American Journal of Obstetrics and Gynecology (2006) 195, 797–802

www.ajog.org

Placental inflammation and viral infection are implicatedin second trimester pregnancy loss

Sindhu K. Srinivas, MD,a,* Yujie Ma, MD,a Mary D. Sammel, ScD,b Doris Chou, MD,a

Cindy McGrath, MD,c Samuel Parry, MD,a Michal A. Elovitz, MDa

Departments of Obstetrics and Gynecology,a Biostatistics and Epidemiology, Center for Clinical Epidemiology andBiostatistics,b and Pathology and Laboratory Medicine,c University of Pennsylvania Health System, Philadelphia, PA

Received for publication March 2, 2006; revised May 8, 2006; accepted May 31, 2006

KEY WORDSInflammationLate pregnancy loss

ChorioamnionitisViral infection

Objective: Second trimester pregnancy loss continues to be a poorly understood adverse obstetric

outcome. A case control study was performed to determine if: (1) similar to early spontaneouspreterm birth, second trimester loss is associated with histologic chorioamnionitis (HCA); and(2) if HCA is present, which organisms may mediate this placental inflammation.

Study design: Cases were patients with a spontaneous second trimester loss. Controls werepatients who presented for induction of labor for fetal or maternal indications. Nested polymer-ase chain reaction (PCR) was performed on placental tissues to detect the presence of viruses and

pathogenic and atypical bacteria. Chi-square and Fisher exact test were used to determine if HCAand/or the presence of virus or bacteria were significantly associated with second trimester loss.The associations of interest were adjusted for possible confounders using multivariable logisticregression.

Results: HCA was more prevalent in cases (67%) than controls (16%) (P ! .001). Seventy-ninepercent (66/84) of cases and 44% (7/16) of controls were positive for any virus (P= .01). The rateof bacterial infection was similar in both cases and controls (P = .35). In multivariable logistic

regression models, HCA (odds ratio [OR] 14.58, 2.62-81.15) and the presence of any virus (OR6.62, 1.56-28.07) were independently associated with second trimester loss.Conclusion: These studies demonstrate that spontaneous second trimester loss is strongly asso-

ciated with HCA and viral infections.� 2006 Mosby, Inc. All rights reserved.

This research was supported by a grant from the National Insti-

tutes of Health to S. Parry (HD42100) and K12 (WRHR Award) to

M. Elovitz.

Presented at the Twenty-Sixth Annual Meeting of the Society for

Maternal Fetal Medicine, Miami, FL, January 30-February 4, 2006.

* Reprint requests: Sindhu Srinivas, MD, University of Pennsylva-

nia Medical Center, 2000 Courtyard Bldg, 3400 Spruce Street, Phila-

delphia, PA 19104.

E-mail: ssrinivas@obgyn.upenn.edu

0002-9378/$ - see front matter � 2006 Mosby, Inc. All rights reserved.

doi:10.1016/j.ajog.2006.05.049

Second trimester pregnancy loss is defined as apregnancy loss after the 14th week of gestation and isestimated to complicate approximately 1% to 2% ofpregnancies.1,2 This obstetric complication has beenreported to be associated with uterine malformations,infection, cervical insufficiency, fetal and placentalanomalies, and genetic and acquired thrombophilias.3,4

Current available literature is confounded by inclusion

798 Srinivas et al

of patients beyond 24 weeks’ gestation and thus involvescases of spontaneous preterm birth. Consequently, nomajor etiologic factors have been described specificallyfor second trimester pregnancy loss between 14 and 24weeks. By investigating potential causes, feasible preven-tion and treatment strategies may be discovered.

There is a growing body of evidence correlatinginfection and/or inflammation with spontaneous pre-term birth, especially those occurring at less than 28weeks of gestation.5,6 One study demonstrated thatapproximately 85% of preterm births at less than 28weeks’ gestation were associated with histologic chorio-amnionitis (HCA).7 Similarly, another study found thatthe frequency and severity of chorioamnionitis were in-versely related to gestational age and preterm birth.8

However, despite this growing body of evidence forearly spontaneous preterm birth, there are little dataregarding infection/inflammation and spontaneous sec-ond trimester pregnancy loss. One inner city universityhospital study reported a 56.7% prevalence of HCAamong 67 cases of midtrimester pregnancy loss. Thatstudy, while implicating inflammation in second trimes-ter loss, was limited by its retrospective nature and thelack of a control group.9 For this study, our aims were(1) to determine the association between second trimes-ter loss and HCA, (2) to determine if viral or bacterialpathogens are associated with HCA in second trimesterpregnancy loss, and (3) to determine if maternal demo-graphic characteristics and/or obstetric history areassociated with HCA and second trimester loss.

