PLANT HORMONE SIGNAL PERCEPTION AND TRANSDUCTION

Plant Hormone Signal Perception and Transduction

Proceedings o/the International Symposium on Plant Hormone Signal Perception and Transduction, Moscow, Russia, September 4-10,1994

Edited by

A.R. SMITH, A.W. BERRY and N.V,J. HARPHAM Institute of Biological Sciences, University of Wales, Aberystwyth

I.E. MOSHKOV, G.V. NOVIKOV A and O.N. KULAEVA Timiryazev Institute of Plant Physiology, Russian Academy of Sciences, Moscow

and

M.A.HALL Institute of Biological Sciences, University of Wales, Aberystwyth

Partly reprinted from Plant Growth Regulation, Volume 18, Nos. 1,2 (1996).

Kluwer Academic Publishers Dordrecht / Boston / London

Library of Congress Cataloging-in-Publication Data

Plant hormone signal perception and transduction / edited by. A.R. Smith ... let a1.l.

p. cm.

1. Plant hormones--Congresses. 2. Cellular signal transduction­-Congresses. 1. Smith. A. R. (Ai leen R.). 1953-QK731.P593 1995 581. 19'27--dc20 95-40384

ISBN-13: 978-94-010-6546-7

DOl: 10.1007/978-94-009-0131-5

e-ISBN-13: 978-94-009-0131-5

PUblished by Kluwer Academic Publishers, P.O. Box 17,3300 AA Dordrecht, The Netherlands.

Kluwer Academic Publishers incorporates the publishing programmes of D. Reidel, Martinus Nijhoff. Dr W. Junk and MTP Press.

Sold and distributed in the U.s.A. and Canada by Kluwer Academic Publishers, 101 Philip Drive, Norwell, MA 02061, U.S.A.

In all other countries, sold and distributed by Kluwer Academic Publishers Group, P.O. Box 322, 3300 AH Dordrecht, The Netherlands.

Printed on acid-free paper

All Rights Reserved © 1996 Kluwer Academic Publishers Softcover reprint of the hardcover 1 st edition 1996

No part of the material protected by this copyright notice may be reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording or by any informa­tion storage and retrieval system, without written permission from the copyright owner.

Contents

Preface

* 1. Molecular analysis of auxin-specific signal transduction M.A. Venis, R.M. Napier, S. Oliver 1

2. Partial purification and kinetic characterization of an auxin-binding activity in cytoplasmic extract of rape seed (Brassica napus. L.) hypocotyls K. JlM'gensen, S.V.S. Nielsen 7

*3. Expression of an auxin-inducible promoter of tobacco in Arabidopsis thaliana D.A.M. van der Kop, F.N.J. Droog, ~.J. van der Zaal, P.J.J. Hooykaas 15

*4. The heterogeneity of the plasma membrane H+ ATPase response to auxin F. Masson, W. Szponarski, M. Rossignol 23

*5. Elementary auxin response chains at the plasma membrane involve external abp1 and multiple electrogenic ion transport proteins H. Barbier-Brygoo, S. Zimmermann, S. Thomine, I.R. White, P. Millner, J. Guem 31

6. Plant hormone receptors from binding proteins to functional units D.Kl~bt 37

7. Regulation of a class of auxin-induced genes in cell-suspension cultures from Nicotiana tabacum C.J.M. Boot, B. van Duijn, A.M. Mennes, K.R. Libbenga 41

8. The IAA-influx carrier at the plasmalemma: Properties, regulation, and function in auxin transduction B.Zbell 49

*9. Cytokinin signalling systems O.N. Kulaeva, N.N. Karavaiko, S.Yu. Selivankina, I.E. Moshkov, G.V. Novikova, Y.V. Zemlyachenko, S.V. Shipilova, E.M. Orudgev 57

10. Zeatin-binding proteins participating in cytokinin-dependent activation of transcription N.N. Karavaiko, S.Yu. Selivankina, F.A. Brovko, Ya.V. Zemlyachenko, S.V. Shipilova, T.K. Zagranichnaya, V.M.Lipkin, O.N. Kulaeva 67

*11. A cytokinin-binding protein complex from tobacco leaves S. Mitsui, T. Wakasugi, M. Sugiura 77

* Chapters indicated with an asterisk are reprinted from Plant Growth Regulation, Volume 18, Nos. 1,2 (1996).

*12.

*13.

*14.

15.

*16.

*17.

*18.

*19.

*20.

21.

*22.

23.

*24.

25.

Photoaffinity labelling of a cytokinin-binding integral membrane protein in plant mitochondria C. Brinegar, G. Shah, G. Cooper

Specific photoaffinity labelling of a thylakoid membrane protein with an azido-cytokinin agonist F. Nogue, R. Mornet, M. Laloue

Isolation and characterisation of cDNAS for cytokinin-repressed genes H. Teramoto, E. Momotani, G. Takeba, H. Tsuji

Cytokinin and abscisic acid in regulation of chloroplast protein gene expression and photosyn­thetic activity V.V. Kusnetsov, R. Oelmuller, A.V. Makeev, G.N. Cherepneva, E.G. Romanko, S.Yu. Selivankina, A.T. Mokronosov, R.G. Herrmann, O.N. Kulaeva

Ethylene binding sites in higher plants N.VJ. Harpham, A.W. Berry, M.G. Holland, I.E. Moshkov, A.R. Smith, M.A. Hall

Effect of I-methylcyclopropene and methylenecyclopropane on ethylene binding and ethylene action on cut carnations E.C. Sisler, E. Dupille, M. Serek

Regulation of the expression of plant defence genes J.F. Bol, A.S. Buchel, M. Knoester, T. Baladin, L.C. Van Loon, H.J.M. Linthorst

Fusicoccin and its receptors P. Aducci, A. Ballio, D. Nasta, V. Fogliano, M.R. Fullone, M. Marra

14-3-3 Protein homologues playa central role in the fusicoccin signal transduction pathway A.H. De Boer, H.A.AJ. Korthout

Endogenous fusicoccin: receptors and ligands G.S. Muromtsev

Different properties of the inward rectifying potassium conductance of aleurone protoplasts from dormant and non-dormant barley grains B. Van Duijn, M.T. Flikweert, F. Heidekamp, Mei Wang

Effect of alien ipt gene on hormonal concentrations of plants R. V. Makarova, T.A. Borisova, I. Machackova, V.1. Kefeli

Abscisic acid-induced gene-expression requires the activity of protein(s) sensitive to the protein­tyrosine phosphatase inhibitor phenylarsine oxide S. Heimovaara-Dijkstra, T.J.F. Nieland, R.M. van der Meulen, M. Wang

Auxin activation of phospholipase A2 generated lipids, and the function of lipid-activated protein kinase G.F.E. Scherer

83

89

97

109

119

127

135

141

147

155

163

171

175

185

*26.

27.

*28.

*29.

30.

*31.

32.

Phospholipid signalling and lipid-derived second messengers in plants G.F.E. Scherer

Site-directed mutagenesis of the cGMP phosphodiesterase inhibitory 'Y subunit from bovine rods V.M. Lipkin, A.M. Alekseev, V.A. Bondarenko, Kh.G. Muradov, V.E. Zagranichny

Studies on the possible role of protein phosphorylation in the transduction of the ethylene signal A.W. Berry, D.S.C. Cowan, N.V.J. Harpham, R.J. Hemsley, G.V. Novikova, A.R. Smith, M.A. Hall

Synthetic peptides as probes of plant cell signalling P.A. Millner, D.A. Groarke,!.R. White

Mechanism of auxin: second messengers V.V. Polevoi, N.F. Sinyutina, T.S. Salamatova, N.!. Inge-Vechtomova, O.V. Tankelyun, E.!. Sharova, M.F. Shishova

A single cell model system to study hormone signal transduction D. Stickens, W. Tao, J.-P. Verbelen

Receptor-like proteins of higher plants K. Palme

191

201

209

217

223

233

239

Dedicated to Professor Olga Nikoaevna Kulaeva on her 65th Birthday

IIpot/Jeccopy OJlbZe HUKOJlae6He KYJlae60U 6 zoo ee 65-mu JlemUJl

nOC6JlllJaemCJl

International Symposium on Plant Hormone Signal Perception and Transduction, Moscow, September 4-10,1994

Scientific Committee

President Vice-President

Members

Organising Committee

President Vice-President Joint General Secretaries

Social Secretaries

Members

M. A. Hall (UK) O. N. Kulaeva (Russia)

A. Ballio (Italy) J. Guem (France) D. Klllmbt (Germany) K. Libbenga (The Netherlands) V. A. Tkachuk (Russia)

O. N. Kulaeva (Russia) V. I. Kefeli (Russia) A. R. Smith (UK) I. E. Moshkov (Russia) G. Hall (UK) G. V. Novikova (Russia)

A. T. Mokronosov (Russia) V. E. Semenenko (Russia) V. V. Kusnetsov (Russia) V. M. Lipkin (Russia) A. V. Nosov (Russia)

The

par

tici

pant

s o

f th

e In

tern

atio

nal

Sym

posi

um o

n P

lant

Hor

mon

e S

igna

l P

erce

ptio

n an

d T

rans

duct

ion,

Mos

cow

Sep

tem

ber

4--1

0, 1

994

AR. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction.

Preface

Investigations on the mechanisms of perception of plant hormones or the transduction of their effects are of very recent date; indeed only in 1971 did the first paper on a 'hormone binding site' appear - that by Reiner Hertel's group on naphthylphthalarnic acid, at that time known only as an auxin transport inhibitor.

Progress on binding sites for natural hormones moved at first at a relatively slow place, partly for tech­nical reasons and partly because very few researchers were attracted to the field. In the 1980's the pace quickened but even so, there were (and still are) fewer workers in the whole field of plant hormone percep­tion and transduction than those involved with anyone animal hormone.

A major landmark was the Society for Experi­mental Biology Symposium at Sutton Bonington in 1989 where workers in both the animal and plant area got together to compare notes and this was followed over the next few years by a number of other meetings which reflected the progress being made.

Early in 1993 it was felt that another conference was timely and Moscow was chosen as the venue. This latter was a reflection partly of the distinguished work being done in the field within several republics of the former Soviet Union but also in some small measure an attempt to support and sustain that work in the face of the tremendous difficulties that confront scientists there.

The conference took place between September 4th and 10th 1994 at the Hotel Uzkoye on the outskirts of Moscow and proved a great success in both the scientific and social dimensions. Indeed, two of the papers revealed for the first time the likely nature of the receptor for fusicoccin. There were over 100 partici­pants and these included scientists from 11 different

countries. This volume includes papers by all the invited speakers and hence provides an up-to-date overview of the topic suitable for current researchers and those wishing to enter the field.

The participants decided to dedicate the conference and the proceedings to one of the editors of this volume namely, Professor Olga Kulaeva.

