher than plastid markers (Figures 3.2, 3.3, 3.10 & 3.11). But

to amplify low copy number genes such as PHYA by using DNA extracted from

herbarium material is relatively difficult, also illustrated by Small et al. (2004).

Chapter 4

105

4.8 Conclusion

In the present study, representative of all major groups in Apocynaceae sensulato

were included.Tribal delimitation of subfamily Rauvolfioideae in both trnL-F separate

and combined (trnL-F, PHYA and atpB) analyses is not well-supported. The present

analyses concluded that Rauvolfioideae, Apocynoideae and the traditional

Asclepiadaceae are all non-monophyletic groups and that, in contrast, the APSA clade

is well-supported. The subfamily Periplocoideae is nested within Apocynoideae. So,

Periplocoideae should be placed in Apocynoideae rather than thought of as the sister

group of the milkweeds. The sister group relationship between Baisseeae and the

milkweeds is also confirmed by present analyses. The ACT clade is not monophyletic,

whereas the monophyly of MOG clade receives high support. Old World

Cynanchineae forms a well-supported group within the New World MOG clade in

combined analyses. In separate trnL-F analyses, Cynanchineae in ACT group are not

monophyletic only the Malagasy Cynanchum group appear as a monophyletic clade

with good support, whereas American generaform a separate clade, and the type

species (C. acutum) appears as incertae sedis. Thissuggests that the Cynanchum

requires further phylogenetic and taxonomic studies acrossits range.

Presently confidence values for clades obtained in combined analyses are

comparatively better than in studies where plastid regions alone were sequenced.

Clade structure within the Apocynaceae is now generally well understood. The

principal challenges now lie in identifying characters that can reflect and articulate

these clades in a formal classification. There is need to sequence greater numbers, of

taxa of Apocynaceae to further refine the relationships in the family. To have high-

quality DNA from herbarium material, new optimised DNA extraction protocols are

also needed. It is more technically difficult to use DNA from herbarium material to

amplify low-copy nuclear genes such as PHYA.

106

Conclusion

The present study aims to investigate the phylogenetic relationships among different

groups (such as subfamilies, tribes and subtribes) of family Apocynaceae. To achieve

the purpose of study, different regions of plastid (trnL-F intron-spacer region and

atpB promoter) and nuclear (PHYA) genomes were sequenced from different taxa

representing major groups in Apocynaceae. For DNA isolation some of the species

were collected from tropical and subtropical regions of Pakistan, while rest of the taxa

were obtained by utilizing different resources (herbarium and living collection) of The

Royal Botanic Gardens Kew, London. The inclusion of specimens from different

geographic areas was also a high priority. To elaborate the number of taxa in

phylogenetic analysis, sequences of various taxa of the family were also retrieved

from the GenBank. Phylogenetic trees were constructed by using two different

programs: PAUP was used for maximum parsimony (MP) analysis and Mr. Bayes

was preferred for Bayesian analysis.

In trnL-F analyses, 177 taxa of Apocynaceae were included as an ingroup. Major

lineages of the family in Bayesian trees receive strong supports as compared to

parsimony analysis with exception of subfamily Rauvolfioideae and Apocynoideae.

Overall resolution within Rauvolfioideae is low in both MP and Bayesian analyses.

While the clade comprised of Apocynoideae, Periplocoideae, Secamonoideae and

Asclepiadoideae (APSA clade) is strongly supported in both parsimony and Bayesian

trees. Apocynoideae is paraphyletic with respect to nested position of Periplocoideae.

In Asclepiadoideae, a clade comprising taxa from Ceropegieae and Marsdenieae

receives good support in Bayesian analysis and confirming the sister relationship of

these two tribes. The monophyly of Asclepiadeae and subtribal relationships are well-

supported in the Bayesian tree. New Wold’s Metastelmatinae, Oxypetalinae and

Gonolobinae (MOG) and Old World’s Asclepiadineae, Cynanchineae and

Tylophorinae (ACT) clades also appear with high posterior probability (PP) value in

Bayesian analysis. The Malagasy succulent group of Cynanchineae forms a separate

clade from rest of the Cynanchineae. Cynanchineae is not recovered monophyletic

since other ‘non Malagasy’ species appear in different tribes in the ACT clade with

weak support. Within MOG clade, Metastelmatinae is monophyletic and Gonolobinae

are embedded in Oxypetalinae.

107

The phylogenetic analyses based on PHYA region, the dataset was comprised of only

112 taxa relatively less number as compared to trnL-F analyses. The plastid marker

trnL-F has widely been used for phylogeny of Apocynaceae, so large number of trnL-

F sequences of Apocynaceae’s taxa is present in the GenBank. The utility of nuclear

regions for phylogeny of Apocynaceae is comparatively low, Livshultz (2010) first

time used PHYA for estimating relationships in Apocynoideae. In the present study

the PHYA marker was employed on taxa of whole family. In both parsimony and

Bayesian analyses based on PHYA, support is weak at some places like APSA clade is

not strongly supported here. Overall resolution produced by PHYA in both Bayesian

and parsimony trees is comparatively higher than trnL-F analyses. For better

resolution of groups, combined (trnL-F and PHYA datasets) phylogenetic trees were

constructed.

In combined analyses, number of taxa was same as in PHYA analyses but resolution

was increased than previous analyses, while the situation in Rauvolfioideae was not

improved. Basal tribes of Apocynoideae such as Nerieae, Malouetieae and subfamily

Periplocoideae are making Apocynoideae paraphyletic. New World (Odontadineae,

Mesechiteae and Echiteae) and Old World Apocyneae form a well-supported clade in

both analyses. Instead Periplocoideae, the Old World tribe Baisseeae of

Apocynoideae appears as sister group of milkweeds. Sister group relationship of

Ceropegieae and Marsdenieae also receive good support in Bayesian analysis. In

Asclepiadeae, ACT is not recovered Monophyletic due to the position of

Cynanchineae (comprised of Old World Cynanchum) with subtribes of MOG clade.

In order to improve resolution in Rauvolfioideae, additionally atpB promoter region

was sequenced from the members of the subfamily. The phylogenetic trees (Bayesian

and parsimony) were constructed using trnL-F, PHYA and atpB sequences. But

overall support in both analyses to resolve groups in Rauvolfioideae was recovered

poor.

From the present study, it is concluded that there are still some gaps which need more

attention by adding more number of taxa and exploiting more loci of plastid and

nuclear genomes. It is also confirmed that resolution power can be increased by

simultaneous analyses of combined datasets.