Material and methods

A case control study of women with a second trimesterpregnancy loss at the Hospital of the University ofPennsylvania was performed between 2002 and 2004.Cases were defined as women who presented with aspontaneous second trimester delivery and controlswere women induced in the second trimester. The studywas conducted with approval from the University ofPennsylvania institutional review board.

Study subjects were identified during their admissionto the labor and delivery unit. All patients at ourinstitution with a pregnancy loss at greater than 14weeks’ gestation are managed by the Obstetrics andGynecology service. Our inclusion criteria were womenwith a singleton pregnancy who presented with a spon-taneous second trimester pregnancy loss secondary topreterm premature rupture of membranes (PPROM),premature labor, or cervical insufficiency. All womenwho had a pregnancy loss between 14 weeks, 0 days and23 weeks, 6 days were included in the study as cases.Controls included all singleton pregnancies presentingfor second trimester induction of labor for congenitalanomalies or maternal medical indications. Women withmultifetal pregnancies and intrauterine fetal demise were

excluded because these losses may be due to differentmechanisms than spontaneous miscarriage. For bothgroups, various demographic characteristics were col-lected through a chart review utilizing a data sheetcompleted at the time of enrollment. All informationwas collected by the primary investigator (SKS). Theinformation collected for each subject included maternalage, race, place of prenatal care, previous obstetrichistory, estimated gestational age (EGA) at delivery(based on previous documented ultrasound or ultrasoundat time of presentation), fetal sex, cervical dilation onadmission, PPROM on admission (documented by 2 outof 3 criteria of pool, positive nitrazine, and fern on sterilespeculum examination), and presence of contractions.

All placentas were sent for pathologic examination,including those from the 2 women requiring dilatationand curettage in the case group. Experienced pathol-ogists were blinded to the conduct of this study and usedstandard representative sampling techniques to diagnoseHCA and funisitis. HCA was defined as the presence ofneutrophils in the membranes (chorion and/or amnion).Funisitis was defined as the presence of neutrophils inthe umbilical cord and is considered indicative of moresevere inflammation than HCA alone.

For viral and bacterial studies, a region of theplacental near the basal plate was sampled. DNA wasextracted from case and control placentas using DNeasymini-kits (QIAGEN, Valenia, CA). Two nanograms ofDNA were used for nested polymerase chain reaction(PCR) to detect the presence of various pathogens.Bacterial and viral pathogens that have been associatedwith reproductive complications were studied.10-15 Thefollowing bacteria and viruses were investigated: cyto-megalovirus (CMV), human papilloma virus (HPV-6,-11, -16, -18), adeno-associated virus 2 (AAV-2), Groupbeta streptococcus (GBS), Escherichia coli (E. coli),Ureoplasma urealyticum (U. urealyticum), and Myco-plasma hominis (M. hominis). Primers for each pathogenare presented in Table I.16-20 To ensure that adequateamounts of DNA were extracted from all samples, weperformed nested PCR to detect a 106-base pair segmentof the beta-actin gene.21 Only specimens found to bepositive for b-actin (84 cases and 16 controls) weretested for the presence of virus and bacteria. Appropri-ate negative and positive controls were utilized for allPCR reactions and individualized for each organisminvestigated. To confirm specificity of the PCR product,all PCR products were sequenced. All experiments wereperformed in duplicate.

For our initial analysis, Pearson chi-square and Fisherexact tests were used to examine the difference in prev-alence of HCA and funisitis and presence of viral andbacterial infection between the study and control groups.Stratified analyses were performed to assess confoundingby gestational age, maternal age, and maternal race.Multivariable logistic regression models were then

Srinivas et al 799

employed using all candidate exposure variables havinga bivariate association with P value ! .20 for the out-come aswell as those thought to be biologically important.The final models consisted of exposures with a 2-tailedP value ! .05 while controlling for maternal age andrace, and gestational age. The variable ‘‘any virus’’ is thepresence of at least a single virus in a placental specimen.

Lastly, the association of maternal demographic andobstetric history factors was evaluated for biologic asso-ciation with second trimester pregnancy loss in the cases.After initial bivariate associations were performed, amultivariable logistic regression model was employedwhile controlling for all significant factors from the initialanalysis as described.