Professor Kulaeva was born in 1929 and, after graduating from Moscow University in 1953 under­took her postgraduate work under the direction of the distinguished Russian plant physiologist A. L. Kursanov and also spent a period in the laboratory of K. Mothes in Halle. Since 1971 she has been Professor and Head of the laboratory of Plant Genome Expres­sion in the Timiriazev Institute of Plant Physiology and Professor of Plant Physiology in Moscow State Univer­sity. Professor Kulaeva has researched a wide range of topics but is perhaps best known for her work on cytokinins, particularly their perception and transduc­tion. It is a tribute to her leadership that despite increas­ingly difficult circumstances, Professor Kulaeva and her group have continued to make important progress. It is appropriate therefore to recognise this contribu­tion.

The editors and the organising committee would like to thank the Russian Science Foundation, the Federation of European Societies of Plant Physiology and the International Association for the promotion of cooperation with scientists from the independent states of the former Soviet Union (INTAS) for their support for the conference and some of its participants.

We would also like to acknowledge the help and support of Gilles Jonker of Kluwer Academic Publishers for his help in initiating and publishing this volume and Mrs Denyer for manuscript preparation.

A. R. Smith et al. (etis.), Plant Hormone Signal Perception and Transduction, 1--6. © 1996 Kluwer Academic Publishers.

1

Molecular analysis of auxin-specific signal transduction

Michael A. Venis, Richard M. Napier & Susan Oliver Horticulture Research International, Cell Physiology, Wellesbourne, Warwick, Kent CV35 9EF, UK

Key words: auxin receptor, endoplasmic reticulum, plasma membrane

Abstract

The auxin-binding protein (ABPl) of maize has been purified, cloned and sequenced. Homologues have been found in a wide range of plants and at least seven ABP sequences from four different species are now known. We have developed a range of anti-ABP antibodies and these have been applied to analysis of the structure, localization and receptor function of ABP. ABPI is a glycoprotein with two identical subunits of apparent Mr = 22 kDa. The regions recognised by our five monoclonal antibodies (MAC 256-260) and by polyclonal antisera from our own and other laboratories have been specified by epitope mapping and fragmentation studies. All polyclonal anti-ABP sera recognise two or three dominant epitopes around the single glycosylation site. Two monoclonals (MAC 256, 259) are directed at the endoplasmic reticulum (ER) retention sequence KDEL at the C-terminus. Early biochemical data pointed to six amino acids likely to be involved in the auxin binding site. Inspection of the deduced sequence of ABPI showed a hexapeptide (HRHSCE) containing five of these residues. Antibodies were raised against a polypeptide embracing this region and recognised ABP homologs in many species, suggesting that the region is highly conserved. This is confirmed by more recent information showing that the selected polypeptide contains the longest stretch of wholly conserved sequence in ABPI. Most strikingly, the antibodies show auxin agonist activity against protoplasts in three different electrophysiological systems - hyperpolarization of tobacco transmembrane potential; stimulation of outward ATP-dependent H+ current in maize; modulation of anion channels in tobacco. The biological activity of these antibodies indicates that the selected peptide does form a functionally important part of the auxin binding site and strongly supports a role for ABPI as an auxin receptor. Although ABP contains a KDEL sequence and is located mainly in the ER lumen, the electrophysiological evidence shows clearly that some ABP must reach the outer face of the plasma membrane. One possible mechanism is suggested by our earlier demonstration that the ABP C-terminus recognised by MAC 256 undergoes an auxin-induced conformational change, masking the KDEL epitope and it is of interest that this C-terminal region appears to be important in auxin signalling [22]. So far we have been unable to detect the secretion of ABP into the medium of maize cell (bms) cultures reported by Jones and Herman [7]. However, recent silver enhanced immunogold studies on maize protoplasts have succeeded in visualizing ABP at the cell surface, as well as auxin-specific clustering of the signal induced within 30 minutes. The function of ABP in the ER, as well as the mechanisms of auxin signal transduction both at plasma membrane and gene levels remain to be elucidated.

Background

The major auxin-binding protein of maize has been purified, cloned and sequenced and is the subject of current study in several laboratories. Our present knowledge is founded on the pioneering paper of Hertel and co-workders [5], which made two particularly significant and far-reaching contributions: first, the

recognition that maize microsomal membranes were a rich source of auxin binding activity - indeed, nothing better has been found to this day; second, the realisa­tion that the synthetic auxin naphthalene-I-acetic acid (NAA) was bound with significantly higher affinity than the native auxin IAA. Together, these factors pro­vided for the first time a system that could be readily reproduced elsewhere and it was not long before inves-

2

Table 1. Properties of maize ABPI

Apparent native Mr 44000

Apparent subunit Mr 22000

Glycan Mr 2000

Deduced sequence 163 residues

Location

Kd (NAA)

+ 38 residues signal peptide

single glycosylation site

3 cysteines

C-tenninal KDEL (Lys-Asp­Glu-Leu)

Endoplasmic reticulum

Plasma membrane?

0.1-0.2 fLM (membrane)

0.05 fLM (purified)

tigations in other laboratories were under way. The original observations were refined and extended and evidence for binding site heterogeneity was obtained, based on differences in affinity, specificity and locali­sation (reviewed in [24]).

All laboratories are agreed that the bulk of the bind­ing activity is associated with endoplasmic reticulum (ER), but that auxin binding sites are located also on other membranes, variously suggested as plasma mem­brane [1], Golgi/plasma membrane [17] or tonoplast [3]. As will be seen from this and from Dr. Barbier­Brygoo's paper in this volume, there is strong evidence that a functional ABP population is present at the sur­face of the plasma membrane and is immunologically related to that in the ER. So far, there is no evidence that distinct ABPs are present in different cellular mem­branes and the major ABP species is now referred to as Zm-ERabpl [19] or, more briefly, ABP1.

Auxin binding activity in the membranes can be readily solubilized by detergent, but the basis of most subsequent purification procedures has been a modi­fied acetone powder method [23] that allows extraction without detergent. Initial purification by ion exchange and gel filtration [23] indicated an apparent native Mr of 40,000-45,000. The first extensive purification of ABPI used an ingenious but complicated sequence of auxin-affinity and immunoaffinity columns [8] and indicated that ABPI is a dimer. Subsequently, more convenient purification protocols were devised, using either affinity chromatography based on NAA [21] or phenylacetic acid [16], or else conventional chromato­graphic media in combination with native PAGE [14].

Most laboratories find that ABPI runs with an apparent Mr of 22,000 on SDS-PAGE and hence it is usually referred to as 22 kDa ABP. It is still uncertain as to whether there is a single auxin-binding site per 22 kDa subunit [6] or one binding site per dimer [8, 21]. The deduced amino acid sequence shows a single potential N-glycosylation site and the presence of the C-terminal KDEL tetrapeptide (lys-asp-glu-Ieu), characteristic of proteins that are actively retained within the lumen of the ER [15]. The main features of ABPI are sum­marised in Table 1.

Structure of ABPI

Antibodies have proved of great value in structural and functional analysis of ABPI and homologues. Poly­clonal antisera to maize ABP have been produced in several laboratories [8, 14,20] and shown by Western blotting to cross-react in a range of species, includ­ing dicotyledonous species [25,27]. Usually, the ABP homologues detected are the same subunit size as in maize, i.e. 22 kDa, but in some cases, e.g. barnyard grass [25] or mung bean [11] the apparent subunit size is slightly larger at 24 kDa. The difference, at least in the case of barnyard grass, is in the size of the polypep­tide, rather than the glycan. Using an epitope mapping kit, three predominant linear epitopes in maize ABP were shown to be recognized by anti-ABP sera from several different laboratories [11]. These epitopes are clustered around, but do not include, the glycosylation site and appear to be regions that are exposed on the surface of the protein. Two of these three epitopes are conserved in ABP homologues from mung bean and barnyard grass.

A set of five monoclonal antibodies against maize ABP has been raised, designated MAC 256 through to MAC 260 [14]. The epitopes recognized by these anti­bodies were assigned by fragmentation studies [10] in conjunction with epitope mapping [17, 12]. Of partic­ular interest are MAC 256 and MAC 259, which are specific for the C-terminal region, especially the ER retention sequence KDEL. In consequence, these anti­bodies recognise ER-resident proteins in animal cells and are excellent markers for animal cell ER [13]. In plant (maize root) cells, MAC 256 staining shows a punctate distribution by immunofluorescence. Plants also use HDEL for ER retention and HDEL proteins are evenly distributed throughout the ER. Since ABP appears to be the major KDEL protein the punctate pattern may indicate that ABP is restricted to a specific

3

Map of the Maize Auxin-Binding Protein

major MAC polyclonal MAC 257

epitopes MAC 256

signal 258 016 260 259 peptide t ~ l t tc N (g. .@.

I

'* .@.

glycosylation

site

Fig. 1. Main structural features of ABPI and the regions recognised by antibodies. The positions of the three cysteine residues (C) are indicated by the bold arrows. The region designated D 16 indicates the putative auxin-binding site, being the part of the sequence against which antibodies (named D16) showing auxin agonist activity were raised [27].

sub-compartment of the ER [13]. The major structural features and epitopes of ABPI are summarized in Fig. 1.

Using a sandwich ELISA (enzyme-linked immuno­sorbent assay) it was found that binding of these two monoclonal antibodies - MAC 256 and MAC 259 -to native ABP was reduced by auxins and analogues in a concentration-dependent manner [10]. There was an excellent correlation between this activity and the physiological activity of the wide range of compounds tested. Indeed, the structure-activity correlation was better than that obtained from in vitro assays oflabeled NAA binding to microsomal or solubilised ABP, e.g. phenoxyacetic acids such as 2,4-D were about as active in the ELISA as NAA. It appears that the presentation of ABP in the ELISA may reflect more accurately the in vivo conformation of the protein. The auxins and monoclonal antibodies were not thought to be com­peting for the same binding site, and the reduction in antibody binding was interpreted as an auxin-induced conformational change that leads to masking of the epitope to which the antibody binds. Since this epi­tope is at the C-terminus, the KDEL region appears to be conformationally active, and this, as discussed later, may have important mechanistic implications in at least two respects, one of which will be mentioned later in this report and the other is discussed in this publication by Dr. Millner.

ABPI has now been produced in the baculovirus expression system [9]. The product is glycosylated,

binds auxin and is correctly targeted to the lumen of the ER. The strawberry homologue has also been expressed in baculovirus and hence we will soon be in a position to undertake comparative biochemical studies on monocot and dicot ABPs.

Is ABPI an auxin receptor?

Until a few years ago, the view that ABPI might be an auxin receptor was based largely on indirect physi­ological correlations between binding activity or ABP abundance and auxin responsiveness (see [24, 26]). Recently, more direct evidence has been obtained, relying initially on the characteristic auxin-induced hyperpolarization of the membrane potential of tobacco protoplasts [4]. This work provided clear evi­dence for a site of ABP-mediated auxin perception at the cell surface, a conclusion supported by data with impermeant auxin analogs [28].

