Placenta Growth Factor-induced Early Growth Response 1(Egr-1) Regulates Hypoxia-inducible Factor-1� (HIF-1�) inEndothelial Cells*□S

Received for publication, March 2, 2010, and in revised form, April 29, 2010 Published, JBC Papers in Press, May 6, 2010, DOI 10.1074/jbc.M110.119495

Nitin Patel1 and Vijay K. Kalra2

From the Department of Biochemistry and Molecular Biology, Keck School of Medicine, University of Southern California,Los Angeles, California 90033

Leukotrienes, the lipid inflammatory products derived fromarachidonic acid, are involved in the pathogenesis of respiratoryand cardiovascular diseases and reactive airway disease in sicklecell disease. Placenta growth factor (PlGF), elaborated fromerythroid cells, increased the mRNA expression of 5-lipoxygen-ase and 5-lipoxygenase-activating protein (FLAP) in humanpulmonary microvascular endothelial cells. PlGF-induced bothpromoter activity and mRNA expression of hypoxia-induciblefactor-1� (HIF-1�), which was abrogated by early growthresponse-1 (EGR-1) small interfering RNA. PlGF showed a tem-poral reciprocal relationship in the mRNA levels of EGR-1 andNAB2, the latter a repressor of Egr-1. Moreover, Nab2, but notmutant Nab2, significantly reduced promoter activity andmRNA expression of HIF-1� and also reduced expression of theHIF-1� target geneFLAP. Furthermore, overexpressionofEgr-1led to increased promoter activities for both HIF-1� and FLAPin the absence of PlGF. Additionally, the Egr-1-mediated induc-tion ofHIF-1� and FLAP promoters was reduced to basal levelsby EGR-1 small interfering RNA. The binding of Egr-1 toHIF-1� promoter was corroborated by electrophoretic mobilityshift assay and chromatin immunoprecipitation assay, whichshowed increased Egr-1 binding to the HIF-1� promoter inresponse to PlGF stimulation. These studies provide a novelmechanism for PlGF-mediated regulation of HIF-1� via Egr-1,which results in increased FLAP expression. This study providesa new therapeutic target, namely Egr-1, for attenuation of ele-vated leukotriene levels in patients with sickle cell disease andother inflammatory diseases.

Leukotrienes (LT)3 are physiological lipid mediators thathave roles in innate immune responses andpathological roles in

inflammatory diseases, such as asthma, airway hyper-reactivity,allergic rhinitis, acute lung injury, and atherosclerosis (1–5).LT are synthesized from substrate arachidonic acid (AA) by5-lipooxygenase (5-LO) in concert with 5-lipoxygenase-acti-vating protein (FLAP). FLAP itself does not have enzymaticactivity; however, it enhances the binding of AA to 5-LO andthus is essential for LT biosynthesis (6). 5-LO oxidizes AA to5-hydroperoxyeicosatetraenoic acid, which is converted intoleukotriene A4 (LTA4). LTB4 and cysteinyl leukotrienes-LTC4,LTD4, and LTE4 are formed from LTA4. Although leukocytesgenerate large amounts of LT from AA, nonleukocyte cells,such as endothelial cells, do not have sufficient 5-LO and FLAPto mediate synthesis of LT (5). However, endothelial cells cantake up leukocyte-derived LTA4 and convert it into bioactiveLT by transcellular biosynthesis (7, 8). LTB4 is a potent che-moattractant for leukocytes and mediates inflammation, al-though cysteinyl-LT are potent bronchoconstrictors that areinvolved in edema, inflammation, and secretion of mucus inasthma (9). In sickle cell disease (SCD), steady state levels ofplasma and urinary LTB4 are elevated, which can undergo afurther increase during vaso-occlusive crises and acute chestsyndrome (10).Increased urinary LTE4 levels are associated with a higher

incidence of pain, both in adults and children with SCD (11).However, themolecularmechanisms of induction of LT in SCDare not yet completely understood. Previously, we showed thatplasma levels of placenta growth factor (PlGF) are higher inSCD subjects compared with healthy individuals and correlatewith increased incidence of vaso-occlusive events (12). In ourrecent studies, we show that PlGF increases mRNA expressionof both hypoxia-inducible factor-1 (HIF-1�) and FLAP inmonocytic cells (13).HIF-1� is the key transcription factor involved in the expres-

sion of genes induced under low oxygen conditions (14, 15).Under normoxia, HIF-1� protein is subjected to tightly regu-lated prolyl hydroxylase (PHDs 1–3)-mediated degradation.However, the degradation of HIF-1� is prevented underhypoxic conditions, resulting in its accumulation and translo-cation to the nucleus where it forms active heterodimers with

* This work was supported, in whole or in part, by National Institutes of HealthGrants R01-HL-079916 and HL-070595.

□S The on-line version of this article (available at http://www.jbc.org) containssupplemental “Experimental Procedures,” Table S1, and Figs. S1 and S2.

1 Present address: Institute for Genetic Medicine, Keck School of Medicine,University of Southern California, Los Angeles, CA 90033.

2 To whom correspondence should be addressed: HMR 611, Dept. of Bio-chemistry and Molecular Biology, University of Southern California KeckSchool of Medicine, Los Angeles, CA 90033. Tel.: 323-442-1526; Fax: 323-442-1528; E-mail: vkalra@usc.edu.

3 The abbreviations used are: LT, leukotriene; 5-LO, 5-lipoxygenase; Egr-1,early growth response 1; FLAP, 5-lipoxygenase-activating protein; HIF-1�,hypoxia-inducible factor-1�; HPMVEC, human pulmonary microvascularendothelial cells; HRE, hypoxia-response element; PlGF, placenta growthfactor; SCD, sickle cell disease; t-HBEC, transformed brain endothelial cells;qRT-PCR, quantitative real time-PCR; WT, wild type; EMSA, electrophoretic

mobility shift assay; ChIP, chromatin immunoprecipitation; siRNA, smallinterfering RNA; FLAP, 5-lipoxygenase-activating protein; AA, arachidonicacid; VEGF, vascular endothelial growth factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TNF-�, tumor necrosis factor-�; PAEC, pulmo-nary aortic endothelial cells; RPA, RNase protection assay; PI3K, phospho-inositide 3-kinase.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 27, pp. 20570 –20579, July 2, 2010© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

20570 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 27 • JULY 2, 2010

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from

HIF-1� leading to transcription of hypoxia-related genes (16).Recently, we showed that up-regulation of HIF-1� mRNA lev-els in response to PlGF was independent of hypoxia both inendothelial cells and monocytes (13, 17). However, the molec-ularmechanisms of PlGF-mediated elevation inHIF-1� expres-sion are not yet studied. Moreover, growth factors (18), lipopo-lysaccharide (19), and TNF-� (20) have been shown to increaseHIF-1� mRNA expression, independently of hypoxia. Impor-tantly, hypoxia, lipopolysaccharide, and TNF-� have beenshown to increase HIF-1� mRNA expression via activation ofNF-�B (20–22). Studies by Karin and co-workers (23) showthat depletion of IKK� in macrophages results in the down-regulation of HIF-1a mRNA, showing that NF-�B regulatesHIF-1� transcription in vivo. However, only limited informa-tion is availablewith respect to themechanisms ofHIF-1� tran-scriptional regulation by other transcription factors. TheHIF-1� gene promoter is TATA-less and consists of a GC-richsequence, and its constitutive expression has been shown to beregulated by Sp1-binding sites (24, 25). The early growthresponse-1 (Egr-1) transcription factor has been shown to reg-ulate gene expression by interacting with GC-rich promoterelements and also by displacing Sp1 from its binding sites in thepromoter, upon induction by various stimuli (26, 27).We there-fore examined the role of Egr-1 in PlGF-induced HIF-1� andFLAP gene expression.