108

Major achievements so far from the study were a paper entitled ‘‘The taxonomy and

systematics of Apocynaceae: where we stand in 2012” which is accepted with minor

revision (Botanical Journal of Linnean Society). While three research papers have

been submitted in different international journals: ‘‘Phylogenetic relationships in

Apocynaceae based on plastid trnL-F intron/spacer region sequences” (Turkish

Journal of Botany), “Identification of putative cis-acting regulatory elements in atpB

gene promoter and phylogenetic relationship in Rauvolfioideae” (Caryologia) and

“Utilization of low-copy nuclear gene in phylogeny of Apocynaceae sensu lato”

(Taxon).

Chapter 5

106

References

Alan CA, Wilkes B. 1964. Studies on the suppression of immune responses by the

periwinkle alkaloids Vincristine and Vinblastine. Journal of Clinical

Investigation 43: 2394–2403.

Alvarez I, Wendel JF. 2003. Ribosomal ITS sequences and plant phylogenetic

inference. Molecular Phylogenetics and Evolution 29: 417–434.

APG I. 1998. An ordinal classification of the families of flowering plants. Annals of

the Missouri Botanical Garden 85: 531–553.

APG II. 2003. An update of the Angiosperm Phylogeny Group classification for the

orders and families of flowering plants: APG II. Botanical Journal of the

Linnean Society 141: 399–436.

APG III. 2009. An update of the Angiosperm Phylogeny Group classification for the

orders and families of flowering plants: APG III. Botanical Journal of the

Linnean Society 161: 105–121.

Bennett JR, Mathews S. 2006. Phylogeny of the parasitic plant family

Orobanchaceae inferred from phytochrome A. American Journal of Botany 93:

1039–1051.

Bentham G. 1876. Apocynaceae and Asclepiadaceae. In: Bentham G, Hooker JD,

eds. Genera plantarum. London: Lovell Reeve, 681–785.

Brown R. 1810. Prodromus Florae Novae Hollandiae et Insulae van Diemen.

London: Richard Taylor & Son.

Brown R. 1811. On the Asclepiadeae, a natural order of plants separated from the

Apocineae of Jussieu. Memoirs of the Wernerian Natural History Society 1:

12–78.

Brown R. 1833. On the organs and mode of fecundation in Orchideae and

Asclepiadeae. Transactions of the Linnean Society of London 16: 685–746.

Chapter 5

107

Bruyns PV, Forster PI. 1991. Recircumscription of the Stapelieae (Asclepiadaceae).

Taxon 40: 381–391.

Bruyns PV. 1999. The systematic position of Eustegia. Botanische Jahrbücher für

Systematik, Pflanzengeshichte und Pflanzengeographie 121: 19–44.

Bruyns PV. 2004. New species in Echidnopsis and Secamone and new records of

Ceropegia (Apocynaceae) from Socotra. Edinburgh Journal of Botany 61: 7–

19.

Candonelle AP De. 1844. Prodromus systematis naturalis regni vegetabilis; Tomo

VIII. Paris, 26–32.

Chase MW, Hillis HG. 1991. Silica gel: an ideal material for field preservation of

leaf samples for DNA studies. Taxon 40: 215–220.

Chin Y-W, Jones WP, Waybright TJ, McCloud TG, Rasoanaivo P, Cragg

GM, Cassady JM, Kinghorn AD. 2006. Tropane aromatic ester alkaloids

obtained from a large-scale recollection of Erythroxylum pervillei stem bark

collected in Madagascar. Journal of Natural Products 69: 414–417.

Civeyrel L, Klackenberg J. 1996. A second species of the Malagasy genus

Secamonopsis (Asclepiadaceae). Novon 6: 144–146.

Civeyrel L, Rowe N. 2001. Phylogenetic relationships of Secamonoideae based on

the plastid gene matK, morphology, and biomechanics. Annals of the Missouri

Botanical Garden 88: 583–602.

Civeyrel L, Thomas Le A, Ferguson K, Chase MW. 1998. Critical reexamination

of palynological characters used to delimit Asclepiadaceae in comparison to

the molecular phylogeny obtained from plastid matK sequences. Molecular

Phylogenetics and Evolution 9: 517–527.

Civeyrel L. 1994. Variation et evolution des types polliniques du genre Secamone

(Secamonoideae, Asclepiadaceae). Comptes Rendus de l Academie des

Sciences Paris 317: 1159–1165.

Chapter 5

108

Civeyrel L. 1995. Pollen morphology and ultrastructure of the genus Secamone in

Africa. In: Le Thomas A, Roche E, eds. 2d Symposium on African Palynology,

Tervuren (Belgium). Orléans: CIFEG, 207–215.

Civeyrel L. 1996. Phylogenie des Asclepiadaceae: Approche palynologique et

moleculaire. Thesis, University of Montpellier.

Coppen J-J W, Cobb AL. 1983. The occurrence of iridoids in Plumeria and

Allamanda. Phytochemistry 22: 125–128.

Court GD. 1987. Fockea Endl. – an African genus. Asklepios 40: 69–74.

Cronquist A. 1981. An Integrated System of Classification of Flowering Plants. New

York: Columbia University Press.

Dan Dicko-Zafimahova L. 1978. Ultrastructure of Pollinia Walls in Calotropis

procera Asclepiadaceae. Adansonia 17: 455–464.

Dannenbaum C, Schill R. 1991. Die Entwicklung der Pollentetraden und Pollinien

bei den Asclepiadaceae. Bibliotheca Botanica 141: 1–138.

Dave Y, Kuriachen PM. 1991. Comparative anatomical characters of Periplocaceae

of follicles and their taxonomic significance. Feddes Repertorium 102: 63–68.

Decaisne, MJ. 1844. Asclepiadaceae. In: De Candolle AP, ed. Prodromus Systematis

Naturalis Regni Vegetabilis. Paris: Treuttel and Würtz, 490–684.

Deepak D, Srivastav S, Khare A. 1997. Pregnane glycosides. Progress in the

chemistry of organic natural products 71: 169–325.

Demeter K. 1922. Vergleichende Asclepiadeenstudien. Flora 115: 130–176.

Dey A, De JN. 2011. Ethnobotanical aspects of Rauvolfia serpentine (L.) Benth. Ex

Kurz. in India, Nepal and Bangladesh. Journal of Medicinal Plants and

Research 5: 144–150.

Chapter 5

109

Don G. 1838. A general history of the Dichlamydeous plants. London: JG Rivington

and F Rivington et al.