The next significant development was the genera­tion of anti-ABP antibodies with auxin agonist activity [27]. From early experiments with group-modifying reagents, provisional assignments of six of the amino acids likely to be present at the auxin binding site of ABP had been made. Inspection of the deduced amino acid sequence of ABPI showed that five of these were clustered in a single hexapeptide. Antisera raised against a synthetic oligopeptide embracing this region recognised all maize ABP isoforms as well as

4

Peptide RTPIHRHSCEEVFT Zea IZmabp 1)

Nicotiana

PGQ RTPIHRHSCEEVFT VLKG PGS RTPIHRHSCEE I F I VLKG

Arabidopsis

Fragaria

PGS ETPIHRHSCEEVFV VLKG PGS GTPIHRHSCEEVFV VLKG

Fig. 2. Sequence of peptide synthesized for antibody production compared with ABPI sequences from four difference species.

ABP homologues in several other species, indicat­ing that the region selected was likely to be highly conserved. More significantly, the anti-peptide anti­bodies were able to mimic precisely the activity of auxin in hyperpolarizing the transmembrane potential of tobacco protoplasts [27]. This auxin agonist activity strongly suggests that the selected peptide lies in the auxin-binding domain of an auxin receptor. The likely importance of this region is reinforced by subsequent data showing that there is almost complete sequence conservation between species (Fig. 2) and that it con­tains the longest stretch of wholly conserved sequence inABP.

The conclusions reached on the basis of the tobacco protoplast hyperpolarization response have been fully supported by subsequent independent measurements of membrane current in maize protoplasts. Using the patch-clamp technique in the whole-cell configura­tion, an auxin-induced increase in outwardly directed current of positive charge was detected under con­ditions consistent with stimulation of the plasma membrane H+ -ATPase [18]. This auxin-induced current was blocked by anti-ABPI antibodies, while the anti-peptide antibodies raised against the putative auxin-binding domain showed auxin agonist activity, stimulating the membrane current in the absence of auxin. Thus, both agonist and antagonist activities of ABP-related antibodies on an auxin-dependent physio­logical response have been demonstrated in two differ­ent systems, one homologous (maize protoplasts with anti-maize ABPI antibodies, [18]) and one heterolo­gous (tobacco protoplasts, maize antibodies).

In addition, the agonist antibodies show auxin-like activity on anion channels in tobacco (Barbier-Brygoo, this volume).

The plasma membrane-endoplasmic reticulum anomaly

From the electrophysiological assays it has been nec­essary to conclude that there is a (functional) pool of ABPI on the outside surface of the plasma membrane. In addition, experiments suggest that it is the C­terminal region that mediates interaction of this ABPI pool with signal transducing elements in the plasma membrane [22]. This implies that the C-terminus is active in two distinct protein-protein interactions in different cellular compartments, since as well as signal transduction at the cell surface, it is the terminal KDEL motif that targets the bulk pool for retention in the ER. Whilst this duplicity could be an efficient use of a conformationally active domain, its consideration also highlights an outstanding anomaly, namely that ABPI is actively targeted to the ER and yet is found to be functional at the cell surface.

In order to reach the plasma membrane the commit­ment to targeting conferred by KDEL has to be overcome. Our earlier observations which suggested that ligand binding induced a conformational change masking KDEL [10] presented a mechanism which can explain ABPI escape and such a model has been elaborated [2]. Once the KDEL retrieval system has been bypassed, ABPI would continue to the cell sur­face through the constitutive secretory pathway. No evidence to support the model that release is triggered by auxin is available yet. One report does claim to show that ABPI is secreted along the constitutive pathway [7] but auxin reduced, rather than enhanced secretion of the putative ABP, contrary to expectation from the model. Using the same system (bms cell suspensions) we have been unable to detect any ABP secretion, while in coleoptile tissue we find ABP to be very stable, neither synthesis nor turnover being influenced by auxin.

As a consequence of this uncertainty, direct evidence for passage of ABPI to the plasma mem­brane, and an explanation for how ER targeting is overcome, remain to be presented. Given the low abundance of ABPl on the plasma membrane this is a particularly difficult problem but one which needs to be resolved. However, the implied presence of a fraction of ABP at the outer face of the plasma membrane has been recently confirmed through a collaboration with Professor David Robinson.* Using a silver-enhanced immunogold technique, it was possible to image ABP clearly at the surface of maize protoplasts, as well as temperature-dependent, auxin-specific clustering of the signal induced within 30 minutes.

It remains important to explain what role ABPI plays in the ER where the bulk of it resides, or at the very least why it is targeted there. It does not appear to function as a molecular chaperone, as has been sug­gested [2], in that unlike the ER-resident protein BiP (luminal binding protein), it is not up-regulated by treatments such as heat shock, reducing agents or tuni­camycin.** Coupled with elucidation of the mecha­nisms of signal transduction at the cell surface and on gene expression, major problems remain to be tackled before the cell biology of ABP is fully understood.

Acknowledgements

Work from the authors' laboratory was supported by the BBSRC and by the BAP, BRIDGE and BIOTECH programs of the European Economic Communities. We thank Drs. Heather Macdonald and Colin Lazarus for supplying the strawberry ABP sequence prior to publication.

References

1. Batt Sand Venis MA (1976) Separation and localization of two classes of auxin binding sites in com coleoptile membranes. Planta 130: 15-21

2. Cross JW (1991) Cycling of auxin -binding protein through the plant cell: pathways in auxin signal transduction. The New Biologist 3: 813-819

3. Dohrmann U, Hertel R and Kowalik H (1978) Properties of auxin binding sites in different subcellular fractions from maize coleoptiles. Planta 140: 97-106

4. Ephritikhine G, Barbier-Brygoo H, Muller JF and Guem J (1987). Auxin effect on the transmembrane potential differ-

• Diekmann et al.(l995) Proc Natl Acad Sci USA 92: 3425-3429. •• Oliver et al. (1995) Planta 197: 465-474.

5

ence of wild-type and mutant tobacco protoplasts exhibiting a differential sensitivity to auxin. Plant Physiol84: 801-804

5. Hertel R, Thomson K-St. and Russo, VEA (1972) In vitro auxin binding to particulate cell fractions from com coleoptiles. Planta 107: 325-340

6. Hesse T, Feldwisch J, Balschusemann D, Bauw G, Puype M, Vandekeckhove J, Lobler M, KUimbt D, Schell J and Palme K (1989) Molecular cloning and structural analysis of a gene from Zea mays (L.) coding for a putative receptor for the plant hormone auxin. EMBO J 8: 2453-2461

7. Jones AM and Herman EM (1993) KDEL-containing auxin­binding protein is secreted to the plasma membrane and cell wall. Plant Physiol 101: 595-606

8. L6bler M and Klambt D (1985) Auxin-binding protein from coleoptile membranes of com (Zea mays L.) I. Purification by immunological methods and characterization. J BioI Chern 260:9848-9853

9. Macdonald H, Henderson J, Napier RM, Venis MA, Hawes C and Lazarus CM (1994) Authentic processing and target­ing of active maize auxin-binding protein in the baculovirus expression system. Plant Physiol 105: 1049-1057

10. Napier RM and Venis MA (1990) Monoclonal antibodies detect an auxin-induced conformational change in the maize auxin-binding protein. Planta, 182: 313-318

II. Napier RM and Venis MA (1992) Epitope mapping reveals conserved regions of an auxin-binding protein. Biochem J 284: 841-845

12. Napier RM and Venis MA (I 992b) The auxin receptor: struc­ture and distribution. In: Clarkson DT and Cooke D (eds) Transport and Receptor Proteins of Plant Membranes, pp 169-177. New York: Plenum Press

13. NapierRM, Fowke LC, Hawes C, Lewis M and Pelham HRB (1992) Immunological evidence that plants use both HDEL and KDEL for targeting proteins to the endoplasmic reticulum. J Cell Sci 102: 261-271

14. Napier RM, Venis MA, Bolton MA, Richardson LI and Butcher GW (1988) Preparation and characterisation of monoclonal and polyclonal antibodies to maize membrane auxin-binding protein. Planta 176: 519-526

15. Pelham HRB (1989) Control of protein exit from the endo­plasmic reticulum. Annu Rev Cell BioI 5: 1-23

16. Radermacher E and Klambt D (1993) Auxin dependent growth and auxin-binding proteins in primary roots and root hairs of com (Zea mays L). J Plant Physiol 141: 698-703

17. Ray PM (1977) Auxin binding sites of maize coleoptiles are localized on membranes of the endoplasmic reticulum. Plant Physiol 59: 594-599

18. RiickA, Palme K, Venis MA,NapierRM and Felle HH(l993) Patch-clamp analysis establishes a role for an auxin binding protein in the auxin stimulation of plasma membrane current in Zea mays protoplasts. The Plant J 4: 41-46

19. Schwob E, Choi S.-Y, Simmons C, Migliaccio F, Bag L, Hesse T, Palme K and Soli D (1993). Molecular analysis of three maize 22 kDa auxin binding protein genes - transient pro­moter expression and regulatory regions. The Plant J 4: 423-432

20. Shimomura S, Inohara N, Fukui T and Futai M (1988) Different properties of two types of auxin-binding sites in membranes from maize coleoptiles. Planta 175: 558-566

21. Shimomura S, Sotobayashi T, Fukui M and Futai T (1986) Purification and properties of an auxin-binding protein from maize shoot membranes. J Biochemistry 99: 1513-1524

22. Theil G, Blatt M R, Fricker, M D, White I R and Millner P (1993) Modulation of K+ channels in Vicia stomatal guard

6

cells by peptide homologues to the auxin binding protein C­tenninus. Proc Natl Acad Sci USA 90: 11493-11497

23. Venis MA (1977) Solubilisation and partial purification of auxin-binding sites of com membranes. Nature (London) 66: 268-269

24. Venis MA (1985) Honnone-binding Sites in Plants. Longman, New York, London

25. Venis MA and Napier RM (1990) Characterization of auxin receptors. In: Roberts J, Kirk C and Venis M (eds) Honnone Perception and Signal Transduction in Animals and Plants, pp 55-65. Cambridge: Company of Biologists

26. Venis MA and Napier RM (1991) Auxin receptors: recent developments. Plant Growth Regul 10: 329-340

27. Venis MA, Napier RM, Barbier Brygoo H, Maurel C, Perrot­Rechenmann C and Guem J (1992) Antibodies to a peptide from the auxin-binding protein have auxin agonist activity. Proc N atl Acad Sci USA 89: 7208-7212

28. Venis MA, Thomas EW, Barbier-Brygoo H, Ephritikhine G and Guem J (1990) Impenneant auxin analogues have auxin activity. Planta 182: 232-235

A. R. Smith et al. (elis.), Pumt Hormone Signal Perception and Transduction, 7-14. © 1996 Kluwe,. Academic Publishers.

7

Partial purification and kinetic characterization of an auxin-binding activity in cytoplasmic extract of rape seed (Brassica napus. L.) hypocotyls

Kirsten J0rgensen & S0ren V. S. Nielsen* The Biotechnology Group, Danish Institute of Plant and Soil Science, Lottenborgvej 2, DK2800 Lyngby, Denmark (* author for correspondence)

Key words: affinity chromatography, auxin-binding activity, Brassica nap us, IAA, proteins

Abstract

This paper reports the partial purification by cation exchange chromatography of an auxin-binding activity from etiolated Brassica nap us hypocotyls. The activity has a well defined pH optimum at pH 7.2 and is highly specific towards indole-3-acetic acid (IAA) with a Kd of 1.7-2 x 10-8 M at this pH. The Ki for 2,4-dichloro-phenoxyacetic acid (2,4-D) was determined to be 10-5 M, while the activity was not inhibited by I-naphthaleneacetic acid (1-NAA). The auxin-binding activity showed a broader range of specificity at pH 7.8 where 2,4-D, I-NAA, 2-NAA, and D-tryptophan were inhibitory to IAA-binding. In addition the Kd for IAA was slightly higher being 5 x 10-8 M at this pH. Affinity column chromatography at pH 7.8 of active fractions and of crude extract resulted in preparations exhibiting a triplet with molecular weights of 53, 58 and 62 kD on SDS-PAGE, the most prominent band being at 58 kD. At pH 7.2 additional bands with molecular weights of 42, 45 and 47 kD were seen.