In this study, we show that PlGF augments 5-LO and FLAPmRNA expression in human pulmonary microvascular endo-thelial cells (HPMVEC), which required activation of thetranscription factors Egr-1 and HIF-1�. Our studies showedthat treatment of HPMVECwith PlGF leads to a rapid increasein EGR-1 mRNA expression. We identified the mechanismsof PlGF-regulated HIF-1� transcription through Egr-1 byreporter gene assay, electrophoretic mobility shift assay(EMSA), and analysis (ChIP). Importantly, we showed thatoverexpression of Nab2, a repressor of Egr-1 activity, attenu-ated PlGF-mediated HIF-1� promoter activity and its tran-scription.Moreover, we showed that PlGF-mediated activationof Egr-1 results in the up-regulation of HIF-1�, in a hypoxia-independent manner, which in turn activated the downstreamtarget gene FLAP. The absence of Egr-1-binding elements inthe FLAP promoter thus obviates directed activation by Egr-1and supports a sequential mechanism requiring HIF-1�.

EXPERIMENTAL PROCEDURES

Cells and Reagents—HPMVEC were obtained and culturedas described previously (28). Transformed human brain endo-thelial cells (t-HBEC) were obtained from Dr. Stins (29) andcultured in RPMI 1640 medium containing 10% fetal bovineserum, 1 mM glutamine, 1 mM sodium pyruvate, 5 mM Hepes,minimal essential medium vitamins, and nonessential aminoacids (one time), 50 �g/ml endothelial cell mitogen, and hepa-rin (20 units/ml). Unless otherwise indicated, both HPMVECand t-HBEC were kept overnight in their respective mediumcontaining serum, followed by serum-free media for 3 h, priorto treatment with PlGF (250 ng/ml) or any other experimentalconditions.Reagents were obtained as follows: human recombinant

PlGF and vascular endothelial growth factor (VEGF-A) were

obtained from R & D Systems (Minneapolis, MN); pharmaco-logical inhibitors of cell signaling (supplemental Table S1) wereobtained fromTocris Bioscience (Ellisville,MO); [32P]UTPwasfrom (ICN Biomedical Inc. (Irvine, CA); primary antibodiesagainst Egr-1, HIF-1�, FLAP, 5-LO, vascular endothelialgrowth factor receptor-1 (VEGFR1), �-actin, and secondaryantibodies conjugated to horseradish peroxidase were obtainedfrom Santa Cruz Biotechnology (Santa Cruz, CA). Unless oth-erwise specified, all other reagents were purchased from Sigma.HIF-1� siRNA and scrambled (sc) siRNA were synthesized atthe Microchemical Core Facility of the University of SouthernCalifornia Norris Comprehensive Cancer Center. TranSilentsiRNA vectors for EGR-1 were from Panomics Inc. (Fremont,CA).mRNA Analysis—Total RNA was isolated using TRIzol rea-

gent (Invitrogen), and the RNase protection assay (RPA) wascarried out using custom-made Riboquant multiprobe tem-plates consisting ofHIF-1�, FLAP, 5-LO, andGAPDH (BDBio-sciences), as described previously (30, 31). The band intensitieswere analyzed on an AlphaImager 2000 gel documentation sys-tem (Alpha Innotech Corp., San Leandro, CA). Quantitativereal time (qRT)-PCR was performed with the iScript one-stepRT-PCR kit using SYBR Green (Bio-Rad) as per the supplier’sinstructions on an ABI PRISM 7900 instrument (Applied Bio-systems, Foster City, CA). Briefly, 40 cycles of amplificationwere carried out after reverse transcription at 95 °C for 10 s and60 °C for 30 s, using the primers listed in Table 1. The mRNAlevels were normalized to GAPDH mRNA for both RPA andqRT-PCR.Transient Transfection—HPMVEC (1 � 106) were resus-

pended in 100�l of unsupplemented plain RPMI 1640mediumcontaining appropriate siRNA constructs (50 nM) or luciferasereporter plasmids or several expression plasmids and trans-fected by nucleofection using the S-05 program in a nucleofec-tor device (Lonza, Basel, Switzerland) (32). The�-galactosidaseplasmid (0.5 �g) was cotransfected with reporter constructs(0.5�g) tomonitor transfection efficiency. After nucleofection,the cells were kept in complete medium overnight followed byserum-free medium for 3 h and treated with PlGF for the indi-cated times. The cell lysates were analyzed for luciferase and�-galactosidase activity using kits (Promega, Madison, WI).Luciferase values were normalized to �-galactosidase values.Data are expressed relative to the activity of the promoter-lesspGL3 basic vector.Western Blot Analysis—The cytosolic and nuclear extracts

were prepared from untreated and PlGF-treated cells. Briefly,2 � 106 cells were resuspended in 400 �l of cell lysis buffer for20 min, and cytosolic supernatants were collected by centri-fugation at 10,000 � g for 30 s. The nuclear extract wasobtained by resuspending the pellet in 50 �l of nuclearextraction buffer for 1 h at 4 °C. The cytosolic extracts iso-lated from t-HBEC were subjected to SDS-PAGE analysis forEgr-1, HIF-1�, and FLAP protein expression. Blots werestripped and reprobed with �-actin antibody tomonitor pro-tein loading. The protein bands were visualized using Immo-bilonWestern reagents (Millipore Corp., Billerica, MA). Themembrane for 5-LO blot was developed using LumigenTMA-6 detection reagent (GE Healthcare) and visualized

Egr-1 Regulates PlGF-induced HIF-1�

JULY 2, 2010 • VOLUME 285 • NUMBER 27 JOURNAL OF BIOLOGICAL CHEMISTRY 20571

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from

using a Fujifilm LAS-4000 Luminescent Image Analyzer(Stamford, CT). The same membrane was stripped and rep-robed for �-actin to examine protein loading.EMSA—The single-stranded wild type (WT) and mutant

oligonucleotides used as probes are listed in Table 1. Theoligonucleotides were biotin-labeled as per the manufactur-er’s instructions (Pierce) followed by annealing of the com-plementary strands in an equimolar amount. The DNA bind-ing reaction consisted of nuclear extract (10 �g), 5% glycerol,5 mM MgCl2, 50 ng/�l poly(dI�dC), 0.05% Nonidet P-40, and1 ng of biotinylated probe. The specificity of DNA-proteininteraction was demonstrated using 50-fold excess unla-beled probe. In supershift assays, nuclear extracts were pre-incubated for 1 h on ice with the indicated antibody (2 �g).The samples were then subjected to native 6% PAGE in0.5� TBE, transferred to a Hybond-N� nylon membrane

(Amersham Biosciences), and devel-oped with streptavidin-horseradishperoxidase/chemiluminescence.ChIP Assay—HPMVEC (5 � 106

cells) were treated with PlGF in thepresence or absence of indicatedinhibitors for indicated times. ChIPanalysis was performed utilizingeither Egr-1 antibody or HIF-1�antibody or control rabbit IgG asdescribed previously (28). Briefly, 5�l of DNA sample was subjected toPCR amplification utilizing primersfor HIF-1� and FLAP promoterregion (primers are listed in Table1). PCR was performed for 30 cyclesunder the following conditions:94 °C for 60 s, 56 °C for 60 s, and72 °C for 45 s. The PCR productswere subjected to agarose gel elec-trophoresis. Densitometric quanti-fication of ChIP products was per-formed using Spot-Denso softwareon Alpha Imager 2000 gel docu-mentation system. The values werenormalized to input DNA.Statistical Analysis—Data are

presented as means � S.E. The sig-nificance of difference in mean val-ues between multiple groups wasanalyzed with parametric one-wayanalysis of variance followed by aTukey-Kramer test using Instat 2software program (GraphPad, SanDiego). Student’s t test was used toevaluate the significance of differ-ence between two groups of experi-ments. ***,p� 0.001; **,p� 0.01;ns,p � 0.05.