Doyle JJ, Doyle JL, Brown AHD, Pfeil BE. 2000. Confirmation of shared and

divergent genomes in the Glycine tabacina polyploid complex (Leguminosae)

using histone H3-D sequences. Systematic Botany 25: 437–448.

Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small quantities of

fresh leaf tissue. Phytochemical Bulletin 19: 11–15.

Endlicher SL. 1838. Genera P1antarum (Apocynaceae & Asclepiadaceae). Vienna:

F. Beck.

Endlicher SL. 1841. Enchiridion botanicum. Leipzig: Engelmann.

Endress M, Albert VA. 1995. A morphological cladistic study of Apocynaceae:

Trends in character evolution within a broadened familial circumscription.

American Journal of Botany 82: 127 (6, Abstracts).

Endress ME, Bruyns P. 2000. A revised classification of the Apocynaceae s.l.

Botanical Review (Lancaster) 66: 1–56.

Endress ME, Hesse M, Nilsson S, Guggisberg A, Zhu J-P. 1990. The systematic

position of the Holarrheninae (Apocynaceae). Plant Systematics and Evolution

171: 157–185.

Endress ME, Liede-Schumann S, Meve U. 2007a. Advances in Apocynaceae: the

enlightenment, an introduction. Annals of the Missouri Botanical Garden 94:

259–267.

Endress ME, Sennblad B, Nilsson S, Civeyrel L, Chase M, Huysmans S,

Grafstrom E, Bremer B. 1996. A phylogenetic analysis of Apocynaceae s.s.

and some related taxa in Gentianales: A multi-disciplinary approach. Opera

Botanica Belgica 7: 59–102.

Chapter 5

110

Endress ME, Stevens WD. 2001. The renaissance of the Apocynaceae sensu lato:

recent advances in systematics, phylogeny, and evolution: Introduction.

Annals of the Missouri Botanical Garden 88: 517–522.

Endress ME, Van der Ham RWJM, Nilsson S, Civeyrel L, Chase MW, Sennblad

B, Potgieter K, Joseph J, Powell M, Lorence D, Zimmerman Y-M, Albert

VA. 2007b. A phylogenetic analysis of Alyxieae (Apocynaceae) based on

rbcL, matK, trnL intron, trnL-F spacer sequences, and morphological

characters. Annals of the Missouri Botanical Garden 94: 1–35.

Endress ME. 1997. Key characters at the interface of the apocynacs and the

asclepiads. American Journal of Botany 84: 189–190 (6, Abstracts).

Endress ME. 2001. Apocynaceae and Asclepiadaceae: United they stand. Haseltonia

8: 2–9.

Endress ME. 2003. Apocynaceae and Asclepiadaceae: United they stand. Haseltonia

8: 1–9.

Endress ME. 2004. Apocynaceae: Brown and now. Telopea 10: 525–541.

Endress PK. 1994. Floral structure and evolution of primitive angiosperms: recent

advances. Plant Systematics and Evolution 192: 79–97.

Fallen ME. 1986. Floral structure in the Apocynaceae: Morphological, functional,

and evolutionary aspects. Botanische Jahrbücher für Systematik 106: 245–

286.

Fishbein M, Chuba D, Ellison C, Mason-Gamer RJ, Lynch SP. 2011.

Phylogenetic relationships of Asclepias (Apocynaceae) inferred from non-

coding chloroplast DNA sequences. Systematic Botany 36: 1008–1023.

Fishbein M. 2001. Evolutionary innovation and diversification in the flowers of

Asclepiadaceae. Annals of the Missouri Botanical Garden 88: 603–623.

Chapter 5

111

Forster PI, Harold K. 1989. Secamone R. Br. (Asclepiadaceae: Secamonoideae) in

Australia. Austrobaileya 3: 69–78.

Friedman F. 1990. Note sur la position systématique du genre Trichosandra Decne.

(Asclepiadaceae). Adansonia 12: 131–138.

Frye TC. 1901. Development of the pollen in some Asclepiadaceae. Botanical

Gazette 32: 325–330.

Galloway GL, Malmberg RL, Price RA. 1998. Phylogenetic utility of the nuclear

gene arginine decarboxylase: an example from Brassicaceae. Molecular

Biology and Evolution 15: 1312–1320.

Gaut BS. 1998. Molecular clocks and nucleotide substitution rates in higher plants.

Evolutionary Biology 30: 93–120.

Gentry AH. 1983. Alstonia (Apocynaceae): Another palaeotropical genus in Central

America. Annals of the Missouri Botanical Garden 70: 206–207.

Good R. 1947. The geography of the flowering plants. London: Longmans, Green

and Co.

Good R. 1952. An atlas of the Asclepiadaceae. New Phytologist 51: 198–209.

Goyder D. 2001. Asclepiadaceae or Apocynaceae? Asklepios 83: 13–16.

Goyder DJ, Nicholas A, Liede-Schumann S. 2007. Phylogenetic relationships in

subtribe Asclepiadinae (Apocynaceae: Asclepiadoideae). Annals of the

Missouri Botanical Garden 94: 423–434.

Goyder DJ. 1992. Secamone (Asclepiadaceae subfam. Secamonoideae) in Africa.

Kew Bulletin 47: 437–474.

Goyder DJ. 1999. The Asclepiadaceae – a figment of our imagination? In:

Timberlake J, Kativu S, eds. African Plants: Biodiversity, Taxonomy and

Uses. Kew: Royal Botanic Gardens, 309–317.

Chapter 5

112

Goyder DJ. 2004. An amplified concept of Philibertia Kunth (Apocynaceae:

Asclepiadoideae), with a synopsis of the genus. Kew Bulletin 59: 415–451.

Goyder DJ. 2006. An overview of asclepiad biogeography. In: Ghazanfar SA,

Beentje H, eds. Taxonomy and Ecology of African Plants and their

Conservation and Sustainable Use. London: Royal Botanic Gardens, Kew,

205–214.

Habibuddin M, Daghriri HA, Humaira T, Al-Qahtani MS, Fafzi AA. 2008.

Antidiabetic effect of alcoholic extract of Caralluma sinaica L. on

streptozotocin-induced diabetic rabbits. Journal of Ethnopharmacology 117:

215–220.

Hallier H. 1905. Provisional scheme of the natural (phylogenetic) system of

flowering plants. New Phytologist 4: 151–162.

Hechem V, Calviño CI, Ezcurra C. 2011. Molecular phylogeny of Diplolepis

(Apocynaceae-Asclepiadoideae) and allied genera, and taxonomic

implications. Taxon 60: 638–648.