Results

We studied 101 cases and 19 controls. The control groupincluded 17 inductions for fetal indications (13 withmultiple anomalies including cardiac and neural tubedefects, 2 aneuploidies, 2 with severe oligohydramnios)and 2 for maternal indications (severe preeclampsia). The2 groups were similar, except that the cases were deliveredat significantly lower gestational ages (19 weeks vs 21 5/7weeks, P = .017) and were more likely to be AfricanAmerican (91% vs 58%, P ! .001) (Table II). Amongthe cases, 53 (52%) presented with PPROM. The remain-ing cases presented with premature labor or cervical in-sufficiency. Both HCA and funisitis were significantlymore common in the cases than in the controls (Table III).

Table I Viral and bacterial pathogens

Pathogen Primer sequence

Beta actin (F) 50- TCCTGTGGCATCCACGAAACT -30

(R) 50 - ATCGTCCACCGCAAATGCTTC -30

CMV (F) 50-GCGTGCTTTTTAGCCTCTGCA-30

(R) 50-AAAAGTTTGTGCCCCAACGGTA-30

HPV 6 (F) 50 - TAGTGGGCCTATGGCTCGTC - 30

(R) 50 – TCCATTAGCCTCCACGGGTG – 30

HPV 11 (F) 50- GGAATACATGCGCCATGTGG -30

(R) 50- CGAGCAGACGTCCGTCCTCG -30

HPV 16 (F) 50- TGCTAGTGCTTATGCAGCAA –30

(R) 50 – ATTTACTGCAACATTGGTAC -30

HPV 18 (F) 50- AAGGATGCTGCACCGGCTGA-30

(R) 50- CACGCACACGCTTGGCAGGT -30

AAV-2 (F) 50-CGACTGTGTCGACAAGATGGTGAT -30

(R) 50-TACCTGTCTGCGTAGTTGATCGAAG- 30

GBS (F) 50 -TTTCACCAGCTGTATTAGAAGTA- 30

(R) 50-GTTCCCTGAACATTATCTTTGAT – 30

E. coli (F) 50-CTGCTGCCTCCGTAGGAGT-30

(R) 50-AGAGTTTGATCCTGGCTCAG-30

U. urealyticum (F) 50-CAATCTGCTCGTGAAGTATTAC-30

(R) 50-ACGACGTCCATAAGCAACT-30

M. hominis (F) 50-CAATGGCTAATGCCGGATACGC-30

(R) 50-AGGTACCGTCAGTCTGCAATC-30

Eighty-four case placentas and 16 controls wereevaluated (beta-actin positive). Seventy-nine percent ofcases and 44% of controls were positive for any virus(P = .01, Table IV). Among cases with HCA, 81% werepositive for the presence of any virus. Within the cases,the presence of any virus was not significantly differentbetween cases with HCA and those without HCA(P = .41). However, we were not powered to look atthis association (power = 4.7%).

No significant associations were found between sec-ond trimester pregnancy loss and any bacteria (U. Urea-lyticum, M. hominis, and GBS) (Table IV). Overall, ourstudy was not powered to find a difference in bacterialpresence between the 2 groups secondary to the low prev-alence of bacteria (power=39%) (Table IV).Escherichiacoli was found to be present in all specimens and wasthought to be a contaminant from the female genital tract,and therefore was not included in the final evaluation.

Multivariable logistic regression was performedbased on findings from the initial analysis (Table V).We developed 4 regression models, all of which con-trolled for maternal age, race, and gestational age.In the first model, the presence of HCA, when controll-ing for maternal age and race, and gestational age, wasindependently associated with pregnancy loss (OR 10.49,2.22-49.6). In the second model, when controlling for

Table II Demographics

Characteristic Study Controls P value

Mean maternalage (y)

26.7 (G7.2) 29.3 (G7.8) .139

RaceBlack 92 (91%) 11 (58%) ! .001Other 9 (9%) 8 (42%) –

Mean gestationalage (wk)

19.3 (G2.6) 21.4 (G2.25) .017

Fetal sexMale 51 (50%) 9 (47%) .293Female 29 (29%) 10 (53%) –Indeterminate 15 (15%) – –Not recorded 6 (6%) – –

Preterm ROM 53 (52%) N/A N/AHistory of preterm

delivery29 (29%) 2 (10%) .096

Statistical significance determined by t test, chi-square, or Fisher exact

tests.

Table III Prevalence of HCA and funisitis

Study group Control group P value

Total 101 19 –HCA 68 (67%) 3 (16%) ! .0001Funisitis 21 (21%) 0 (0%) .02

HCA, Histologic chorioamnionitis. Statistical analysis by Fisher exact

test.