RESULTS

PlGF Augments mRNA Expressionof 5-LO and FLAP in HPMVEC—Previous studies have shownthat cultured humanpulmonary aortic endothelial cells (PAEC)express low levels of 5-LO and therefore do not form LT. How-ever, overexpression of 5-LO in human PAEC results in anincrease in LT formation (33). Thus, we examined whetherexpression of 5-LO and FLAP, key regulatory molecules in LTformation, were modulated in HPMVEC upon PlGF stimula-tion. As shown in Fig. 1A, there was a time-dependent (1–6 h)increase in FLAPmRNA expression, which was optimum (�2-fold increase) at 6 h. However, 24 h post-induction, FLAPmRNAexpression returned to the basal levels. The endogenousmRNA expression of 5-LO was undetectable, which was in-creased upon PlGF treatment for 6 h (Fig. 1A). PlGF-mediatedincrease in FLAP mRNA expression was also verified by qRT-PCR (Fig. 1B), which showed results similar to those observedin RPA. In addition, qRT-PCR results showed increasedHIF-1�

FIGURE 1. Role of Egr-1 and HIF-1� in PlGF-induced 5-LO and FLAP mRNA expression in HPMVEC. A, RPAanalysis of FLAP, 5-LO, and GAPDH in total RNA isolated from untreated and PlGF (250 ng/ml)-treated HPMVECat the indicated times. B, qRT-PCR analysis of HIF-1� and FLAP mRNA in PlGF-treated HPMVEC at the indicatedtimes. C, qRT-PCR analysis of EGR-1, NAB2, HIF-1�, FLAP, 5-LO, and VCAM-1 mRNA in VEGF-treated (250 ng/ml)HPMVEC at the indicated times. D, HPMVEC were pretreated for 30 min with pharmacological inhibitors ofHIF-1�, ascorbate (25 �M), PI3K, LY294002 (10 �M), NADPH oxidase, and diphenyleneiodonium (DPI) (10 �M)followed by PlGF treatment for 6 h. Total RNA was isolated and subjected to RPA for the expression of theindicated genes. E, HPMVEC were transfected with indicated siRNA or scrambled siRNA constructs followed byPlGF treatment for 6 h. Total RNA was subjected to RPA analysis of HIF-1�, FLAP, 5-LO, and GAPDH. Data arerepresentative of three independent experiments.

Egr-1 Regulates PlGF-induced HIF-1�

20572 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 27 • JULY 2, 2010

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from

mRNAexpression in PlGF-treatedHPMVEC (Fig. 1B). To assessthe specificity of PlGF action, we treated HPMVEC withVEGF-A, themost potent angiogenic factor of theVEGF family.The mRNA expression of FLAP and HIF-1� was unchanged,whereas expression of 5-LO remain undetected upon VEGFstimulation at the indicated times (Fig. 1C). However, VEGF ledto a 4.5-fold increase in VCAM-1 mRNA expression at 2 h, asexpected, and showed that the VEGF was biologically active.Next, we carried out estimation of immunoreactive LT in cul-ture supernatants of PlGF-treated HPMVEC, which showed2.1-, 3.1-, and 3.8-fold increases in immunoreactive LTB4,LTC4, and LTE4 release, respectively, compared with control(supplemental Fig. S1A). Moreover, PlGF-induced FLAPmRNA expression (Fig. 1D) and immunoreactive LTB4 release(supplemental Fig. S1B) were significantly reduced by pharma-cological inhibitors of HIF-1�, phosphoinositide 3-kinase(PI3K), and NADPH oxidase (description of inhibitors pro-vided in supplemental Table S1). Taken together, our resultsshowed that PlGF-mediated FLAP expression required activa-tion of PI3K, NADPH oxidase, and HIF-1� in HPMVEC asobserved previously in monocytes (13).

PlGF-induced FLAP ExpressionInvolves Both Egr-1 and HIF-1�Transcription Factors—Becauseprevious studies have shown therole of Egr-1 in regulation of 5-LOtranscription (34), we examined theeffect of EGR-1 siRNA on PlGF-in-duced 5-LO and FLAP mRNA ex-pression. Transfection of HPMVECwith EGR-1 siRNA led to com-plete abrogation in PlGF-in-duced 5-LO and FLAP mRNAexpression (Fig. 1E, 4th lane), com-pared with cells transfected withscEGR-1 siRNA (Fig. 1E, 6th lane).Moreover,EGR-1 siRNA, comparedwith scEGR-1 siRNA, also inhibitedPlGF-induced HIF-1� mRNA ex-pression (Fig. 1E, 1st panel, 4thlane). Because we previouslyshowed a role for HIF-1� in theregulation of PlGF-induced FLAPexpression in both THP-1 mono-cytes and peripheral blood mono-cytes (13), we examined the effect ofHIF-1� siRNA in HPMVEC. Asshown in Fig. 1E, 3rd lane, HIF-1�siRNA markedly attenuated PlGF-induced HIF-1� and FLAP mRNAlevels but not that of 5-LO. How-ever, scHIF-1� siRNA had no effecton HIF-1� or FLAP mRNA levels(Fig. 1E, 5th lane). Similarly, the celltransfected with HIF-1� siRNA orEGR-1 siRNA showed significantlyreduced levels of immunoreactiveLTB4 release compared with their

corresponding scrambled siRNA controls upon treatment withPlGF (supplemental Fig. S1C). Taken together, these resultsshowed that PlGF-induced expression of FLAP involved bothEgr-1 and HIF-1� transcription factors.PlGF Regulates Expression of Egr-1 and Nab2 in a Temporal

Reciprocal Manner—We examined the effect of PlGF on themRNA expression levels of EGR-1 and its repressor NAB2 (35,36). Treatment of HPMVEC with PlGF showed an increase inEGR-1mRNA expression within 30min, which returned to thebasal levels by 4 h (Fig. 2A). In contrast, the levels of NAB2mRNA declined by half after 30 min, which were furtherreduced at 60 min. Remarkably, NAB2 mRNA levels showedrecovery after 60 min of stimulation, as evident from levelsobserved at 4 and 8 h, respectively (Fig. 2A). These data showeda temporal reciprocal association between the expression levelsof EGR-1 and NAB2 mRNA in response to PlGF in HPMVEC.In contrast to the effect of PlGF,VEGF stimulation ofHPMVECdid not alter the mRNA expression of EGR-1 and NAB2 com-pared with untreated cells (Fig. 1C). We then examinedwhether PlGF increased functional Egr-1 DNA binding activityin the nuclear extracts of HPMVEC. As shown in Fig. 2B, bind-

FIGURE 2. PlGF-induced Egr-1 transcription activity is repressed by Nab2. A, qRT-PCR analysis of EGR-1and NAB2 mRNAs in total RNA isolated from untreated and PlGF-treated HPMVEC at the indicated times.B, EMSA for Egr-1 binding to its consensus DNA binding sequence in HPMVEC nuclear extracts (10 �g).Where indicated, 50-fold excess of unbiotinylated probe (3rd lane) or Egr-1 antibody (2 �g, 4th lane) wasadded. Protein-DNA complexes were visualized by autoradiography. * indicates the band of interest.C, cytosolic extracts from t-HBEC treated with PlGF at the indicated times (1– 8 h) were subjected toWestern blotting to detect Egr-1, HIF-1�, FLAP, 5-LO, and �-actin proteins using appropriate antibodies.D, HPMVEC were cotransfected with either control reporter plasmid (pCtrl-Luc) or pEgr-1Luc (containingfour repeats of Egr-1-binding sites) or pEgr-1-Luc along with Nab2 WT expression plasmid or pEgr-1-Lucalong with Nab2 mutant (Nab2:�NCD2) plasmid and �-galactosidase plasmid prior to PlGF treatment for4 h. Each construct was used at 0.5 �g for transfection. Luciferase and �-galactosidase activities weremeasured in cell lysates as described under “Experimental Procedures.” The data represent the means �S.E. of three independent experiments. Where indicated, the vertical lines show repositioned lanes from asingle gel. ***, p � 0.001; ns, nonsignificant.