Hennig W. 1950. Grundzuge einer Theorie der Phylogenetischen Systematik. Berlin:

Deutsche Zentralverlag.

Hennig W. 1966. Phylogenetic systematics. Urbana: University of Illinois Press.

Homberger K, Hesse M. 1984. Kopsirachin, ein ungewöhnliches alkaloid aus der

Apocynaceae Kopsia dasyrachis Ridl. Helvetica Chimica Acta 67: 237–248.

Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP, 2001. Bayesian inference of

phylogeny and its impact on evolutionary boilogy. Science 294: 2310–2314.

Huelsenbeck JP, Ronquist F. 2001. Mr. Bayes: Bayesian inference of phylogenetic

trees. Bioinformatics 17: 754–755.

Hutchinson J. 1973. The families of flowering plants. Oxford: Clarendon Press.

Chapter 5

113

Ionta GM, Judd WS. 2007. Phylogenetic relationships in Periplocoideae

(Apocynaceae s.l.) and insights into the origin of pollinia. Annals of the

Missouri Botanical Garden 94: 360–375.

Johnson LA, Soltis DE. 1998. Assessing congruence: Empirical examples from

molecular data. In: Soltis DE, Soltis PS, Doyle JJ, eds. Molecular systematics

of plants II: DNA sequencing. Boston: Kluwer Academic Publishers, 297–348.

Judd WS, Sanders RW, Donoghue MJ. 1994. Angiosperm family pairs:

Preliminary phylogenetic analyses. Harvard Paper of Botany 5: 1–51.

Jussieu ALde. 1789. Genera Plantarum. Paris: Herissant.

Kelchner SA. 2000. The evolution of noncoding chloroplast DNA its application in

plant systematics. Annals of the Missouri Botanical Garden 87: 482–498.

Khan SW, Khatoon S. 2008. Ethnobotanical studies on some useful herbs of

Haramosh and Bugrote valleys in Gilgit, northern areas of Pakistan. Pakistan

Journal of Botany 40: 43–58.

Kirtikar KR, Basu BD. 1999. Indian medicinal plants. Dehrandun: International

book distributor, 191-192, 420-422, 993-994, 2045-2047.

Kisakürek MV, Leeuwenberg AJM, Hesse M. 1983. A chemotaxonomic

investigation of the plant families of Apocynaceae, Loganiaceae, and

Rubiaceae by their indole alkaloid content. In: Pelletier SW, ed. Alkaloids:

Chemical and Biological Perspectives. New York: Wiley, 211–376.

Klackenberg J. 1992a. Taxonomy of Secamone s.l. (Asclepiadaceae) in the

Madagascar Region. Opera Botanica 112: 11–27.

Klackenberg J. 1992b. Taxonomy of Secamone (Asclepiadaceae) in Asia and

Australia. Kew Bulletin 47: 595–612.

Klackenberg J. 1995a. Malagasy Asclepiadaceae: reinstatement of the genus

Pervillea and two new combinations. Phytologia 78: 189–191.

Chapter 5

114

Klackenberg J. 1995b. Taxonomy and phylogeny of the SE Asian genus Genianthus

(Asclepiadaceae). Botanische Jahrbücher für Systematik 117: 401–467.

Klackenberg J. 1996a. The new genus Calyptranthera (Asclepiadaceae) from

Madagascar. Novon 6: 25–27.

Klackenberg J. 1996b. Revision of the Malagasy genus Pervillea (Asclepiadaceae)

and its phylogenetic relationship to Calyptranthera. Nordic Journal of Botany

16: 165–184.

Klackenberg J. 1997. Revision of the genus Baroniella Costantin & Gallaud

(Asclepiadaceae, Periplocoideae). Candollea 52: 383–407.

Klackenberg J. 2001. Notes on Secamonoideae (Apocynaceae) in Africa. Adansonia

23: 317–335.

Klackenberg J. 2005. Secamone trichostemon Klack. (Apocynaceae,

Secamonoideae) a new species from Madagascar. Candollea 60: 119–122.

Kolukisaoglu HU, Marx S, Wiegmann C, Hanelt S, Schneider-Poetsch HA. 1995.

Divergence of the phytochrome gene family predates angiosperm evolution

and suggests that Selaginella and Equisetum arose prior to Psilotum. Journal

of Molecular Evolution 41: 329–337.

Kunze H, Meve U, Liede S. 1994. Cibirhiza albersiana, a new species of

Asclepiadaceae, and establishment of the tribe Fockeeae. Taxon 43: 367–376.

Kunze H. 1995. Floral morphology of some Gonolobeae (Asclepiadaceae).

Botanische Jahrbücher für Systematik 117: 211–238.

Kunze H. 1990. Morphology and evolution of the corona in Asclepiadaceae and

related families. Tropische und subtropische Pflanzenwelt 76: 1–51.

Kunze H. 1993. Evolution of the translator in Periplocaceae and Asclepiadaceae.

Plant Systematics and Evolution 185: 99–122.

Chapter 5

115

Kunze H. 1996. Morphology of the stamen in the Asclepiadaceae and its systematic.

Botanische Jahrbücher für Systematik 118: 547–579.

Lahaye R, Civeyrel L, Speck T, Rowe N. 2005. Evolution of shrub-like growth

forms in the lianoid subfamily Secamonoideae (Apocynaceae s.l.) of

Madagascar: Phylogeny, biomechanics, and development. American Journal

of Botany 92: 1381–1396.

Lahaye R, Klackenberg J, Källersjö M, Van Campo E, Civeyrel L. 2007.

Phylogenetic relationships between derived Apocynaceae s.l. and within

Secamonoideae based on chloroplast sequences. Annals of the Missouri

Botanical Garden 94: 376–391.

Leeuwenberg AJM. 1994. Taxa of the Apocynaceae above the genus level. Series of

revisions of Apocynaceae, XXXVIII. Wageningen Agriculture University

Papers 94: 45–60.

Leeuwenberg AJM. 2003. Series of revisions of Apocynaceae. LIII. Melodinus.

Systematics and Geography of Plants 73: 3–62.

Liede S, Taüber A. 2000. Sarcostemma R. Br. (Apocynaceae–Asclepiadoideae). A

controversial generic circumscription reconsidered: evidence from trnL-trnF

spacers. Plant Systematics and Evolution 225: 133–140.

Liede S, Albert F. 1994. Tribal disposition of genera in the Asclepiadaceae. Taxon

43: 201–231.