Introduction

In plants two different types of auxin-binding pro­teins (ABP) with putative receptor function have been reported. One type is located to plasma membranes and to endoplasmic reticulum and is observed to mediate a transmembrane hyperpolarization via activation of the H+ -A1Pases in the plasma membrane [10]. This type of receptor is characterized at the biochemical as well as the molecular biological level [6, 10].

The other type of auxin-binding proteins is located in the cytoplasm/nucleus and is hypothesised to func­tion in an analogous way to steroid receptors [9, 17). This type of auxin-binding activity has primarily been demonstrated in extracts of dicotyledonous plants [17]. Purified soluble auxin-binding proteins have been shown to stimulate auxin-dependent transcrip­tion when added to isolated nuclei [1, 7, 17, 21). Addition of soluble auxin-binding proteins purified from mung bean hypocotyls [18, 19] to nuclei isolated from mung bean resulted in the auxin­dependent expression of specific genes [7] which were also expressed in auxin treated tissues. Recently a

cytoplasmic protein from Hyoscyamus muticus was purified on the basis of photoaffinity labelling with azido-IAA and demonstrated to be a glutathione S­transferase [2).

The properties of soluble auxin-binding proteins have been shown to change during the growth of suspension cultures [4, 22] and to have high affinity for auxins which modulate differentiation of pea tissues [5]. Kinetic characteristics of this type of auxin­binding protein have been reported by several authors [17] and KdS for IAA ranging from 10-5_10- 8 Mhave been observed together with pH optima ranging from pH 7-8 [11, 12, 16, 19).

The present work originated from the observa­tion that different cultivars of Brassica napus respond morphogenetically different in tissue culture [14]. In order to study the possible influence of soluble auxin receptors on morphogenetic responses we initially intended to compare protein patterns in auxin affin­ity purified fractions of cytoplasmic proteins from differently responding cultivars of Brassica napus. In preliminary experiments we applied affinity col­umn chromatography to extracts of a high-regenerating

8

and a non-regenerating cultivar. Adsorbing proteins to immobilized D-tryptophan and eluting the proteins with a physiological concentration of IAA resulted in preparations from both cultivars displaying a triplet with one prominent band of apparent molecular weight of 55 kD on SDS-gels. The failure to demonstrate bind­ing ofIAA to the purified protein urged us to try alterna­tive purification methods allowing us to measure auxin binding activity. Ion exchange chromatography of the auxin-binding activity from a third cultivar, Topas, and kinetic characterization of the resulting preparations are presented together with affinity purification data in this paper.

Materials and methods

Chemicals

All chemicals were of analytical grade and supplied by either Sigma or Merck. 3-[5(n)_3H] IAA (specific activity 20-30 Ci mmol- 1) was purchased from Amer­sham. Ion exchange material was purchased from Pharmacia and Affigel-10 was purchased from Bio­Rad.

Affinity material

The affinity support, Affigel-lO, was washed 5 times with 10 volumes of dH2 O. D-tryptophan was linked via the a-amino group to the Affigel-10 reactive groups by incubating the washed Affigel-IO with two vol­umes of 10 mM D-tryptophan in 0.5 M carbonate buffer pH 8,0.5 M NaCl for 2 hours at room tempera­ture in the dark. The D-tryptophan Affigel-IO affinity material was packed on to a column (0.9 x 16 cm) wrapped in aluminium foil and remaining reactive sites were blocked by washing with 10 volumes of 50 mM TrisHCl,pH 8, 0.5 M NaC!. The affinity material was finally washed with 10 volumes of 50 mM Na-acetate buffer pH 4, 50 mM NaC! before equilibration with binding-buffer (20 mM TrisHCl pH 7.8, 20 mM KCl, 1 mM EDTA, 5 mM MgCh or 20 mM K-phosphate buffer pH 7.2 with the same additions). On average the affinity material contained approximately 4 mM D-tryptophan/ml- 1 sedimented gel.

Preparation of dextran coated charcoal (DCC)

Activated charcoal (Merck, average size 1.5 mm) was crushed with a mortar and pestle. The charcoal was

suspended in dH20 and washed by centrifugation at 3000 x g for 2 min. The washing was repeated until the supernatant was free of particles. The pelleted charcoal was then washed twice with binding buffer containing 0.6 g/IOO ml of Dextran T-70 before suspension in the same buffer. The final preparation contained 5 g (initial) of charcoal and 0.6 g of dextran/IOO ml. The capacity of DCC varied between batches but was at least 10 fold higher than the highest IAA concentration employed in the experiments. Equilibrium between IAA and DCC and between IAA and protein, was reached after 20 and 90 min respectively.

SDS-polyacrylamide gel electrophoresis

Protein was precipitated with 10% trichloroacetic acid and sedimented by centrifugation at 20000 x g for 10 min. The pellets were washed once with ice-cold acetone and dissolved in a minimum of 2 x SDS­loading buffer [20]. SDS-PAGE was performed in 10% gels essentially as described by Laemmli [8]. Gels were stained with silver essentially as described in [13]. 2-D gel electrophoresis was performed as described by [3].

Quantitation of specific auxin-binding activity

Auxin-binding activity was assayed with 25 nM 3H_ IAA (corresponding to 1.1-1.65 x 106 dpmlml) in the presence and absence of 200 p,M unlabelled IAA. Protein-bound IAA was measured using the dextran coated charcoal method [11]. Specific binding was calculated by subtracting radioactivity bound at 200 p,M from the radioactivity bound at 25 nM.

Protein determination

Protein was determined with the Bio-Rad Protein assay according to the manufacturers instructions. BSA was used as a standard.

Plant material

Seeds from the rape seed cultivar Topas were germi­nated in the dark for 9 d at 20 ° C on cotton pads soaked in tap water. The etiolated seedlings were placed on ice and harvested. During harvest each batch ofhypocotyls was exposed to dim daylight for approximately 30 min. The hypocotyls were stored at -80 °C for later use.

Extraction

Frozen hypocotyls were ground with sand in 1 volume extraction-buffer (50 mM K-phosphate pH 7.0, 20 mM KCl,2 mM Na-EDTA and 4 mM DTT) with a mortar and pestle. The homogenate was filtered through 4 layers of gauze. The retentate was homogenized again in 1 volume of extraction-buffer and filtered through 4 layers of gauze. The combined extract was cen­trifuged for 30 min at 20000 x g.

For measurement of auxin-binding activity in the crude extract, the supernatant was concentrated to 1 ml/lO g FW by dialysis overnight against 20% PEG in 20 mM K-phosphate pH 7.2, 20 mM KCI, 1 mM Na-EDTA.

Partial purification of auxin-binding activity

10 ml of DEAE-Sepharose CL 6B equilibrated in extraction buffer was added per 100 ml of crude extract and the mixture was allowed to stand for 1 h with gentle stirring. The slurry was applied to a sintered glass filter and vacuum filtrated. 4 ml of CM-Sepharose CL 6B equilibrated in extraction buffer was added per 100 ml of filtrate and the mixture was allowed to stand for 1 h with gentle stirring. The slurry was vacuum filtrated on a sintered glass filter and unbound protein was removed by washing with 2 x 100 ml of extraction buffer. The washed gel was applied to a column (i.d. 116 mm) and bound protein was eluted with 0.6 M KCl in extraction buffer. 2 ml fractions were collected, and fractions with OD280 > 0.06 were pooled and dialyzed overnight against 100 volumes of 20 mM TrisHCl pH 7.8 or 20 mM K-phosphate pH 7.2 containing 20 mM KCI and 1 mM Na-EDTA. For large scale preparations a column with inner diameter of 25 mm was used and 10 ml fractions were collected.

Assay for auxin-binding activity

Auxin-binding activity was assayed in a mixture con­taining 20 mM TrisHCl pH 7.8 or 20 mM K -phosphate pH 7.2 with 20 mM KCI, 1 mM Na-EDTA, 2.5 mM MgCIz, and 0.5 ml protein preparation/ml. The mix­ture contained 3.125 nM of 3-[5(n)-3H]IAA specific activity 25-27 Ci mmol - I) and the concentration of lAA was varied by the addition of cold IAA. After incubation for 90 min at room temperature the mixture was cooled in an icebath for 10 min. Triplicate samples of 100 JlI were added to 400 JlI ofDCC and the mixture was vigorously shaken for 20 min. The activated char-

9

coal was then sedimented by centrifugation for 10 min at 28000 g, and 250 JlI of supernatant was taken for liquid scintillation counting.

pH-optimum

For determination of pH optimum the pH was varied by mixing 1 volume protein preparation with I vol­ume of 50 mM citrate-phosphate buffer (pH 5.6-6.5), 50 mM Tris HCI (pH 7.3-8.6) or 50 mM carbonate buffer (pH 6.85-9.5) containing 20 mM KCI, 5 mM MgCIz, and tritiated/cold IAA in double concentra­tions. Specific binding was estimated as described under quantification of specific binding.

Competition experiments

Kjs were calculated from apparent KdS for IAA deter­mined at pH 7.2 and pH 7.8 in the presence of 10 JlM indole acetamide (lAM), 2,4-diochlorophenoxyacetic acid (2,4-D), 1-napthaleneacetic acid (l-NAA), 2-naphthaleneacetic acid (2-NAA), L-Tryptophan(L-trp) or D-tryptophan (D-trp), respectively.

Affinity purification

Active CM-fractions and crude extract were brought to 5 mM MgCIz and applied to D-tryptophan Affigel-lO columns at 5 ml h -I. Unbound protein was removed by washing the column with a minimum of 20 vol­umes of binding buffer. Bound protein was eluted with binding buffer containing 0.5 JlM IAA. 20000 cpm 3H_ IAA ml- I was added to monitor IAA concentration in the eluate. The bound protein was eluted at 5 ml h- I

and 0.5 ml fractions were collected. Fractions were analyzed by SDS-PAGE.