Egr-1 Regulates PlGF-induced HIF-1�

JULY 2, 2010 • VOLUME 285 • NUMBER 27 JOURNAL OF BIOLOGICAL CHEMISTRY 20573

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from

ing of nuclear extract protein(s) from PlGF-treated HPMVECto the oligonucleotide probe containing the consensus Egr-1-binding site was significantly increased (2nd lane), which wascompeted out by 50-fold excess cold probe (3rd lane) as deter-mined by EMSA.Additionally, preincubation of nuclear extractwith Egr-1 antibody supershifted the DNA-protein band (Fig.2B, 4th lane), indicating the specificity of Egr-1 binding.PlGF Augments Egr-1, HIF-1�, 5-LO, and FLAP Protein

Expression in t-HBEC—Because HPMVEC are primary cellsand can be cultured only up to 6–7 passages, we examinedwhether t-HBEC could be utilized as a substitute model. Thelatter cell line was used for studying the effect of PlGF on Egr-1,HIF-1�, FLAP, and 5-LO protein levels. We analyzed the timecourse of PlGF-mediated induction of Egr-1, HIF-1�, FLAP,and 5-LO protein in t-HBEC. PlGF caused a time-dependent(1–8 h) increase in Egr-1, HIF-1�, FLAP, and 5-LO protein

expression in cytosolic extracts ofstimulated t-HBEC (Fig. 2C). Thelevels of Egr-1 protein peaked dur-ing the first 2 h after stimulationfollowed by a decrease from 4 to 8 h.In contrast, the levels of HIF-1�,FLAP, and 5-LO proteins were rela-tively low during the first 2 h fol-lowed by an increase from 4 to 8 hafter stimulation. These resultsshowed that PlGF increased Egr-1protein expression at an early timeperiod, although the increase inHIF-1�, FLAP, and 5-LO proteinsoccurred at a later time point.Nab2 Represses PlGF-induced

Egr-1 Transcriptional Activity—We performed transcription re-porter assays to examine the knownrepressor effect of Nab2 on Egr-1transcriptional activity. HPMVECwere transfected with a luciferasereporter construct containing fourEgr-1-binding sites (pEgr-1-Luc).Upon PlGF treatment of HPMVECtransiently transfected with pEgr-1-luc, we observed a 4-fold increase inluciferase activity, whereasHPMVECtransfected with plasmid lackingEgr-1-binding sites (pCtrl-Luc)did not show increased luciferaseactivity above the basal levels (Fig.2D).WhenHPMVECwere cotrans-fected with Nab2 WT plasmid inaddition to pEgr-1-Luc, there was asignificant reduction in luciferasereporter expression (Fig. 2D). Thisresult was specific because cotrans-fection of reporter with the Nab2mutant (Nab2:�NCD2) caused nosignificant reduction in reporterexpression (Fig. 2D). The interac-

tion of a physiological repressor of Egr-1, namelyNab2, corrob-orates our observation that PlGF-induced responses are medi-ated through Egr-1.PlGF Induced Egr-1 Binding to HIF-1� Promoter—Because

EGR-1 siRNA reduced PlGF-induced HIF-1� mRNA expres-sion in HPMVEC, we analyzed the HIF-1� promoter for thepresence of cis-acting Egr-1-binding elements. In silico analysisof theHIF-1� promoter (�863/�5 bp) revealed the presence ofhigh GC content (67%), multiple Egr-1/Sp1, NF-�B, and AP-1-binding sites, and the absence of a canonical TATA box, asshown in schematic Fig. 3A. To determine whether Egr-1 pro-tein binding occurred within theHIF-1� promoter, EMSA wasperformed utilizing both WT and mutant oligonucleotideprobes corresponding to the Egr-1-binding site at �74/�68 bpof theHIF-1� promoter (Table 1). As shown in Fig. 3B, nuclearextracts from PlGF-treated HPMVEC showed an �3-fold

FIGURE 3. PlGF promotes Egr-1 binding to HIF-1� promoter in vitro (EMSA) and in vivo (ChIP). A, schematicof HIF-1� promoter (�863/�5 bp) indicating the presence of different transcription factor-binding sites,including Egr-1, AP-1, and NF-�B. B, HPMVEC nuclear extracts (10 �g) were incubated either with a biotinylatedWT or with mutant oligonucleotide probe corresponding to the proximal Egr-1-binding site (ERE) (�74/�68bp) in the HIF-1� promoter. Where indicated, a 50-fold excess of unlabeled WT probe (3rd lane) or Egr-1antibody (2 �g, 4th lane) was added. * denotes supershifted band. C, HPMVEC were pretreated with indicatedpharmacological inhibitors for 30 min prior to PlGF treatment for 2 h. The chromatin samples were immuno-precipitated with either Egr-1 antibody (1st and bottom panels) or control rabbit IgG (3rd panel). ChIP productswere amplified using primers either flanking the Egr-1-binding sites in HIF-1� promoter or corresponding tothe FLAP promoter region (�310/�9 bp, bottom panel) as indicated in Table 1. The 2nd panel shows amplifi-cation of input DNA prior to immunoprecipitation. Data are representative of two independent experiments.D, HPMVEC transfected with p9HIF1-Luc construct (containing nine repeats of HRE) along with �-galactosidaseplasmid were cotransfected with either Nab2 WT or mutant (Nab2:�NCD2) expression plasmid prior to 6 h ofPlGF stimulation. Each construct was used at 0.5 �g for transfection. Luciferase and �-galactosidase activitieswere estimated as mentioned under “Experimental Procedures.” The data represent the means � S.E. of threeindependent experiments. The repositioned lanes from a single gel are indicated as vertical lines. ***, p � 0.001;ns, nonsignificant.

Egr-1 Regulates PlGF-induced HIF-1�

20574 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 27 • JULY 2, 2010

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from

increase in Egr-1 binding to WT probe (2nd lane) comparedwith untreated cells (1st lane). Furthermore, the DNA bindingactivity was reduced upon addition of a 50-fold excess of unla-beledWT probe (Fig. 3B, 3rd lane) to the nuclear extracts fromPlGF-treated HPMVEC. Moreover, Egr-1 antibody super-shifted the DNA-protein complexes, indicating the specificityof Egr-1 binding (Fig. 3B, 4th lane). In addition, the mutantoligonucleotide failed to show any DNA binding activity (Fig.3B, 5th lane) as compared withWT probe (Fig. 3B, 2nd lane) innuclear extracts from PlGF-treated HPMVEC. These resultsshowed that Egr-1 protein in the nuclear extracts of PlGF-treated HPMVEC bound to the Egr-1 DNA-binding site at�74/�68 bp of the HIF-1� promoter.

Further validation of Egr-1 protein binding to the HIF-1�promoter was obtained by ChIP analysis of the native chroma-tin from PlGF-treatedHPMVEC. As shown in Fig. 3C, chroma-tin samples immunoprecipitated with Egr-1 antibody led to a3-fold increase in the expected PCR product size of 323 bp,corresponding to the HIF-1� promoter (�455/�132 bp) con-taining at least twoEgr-1-binding sites. The amplification of theChIP productwas significantly reduced by pretreatment of cellswith either antibody to VEGFR1 or curcumin, a putative Egr-1inhibitor (37). The amplification of input DNA was equal in allthe samples (Fig. 3C, 2nd panel), and immunoprecipitationwith control rabbit IgG did not amplify any product (Fig. 3C,3rd panel). Next, we examined whether Egr-1 also regulatedFLAPmRNA expression by directly binding to its promoter invivo. As shown in Fig. 3C, bottom panel, immunoprecipitationof chromatin from PlGF-treated HPMVEC with an Egr-1 anti-

body did not show amplification of aPCR product corresponding to the�310/�9 bp region of the FLAPpromoter. Taken together, theseresults showed that Egr-1 binds spe-cifically to the HIF-1� promoter toaugment HIF-1� transcription butnot to the FLAP promoter inHPMVEC.Nab2 Represses PlGF-induced