Liede S, Kunze H. 1993. A descriptive system for corona analysis in the

Asclepiadaceae. Plant Systematics and Evolution 185: 99–284.

Liede S, Kunze H. 2002. Cynanchum and the Cynanchinae (Apocynaceae –

Asclepiadoideae): a molecular, anatomical and latex triterpenoid study.

Organisms Diversity and Evolution 2: 239–269.

Liede S, Meve U. 2002. Dissolution of Cynanchum sect. Macbridea (Apocynaceae-

Asclepiadoideae). Nordic Journal of Botany 22: 579–591.

Chapter 5

116

Liede S, Taüber A, Schneidt J. 2002. Molecular considerations in the Tylophorinae

K. Schum (Apocynaceae-Asclepiadoideae). Edinburgh Journal of Botany 59:

377–403.

Liede S, Taüber A. 2002. Circumscription of the genus Cynanchum (Apocynaceae-

Asclepiadoideae). Systematic Botany 27: 789–801.

Liede S. 1994. Myth and reality in the subtribe Astephaninae (Decne.) Schumann

(Asclepiadaceae). Botanical Journal of the Linnean Society 114: 81–98.

Liede S. 1997. Subtribes and genera of the tribe Asclepiadeae (Apocynaceae,

Asclepiadoideae) – A synopsis. Taxon 46: 233–247.

Liede S. 2001. Molecular considerations on the subtribe Astephaninae Endl. ex

Meisn. (Apocynaceae -Asclepiadoideae). Annals of the Missouri Botanical

Garden 88: 657–668.

Liede-Schumann S, Rapini A, Goyder DJ, Chase MW. 2005. Phylogenetics of the

New World subtribes of Asclepiadeae (Apocynaceae -Asclepiadoideae):

Metastelmatinae, Oxypetalinae, and Gonolobinae. Systematic Botany 30: 184–

195.

Lienau K, Straka H, Friedrich B. 1986. Palynologia madagassica et mascarenica,

Fam. 167–181. Tropische und subtropische Pflanzenwelt 55: 1–158.

Livshultz T, Middleton DJ, Endress ME, Williams J. 2007. Phylogeny of

Apocynoideae and the APSA clade. Annals of the Missouri Botanical Garden

94: 323–361.

Livshultz T. 2002. Comparative morphology and development of staminal coronas in

Dischidia. (Asclepiadoideae, Apocynaceae). Botanical Society of America

meeting (Oral presentation).

Livshultz T. 2003. Lectotypification of Dolichostegia Schlechter (Asclepiadoideae,

Apocynaceae) and a new combination, Dischidia boholensis. Taxon 52: 595–

600.

Chapter 5

117

Livshultz T. 2010. The phylogenetic position of milkweeds (Apocynaceae

subfamilies Secamonoideae and Asclepiadoideae): Evidence from the nucleus

and chloroplast. Taxon 59: 1016–1030.

Lý TD. 1986. Die Familie Apocynaceae Juss. in Vietnam. Teil 1. Allgemeiner Teil.

Feddes Repertorium 97: 235–273.

Macfarlane JM. 1933. The Evolution and Distribution of Flowering Plants.

Philadelphia: Noel.

Malme GOAN. 1927. Asclepiadaceae dusenianae in Paraná collectae. Arkiv för

Botanik 21A: 1–48.

Mathews S, Donoghue MS. 1999. The root of angiosperm phylogeny inferred from

duplicate phytochrome genes. Science 286: 947–950.

Mathews S, Lavin M, Sharrock RA. 1995. Evolution of the phytochrome gene

family and its utility for phylogenetic analysis of angiosperms. Annals of the

Missouri Botanical Garden 82: 296–321.

Mathews S, Sharrock RA. 1996. The phytochrome gene family in grasses (Poaceae):

a phylogeny and evidence that grasses have a subset of the loci found in dicot

angiosperms. Molecular Biology and Evolution 13: 1141–1150.

Mathews S, Tsai RC, Kellogg EA. 2000. Phylogenetic structure in the grass family

(Poaceae): Evidence from the nuclear gene phytochrome B. American Journal

of Botany 87: 96–107.

Meve U, Liede S. 1999. The Asclepiadoideae and Periplocoideae (Apocynaceae s.l.)

of the Thunberg herbarium. Nordic Journal of Botany 19: 129–138.

Meve U, Liede S. 2001a. Inclusion of Tenaris and Macropetalum in Brachystelma

(Apocynaceae-Asclepiadoideae-Ceropegieae) inferred from non-coding

nuclear and chloroplast DNA sequences. Plant Systematics and Evolution 228:

89–105.

Chapter 5

118

Meve U, Liede S. 2001b. Reconsideration of the status of Lavrania, Larryleachia and

Notechidnopsis (Asclepiadoideae-Ceropegieae). South African Journal of

Botany 67: 161–168.

Meve U, Liede S. 2002. A molecular phylogeny and generic rearrangement of the

stapeloid Ceropegieae (Apocynaceae-Asclepiadoideae). Plant Systematics and

Evolution 234: 171–209.

Meve U, Liede S. 2004. Subtribal division of Ceropegieae (Apocynaceae-

Asclepiadoideae). Taxon 53: 61–72.

Meve U, Liede-Schumann S. 2007. Ceropegia (Apocynaceae, Ceropegieae,

Stapeliinae): paraphyletic but still taxonomically sound. Annals of the

Missouri Botanical Garden 94: 392–406.

Meve U. 1995. Neoschumannia (including Swynnertonia), a primitive genus of the

Asclepiadaceae-Stapelieae. Plant Systematics and Evolution 197: 233–242.

Meve U. 2002. Species numbers and progress in asclepiad taxonomy. Kew Bulletin

57: 459–464.

Middleton DJ. 2004a. A revision of Kopsia (Apocynaceae: Rauvolfioideae).

Harvard Paper of Botany 9: 89–142.

Middleton DJ. 2004b. Apocynaceae. In: Soepadmo E, Saw LG, Chung RCK, eds.

Tree Flora of Sabah and Sarawak. Kuala Lumpur: Forest Research Institute,

Ampang Press, 1–61.

Middleton DJ. 2007. Apocynaceae, subfamilies Rauvolfioideae and Apocynoideae.

Flora Malesiana 18: 1–471.

Morales JF. 1995. Evaluación del Género Alstonia (Apocynaceae) en Centro

América. Phytologia 78: 192–194.

Morales JF. 1997. A synopsis of the genus Allomarkgrafia (Apocynaceae). Brittonia

49: 337–345.