800 Srinivas et al

Table IV Viral and bacterial pathogensdunadjusted analysis

Virus Case (n = 84) Control (n = 16) OR CI P value

Any virus 66 (79%) 7 (44%) 4.71 1.33-16.89 .004CMV 36 (43%) 3 (19%) 3.25 0.80-18.89 .09HPV 48 (57%) 5 (31%) 2.93 0.84-11.63 .10AAV-2 14 (17%) 3 (19%) 0.87 0.2-5.36 1.00Any bacteria* 23 (27%) 3 (19%) 1.63 0.39-9.7 .35GBS 6 (7%) 2 (13%) 0.54 0.085-6.02 .38U. Urealyticum 2 (2%) 0 (0%) – – –M. hominis 19 (23%) 1 (6%) 4.68 0.63-206.3 .18E. coli 84 (100%) 16 (100%) – – –

* Excluding E. coli.

the same factors, the presence of any virus also was as-sociated with pregnancy loss. In the third model, whenevaluating the presence of any virus and the presenceof HCA in the same model, HCA remained significant.In the final model, when evaluating HCA and the pres-ence of CMV and HPV, HCA remained independentlyassociated with pregnancy loss.

Of maternal characteristics evaluated in the cases,only gestational age was significantly associated withHCA (Table VI). In addition, gestational age greaterthan 20 weeks was associated with HCA and funisitis(P = .032 and P = .017, respectively). A linear relation-ship exists between the presence of HCA and funisitisand increasing gestational age (Figure). Based on our re-gression model within the cases, for every 1-week in-crease in gestational age the patient is 23% (OR 1.23,P = .016) more likely to have HCA. Similarly, the like-lihood of funisitis increases by 38% (OR 1.38, P = .01)per week of gestation.

Comment

Our results indicate that HCA and funisitis and viralinfections are significantly associated with second

Table V Multivariable logistic regressiondcases versuscontrols

Variable OR CI P value

Model 1*HCA 10.49 2.22-49.6 .003

Model 2*Any virus 6.63 1.56-28.07 .010

Model 3*HCA 7.85 1.56-39.56 .012Any virus 4.02 0.87-18.59 .075

Model 4*HCA 17.80 2.68-118.34 .003CMV 4.18 0.93-18.80 .062HPV 2.29 0.54-9.61 .259

* Controlled for maternal age and race, and gestational age.

trimester pregnancy loss. Our study also suggests apossible interactive effect between HCA and the pres-ence of virus in this adverse reproductive outcome. Thestrengths of this study are the prospective collectionof cases and controls, the presence of a control group,and the exclusion of patients with early preterm birth.

The significantly lower rates of HCA and funisitis inour control group suggest that the high prevalence ofHCA in the case group cannot be attributed exclusivelyto labor and/or induction of labor. While we wereunable to control for length of labor, another group ofinvestigators previously demonstrated that histologicacute inflammation was not related to the duration oflabor or interval from PROM to delivery.22

There is a paucity of literature specifically evaluatingthe association between inflammation and clinical riskfactors with spontaneous second trimester pregnancyloss (14 0/7-23 6/7 weeks). While some studies addressplacental inflammation and/or viruses in pregnancy lossand preterm birth, these studies involve a significantlydifferent cohort of patients. One example is a study by

Table VI Variables associated with HCA in cases

Characteristic n (%) P value

Maternal age (y)%20 (n = 78) 52 (66%) .895!20 (n = 24) 17 (70%)

History of preterm deliveryYes (n = 29) 19 (66%) .991No (n = 72) 49 (68%)

History of full term deliveryYes (n = 48) 32 (67%) .938No (n = 53) 36 (68%)

Gestational age (wk)R20 (n = 43) 34 (79%) .032!20 (n = 55) 31 (56%)

PresentationPPROM (n = 53) 33 (62%) .331No PPROM (n = 42) 31 (74%)

All analysis done by chi-square test.

Srinivas et al 801

Wenstrom et al, which evaluated viral infection inwomen with a pregnancy loss following amniocentesis.23

In this study, the presence of viral DNA (by PCR) inamniotic fluid was compared between 62 cases withloss after amniocentesis to 60 controls who deliveredat term after second trimester amniocentesis. The pres-ence of virus in the amniotic fluid was not associatedwith early post-amniocentesis pregnancy loss in thisstudy. These results cannot be extrapolated to the pa-tients presenting with spontaneous second trimesterloss in our study.