Results

Concentration of activity

It was not possible to measure any auxin-binding activity in crude extracts and attempts to concen­trate the protein by ammonium sulfate precipitation resulted in the formation of an insoluble gel which trapped most of the protein present in the extract. When concentrating the extract by dialysis against 20% PEG it was possible to measure auxin-binding activity, although non-specific binding was relatively high. Instead the activity was concentrated by batch

10

600

500

-E ft 400 Ol c 'g 300 :.0 u

~ 200 Q) a. en

100

0 5 6 7 8 9 10

pH Fig.i. pH-optimum of auxin binding activity. <>, citrate-phosphate; *, carbonate; 0, Tris He!.

adsorption to CM-Sepharose CL 6B. Interfering sub­stances were removed by preadsorption to DEAE­Sepharose CL 6B to minimize the volume of cation material necessary for binding of the activity. This batch purification protocol resulted in preparations enriched approximately 300 fold for specific auxin­binding activity (Table 1). Analysis of the prepara­tion by 10% SDS-PAGE revealed at least 20 protein bands with molecular weights ranging from 14-94 kD (Fig.2A).

pH-optimum

The effect of pH on specific binding of IAA was tested in the range from pH 5.6-pH 9.5 (Fig. 1). The specific binding appeared to be optimal at pH 6.9-7.2. In addi­tion it appears that Tris causes an upward shift in the pH optimum.

Specificity

In preliminary experiments performed at pH 7.8 we obtained near homogeneous preparations by adsorbing proteins from crude extracts and active (NH4hS04-fractions to immobilized D-tryptophan and eluting auxin-binding proteins with 0.5 J-lM IAA. We have therefore tested the affinity of the binding activity at pH 7.8 as well as at the optimum pH 7.2. Binding activity was measured in the range of3 .125 nM-O.5 J-lM

IAA and radioactivity bound at 0.2 mM was subtracted to correct for non-specific binding. Scatchard plots revealed one high affinity binding site with aKo of 1.7-2.0 x 10-8 M for IAA at pH 7.2 and 4.8-5.1 x 10-8 M at pH 7.8.

At pH 7.2 the only compound of the six compounds tested that exhibited an inhibitory effect was 2,4-D. The apparent Ko in the presence of 10 J-lM 2,4-D was 3.9 x 10-8 M corresponding to a Kj of 8-11 J-lM. The apparent Kds in the presence of the other compounds tested were in the range of 0.5-1.8 x 10-8 M thus indicating these compounds not to be inhibitory. Four of the tested compounds appeared to be inhibitory at pH 7.8. The four compounds were 2,4-0, I-NAA, 2-NAA and D-trp with Kjs of 2-2.1,9-10,6-6.5, and 57-93 J-lM, respectively.

D-tryptophan affinity chromatography

Hypothesizing the indole moiety of IAA to be part of the structure recognized by auxin-binding proteins and that steric hindrance for binding would probably not be present in D-tryptophan we have prepared an affinity material consisting of D-tryptophan linked to Affigel-10 via the (};-amino group. Proteins from crude extracts and from active CM-preparations that were adsorbed to the material at pH 7.8 and at pH 7.2 respectively, were eluted with 0.5 mM IAA.

Affinity purification at pH 7.8 resulted in a near homogeneous preparation exhibiting a triplet with molecular weights of approximately 62, 58 and 53 kD (Fig. 2B). The 58 kD band was the most prominent and was stained red with silver. Affinity purification at pH 7.2 resulted in a preparation containing a triplet with molecular weights as above (62, 55, 53 kD) and three additional bands at approximately 42, 45 and 47 kD (Fig. 2C). At pH 7.8 it was not possible to elute the remaining three proteins by lowering the pH to 7.2 nor could they be isolated by rechromatographing the run-through at pH 7.2. When re-eluting the pH 7.2 col­umn at pH 7.8 feint bands with molecular weights of 62 and 58 kD could be observed in the protein con­taining fractions. Affinity chromatography of inactive preparations did not result in any detectable proteins in the eluted fractions at either pH.

In preliminary affinity chromatography experi­ments performed at pH 7.8 with extracts from two cultivars, Diplom and Rally, similar preparations showing a triplet with molecular weights of approxi­mately 55, 58 and 66 kD on SDS-PAGE were obtained (data not shown).

11

Table 1. Ion-exchange purification of specific auxin-binding activity from Brassica napus hypocotyls

Total protein

(mg)

Crude extract 19.44

CM-pool 0.08

Specific activity

(cpm Ilg- 1)

6"

1808

Total activity

(cpm)

110,800

144,600

Yield

(%)

130

Purification

fold

317

" Calculated from the activity determined with PEG-concentrated extract.

B

62 58 53

94 67

43

30

20

Fig. 2. SDS-PAGE of A) CM-pool; B) pH 7.8 affinity preparation; C) pH 7.2 affinity preparation.

Large scale purification and 2D-electrophoresis

Aiming at microsequencing, we performed a large scale purification of the pH 7.8 triplet from 2 kg of hypocotyl. In order to obtain a pure peptide, we attempted to purify the most prominent band further by 2D-electrophoresis. Initially 4% of the preparation

was subje..:ted to 2D-electrophoresis (Fig. 3). Surpris­ingly, the 2D-gel electrophoresis revealed only one spot corresponding to an apparent molecular weight of approximately 70 kD and a pI of about 6.8. Conse­quently the remainder of the affinity preparation was subjected to N-terminal sequencing without further purification and an insignificant sequence of 7 amino

12

6.

Fig. 3. 2-D gel of pH 7.8 affinity preparation. 1st dimension was NEpHGE.

acids together with some background was observed (data not shown). Peak heights indicated the protein sample to contain 4-8 pmole of protein (data not shown).

Discussion

By cation exchange chromatography of extracts from B. napus hypocotyls, we have obtained a protein preparation enriched 300 fold for specific IAA -binding activity. The activity was tested for binding in the pH interval from 5.6-9.5 and exhibited a rather well defined binding optimum at pH 6.9-7.2. This optimum is in good agreement with a cytoplasmic function and with previously published optima for soluble auxin binding proteins which are in the range of pH 7-pH 7.8 [11, 12, 19]. Also the affinity of the activity towards IAA at both pH 7.2 and pH 7.8 appears to agree well with previously published results where KdS ranging from 10-8 M in tobacco callus [11, 12] to 10-7 Min coconut [16] to 10-5 M in mung bean [19] have been observed.

At optimum pH, the activity is exclusively specific for IAA and 2,4-D both of which are active auxins, while the activity shows no specificity towards inactive indole derivatives or the active auxin I-NAA and its inactive analogue 2-NAA. The apparent KdS in the presence of the non-competing compounds are observed to be slightly lower than the Kd detennined with no competitor present. This agrees well with results obtained by photoaffinity labelling with tritiated azido-IAA (unpublished results) where the autoradio­gram showed a more intense staining when incuba­tions were made in the presence of D-tryptophan, L-tryptophan, and I-NAA than with radiolabel alone.

The activity exhibits a broader specificity when assayed at pH 7.8 where the binding of IAA is inhibited by I-NAA, 2-NAA, and D-Trp as well as by 2,4-D. Depending on pH the Kd for IAA is 2-3 orders of magnitude lower than the Ki for 2,4-D or NAA implying the activity to be exclusively involved in IAA binding. This may indicate the activity to be either regulatory or enzymatically involved in the metabolism of IAA in the plant rather than in what is

generally regarded as auxin effects. Provided the IAA­binding activity represents an auxin receptor the result would imply the effect of IAA on B. napus hypocotyls to be different from the effect of2,4-D and I-NAA.

In order to identify the protein(s) responsible for the auxin-binding activity we have examined the possibility of employing a group-specific adsorbent in combination with biospecific elution conditions.

Both at pH 7.2 and at pH 7.8 bound proteins were eluted between 0.1 and 0.25 mM IAA and prolonged washing after the maximum of 0.5 mM IAA was reached did not result in the elution of additional pro­teins. Furthermore at both pH's the same proteins were eluted regardless of whether crude extract or active CM-preparations were used showing the affinity pro­tocol to be rather selective. The triplet obtained by chromatography at pH 7.8 and the triplet with the higher molecular weight obtained at pH 7.2 appear to be identical, as judged by the red staining of the most prominent band.

Whether the 3 kD discrepancy in molecular weight can be ascribed to experimental variation or to pH­dependent conformational changes is not clear, though the results from 2D-electrophoresis and sequencing of the pH 7.8 large scale preparation indicates the 3 bands seen on SDS-page to represent one peptide, thereby making the latter explanation more likely.

In preliminary experiments employing two differ­ent cultivars - Diplom and Rally - affinity purifi­cation from crude extracts and from auxin-binding (NH4hS04-fractions at pH 7.8 resulted in preparations exhibiting a triplet with almost identical molecular weights, and the most prominent band at 55 kD staining red with silver (data not shown). These results indi­cate the proteins purified by affinity chromatography at pH 7.8 to be of general occurrence in Brassica nap us spring cultivars. Whether the method could be applied to other plant species has not been examined, but a doublet with molecular weights in the same area (65 and 67 kD) has been detected in extracts of several plant species by reactivity to antibodies anti-idiotypic to anti-IAA antibodies [15].

So far only indirect evidence links the affinity puri­fied protein(s) to the observed specific auxin-binding activity and cDNA-cloning and expression of the corresponding gene(s) will be pursued in order to assign biochemical functions to the individual pro­teins.

13

Acknowledgements

Ms. Winnie Dam and Mr. Thomas Seigert are acknowl­edged for skillful technical assistance. Professor JE Celis, University of Aarhus is gratefully acknowl­edged for running two-D gels and Dr. HH Rasmussen, University of Aarhus, for N-terrninal sequencing. This work was supported by EU BIOTECH contract BI02-CT93-0400 and KJ was supported by a grant from the Danish Research Academy (Grant No. 13-4380).

References

1. Bailey HM, Barker RDJ, Libbenga KR, van der Linde PCG, Mennes AM and Elliott MC (1985) Auxin binding site in tobacco cells. Biologia Plantarum 27: 105-109

2. Bilang J, Macdonald H, King PJ and Sturm A (1993) A soluble auxin-binding protein from Hyoscyamus muticus is a glutathione S-transferase. Plant Physiol 102: 29-34

3. Celis JE, Madsen P, Rasmussen HH, Leffers H, Honore B, Gesser B, Dejgfu'd K, Olsen E, Magnusson N, Kiel J, Celis A, Lauridsen JB, Basse B, Ratz GP, Andersen AH, Walburn E, Brandstrup B, Pedersen PS, Brandt NJ, Puype M, Van Damme MJ and Vanderkerckhove J (1991) A comprehensive two­dimensional gel protein database of non cultured unfractionated normal human epidermal keratinocytes: Towards an integrated approach to the study of the cell proliferation, differentiation and skin deseases. Electrophoresis 12: 802-872

4. Herber B, Ulbrich B and Jacobsen H-J (1988) Modulation of soluble auxin-binding proteins in soybean cell suspensions. Plant Cell Reports 7: 178-181

5. Jacobsen H-J (1991) Somatic embryogenesis in seed legumes: The possible role of soluble auxin receptors. Israel J Botany 40: 139-143

6. Jones AM (1990) Do we have the auxin receptor yet? Physi­ologia Plantarum 80: 154-158

7. Kikuchi M, Imaseki H and Sakai S (1989) Modulation of gene expression in isolated nuclei by auxin-binding proteins. Plant Cell Physiol30: 765-773

8. Laemmli UK (1970) Cleavage of structural protein during the assembly of the head of bacteriophage T4. Nature 227: 680-685

9. Libbenga KR and Mennes AM (1987) Hormone binding and its role-in hormone action. In: Davies PJ (ed) Plant hormones and their role in plant growth and development, pp 194--221. Kluwer Academic Publishers, Dordrecht.