Chapter 5

119

Muellner AN, Samuel R, Johnson SA, Cheek M, Pennington TD, Chase MW,

2003. Molecular phylogenetics of Meliaceae (Sapindales) based on nuclear

and plastid DNA sequences. American Journal of Botany 90: 471–480.

Nazar N, Mahmood T. 2010. Morphological and molecular characterization of

selected Artemisia species from Rawalakot, Azad Jammu and Kashmir. Acta

Physiologiae Plantarum 33: 625–633.

Nicholas A, Baijnath H. 1994. A consensus classification for the order Gentianales

with additional details on the suborder Apocynineae. The Botanical Review

(Lancaster) 60: 440–482.

Nilsson S, Endress ME, Grafstrom E. 1993. On the relationships of the

Apocynaceae and Periplocaceae. Grana 32: 3–20.

Nilsson S. 1986. The significance of pollen morphology in the Apocynaceae. In:

Blackmore S, Ferguson K, eds. Pollen and Spores: Form and Function.

London: Academic Press, 359–374.

Nilsson S. 1990. Taxonomic and evolutionary significance of pollen in Apocynaceae.

P1ant Systematics Evolution 5: 91–102.

Nixon KC, Carpenter JM. 1996. On simultaneous analysis. Cladistics 12: 221–241.

Olmstead RG, Reeves PA. 1995. Evidence for the polyphyly of the Scrophulariaceae

based on chloroplast rbcL and ndhF sequences. Annals of the Missouri

Botanical Garden 82: 176–193.

Omlor R. 1998. Generische revision der Marsdenieae (Asclepiadaceae). Thesis,

Universitat Kais-erslautern.

Orbigny A. (ed.) 1843. Dictionnaire Universel d’Histoire Naturelle. Paris: Renard.

Oudhia P, Tripathi RS, Puri S, Chandel DS. 1999. Traditional knowledge about

medicinal weeds in Chhattisgarh. Vasundhara the Earth 1: 12–15.

Chapter 5

120

Pagel M, 1999. Inferring historical patterns of biological evolution. Nature 401: 877–

884.

Pagen FJJ. 1987. Series of revisions of Apocynaceae XX. Oleander: Nerium L. and

the Oleander cultivars. Wageningen Agriculture University Papers 87: 1–113.

Persoon JGM, van Dilst FJH, Kuijpers RP, Leeuwenberg AJM, Vonk GJA.

1992. The African species of Landolphia P. Beauv. Series of revisions of

Apocynaceae. XXXIV. Wageningen Agriculture University Paper 92: 1–232.

Pichon M. 1949. Classification des Apocynacées. IX. Rauvolfiées, Alstoniées,

Allamandées et Tabernaémontanoidées. Mémoires du Muséum National

d’Histoire Naturelle 27: 153–251.

Pichon M. 1948a. Classification des Apocynacées. V. Cérbéroidées. Notulae

systematicae, herbier d'muséum de Paris, Phanérogamie 13: 212–229.

Pichon M. 1948b. Classification des Apocynacées. I. Carissées et Ambelaniees.

Mémoires du Muséum National d'Histoire Naturelle 24: 111–181.

Pichon M. 1950a. Classification des Apocynacées: XXVIII, Supplement aux

Plumérioidées. Mémoires du Muséum National d'Histoire Naturelle serie B,

botanique 1: 145–166.

Pichon M. 1950b. Classification des Apocynacées. XXV. Échitoidés. Mémoires du

Muséum National d'Histoire Naturelle serie B, botanique 1: 1–143.

Pichon, M. 1947. Classification des Apocynacées: IV. Genre ‘‘Alstonia’’ et genres

voisins. Bulletin du Museum National d'Histoire Naturelle (Paris) 19: 294–

301.

Potgieter K, Albert VA. 2001. Phylogenetic relationships within Apocynaceae s.l.

based on trnL intron and trnL-F spacer sequences and propagule characters.

Annals of the Missouri Botanical Gardens 88: 523–549.

Chapter 5

121

Potgieter K. 1999. Phylogenetic study of Apocynaceae Juss. and Aspidosperma Mart.

& Zucc. Thesis, University of Illinois at Urbana-Champaign.

Rapini A, Chase MW, Goyder DJ, Griffiths J. 2003. Asclepiadoideae

classification: Evaluating the phylogenetic relationships of New World

Asclepiadoideae (Apocynaceae). Taxon 52: 33–50.

Rapini A, Chase MW, Konno TUP. 2006. Phylogenetics of South American

Asclepiadeae (Apocynaceae). Taxon 55: 119–124.

Rapini A, Fontella-Pereira J, Goyder DJ. 2011. Towards a stable generic

circumscription in Oxypetalinae (Apocynaceae). Phytotaxa 26: 9–16.

Rapini A, Mello-Silva R, Kawasaki ML. 2002. Richness and endemism in

Asclepiadoideae (Apocynaceae) from the Espinhaço range of Minas Gerais,

Brazil - a conservationist view. Biodiversity and Conservation 11: 1733–1746.

Rapini A, Van den Berg C, Liede-Schumann S. 2007. Diversification of

Asclepiadoideae (Apocynaceae) in the New World. Annals of the Missouri

Botanical Gardens 94: 407–422.

Rapini A. 2002. Six new species of Ditassa R. Br. from the Espinhaço Range, Brazil,

with notes on generic delimitation in Metastelmatinae (Apocynaceae-

Asclepiadoideae). Kew Bulletin 57: 533–546.

Rapini A. 2012. Taxonomy “under construction”: advances in the systematics of

Apocynaceae, with emphasis on the Brazilian Asclepiadoideae. Rodriguésia

63: 75–88.

Richard EJ. 1997. Preparation of plant DNA using CTAB. In: Ausubel F, Brent R,

Kingston RE, Moore DD, Siedman JG, Smith JA, Struhl K, eds. Short

Protocols in Molecular Biology. New York: Wiley, 2.10–2.11.

Rosatti TJ. 1989. The genera of suborder Apocynineae (Apocynaceae and

Asclepiadaceae) in the southeastern United States. Journal of the Arnold

Arboretum 70: 307–401.

Chapter 5

122

Safwat FM. 1962. The floral morphology of Secamone and the evolution of the

pollinating apparatus in Asclepiadaceae. Annals of the Missouri Botanical

Garden 49: 95–129.

Samuel R, Kathriarachchi H, Hoffmann P, Barfuss MHJ, Wurdack KJ, Davis

CC, Chase MW. 2005. Molecular phylogenetics of Phyllanthaceae: Evidence

from plastid matK and nuclear PHYC sequences. American Journal of Botany

92: 132–141.