We found that neither maternal demographics norclinical presentation predicted the presence of HCAin second trimester loss. Somewhat surprisingly, a his-tory of a previous preterm delivery did not increase awoman’s risk for second trimester pregnancy loss. Thesefindings concur with a recent article by Mercer et al,which found that preterm birth in the first pregnancywas an insensitive marker for periviable birth (20-26weeks) in the second pregnancy.2

However, supporting biological similarity betweenearly preterm births and second trimester loss are ourfindings that gestational age (O20 weeks) remainedsignificantly associated with the presence of HCA andfunisitis, and the relationship appeared to be linear.The high prevalence of HCA in second trimester loss, aswith early preterm birth (!28 weeks),6-7 suggests thatthese adverse reproductive outcomes may have commonetiologies.

Our findings demonstrate that viruses may be anetiologic factor in second trimester pregnancy loss.Recent data demonstrate that viral infection can acti-vate inflammatory pathways (specifically by increasingIL-6, IL-8, and TNF-alpha) in the placenta.24 Thesestudies demonstrate biological plausibility that virusesmay mediate placental inflammation and result inpregnancy loss. In our study, it is not clear whether theassociation between viruses and second trimester lossare caused by 1) viruses as the primary pathogen or 2)viruses as opportunistic infections in the presence of

Figure Bar graph depicting the prevalence of chroiamnionitis

and funisitis by gestational age quartiles in cases. The solid barrepresents histologic chorioamnionitis (HCA) and open barrepresents funisitis.

inflammation. This study was not powered to evaluatethe synergistic effect between viral infection presenceand HCA, the effect of individual viruses on pregnancyloss, or the association between certain types of bacteriaand HCA. While we investigated bacteria previously im-plicated in preterm birth, different bacteria may play arole in pregnancy loss at these gestational ages.14,15

Since we only evaluated 4 bacterial pathogens, our find-ing of no association of bacterial pathogens with secondtrimester pregnancy loss does not eliminate a potentialrole for bacteria in this adverse reproductive event.The low prevalence of U. urealyticum and GBS in ourstudy suggests that these bacteria do not play a signifi-cant role in second trimester loss. However, our findingscannot exclude the possibility that M. hominis or otherbacteria play a mechanistic role in second trimester loss.

Although our study has only a small control group,the significantly different rates of HCA between thecases and controls (P ! .0001) argues against a type Ierror. In addition, it is not surprising that the gestationalage was significantly greater in the control group sincethe diagnostic tests need to be performed and confirmedbefore a second trimester induction of labor for fetalindications occurs. An alternative control group wouldbe placentas from second trimester elective terminations.However, the effect of labor on the development ofHCA could not be evaluated in that group.

In summary, placental inflammation is strongly as-sociated with second trimester pregnancy loss. WhileHCA has the strongest association with loss, viralinfections are also independently associated with spon-taneous second trimester pregnancy loss. Viruses maymediate loss by inflammatory pathways and/or bymechanisms that do not manifest in placental inflam-mation (such as apoptosis). More research is warrantedto evaluate the etiologies of placental inflammation insecond trimester loss. Identifying the causative factorsof placental inflammation in this cohort of patientswill enable us to develop effective prevention strategiesand proper counseling regarding future reproductiveoutcome.

References

1. Wyatt PR, Owolabi T, Meier C, Huang T. Age-specific risk of fetal

loss observed in a second trimester serum screening population.

Am J Obstet Gynecol 2005;192:240-6.

2. Mercer B, Milluzzi B, Collin M. Periviable birth at 20-26 weeks of

gestation: proximate causes, previous obstetric history and recur-

rence risk. Am J Obstet Gynecol 2005;193:1175-80.

3. Drakeley AJ, Quenby S, Farquharson RG. Mid-trimester lossdappraisal of a screening protocol. Hum Reprod 1998;13:1975-80.

4. Ansari AH, Kirkpatrick B. Recurrent pregnancy loss: an update.

J Reprod Med 1998;43:806.

5. Goldenberg RL, Thom E, Moawad AH, Johnson F, Roberts J,

Caritis SN. The preterm prediction study: fetal fibronectin, bacte-

rial vaginosis, and peripartum infection. NICHD Maternal Fetal

Medicine Units Network. Obstet Gynecol 1996;87:656-60.

802 Srinivas et al

6. Goldenberg RL, Hauth JC, Andrews WW. Intrauterine infection

and preterm delivery. N Engl J Med 2000;342:1500-7.