HIF-1� Transcriptional Activity—Next, we examined whether PlGFmediated Egr-1 increase was directlyassociated with transcriptional acti-vation of HIF-1�. Transfection ofHPMVEC with a luciferase reporterconstruct (p9HIF-1�-Luc) con-taining nine hypoxia-response ele-

ments (HRE), showed a 5-fold increase in luciferase activityupon PlGF treatment (Fig. 3D, lane 2) compared withuntreated cells (lane 1). PlGF-induced HRE luciferase activ-ity was significantly attenuated in cells overexpressing Nab2WT protein (Fig. 3D, lane 3). However, expression of Nab2mutant protein did not significantly reduce HRE luciferaseactivity (Fig. 3D, lane 4). The overexpression of Nab2 WTand Nab2 mutant proteins had no effect on HRE luciferaseactivity, in the absence of PlGF treatment (data not shown).These results showed that PlGF mediated induction of HREactivity could be repressed by Nab2, a repressor of Egr-1,supporting the role of Egr-1 in transactivation of HIF-1�.PlGF-induced HIF-1� Promoter Activation Requires Egr-1

and Is Repressed by Nab2—To further verify the role of Egr-1in the regulation of HIF-1� transcription, HPMVEC werecotransfected with HIF-1� promoter plasmid (phHIF1A(�863/�5)-Luc) and EGR-1 siRNA. As shown in Fig. 4A, PlGFincreased HIF-1� promoter activity by 4-fold, which wasreduced by EGR-1 siRNA but not with scEGR-1 siRNA. More-over, cotransfection of phHIF1A (�863/�5)-Luc with Egr-1expression plasmid in HPMVEC resulted in a 5-fold increase inHIF-1� promoter activity, in the absence of PlGF treatment(Fig. 4B, lane 2) compared with cells transfected with an emptyvector (Fig. 4B, lane 1). Additionally, Egr-1-mediated HIF-1�promoter activation was attenuated by cotransfection withNab2 WT expression plasmid. However, cotransfection withNab2 mutant lacking Egr-1 binding ability, did not affectHIF-1� reporter activity. These results showed that overex-

FIGURE 4. Role of Egr-1 and Nab2 in PlGF-induced HIF-1� promoter activity. HPMVEC transfected with theHIF-1� promoter construct phHIF1A (�863/�5 bp)-Luc along with �-galactosidase plasmid were eithercotransfected with indicated siRNA (A) or with expression plasmids (B) prior to 6 h of PlGF stimulation. Eachconstruct was used at 0.5 �g for transfection. Estimation of luciferase and �-galactosidase activities was carriedout as described under “Experimental Procedures.” The data represent the means � S.E. of three independentexperiments. ***, p � 0.001; ns, nonsignificant.

TABLE 1Oligonucleotide primers used in this studyThe abbreviations used are as follows: ERE, Egr-1 responsive element; SDM, site-directed mutagenesis. Bold and underlined sequences represent the specific mutations.

Gene/fragment location Method Forward sequence Reverse sequence

Human HIF-1� qRT-PCR ctcaaagtcggacagcctca ccctgcagtaggtttctgctHuman FLAP qRT-PCR tctacactgccaaccagaac acggacatgaggaacaggHuman EGR-1 qRT-PCR tcaggcggacacgggcgagc tgcgcagctcaggggtgggcHuman NAB2 qRT-PCR gaccctgcagcccagactc ccaggcagtggtgatagcttcERE (�380/�372 bp) in HIF-1� promoter EMSA aggcgagcgggcgcgctcccg cgggagcgcgcccgctcgcctERE-mutant in HIF-1� promoter EMSA Aggcgagctagcgcgctcccg cgggagcgcgctagctcgcctHRE (�170/�167 bp) in FLAP promoter EMSA ctggctttgcgtgctcctctg cagaggagcacgcaaagccagHRE mutant in FLAP promoter EMSA ctggctttgaaagctcctctg cagaggagctttcaaagccagFLAP promoter (�310/�9 bp) ChIP cagagatgatggcagcttcca aaggggaagtgagagcttgcaHIF-1� promoter (�455/�154 bp) ChIP attggatctcgaggaacccgc cccctcgtgagactagagaga

Egr-1 Regulates PlGF-induced HIF-1�

JULY 2, 2010 • VOLUME 285 • NUMBER 27 JOURNAL OF BIOLOGICAL CHEMISTRY 20575

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from

pression of Egr-1 protein stimulatedHIF-1� promoter activity,in the absence of PlGF stimulation. Taken together, theseresults clearly suggest that Egr-1 was directly responsible forinducing HIF-1� promoter activity and that induction wasantagonized by the physiological repressor Nab2.Egr-1 Increases FLAPmRNAExpression viaHIF-1�—In silico

analysis of the FLAP promoter did not reveal the presence ofEgr-1-binding sites, thuswe examinedwhether the Egr-1medi-ated induction of FLAP promoter activity was dependent onHIF-1�. As shown in Fig. 5A, lane 2, PlGF increased FLAP pro-moter (�371FLAP-Luc) activity by 4-fold. Similarly, overex-pression of Egr-1 achieved the same result, leading to a 6-foldincrease inFLAPpromoter activity (Fig. 5A, lane 3), in the absenceof PlGF treatment. Moreover, cotransfection of HPMVEC withEgr-1 expression plasmid along withHIF-1� siRNA, resulted insignificantly reduced FLAP promoter activity (Fig. 6A, lane 4).Cotransfection of Egr-1 expression plasmid with scHIF-1�siRNA did not show any inhibition in Egr-1 induced FLAP pro-moter activity, as expected (Fig. 5A, lane 5). The involvement of

HIF-1� in FLAP promoter activa-tion, as a positive control, was con-firmed in HPMVEC by overexpres-sion of HIF-1�, which led to a 5-foldincrease in FLAP promoter activity(Fig. 5A, lane 6), independent ofPlGF stimulation. These resultsshowed that Egr-1 mediated FLAPpromoter activation occurred viaHIF-1�.Next, we examined whether

Nab2 affected the mRNA levels ofbothHIF-1� and FLAP. As shown inFig. 5B, PlGF treatment of HPMVECfor 6 h resulted in a 3- and 4-foldincrease in the mRNA levels ofHIF-1� and FLAP, respectively.However, overexpression of WTNab2, but not mutant Nab2 pro-tein, led to significantly reducedlevels of both HIF-1� and FLAPmRNA in response to PlGF treat-ment of transfected HPMVEC.The overexpression of both WTand mutant NAB2 mRNA wasconfirmed by qRT-PCR, whichshowed an increase of both WTand mutant NAB2 mRNAs by 2.5-fold, compared with untransfectedcells (Fig. 5B). In addition, trans-fection of Nab2 WT but not Nab2mutant reduced PlGF-mediatedimmunoreactive LTB4 release (sup-plemental Fig. S1C). These resultsshowed that Nab2 reduced PlGF-induced mRNA expression of bothHIF-1� and FLAP corroboratingthe upstream role of Egr-1.PlGF-mediated FLAP Expression

in HPMVEC Involves Activation of HIF-1� but Not of NF-�B—Because transcriptional activation can be cell- and tissue-sen-sitive, we examined whether PlGF-mediated FLAP expressionin HPMVEC involved the same set of transcription factors aswas observed in THP-1 monocytic cells and peripheral bloodmonocytes (13). We used WT �371FLAP-Luc and differentmutant constructs as described previously (13). There was a4-fold increase in WT FLAP promoter activity, in response toPlGF treatment of HPMVEC, whereas cells transfected withpromoter mutations in HRE site-1 (HIF-1�-M1) or HRE site-2(HIF-1�-M2) showed reduced activity by 50% (Fig. 5C). Moreimportantly, mutation of both HRE sites (HIF-1�-M1 � 2) inthe FLAP promoter showed maximum inhibition (80%) inPlGF-induced FLAP promoter activity. In contrast, an NF-�Bmutant construct did not affect PlGF-induced FLAP promoteractivity (Fig. 5C). These results demonstrated that both HREsites, but not the promoter proximal NF-�B site, were essentialfor PlGF-induced FLAP promoter activity in HPMVEC, as wasobserved previously in monocytes (13).