Sang T, Crawford DJ, Stuessy TF. 1997a. Chloroplast phylogeny, reticulate

evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of

Botany 84: 1120–1136.

Sang T, Donoghue MJ, Zhang D. 1997b. Evolution of alcohol dehydrogenase genes

in peonies (Paeonia): phylogenetic relationships of putative nonhybrid

species. Molecular Biology and Evolution 14: 994–1007.

Sang T, Zhang D. 1999. Reconstructing hybrid speciation using sequences of low-

copy nuclear genes: hybrid origins of five Paeonia species based on Adh gene

phylogenies. Systematic Botany 24: 148–163.

Sang T. 2002. Utility of low-copy nuclear gene sequences in plant phylogenetics.

Critical Reviews in Biochemistry and Molecular Biology 37: 121–147.

Schill, R, Jäckel U. 1978. Beitrag zur Kenntnis der Asclepiadaceen-Pollinarien.

Tropische und subtropische Pflanzenwelt 22: 1–122.

Schlechter R. 1914. Periplocaceae. In: Mildbraed J, ed. Wissenschaftliche Ergebnisse

der deutschen Zentral-Afrika-Expedition. Leipzig: Klinkhardt and Biermann,

541–542.

Schlechter R. 1924. Periplocaceae and Asclepiadaceae. In: Fries RE, Fries TCE, eds.

Beitrage zur Kenntnis der Flora des Mt. Kenia, Mt. Aberdove und Mt. Elgon.

Notizblatt des Botanischen Gartens und Museums zu Berlin-Dahlem 9: 1–32.

Chapter 5

123

Schumann K. 1895. Apocynaceae and Asclepiadaceae. In: Engler A, Prantl K, eds.

Die Natürlichen Pflanzenfamilien. Germany: Engelmann, Leipzig, 109–305.

Sennblad B, Bremer B. 1996. The familial and subfamilial relationships of

Apocynaceae and Asclepiadaceae evaluated with rbcL data. Plant Systematics

and Evolution 202: 153–175.

Sennblad B, Bremer B. 2000. Is there a justification for differential a priori

weighting in coding sequences? A case study from rbcL and Apocynaceae.

Systematic Biology 49: 101–113.

Sennblad B, Bremer B. 2002. Classification of Apocynaceae s.l. according to a new

approach combining Linnaean and phylogenetic taxonomy. Systematic

Biology 51: 389–409.

Sennblad B, Endress ME, Bremer B. 1998. Morphology and molecular data in

phylogenetic fraternity the tribe Wrightieae (Apocynaceae) revisited.

American Journal of Botany 85: 1143–1158.

Sennblad B. 1997. Phylogeny of the Apocynaceae s.l. Thesis, Acta Universitas

Uppsaliensis.

Sheelaa B, Hussain SM, Kumar PS, Kalaichelvam VK, Venkatachalam VK.

2010. Vasodialation effect of latex from Calotropis gigantea in green frog

Rana hexadactyla. Asian Journal of Medicinal Science 2: 22–24.

Sidiyasa K. 1998. Taxonomy, phylogeny, and wood anatomy of Alstonia

(Apocynaceae). Blumea Supplement 11: 1–230.

Simmons MP, Clevinger CC, Savolainen V, Archer RH, Mathews S, Doyle JJ.

2001. Phylogeny of the Celastraceae inferred from phytochrome B gene

sequence and morphology. American Journal of Botany 88: 313–325.

Simões AO, Endress ME, Conti E. 2010. Systematics and character evolution of

Tabernaemontaneae (Apocynaceae, Rauvolfioideae) based on molecular and

morphological evidence. Taxon 59: 772–790.

Chapter 5

124

Simões AO, Endress ME, Van der Niet T, Conti E, Kinoshita LS. 2004. Tribal and

intergeneric relationships of Mesechiteae (Apocynaceae, Apocynoideae):

Evidence from three noncoding plastid DNA regions and morphology.

American Journal of Botany 91: 1409–1418.

Simões AO, Livshultz T, Conti E, Endress ME. 2007. Phylogeny and systematics

of the Rauvolfioideae (Apocynaceae) based on molecular and morphological

evidence. Annals of the Missouri Botanical Garden 94: 268–297.

Small RL, Cronn RC, Wendel JF. 2004. Use of nuclear genes for phylogeny

reconstruction in plants. Australian Systematic Botany 17: 145–170.

Small RL, Ryburn JA, Cronn RC, Seelanan T, Wendel JF. 1998. The tortoise and

the hare: choosing between noncoding plastome and nuclear Adh sequences

for phylogeny reconstruction in a recently diverged plant group. American

Journal of Botany 85: 1301–1315.

Small RL, Wendel JF. 2000. Phylogeny, duplication, and intraspecific variation of

Adh sequences in New World diploid cottons (Gossypium, Malvaceae).

Molecular Phylogenetics and Evolution 16: 73-84.

Soerianegara I, Lemmens RHMJ. 1994. Plant resources of South-East Asia

timber trees: major commercial timbers. Wageningen: Pudoc Scientific

Publishers.

Stapf O. 1902. Apocynaceae. In: Thiselton-Dyer WT, ed. Flora of Tropical Africa.

London: Lovell Reeve, 24–231.

Stebbins GL. 1974. Flowering plants: Evolution above the species level. Cambridge:

Belknap Press of Harvard University Press.

Stevens WD. 1976. A revision of Matelea subg. Dictyanthus (Apocynaceae, sensu

lato). Thesis, Michigan State University.

Struwe L, Albert VA, Bremer B. 1994. Cladistics and family level classification of

the Gentianales. Cladistics 10: 175–206.

Chapter 5

125

Surveswaran S, Kamble MY Yadav SR, Sun M. 2009. Molecular phylogeny of

Ceropegia (Asclepiadoideae, Apocynaceae) from Indian Western Ghats. Plant

Systematics and Evolution 281: 51–63.

Swarupanandan K, Mangaly JK, Sonny TK, Kishorekumar K, Chand-Basha S.

1996. The subfamilial and tribal classification of the family Asclepiadaceae.

Botanical Journal of the Linnean Society 120: 327–369.

Swofford DL. 2001. PAUP* 4.0: Phylogenetic analysis using parsimony (*and other

methods). Sunderland, Massachusetts: Sinauer Associates.