7. Yoon BH, Romero R, Park JS, Kim M, Oh SY, Kim CS, et al.

The relationship among inflammatory lesions of the umbilical

cord (funisitis), umbilical cord plasma Il-6 concentrations, amniotic

fluid infection and neonatal sepsis. Am J Obstet Gynecol 2000;183:

1124-9.

8. Mueller-Heubach E, Rubinstein DN, Schwarz SS. Histologic cho-

rioamnionitis and preterm delivery in different patient populations.

Obstet Gynecol 1990;75:622-6.

9. Heller DS, Moore-house-Moore C, Skurnick J, Baergen RN.

Second trimester pregnancy loss at an urban hospital. Infect Dis

Obstet Gynecol 2003;11:117-22.

10. von Dadelszen P, Magee LA, Krajden M, Alasaly K, Popovska V,

Devarakonda RM, et al. Levels of antibodies against cytomegalo-

virus and Chlamydophila pneumoniae are increased in early onset

pre-eclampsia. BJOG 2003;110:725-30.

11. Hermonat PL, Han L, Wendel PJ, Quirk JG, Stern S, Lowery CL,

et al. Human papillomavirus is more prevalent in first trimester

spontaneously aborted products of conception. Virus Genes 1997;

14:13-7.

12. Parry S, Holder J, Halterman MW, Weitzman MD, Davis AR,

Federoff H, et al. Transduction of human trophoblastic cells by

replication deficient recombinant viral vectors. Promoting cellular

differentiation affects virus entry. Am J Pathol 1998;152:1521-9.

13. Tobiasch E, Rabreau M, Geletneky K, Larue-Charlus S, Severin

F, Becker N, et al. Detection of adeno-associated virus DNA in

human genital tissue and material from spontaneous abortion.

J Med Virol 1994;44:215-22.

14. Lamont RF, Taylor-Robinson D, Wigglesworth JS, Furr PM,

Evans RT, Elder MG. The role of mycoplasmas, ureaplasmas

and chlamydiae in the genital tract of women presenting in spon-

taneous early preterm labour. J Med Microbiol 1987;24:253-7.

15. Revised guidelines for prevention of early-onset group B strepto-

coccal (GBS) infection. American Academy of Pediatrics

Committee on Infectious Diseases and Committee on Fetus and

Newborn. Pediatrics 1997;99:489-96.

16. Machida U, Kami M, Fukui T, Kazayuma Y, Kinoshita M,

Tanaka Y, et al. Real-time automated PCR for early diagnosis

and monitoring of CMV infection after bone marrow transplan-

tation. J Clin Microbiol 2000;2536-42.

17. Distefano AL, Alonso A, Martin F, Pardon F. Human cytomega-

lovirus: detection of congenital and perinatal infection in Argen-

tina. BMC Pediatrics 2004;4:11.

18. CouroucliAI,Welty SE,RamsayPL,WeardenME,Fuentes-Garcia

FJ, Ni J, et al. Detection of microorganisms in the tracheal aspirates

of preterm infants by polymerase chain reaction: association of

adenovirus infection with bronchopumonary dysplasia. Pediatr

Res 2000;47:225.

19. Danbing KE, Menard C, Picard FJ, Boissinot M, Ouellette M,

Roy PH, et al. Development of conventional and real-time PCR

assays for the rapid detection of group B Streptococci. Clin

Chem 2000;46:324-31.

20. Schanke JT, Watson J, Grunenwald HL. Detection of blood-borne

microbes with the master pure complete DNA and RNA purifica-

tion kit. Epicenter Forum 5(3).

21. Malarstig A, Tenno T, Jossan S, Aberg M, Siegbahn A. A quanti-

tative real-time PCR method for tissue factor mRNA. Thromb Res

2003;112:175-83.

22. Salafia CM, Sherer DM, Spong CY, Lencki S, Eglinton GS, Par-

kash V, et al. Fetal but not maternal serum cytokine levels corre-

late with histologic acute placental inflammation. Am J Perinatol

1997;14:419-22.

23. Wenstrom KD, Andrews WW, Bowles NE, Towbin JA, Hauth JC,

Goldenberg RL. Intrauterine viral infection at the time of second

trimester genetic amniocentesis. Obstet Gynecol 1998;92:420-4.

24. Chou D, Ma Y, Zhang J, McGrath C, Parry S. Cytomegalovirus

infection of trophoblast cells elicits an inflammatory response:

a possible mechanism of placental dysfunction. Am J Obstet Gyne-

col 2006;194:535-41.