FIGURE 5. Egr-1 regulates FLAP mRNA expression through HIF-1�. A, HPMVEC transfected with �371FLAP-Luc promoter construct along with �-galactosidase plasmid were either cotransfected with the indicatedexpression plasmid or with siRNA construct prior to PlGF exposure for 6 h. Each construct was used at 0.5 �g fortransfection. Luciferase and �-galactosidase activities were estimated as described under “Experimental Pro-cedures.” ***, p � 0.001; ns, nonsignificant. B, qRT-PCR analysis of EGR-1, NAB2, HIF-1�, and FLAP in untreatedand PlGF-treated HPMVEC. Where indicated, HPMVEC were transfected with either NAB WT or Nab2 mutantconstruct. C, HPMVEC were cotransfected with either WT (�371FLAP-Luc) or mutant FLAP promoter constructs(HRE-M1 or HRE-M2 or HRE-M1�2 or NF-�B) and �-galactosidase plasmid, followed by PlGF treatment for 6 h.The luciferase activity was normalized with that of the promoter-less pGL3 basic vector. The data representmeans � S.E. of three independent experiments. ***, p � 0.001; **, p � 0.01; ns, nonsignificant. D, HPMVEC werepretreated with either ascorbate or LY294002 or diphenyleneiodonium (DPI) prior to PlGF stimulation for 4 h.The chromatin samples were subjected to immunoprecipitation with either HIF-1� antibody (1 �g, upperpanel) or control rabbit IgG (1 �g, lower panel). Purified DNA was PCR-amplified with the primers (listed in Table1) corresponding to the region containing both HRE sites (�310/�9 bp) in the FLAP promoter. The input DNApanel represents the amplification of samples before immunoprecipitation. Data are representative of threeindependent experiments.

Egr-1 Regulates PlGF-induced HIF-1�

20576 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 27 • JULY 2, 2010

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from

The role of HRE sites in PlGF-induced FLAP expression wasfurther substantiated by demonstrating increased HIF-1�-DNA binding activity in vitro by EMSA (supplemental Fig. S2)and in vivo by ChIP (Fig. 5D). HPMVEC treated with PlGFshowed a 4-fold increase in expected PCR product of 319-bpsize corresponding to the FLAP promoter region (�310/�9 bp)containing two HRE sites (Fig. 5D, upper panel). Chromatinsamples from HPMVEC preincubated with ascorbate,LY294002, and diphenyleneiodonium followed by PlGF treat-ment showed reduced amplification of expected PCR productby 75%. The amplification of input DNA before immunopre-cipitation was equal in all the samples (Fig. 5D, middle panel).In addition, samples immunoprecipitated with control rabbitIgG did not amplify any products (Fig. 5D, lower panel). Theseresults indicate that PlGF increases FLAPmRNA expression bypromoting HIF-1� binding to FLAP promoter in HPMVEC.Thus, PlGF mediated FLAP transcription in hematopoieticcells, and endothelial cells utilize the same set of transcriptionfactors.

DISCUSSION

In this study, we showed that PlGF, a member of VEGF fam-ily, increased mRNA expression of 5-LO and FLAP in humanpulmonary microvascular endothelial cells. Most importantly,we identified the molecular mechanisms of PlGF-mediatedHIF-1� induction in a hypoxia-independentmanner. The effectwas specific for PlGF, as VEGF-A, potent angiogenic factor, didnot augment the expression ofHIF-1�, 5-LO, and FLAPmRNA.Our results show that PlGF increased levels of the Egr-1 tran-scription factor, which in turn regulated the transcription ofHIF-1�. To the best of our knowledge, this work is the firstreport that defines the relationship between Egr-1 andHIF-1�.

Our studies identified a role for the transcription factor Egr-1in regulation of PlGF-induced HIF-1� mRNA expression andits downstream target gene FLAP. Our results showed that

EGR-1 siRNA was effective in reducing PlGF-mediated 5-LOand FLAP mRNA expression. The role of Egr-1 in 5-LO tran-scription is consistent with the presence of several GC-boxes inthe human 5-LO gene promoter that are proximal to the tran-scription start site and are recognized by transcription factorsSp1 and Egr-1 (34, 38). However, PlGF-induced FLAP mRNAexpression was attenuated by both EGR-1 siRNA and HIF-1�siRNA, indicating direct or indirect roles of these transcriptionfactors. Previous studies showed that TNF-�- and lipopolysac-charide-induced FLAP promoter activities in THP-1 cellsrequire the first 134 bp of the promoter (�134/�12 bp), whichcontains binding sites for NF-�B and CCAAT/enhancer-bind-ing protein (39, 40). However, we showed that PlGF-inducedFLAP promoter activity in THP-1 cells required HRE, but notthe NF-�B site, in the �371/�12 region of the FLAP promoter(13). In silico analysis of the human FLAP promoter (�371/�12bp) did not reveal the presence of bona fide Egr-1/Sp1 sites.Thus, we hypothesized that Egr-1 may have acted throughHIF-1� to up-regulate the expression of an HIF-1�-regulatedtarget gene, i.e. FLAP. This study showed that PlGF-inducedpromoter activity and mRNA expression of FLAP were attenu-ated by HIF-1� siRNA, which was consistent with our previousfindings in THP-1 cells, indicating that both monocytes andendothelial cells utilize the same signaling pathways for FLAPexpression. Thus, we examined the role of Egr-1 and its repres-sor Nab2 (36) in PlGF-induced transcription of HIF-1�.

Egr-1, a zinc finger transcription factor, preferentially bindsthe GC-rich sequence 5-TGCGT(G/A)GGCGGT-3. Egr-1belongs to a group of early response genes, as stimulation byextracellular stimuli such as growth factors and cytokines rap-idly induces EGR-1 gene expression (41–45). Moreover, Egr-1plays important roles in development, growth control, and dif-ferentiation (45). Egr-1-mediated gene transcription is tightlyregulated by the repressor proteins NAB1 and Nab2 (35, 47).The function of Nab2 as Egr-1 regulator is more importantbecause its expression is shown to be induced by the same sig-nals that lead to EGR-1 expression, whereas NAB1 is constitu-tively expressed in most cells (36). Our studies showed thatPlGF induced EGR-1 in the early phase of induction (first 30min), whereas the NAB2 levels were down-regulated inHPMVEC. This was followed by a reduction in EGR-1 mRNAand a concomitant increase in NAB2mRNA at a later phase ofPlGF induction (1–8 h). This relationship suggested a recipro-cal mode of regulation in PlGF-mediated EGR-1 and NAB2expression in HPMVEC. These findings are in concordancewith a previous study, which showed a temporal association inthe expression of EGR-1 and NAB2, in response to VEGF inendothelial cells (48). However, in this study, stimulation ofHPMVEC with VEGF did not alter mRNA expression of bothEGR-1 and NAB2. The possible explanation for the differencesseen in the studies is perhaps the result of differences in endo-thelial cell type, dose, and/or duration of VEGF stimulation ofHPMVEC. Furthermore, our results showed that WT Nab2abrogated PlGF-driven Egr-1 transcriptional activity, whereas adominant negative mutant Nab2 expression plasmid (Nab2:�NCD2) had no effect on PlGF-induced Egr-1 transcriptionalactivation. There are at least two separable repression domains

FIGURE 6. Schematics of the PlGF-mediated regulation of gene expres-sion in endothelial cells. PlGF stimulation of endothelial cells leads to anearly increase in Egr-1 protein, which regulates the transcription of 5-LO andHIF-1� gene by binding to their respective promoters. HIF-1� protein trans-locates to the nucleus, binds with its partner HIF-1�, and stimulates transcrip-tion of FLAP after binding to HREs. Subsequently, the increased expression of5-LO and FLAP leads to elevated levels of LT, which may promote the adhe-sion and migration of leukocytes from blood to the alveolar space of lungscontributing to organ injury.