10. Napier RM and Venis MA (1991) From auxin-binding protein to plant hormone receptor. TIBS 16: 72-75

11. Oostrom H, Van Loopick-Detmers MA and Libbenga KR (1975) A high affinity receptor for indoleacetic acid in cul­tured tobacco pith explants. FEBS Letters 59: 194--197

12. Oostrom H, KuleschaZ, Van Vliet TB and Libbenga KR (1980) Characterization of a cytoplasmic auxin receptor from tobacco­pith callus. Planta 149: 44--47

13. Polyacrylamide gel electrophoresis. Published by Pharmacia, Laboratory Separation Division. 1984 Uppsala, Sweden.

14. Poulsen GB and Nielsen SVS (1989) Regeneration of plants from hypocotyl protoplasts ofrapeseed (Brassica napus L. var

14

Oleifera) cultivars. Plant Cell, Tissue and Organ Culture 17: 153-158

15. Prasad PV and Jones AM (1991) Putative receptor for the . plant growth hormone auxin identified and characterized by

anti-idiotypic antibodies. Proc Natl Acad Sci 88: 5479-5483 16. Roy P and Biswas BB (1977) A receptor for indoleacetic acid

from plant chromatin and its role in transcription. Biochem Biophys Res Comm 74: 1597-1606

17. Sakai S (1992) Regulatory functions of soluble auxin-binding proteins. International Review of Cytology 135: 239-267

18. Sakai S (1985) Auxin-binding protein in etiolated mung bean seedlings: Purification and properties of auxin-binding protein­II. Plant Cell Physiol 26: 185-192

19. Sakai S and Hanagata T (1983) Purification of an auxin-binding protein from etiolated mung bean seedlings by affinity chroma­tography. Plant Cell Physiol24: 685-693

20. SchleifRF and Wensink (1981) Practical methods in molecular biology. 62-88. Manor P (ed) Springer Verlag, New York, Heidelberg, Berlin.

21. Van Der Linde PCG, Bouman H, Mennes AM and Libbenga KR (1984) A soluble auxin-binding protein from cultured tobacco tissues stimulates RNA synthesis in vitro. Planta 160: 145-157

22. Van Der Zaal EJ, Mennes AM and Libbenga KR (1987) Auxin­induced rapid changes in translatable mRNAs in tobacco cell suspensions. Planta 172: 514-519

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 15-22. © 1996 Kluwer Academic Publishers.

15

Expression of an auxin-inducible promoter of tobacco in Arabidopsis thaliana

Dianne A.M. van der Kop, Frans N.J. Droog, Bert J. van der Zaal & Paul J.J. Hooykaas Institute of Molecular Plant Sciences, Center for Phytotechnology RULITNO, Clusius Laboratory, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands

Key words: auxin, gene expression, Arabidopsis thaliana, auxin-inducible promoter, ,a-glucuronidase

Abstract

The expression of the auxin-inducible NtI03-1 gene of tobacco was studied inArabidopsis thaliana. For this purpose we introduced a gene fusion between the promoter of the gene and the ,a-glucuronidase reporter gene (GUS) into Arabidopsis thaliana. The expression and location of GUS activity were studied histochemically in time and after incubation of seedlings on medium containing auxins or other compounds. The auxins 2,4-dichlorophenoxyacetic acid (2,4-D), indole-3-acetic acid (IAA), and I-naphthylacetic acid (I-NAA) were able to induce GUS activity in the root tips of transgenic seedlings. The auxin transport inhibitor 2,3,5-triiodobenzoic acid was able to induce GUS activity not only in the root tip, but also in other parts of the root. Induction by the inactive auxin analog 3,5-dichlorophenoxyacetic acid was much weaker. Compounds like glutathione and the heavy metal CUS04 were weak inducers. GUS activity observed after induction by glutathione was located in the transition zone. Salicylic acid and compounds increasing the concentration of hydrogen peroxide in the cell were also very well able to induce GUS activity in the roots. The possible involvement of hydrogen peroxide as a second messenger in the pathway leading to the induction of the Nfl 03-1 promoter is discussed.

Introduction

The plant hormone auxin has been studied extensively over many years. It is involved in various processes like cell division, elongation, differentiation and initiation of buds and lateral roots [23]. In the past few years molecular biological tools have opened new ways to investigate t1;te mode of action of auxins and auxin signal transduction. Thus, auxin-responsive genes have been cloned and characterized [1, 6, 12, 16-22, 26, 27]. While the function of most of the isolated genes is still unknown, one group of genes can be distinguished because they encode proteins that have significant homology to animal and plant glutathione S-transferases (GSTs) [8,21].

The Nt103 genes from tobacco form a family of auxin-responsive genes encoding proteins with in vitro GST activity [8]. The cDNAs corresponding to the NtI03 genes were isolated after differential screen­ing of a cDNA library constructed from RNA isolated from auxin-starved tobacco (Nicotiana tabacum) cell-

suspension cells which were treated for four hours with 2,4-D [27]. The mRNA produced via the Nfl 03 genes was induced within 30 minutes after the addition of 2,4-D to auxin-starved cell-suspension cultures. Also other auxins were found to be able to induce the mRNA. Interestingly salicylic acid (SA) which is thought to be the endogenous signal required for induction of the systemic acquired resistance (SAR) response of plants was found to be able to induce the mRNA [3].

When the promoter of one of the genes of the Nt! 03 gene family, the Nt103-1 gene, was fused to the B­glucuronidase reporter gene (gusA) and introduced into tobacco, GUS expression could be detected in the root tips of transgenic plants. The expression was enhanced by the addition of 2,4-D to the medium [27]. We were interested to use the Nt103-1 promoter in Arabidopsis thaliana for a genetic analysis of auxin-induced gene expression. For this reason we had to test first whether the Nfl 03-1 promoter had the same expression pattern and induction characteristics in this plant species. Thus

16

Arabidopsis thaliana was transformed with constructs containing the Nfl 03-1 promoter translationally fused to the gusA coding region. The expression pattern of the hybrid gene was studied by histochemical analy­ses of seedlings. The expression of the promoter after induction with the synthetic auxins 2,4-D and I-NAA and the naturally occurring auxin indole-3-acetic acid (lAA) was compared to the expression in tobacco. The specificity of the promoter to auxin was tested by incu­bation with structural analogs of auxin. Because of the possible role of GSTs in plants, also stress-inducing compounds like heavy metals, glutathione and SA were tested. It was also tested if hydrogen peroxide, a possible second messenger in the pathway gave induc­tion of the promoter.

Materials and methods

Plant material and growth conditions

Seeds of Arabidopsis thaliana ecotype Columbia (WT-I) were a gift from Dr P. Sijmons (MOGEN International Leiden). Plants were grown at 21°C in a 16 h light/8 h dark cycle. The light intensity in the tissue culture room was 3000 lux (Philips TLDSOW 183HF).

Construction of plasmids

Construction of the Nt103-lIgusA gene fusion, pBGUS 1 and introduction into Agrobacterium tumefa­ciens strain LBA4404 were described earlier [28]. The pAIR 1 (Auxin-Induced Reporter 1) construct contains the same Nt103-lIgusA fusion gene as pBGUSl (van der Kop, unpublished). Unless otherwise stated, inde­pendent transgenic plant-lines containing the pBGUS 1 construct were used.

Transformation of Arabidopsis

Arabidopsis thaliana was transformed with Agrobac­terium tumefaciens strain LBA4404 using the root transformation protocol [24]. T, seeds were germi­nated on Basal Medium (BM) being half-strength MS medium containing 20 gil sucrose, 0.5 gil MES pH S.7 and 8 gil Daichin agar, supplemented with SO mgll kanamycin or 20 mgll hygromycin.

GUS histochemical assay

Histochemical analysis of seedlings for GUS activity was performed as described by Jefferson et al. [13]. Seedlings were incubated in a solution containing 0.3 gil, S-bromo-4-chloro-3-indolyl glucuronide (X-gluc); 0.3 mM K ferricyanide; 10 mM Na2 EDTA; 0.1 % Sodium Laurylsarcosine and 0.1 % Triton-XI00 in 0.1 M NaP04 pH 7.0 for 16 h at 37°C.

Induction assay

T 2 or T 3 transgenic seeds were surface sterilized, resus­pended in 0.1 % agarose and transferred to BM. After 48 h, the germinating seeds were transferred to BM supplemented with hormones or other compounds. After an induction period of 24 h, the seedlings were histochemically stained for GUS activity. In a segregat­ing population the number of GUS positive seedlings was determined and corrected for the percentage of transgenic seedlings as determined by germination of seeds on medium containing kanamycin.

Results

Introduction of an auxin-responsive tobacco gene in Arabidopsis thaliana

The expression of the Nt103 gene family was studied in tobacco cell suspension cultures earlier in our group [3, 4, 27]. Transcripts were found to accumulate in cell-suspension cultures after induction by auxins and certain other compounds (see discussion). Transgenic tobacco plants containing the promoter of one of the Nt103 genes, Ntl 03-1, fused to the coding region of the gusA gene (pBGUS1) were obtained previously [28]. After introduction of the pBGUS 1 construct into Arabidopsis thaliana, T, seeds were harvested. After self-fertilization of the T, plants, T2 seeds were obtained and tested in induction assays (lines 10, 13 and 21). In one experiment we used homozygous trans­genic T3 lines harbouring the pAIRl construct (lines 2,8 and 11) which contained the same Nt103-1lgusA fusion gene as pBGUS 1. The GUS activity reported below was not due to endogenous GUS activity in Arabidopsis because transgenic seedlings containing a control construct without the gusA gene, pBDHSa [10] expressed no GUS activity after induction by the compounds tested (data not shown).

Expression a/the NtJ03-1/gusAfusion in Arabidopsis thaliana and indUction by auxins

Transgenic tobacco plants harbouring the pBGUS I construct expressed GUS activity in the root tips of rapidly growing root systems [28]. The GUS expres­sion could be increased after incubation of the plants on medium containing 2,4-D. In Arabidopsis weak GUS activity was detected in the root tips in only a small percentage of transgenic seedlings after germi­nation on hormone free medium (Fig. IA). However after induction by incubation of the seedlings on medium containing 2,4-D, GUS activity was strongly enhanced. Induction of GUS activity could be achieved one to three days after germination in the primary roots. After the formation of lateral roots at 7 days after germination, GUS activity could be induced in the root tips of lateral roots and remained inducible for at least two weeks but only in young lateral roots (Fig. 11). The pattern of GUS expression depended on the age of the seedlings. In very young seedlings, induced one day after germination, weak GUS activity was detectable in almost the complete root with the strongest GUS activity in the zone of transition between the hypo<;otyl and the root, the transition zone, and in the root tip (Fig. IB). In seedlings induced two or three days after germination, GUS activity could only be detected in the root tip (Fig. I C). In the root tip GUS activity was mainly present in the epidermis.