Swofford DL. 2002. PAUP* 4.10b: Phylogenetic Analysis Using Parsimony (*and

other methods). Sunderland, MA: Sinauer Associates.

Taberlet P, Gielly L, Pautou G, Bouvet J. 1991. Universal primers for amplification

of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17:

1105–1109.

Takhtajan A. 1997. Diversity and classification of flowering plants. New York:

Columbia University Press.

Thankamma L. 2003. Hevea latex as wound healer and pain killer. Current Science

84: 971–972.

Thorne RF. 1976. A phylogenetic classification of the Angiospermae. Evolutionary

Biology, 9: 35–106.

Thorne RF. 1992. An updated phylogenetic classification of the flowering plants.

Aliso 13: 365–389.

Tsiang Y. 1934. Notes on Asiatic Apocynales. II. Sunyatsenia 2: 90–202.

Venter HJT, Verhoeven RL. 1997. A tribal classification of the Periplocoideae

(Apocynaceae). Taxon 46: 705–720.

Chapter 5

126

Venter HJT, Verhoeven RL. 2001. Diversity and relationships within the

Periplocoideae (Apocynaceae). Annals of the Missouri Botanical Garden 88:

550–568.

Venter HJT, Verhoeven R, Kotze JDS. 1990. The genus Petopentia

(Periplocaceae). South African Journal of Botany 56: 393–398.

Verhoeven RL, Liede S, Endress ME. 2003. The tribal position of Fockea and

Cibirhiza (Apocynaceae-Asclepiadoideae): evidence from pollinium structure

and cpDNA sequence data. Grana 42: 70–81.

Verhoeven RL, Venter HJT. 1998. Pollinium structure in Periplocoideae

(Apocynaceae). Grana 37: 1–14.

Verhoeven RL, Venter HJT. 2001. Pollen morphology of the Periplocoideae,

Secamonoideae, and Asclepiadoideae (Apocynaceae). Annals of the Missouri

Botanical Garden 88: 569–582.

Wanntorp L, Kocyan A, Renner SS. 2006b. Wax plants disentangled: A phylogeny

of Hoya (Apocynaceae) using molecular markers. Molecular Phylogenetics

and Evolution 39: 722–733.

Wanntorp L, Kocyan A, van Donkelaar R, Renner SS. 2006a. Towards a

monophyletic Hoya (Marsdenieae, Apocynaceae): Inferences from the

chloroplast trnL region and the rbcL-atpB spacer. Systematic Botany 31: 586–

596.

Williams JK. 1996. The Mexican genera of Apocynaceae (sensu A. DC.), with key

and additional taxonomic notes. Sida 17: 197–213.

Wolfe KH, Li W-H, Sharp PM. 1987. Rates of nucleotide substitution vary greatly

among plant mitochondrial, chloroplast and nuclear DNAs. Proceedings of the

National Academy of Sciences of the United States of America 84: 9054–9058.

Chapter 5

127

Woodson Jr RE. 1930. Studies in the Apocynaceae. I. A critical study of the

Apocynoideae (with special reference to the genus Apocynum). Annals of the

Missouri Botanical Garden 17: 1–213.

Woodson Jr RE. 1941. The North American Asclepiadaceae. 1. Perspective of the

genera. Annals of the Missouri Botanical Garden 28: 193–244.

Woodson Jr RE. 1951. Studies in the Apocynaceae. VIII. An interim revision of the

genus Aspidosperma Mart. & Zucc. Annals of the Missouri Botanical Garden

38: 119–207.

Wyatt R, Broyles SB, Lipow SR. 2000. Pollen-ovule ratios in milkweeds

(Asclepiadaceae): An exception that probes the rule. Systematic Botany 25:

171–180.

Zarucchi JL, Morillo GN, Endress ME, Hansen BF, Leeuwenberg AJM. 1995.

Apocynaceae. In: Steyermark JA, Berry PA, Holst BK, eds. Flora of the

Venezuelan Guayana. St. Louis: Missouri Botanical Garden/Timber Press,

471–571.

Zhu JP, Guggisberg A, Kalt-Hadamowsky M, Hesse M. 1990. Chemotaxonomic

study of the genus Tabernaemontana (Apocynaceae) based on their indole

alkaloid content. Plant Systematics and Evolution 172: 13–34.

128

Appendix I

QIAquick PCR Purification Kit Protocol

Procedure

1. Five volumes of PB Buffer was added to 1 volume of the PCR sample and mixed.

2. Then a QIAquick spin column was placed in a provided 2 ml collection tube.

3. Sample was poured into the QIAquick column for DNA binding and then

centrifuged for 30-60 seconds and discarded flow-through.

4. QIAquick column was placed back into the same tube.

5. For washing, 0.75 ml Buffer PE was added to the QIAquick column followed by

centrifugation for 30-60 seconds.

6. Flow-through was discarded and QIAquick column was placed back in the same

tube, followed by centrifugation of an additional 1 minute.

7. After centrifugation, the QIAquick column was transferred to a clean 1.5 ml

microcentrifuge tube.

8. DNA was eluted by adding 50 μl elution buffer (10 mM Tris·Cl, pH 8.5) to the

center of the QIAquick membrane and the column was centrifuged for 1 minute,

at the end purified DNA was collected in the tube.

129

Appendix II

Cycle Sequencing

Reaction Mixture

Reagent Quantity

2.5X Terminator Ready Reaction Mix* 0.5 μl

5X Sequencing buffer 2 μl

Primer 0.75 μl (3.2 pmol)

Deionized water 6.25 μl

Template 1 μl (10-40 ng)

Total volume 10 μl

Following temperature conditions were used;

Purification of cycle sequencing product

1. Reaction plate with sequencing product was short spined and then 2 μl of 125 mM EDTA

was added to each well.

2. 3 M sodium acetate was also added to each well and spin shortly.

3. After spinning, 100 % ethanol was added to each well.

4. Reaction plate was sealed and for proper mixing the plate was inverted 4 times.

5. For incubation, the plate was left at room temperature for 15 minutes.

6. Centrifugation was carried out at 1650 × g for 45 minutes and temperature was set at

4 °C.

96 °C 1 minute 1 Cycle

96 °C 10 seconds

25 Cycles 50 °C 5 seconds

60 °C 4 minutes

4 °C Hold

130

7. Reaction plate was removed from centrifuge and spin again at 185 × g for 1 minute in

inverted position. At the end the samples were resuspended in buffer.

8. After centrifugation, 70 % ethanol was added to each well.

9. Step 6 and 7 was repeated.

10. At the end the samples were resuspended in buffer.