Egr-1 Regulates PlGF-induced HIF-1�

JULY 2, 2010 • VOLUME 285 • NUMBER 27 JOURNAL OF BIOLOGICAL CHEMISTRY 20577

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from

in Nab2 (NCD1 and NCD2), and the NCD2 region in Nab2 isessential for repressing transcription of Egr-1 (49).Egr-1 coregulates expression of a number of genes contain-

ing similar GC-rich sequences, by displacing Sp1 binding fromthese promoters (26, 27, 34). An examination of the 5-UTRregion of the HIF-1� gene shows several GC-rich sequences,known to be constitutively regulated by Sp1-binding sites (25).Our results showed that Egr-1 has an essential role for PlGF-induced HIF-1� transcription through direct interaction withtheHIF-1� promoter in HPMVEC.We identified several puta-tive Egr-1-binding sites in the promoter of HIF-1�, and wedemonstrated that PlGF promotes the functional binding ofEgr-1 to at least one of its binding sites (�74/�68 bp) present inthe HIF-1� promoter, as demonstrated by EMSA. Consistentwith this observation, ChIP analysis showed increasedamplification of the HIF-1� promoter region (�455/�154bp) containing Egr-1-binding sites in the chromatin of PlGF-treated cells when immunoprecipitated with Egr-1 antibody.Furthermore, PlGF-mediated HIF-1� promoter activationwas inhibited by EGR-1 siRNA. In addition, Egr-1 overex-pression stimulated HIF-1� promoter activity, which wascompletely abolished by coexpression of WT Nab2 proteinbut not by Nab2 mutant protein. Thus, our results are in linewith previous findings where Nab2 inhibited VEGF-inducedtissue factor promoter activity (48). Recent studies haveimplicated cross-talk between NF-�B and HIF-1� genes,where NF-�B regulatesHIF-1� promoter activity andmRNAexpression in response to H2O2, short duration hypoxia, andTNF-� (20, 21, 50). Thus, the possibility of PlGF-mediatedactivation of HIF-1� through indirect stimulation of NF-�Bcannot be ruled out.Endothelial cells are generally thought to be incapable of car-

rying out the conversion of AA to LTA4, because these cells donot express 5-LO enzyme (51). However, they express LTA4hydrolase and LTC4 synthetase enzymes, which can generateLTB4 and LTC4, respectively, from exogenous LTA4. In addi-tion, other studies have identified the transcellular mode ofcysteinyl-LT biosynthesis (8, 52) by uptake of LTA4, which issecreted from neighboring activated peripheral blood leuko-cytes after their adhesion to vascular endothelium (53). Conse-quently, a direct role of endothelial cells as an independentsource of LT has not been widely accepted. However, low levelsof expression of 5-LO have been detected in PAEC (33). In thisstudy, 5-LO mRNA expression was undetectable in HPMVECat resting stage by both RPA and qRT-PCR, which was inducedupon PlGF treatment. Our findings of PlGF-induced 5-LOexpression in HPMVEC are consistent with previous studies ofincreased 5-LO expression in PAEC of patients with primarypulmonary hypertension (54) and in rats exposed to chronichypoxia (46). Our results showed that PlGF up-regulates FLAPmRNA expression by activation of PI3K, NADPH oxidase, andHIF-1� in HPMVEC as reported previously for PlGF-inducedFLAP expression in THP-1 monocytes (13). Previously, weshowed that PlGF increases ET-1mRNAexpression inHPMVEC(17). Consistent with our earlier findings (17), we observed anincrease inHIF-1� mRNA in HPMVEC in response to PlGF. Inthis study we show that PlGF induced 5-LO and FLAP expres-sion in both HPMVEC and t-HBEC.

Finally, the functional significance of Egr-1-inducedHIF-1� was established by showing the transactivation of itstarget genes such as FLAP. In silico analysis showed that theFLAP promoter lacks Egr-1-binding sites. However, overex-pression of Egr-1 in HPMVEC resulted in increased FLAPpromoter activity, which was completely abrogated uponsilencing ofHIF-1�. Thus, we concluded that Egr-1 regulatesFLAP mRNA expression by first activating HIF-1� geneexpression. In addition, the Egr-1 repressor Nab2 signifi-cantly reduced the expression of both downstream genes,HIF-1� and FLAP, in response to PlGF stimulation ofHPMVEC. The direct role of HIF-1� in PlGF-induced FLAPexpression was confirmed by different approaches, includingsilencing with HIF-1� siRNA, site-directed mutagenesis of theFLAP promoter, EMSA (supplemental Fig. S2), and ChIP anal-ysis. The results obtained in this study were consistent with ourprevious report of PlGF-induced FLAP expression in mono-cytes (13).In conclusion, we show that PlGF-induced HIF-1� expres-

sion was mediated by Egr-1 and that the Egr-1/HIF1� pathwaycarried out PlGF-mediated induction of FLAP mRNA expres-sion in endothelial cells (as illustrated in Fig. 6). Experimentsdefining the molecular signaling pathway(s) responsible forPlGF-mediated Egr-1 induction are currently in progress andwill further enhance our understanding of the role of PlGF inpathophysiological complications of SCD.

Acknowledgments—We thankDr. John Svaren (University ofWiscon-sin, Madison) for kindly providing Nab2 (WT and mutant), pEgr-1-Luc (containing four repeats of Egr-1-binding sites), and controlpCtrl-Luc constructs. We also thank Dr. Jaroslow Dastych (PolishAcademy of Sciences, Poland) for providing phHIF-1A (�863/�5 bp)-Luc construct, Dr. Ruo-Pan Huang (Emory University, Atlanta, GA)for providing Egr-1 expression plasmid (pCMV-neo-Egr-1), and Dr.Timothy Bigby (Veterans Affairs Hospital SanDiego, La Jolla, CA) forproviding �371FLAP-Luc construct. We thank Dr. Michael StallcupandDr.Michael Kahn (University of SouthernCaliforniaKeck Schoolof Medicine, Los Angeles) for providing HIF-1� expression plasmidand p9HIF-1-Luc (containing nine repeats of HRE), respectively. WethankDr. Stanley Tahara for critical review of themanuscript and forinvaluable suggestions during the course of this study. We also thankthe Institutional Core of University of Southern California ResearchCenter for Liver Disease for the use of a sequence detection instrument(supported by National Institutes of Health Grant P30-DK 048522).

REFERENCES1. Lewis, R. A., Austen, K. F., and Soberman, R. J. (1990)N. Engl. J. Med. 323,

645–6552. Samuelsson, B., Dahlen, S. E., Lindgren, J. A., Rouzer, C. A., and Serhan,

C. N. (1987) Science 237, 1171–11763. Zhao, L., Moos,M. P., Grabner, R., Pedrono, F., Fan, J., Kaiser, B., John, N.,

Schmidt, S., Spanbroek, R., Lotzer, K., Huang, L., Cui, J., Rader, D. J., Evans,J. F., Habenicht, A. J., and Funk, C. D. (2004) Nat. Med. 10, 966–973

4. Funk, C. D. (2001) Science 294, 1871–18755. Peters-Golden, M., and Henderson, W. R., Jr. (2007) N. Engl. J. Med. 357,

1841–18546. Ferguson, A. D., McKeever, B. M., Xu, S., Wisniewski, D., Miller, D. K.,

Yamin, T. T., Spencer, R. H., Chu, L., Ujjainwalla, F., Cunningham, B. R.,Evans, J. F., and Becker, J. W. (2007) Science 317, 510–512

7. Gronert, K., Clish, C. B., Romano, M., and Serhan, C. N. (1999) Methods

Egr-1 Regulates PlGF-induced HIF-1�

20578 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 27 • JULY 2, 2010

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from

Mol. Biol. 120, 119–1448. Folco, G., and Murphy, R. C. (2006) Pharmacol. Rev. 58, 375–3889. Kanaoka, Y., and Boyce, J. A. (2004) J. Immunol. 173, 1503–151010. Setty, B. N., and Stuart, M. J. (2002) J. Lab. Clin. Med. 139, 80–8911. Jennings, J. E., Ramkumar, T., Mao, J., Boyd, J., Castro, M., Field, J. J.,

Strunk, R. C., and DeBaun, M. R. (2008) Am. J. Hematol. 83, 640–64312. Perelman, N., Selvaraj, S. K., Batra, S., Luck, L. R., Erdreich-Epstein, A.,

Coates, T. D., Kalra, V. K., and Malik, P. (2003) Blood 102, 1506–151413. Patel, N., Gonsalves, C. S., Yang, M., Malik, P., and Kalra, V. K. (2009)