Li et al. [14] found that light could inhibit the expression of some auxin-regulated genes and so we germinated seedlings in the dark as well. However, dark treatment did not lead to higher levels of GUS expression (data not shown).

In tobacco induction by different auxins was tested in cell-suspension cultures. 2,4-D was able to induce the mRNA produced via the NtJ03 genes efficiently. Also NAA and IAA were able to do so [27]. To com­pare the activity of different auxins in Arabidopsis, transgenic seedlings were incubated on media contain­ing varying concentrations of2,4-D, NAA or IAA (Fig. 2).

Figure 2 shows that 0.1 pM2,4-D and 0.1 pMIAA led to the induction of GUS activity. The percentage of seedlings with GUS activity was highest after induc­tion by 2,4-D. IAA was also very able to induce GUS activity. NAA gave the lowest percentage of seedlings with GUS activity, though the concentration of NAA was 10 times higher than the concentrations of 2,4-D or IAA used. After induction by NAA (Fig. lD) GUS activity was found slightly more near the very tip of

17

the root than after induction by 2,4-D or IAA, when GUS activity became visible I mm from the tip of the root.

Induction o/the NtJ03-1/gusAfusion by auxin analogs, glutathione and heavy metals

To get an idea of the structural requirements for inducers, some structurally related analogs of aux­ins were tested (Fig. 3). The compound 3,5-Clichloro­phenoxyacetic acid (3,5-D), a physiologically inactive analog of 2,4-D, gave some induction of GUS activity in the root tip. The induction was inefficient, how­ever, and comparable to that seen after incubation of seedlings on a 100 times lower 2,4-D concentration. The auxin transport inhibitor2,3,5-triiodobenzoic acid (TIBA) was very well able to induce GUS activity. GUS activity was detected in the root tip, the vascular tissue of the root and/or in the transition zone or in the complete root (Fig. IE).

GSTs catalyze the conjugation of glutathione (GSH) to electrophilic compounds and thus are involved in detoxification processes [7]. GSH was able to induce GUS activity in the transgenic Arabidopsis seedlings although it was much less effective than 2,4-D. Surprisingly, the GUS activity induced was found exclusively in the transition zone, and not in the root tip (Fig. IF).

Stress caused by heavy metals did not lead to induc­tion of the reporter gene in a tobacco cell-suspension [3]. However, incubation of Arabidopsis seedlings with CUS04 did lead to induction of the reporter gene.

Induction o/the NtJ03-l/gusA gene fusion via hydrogen peroxide

Boot et al. [3] showed that the mRNA correspond­ing to the NtJ03 gene family could be induced by SA in tobacco cell-suspension cultures. Recently it was found that the signal transduction pathway leading from SA to the expression of PR genes was mediated via activated oxygen species [5]. SA was found to inhibit a catalase whose activity normally dismutates hydrogen peroxide, H202, into H20 and 02. By doing so the concentration of H20 2 is elevated which leads to induction of the PR genes. We tested whether SA was also able to induce the Nfl 03-1 / gusA gene fusion in Arabidopsis. In experiments corresponding to those described by Chen et al. [5], we tested if H202 was involved in the signal transduction pathway leading to the induction of the gene.

18

A D

F

I

Fig. 1. Histochemical analysis of GUS activity of transgenic seedlings of Arabidopsis thaliana containing the pAIR I or pBGUS I construct. A) seedlings in the absence of inducers B) seedlings induced by 2,4 .. D (I J.LM) one day after germination. C) seedlings induced by 2,4-D (1 J.LM) two days after germination. D) idem C but induced by NAA (10 p.M). E) idem C but induced by TIBA (100 J.LM). F) idem C but induced by GSH (100 J.LM). G) idem C but induced by SA (100 J.LM). H) idem C but induced by 3-AT (1 mM). I) idem C but induced by MV (1 mM). J) seedlings induced by 2,4-D (I J.LM) seven days after germination. K) idem] but induced by SA (100 J.LM).

In Fig. 4 it is shown that SA was able to induce GUS activity in Arabidopsis seedlings. The inactive analog of SA, 3 .. hydroxybenzoic acid (3 .. HBA), was not able to induce GUS activity. Chen et al. [5]

found that 3 .. HBA was not able to inhibit catalase and thereby elevate the concentration of HzOz. The compound 3 .. amino .. l,2,4 .. triazole (3 .. AT) which is a specific inhibitor of catalase activity was able to induce

19

80 . ,0

70

:f 60 0 .. CIl 50 ~ C)

1 40 ., 0> .5 ~ 30 '" ., .. "0

20 ;I.

10

0 conlrol 0.1 ~M 2.4-0 1 ~M 2.4-0 0.1 ~M 1M 1 ~M 1M 1 ~M NAA 1 0 ~M NAA

Fig. 2. Induction of NtJ03-J /gusA expression by different auxins. Seedlings were incubated on medium containing 0.1 11M or I 11M 2,4-0, 0.1 11M or I 11M IAA or I 11M or 10 11M NAA. After histochemical staining for GUS activity, the percentage of seedlings with GUS activity was determined for three independent transgenic lines (10, 13 and 21). Per treatment 150-200 seedlings were tested. Similar results were obtained in three independent experiments.

90

80

z.. 70 :l: o .. 60

CIl ~

~ 50 'j

~ 40 ,!;

'2 ~ 30 "0 ;I. 20

10

o

. 10

control 2.4·0 3.5·0 8A TI8A GSH CuS04

Fig. 3. Induction of NtJ03-I/gusA by auxin analogs, glutathione and CUS04. Seedlings were incubated on medium containing 0.1 11M 2,4-0, 10 11M 3,5-0, 100 11M BA or 100 11M TIBA. Also I mM GSH and 10 11M CUS04 were tested. After histochemical staining for GUS activity, the percentage of seedlings with GUS activity was determined for two independent transgenic lines (10 and 13). Per treatment 100 seedlings were tested. Similar results were obtained in 2 independent experiments.

GUS activity in our system. Methyl viologen (MV) which is known to promote the generation of H20 2

turned out to be an even better inducer of GUS activity than 2,4-D. It has to be noted however, that the con­centrations of the compounds tested were 100 to 1000 times higher than the tested concentration of 2,4-D. Incubation of seedlings on medium containing H202

itself did not lead to induction of GUS activity. This was probably due to the rapid conversion of H202 into H20 and O2 in the medium. After induction by SA the GUS activity was located in the transition zone, in the vascular tissue of the root and in the root tip (Fig. 1 G). This was also the case after induction by 3-AT (Fig. IH). After induction by MV, GUS activity was more

20

~-

90

80 ~ .2: U 70 .. '" => 60 \!) £

'i 50 on 0> ~ 40 a: .. on 30 '0 .,.

20

10

0

control 2.4-D SA H202 3·AT MV 3-HBA ----------------------

Fig. 4. Induction of NtJ03-J /gusA expression by SA and H202. Seedlings were incubated on medium containing I J.lM 2,4-D, 100 J.lM SA, 100 J-LM 3-HBA, I mM H202, I mM 3-AT or I mM MY. After histochemical staining for GUS activity, the percentage of seedlings with GUS activity was determined for three independent transgenic lines containing the pAIRI construct (2, 8 and II). Per treatment 150-200 seedlings were tested.

intense and located in the transition zone, the vascular tissue of the root and the root tip or in the complete root (Fig. 11).

After induction of older plantlets by SA, GUS activ­ity was not restricted to the young root tips like after induction by 2,4-D. GUS activity was also present in the vascular tissue of older roots and in various tissues oflateral roots (Fig.lK). Plant lines 2, 8 and 11 showed higher levels of GUS activity than the plant lines trans­formed with the pBGUS 1 construct. This was probably due to the presence of the 35SCaMVpromoter near the NtJ03-I promoter in the construct pAIR 1 which was used to transform these plant lines.

Discussion

Induction by auxins and auxin analogs

The expression of GUS activity by the NtJ03-I/gusA fusion gene in Arabidopsis thalial'{a was, as in tobacco, mainly localized in the root tip [28]. After induction by auxins GUS activity was enhanced in the root tip and, depending on the developmental stage of the seedlings, could also be detected in the transition zone and in the vascular tissue of the root. The age of the roots was important for their capacity to be induced by auxins. In Arabidopsis this was more critical than in tobacco. As has been shown in tobacco cell-suspension cultures [27], different auxins were able to induce GUS activity

in Arabidopsis, whereby 2,4-D seemed to be the most effective inducer.

Differences were seen between the tobacco and Arabidopsis systems when auxin analogs were used. In tobacco cell-suspensions the inactive auxin ana­log, 3,5-D was as effective as 2,4-D in inducing GUS expression [4], but in Arabidopsis it was only a weak inducer. The opposite was true for the auxin transport inhibitor TIBA. This was a weak inducer in tobacco [4], but a strong inducer in Arabidopsis. These com­pounds have no auxin activity, but have been reported to be able to bind to the auxin-binding protein [9]. Their structural resemblance to auxins could be the reason for their ability to induce GUS activity. Differences in induction between tobacco and Arabidopsis can pos­sibly be explained by the different experimental sys­tems used. They might also be caused by differences between the Arabidopsis and tobacco auxin-binding proteins involved.

Induction by stress-inducing compounds

Glutathione as well as heavy metals, especially Cu2+ ions, were able to induce GUS activity in Arabidop­sis. This was also the case in transgenic tobacco plants (Droog, unpublished results). Recently it was found that the NtJ03 gene family encodes glutathione S­transferases [8]. In animals, GSTs are believed to play an important role in the protection of cellular macro­molecules from attack by reactive electrophiles. They

are thought to be involved in detoxification, and via their associated GSH-dependent peroxidase activity, may play an important role in protecting tissues from endogenous organic hydroperoxides produced during oxidative stress [7]. Although it is not known whether the protein encoded by the Nt103-l gene is involved in detoxification, this would be in line with the ability of stress-inducing compounds to induce the promoter. The induction by auxin and auxin analogs may also be related to the detoxifying function of the gene. Alternatively, GSTs have been found to bind a variety of hydrophobic compounds such as hormones and to serve as intracellular carrier proteins for the transport of such ligands [7, and references therein]. The function of the Ntl03-l protein may also be in binding auxin and transporting them. Recently two papers were pub­lished in which auxin-binding proteins were found to be GSTs [2,29].