Blood 113, 1129–113814. Semenza, G. L. (2000) J. Appl. Physiol. 88, 1474–148015. Seagroves, T. N., Ryan, H. E., Lu, H., Wouters, B. G., Knapp, M., Thibault,

P., Laderoute, K., and Johnson, R. S. (2001)Mol. Cell. Biol. 21, 3436–344416. Hon,W. C.,Wilson,M. I., Harlos, K., Claridge, T. D., Schofield, C. J., Pugh,

C. W., Maxwell, P. H., Ratcliffe, P. J., Stuart, D. I., and Jones, E. Y. (2002)Nature 417, 975–978

17. Patel, N., Gonsalves, C. S., Malik, P., and Kalra, V. K. (2008) Blood 112,856–865

18. Fukuda, R., Hirota, K., Fan, F., Jung, Y. D., Ellis, L. M., and Semenza, G. L.(2002) J. Biol. Chem. 277, 38205–38211

19. Blouin, C. C., Page, E. L., Soucy,G.M., andRichard,D. E. (2004)Blood103,1124–1130

20. van Uden, P., Kenneth, N. S., and Rocha, S. (2008) Biochem. J. 412,477–484

21. Belaiba, R. S., Bonello, S., Zahringer, C., Schmidt, S., Hess, J., Kietzmann,T., and Gorlach, A. (2007)Mol. Biol. Cell 18, 4691–4697

22. Frede, S., Stockmann,C., Freitag, P., and Fandrey, J. (2006)Biochem. J.396,517–527

23. Rius, J., Guma, M., Schachtrup, C., Akassoglou, K., Zinkernagel, A. S.,Nizet, V., Johnson, R. S., Haddad, G. G., and Karin, M. (2008)Nature 453,807–811

24. Iyer,N.V., Leung, S.W., and Semenza,G. L. (1998)Genomics 52, 159–16525. Minet, E., Ernest, I., Michel, G., Roland, I., Remacle, J., Raes, M., and

Michiels, C. (1999) Biochem. Biophys. Res. Commun. 261, 534–54026. Khachigian, L.M.,Williams, A. J., andCollins, T. (1995) J. Biol. Chem. 270,

27679–2768627. Mackman, N., Morrissey, J. H., Fowler, B., and Edgington, T. S. (1989)

Biochemistry 28, 1755–176228. Kim, K. S., Rajagopal, V., Gonsalves, C., Johnson, C., and Kalra, V. K.

(2006) J. Immunol. 177, 7211–722429. Stins, M. F., Shen, Y., Huang, S. H., Gilles, F., Kalra, V. K., and Kim, K. S.

(2001) J. Neurovirol. 7, 3944–400330. Giri, R. K., Selvaraj, S. K., and Kalra, V. K. (2003) J. Immunol. 170,

5281–529431. Selvaraj, S. K., Giri, R. K., Perelman, N., Johnson, C., Malik, P., and Kalra,

V. K. (2003) Blood 102, 1515–152432. Kang, J., Ramu, S., Lee, S., Aguilar, B., Ganesan, S. K., Yoo, J., Kalra, V. K.,

Koh, C. J., and Hong, Y. K. (2009) Anal. Biochem. 386, 251–255

33. Zhang, Y. Y., Walker, J. L., Huang, A., Keaney, J. F., Clish, C. B., Serhan,C. N., and Loscalzo, J. (2002) Biochem. J. 361, 267–276

34. Silverman, E. S., Du, J., De Sanctis, G. T., Rådmark, O., Samuelsson, B.,Drazen, J. M., and Collins, T. (1998) Am. J. Respir. Cell Mol. Biol. 19,316–323

35. Houston, P., Campbell, C. J., Svaren, J., Milbrandt, J., and Braddock, M.(2001) Biochem. Biophys. Res. Commun. 283, 480–486

36. Svaren, J., Sevetson, B. R., Apel, E. D., Zimonjic, D. B., Popescu, N. C., andMilbrandt, J. (1996)Mol. Cell. Biol. 16, 3545–3553

37. Giri, R. K., Rajagopal, V., and Kalra, V. K. (2004) J. Neurochem. 91,1199–1210

38. Rådmark, O., and Samuelsson, B. (2009) J. Lipid Res. 50, S40–S4539. Serio, K. J., Reddy, K. V., andBigby, T.D. (2005)Am. J. Physiol. Cell Physiol.

288, C1125–C113340. Reddy, K. V., Serio, K. J., Hodulik, C. R., and Bigby, T. D. (2003) J. Biol.

Chem. 278, 13810–1381841. Wu, S. Q., Minami, T., Donovan, D. J., and Aird, W. C. (2002) Blood 100,

4454–446142. Rong, Y., Hu, F., Huang, R., Mackman, N., Horowitz, J. M., Jensen, R. L.,

Durden, D. L., Van Meir, E. G., and Brat, D. J. (2006) Cancer Res. 66,7067–7074

43. Mechtcheriakova, D., Schabbauer, G., Lucerna,M., Clauss,M., DeMartin,R., Binder, B. R., and Hofer, E. (2001) FASEB J. 15, 230–242

44. Yan, S. F., Zou, Y. S., Gao, Y., Zhai, C., Mackman, N., Lee, S. L., Milbrandt,J., Pinsky, D., Kisiel, W., and Stern, D. (1998) Proc. Natl. Acad. Sci. U.S.A.95, 8298–8303

45. Yan, S. F., Fujita, T., Lu, J., Okada, K., Shan Zou, Y., Mackman, N., Pinsky,D. J., and Stern, D. M. (2000) Nat. Med. 6, 1355–1361

46. Voelkel, N. F., Tuder, R. M., Wade, K., Hoper, M., Lepley, R. A., Goulet,J. L., Koller, B. H., and Fitzpatrick, F. (1996) J. Clin. Invest. 97, 2491–2498

47. Kumbrink, J., Gerlinger, M., and Johnson, J. P. (2005) J. Biol. Chem. 280,42785–42793

48. Lucerna, M., Mechtcheriakova, D., Kadl, A., Schabbauer, G., Schafer, R.,Gruber, F., Koshelnick, Y., Muller, H. D., Issbrucker, K., Clauss, M.,Binder, B. R., and Hofer, E. (2003) J. Biol. Chem. 278, 11433–11440

49. Srinivasan, R., Mager, G. M., Ward, R. M., Mayer, J., and Svaren, J. (2006)J. Biol. Chem. 281, 15129–15137

50. Bonello, S., Zahringer, C., BelAiba, R. S., Djordjevic, T., Hess, J., Michiels,C., Kietzmann, T., andGorlach, A. (2007)Arterioscler. Thromb. Vasc. Biol.27, 755–761

51. Miller, D. K., Sadowski, S., Soderman, D. D., and Kuehl, F. A., Jr. (1985)J. Biol. Chem. 260, 1006–1014

52. Zarini, S., Gijon, M. A., Ransome, A. E., Murphy, R. C., and Sala, A. (2009)Proc. Natl. Acad. Sci. U.S.A. 106, 8296–8301

53. Feinmark, S. J., and Cannon, P. J. (1986) J. Biol. Chem. 261, 16466–1647254. Wright, L., Tuder, R. M., Wang, J., Cool, C. D., Lepley, R. A., and Voelkel,

N. F. (1998) Am. J. Respir. Crit. Care Med. 157, 219–229

Egr-1 Regulates PlGF-induced HIF-1�

JULY 2, 2010 • VOLUME 285 • NUMBER 27 JOURNAL OF BIOLOGICAL CHEMISTRY 20579

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from

Nitin Patel and Vijay K. Kalra) in Endothelial CellsαHIF-1 (αHypoxia-inducible Factor-1

Placenta Growth Factor-induced Early Growth Response 1 (Egr-1) Regulates

doi: 10.1074/jbc.M110.119495 originally published online May 6, 20102010, 285:20570-20579.J. Biol. Chem. 

  10.1074/jbc.M110.119495Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2010/05/06/M110.119495.DC1

  http://www.jbc.org/content/285/27/20570.full.html#ref-list-1

This article cites 54 references, 32 of which can be accessed free at

by guest on June 25, 2018http://w

ww

.jbc.org/D

ownloaded from