Induction via hydrogen peroxide

The Nt103-l promoter has an ocs/as-l element in com­mon with the nopaline synthase (nos) promoter, and the 35S Cauliflower mosaic virus promoter [15, 30]. The ocs element was found to mediate induction by auxin and SA [30]. SA was previously found by us to be able to induce the mRNA corresponding to one of the genes of the Ntl03 gene family in cell-suspension cultures [3]. Recently, it was found that addition of SA can lead to elevated levels of H202, which in tum are involved in induction of the PR genes [5]. From a comparison of our results with the results obtained by Chen et al. [5] a clear resemblance can be seen and H202 thus seems to be one of the signals that can lead to the induction of the Nt103-l promoter. It has been found that H20 2 was able to cause an "activated state" of IAA [11] and this might lead to induction of the promoter. Alternatively, the oxidative stress caused by H202 might lead directly to a change in activity of certain transcription factors as was described for API, NF-kB and Myc in mammalian cells [7].

The location o/GUS activity

The location of GUS activity after induction by com­pounds other than auxins was not restricted to the root tip. After induction by other compounds the GUS activ­ity did also seem to be less dependent on the develop­mental stage of the roots. Boot [4] found evidence for the existence of different perception-transduction pathways for SA and 2,4-D leading to the expression

21

of the Nt103 genes. Induction of the Nt103 promoter by 2,4-Dcould be inhibited with D16 antibodies which recognize the auxin-binding site of the auxin-binding protein [25], but induction by SA was not inhibited.

A different distribution of ligand binding proteins for auxin, SA and other inducers of the Ntl 03 genes may explain the differences observed in the location of expression after addition of the different inducers.

From these experiments we concluded that the promoter of the tobacco gene was auxin-inducible in Arabidopsis thaliana. We can thus use this promoter for a genetic analysis of auxin-induced gene expres­sion.

Acknowledgement

The research described in this article was financially supported by the Netherlands Organisation for Applied Scientific Research TNO.

References

I. Alliotte T, Tire C, Engler G, Peleman J, Caplan A, van Montagu M and Inze D (1989) An auxin-regulated gene of Arabidopsis thaliana encodes a DNA-binding protein. Plant Physiol 89: 743-752

2. Bilang J, Macdonald H, King PJ and Sturm A (1993) A soluble auxin-binding protein from Hyoscyamus muticus is a glutathione S-transferase. Plant Physiol 102: 29-34

3. Boot CIM, van der Zaal EJ, Velterop J, Quint A, Mennes AM, Hooykaas PJJ and Libbenga KR (1993) Further char­acterization of expression of auxin-induced genes in tobacco (Nicotiana tabacum) cell-suspension cultures. Plant Physiol 102: 513-520

4. Boot CIM (1994) Regulation of auxin-induced genes in cell­suspension cultures from Nicotiana tabacum. PhD Thesis, Leiden University, 161 pp

5. Chen Z, Silva H and K1essig DF (1993) Active oxygen species in the induction of plant systemic acquired resistance by sali­cylic acid. Science 262: 1883-1886

6. Conner TW, Goekjian VH, Lafayette PR and Key JL (1990) Structure and expression of two auxin-inducible genes from Arabidopsis. Plant Mol BioI 15: 623-632

7. Daniel V (1993) Glutathione S-transferases: Structure and regulation of expression. Critical Reviews in Biochemistry and Molecular Biology 27: 173-207

8. Droog FNJ, Hooykaas PJJ, Libbenga KR and van der Zaal EJ (1993) Proteins encoded by an auxin-regulated gene family of tobacco share limited but significant homology with glutathione S-transferases and one member indeed shows in vitro GST activity. Plant Mol BioI 21: 965-972

9. Edgerton MD, Tropsha A and Jones AM (1994) Modelling the auxin-binding site of auxin-binding protein I of maize. Phytochemistry 35: 1111-1123

10. Goddijn OIM (1992) Regulation of terpenoid indole alkaloid biosynthesis in Catharanthus raseus: The tryptophan decar­boxylase gene. PhD Thesis, Leiden University, 99 pp

22

II. Gunse B and Elstner EF (1992) Formation of activated states of indoleacetic acid and cytokinins: An experimental approach to a hypothesis concerning signal transduction. J. Plant Physiol 140:536-540

12. Hagen G, Kleinschmidt A and Guilfoyle TJ (1984) Auxin­regulated gene expression in intact soybean hypocotyl and excisedhypocotyl sections. Planta 162: 147-153

13. Jefferson RA, Kavanagh TA and Bevan M (1987) (3-Glucuronidase (GUS) as a sensitive and versatile gene fusion marker in plants. Journ of Cellular Biochemistry S II B (57) meeting abstract

14. Li Y, Hagen G and Guilfoyle TJ (1991) An auxin-responsive promoter is differentially induced by gradients during tropisms. The Plant Cell 3: 1167-1175

15. Liu X and Lam E (1994) Two binding sites for plant transcrip­tion factor ASF-I can respond to auxin treatments in transgenic tobacco. The Journal of Biological Chemistry 269: 668-675

16. McClure BA and Guilfoyle TJ (1987) Characterization of a class of small auxin-inducible soybean polyadenylatedRNAs. Plant Mol Bioi 9: 611-623

17. Reddy ASN and Poovaiah BW (1990) Molecular cloning and sequencing of a cDNA for an auxin-repressed mRNA: correla­tion between fruit growth and repression of the auxin-regulated gene. Plant Mol Bioi 14: 127-136

18. Reddy ASN, Jena PK, Mukherjee SK and Poovaiah BW (1990) Molecular cloning of cDNAs for auxin-induced rnRNAs and developmental expression of the auxin-inducible genes. Plant Mol Bioi 14: 643-653

19. Takahashi Y, Kuroda H, Tanaka T, Machida Y, Takebe I and Nagata T (1989) Isolation of an auxin-regulated gene cDNA expressed during the transition from GO to S phase in tobacco mesophyll protoplasts. Proc Natl Acad Sci USA 86: 9279-9283

20. Takahashi Y and Nagata T (1992a) Differential expression of an auxin-regulated gene, parC, and a novel related gene C-7,

from tobacco me sophy II protoplasts in response to external stimuli and in plant tissues. Plant Cell Physiol 33: 779-787

21. Takahashi Y and Nagata T (1992b) parB: An auxin-regulated gene encoding glutathione S-transferase. Proc Natl Acad Sci USA 89: 56-59

22. Theologis A, Huynh TV and Avis RW (1985) Rapid induction of specific mRNAs by auxin in pea epicotyl tissue. J Mol Bioi 183:53-68

23. Thimann KV (1969) The Physiology of Plant growth and developement. New York: McGraw-Hill

24. Valvekens D, van Montagu M and van Lijsebettens M (1988)Agrobacterium tumefaciens mediated transformation of Arabidopsis thaliana root explants by using kanamycin selec­tion. Proc Natl Acad Sci USA 85: 5536-5540

25. Venis MA, Napier RM, Barbier-Brygoo H, Maurel C, Perrot­Rechenmann C and Guern J (1992) Antibodies to a peptide from the maize auxin-binding protein have auxin agonist activity. Proc Nat! Acad Sci USA 89: 7208-7212

26. Walker JC and Key JL (1982) Isolation of cloned cDNAs to auxin-responsive poly(A) RNAs of elongating soybean hypocotyl. Proc Natl Acad Sci USA 79: 7185-7189

27. Van der Zaal EJ, Memelink J, Mennes AM, Ouint A and Libbenga KR (1987) Auxin-inducedmRNA species in tobacco cell cultures. Plant Mol Bioi 10: 145-157

28. VanderZaal EJ, DroogFNJ, BootCJM, HensgensLAM,Hoge JHC, Schilperoort RA and Libbenga KR (1991) Promoters of auxin-inducible and root tip-specific expression. Plant Mol Bioi 16: 983-998

29. Zettl R, Schell J and Palme K (1994) Photoaffinity labeling of Arabidopsis thaliana plasma membrane vesicles by 5-azido­[7 -3Hlindole-3-acetic acid: Identification of a glutathione S-transferase. Proc Nat! Acad Sci USA 91: 689-693

30. Zhang B and Singh KB (1994) ocs element promoter sequences are activated by auxin and salicylic acid in Arabidopsis. Proc Natl Acad Sci USA 91: 2507-2511

A. R. Smith et al. (eds.). Plant Hormone Signal Perception and Transduction. 23-29. © 1996 Kluwer Academic Publishers.

23

The heterogeneity of the plasma membrane H+ -ATPase response to auxin An alternative way to analyse signal perception and transduction?

F. Masson, W. Szponarski & M. Rossignol Lab. Biochimie et Physioiogie Wgetaies. INRAIENSA-MICNRS URA 573. 34060. Montpeliier 1. France

Key words: tobacco, auxin, plasma membrane H+ -ATPase, sensitivity, marker polypeptides

Abstract

The sensitivity of the plasma membrane H+ -ATPase in tobacco was investigated in vitro, both at the proton translocation level and the ATPase level, according to plant development and leaf location. Both activities are stimulated by auxin in all leaves, whatever the plant age and the leaf age. However, the sensitivity to auxin was heterogeneous with respect to plant development and leaf location. In parallel experiments using the same plasma membrane samples, polypeptides patterns were investigated by two-dimensional gel electrophoresis and image analysis was used to quantify the relative abundance of 11 ° peptides. Systematic analysis of the two kinds of data identified 8 polypeptides, the abundance of which changed in a consistent way with the sensitivity, whatever the plant developmental state and leaf location. These unknown polypeptides are proposed as potential markers of the membrane response to auxin.

Introduction

The response to auxin of the plasma membrane H+ -ATPase constitutes one of the best documented mem­brane responses to a phytohormone described [10, 17, 21].

Although many hypothesis have been proposed concerning the pathway between auxin and its target [1, 2, 6, 7, 11, 20, 22, 23, 28], signal percep­tion and transduction remain to be elucidated. In the case of tobacco leaves, we previously showed that the ATPase-mediated proton translocation on isolated plasma membrane vesicles depends in a complex way on auxin concentration. The dose-response curves between proton translocation and IAA are system­atically bell-shaped in such a way that, according to the IAA concentration, the ATPase can remain unaffected, be stimulated or inhibited [17, 18]. This situation allows one to take in practice the hormone concentration inducing the highest stimulation of proton pumping as a measure of the in vitro sensitivity to auxin of the perception and transduction pathway.

In addition, we observed that this sensitivity changes during plant development. For membrane vesicles pre­pared from leaves of vegetative or flowering plants, the optimal concentration is quite high ( ca 10 J-LM ), but this concentration transiently decreased by ca 3 orders of magnitude during floral induction [17, 18]. Such effects were observed with plasma membrane prepa­rations obtained using non-senescent leaves from the plants. However, several lines of evidence indicate that the response could be heterogeneous according to leaf and plant age: (i) an auxin concentration gradient is known to occur in tobacco according to the age of the leaves [24], (ii) the auxin content in leaves increases during the induction of flowering [12], and (iii) var­ious functional and structural changes are known to take place during growth and development such as the sink to source transition [9].

The present work was undertaken in order (i) to investigate the heterogeneity of the ATPase sensitivity to auxin in tobacco and (ii) to look at structural differ­ences which could be linked to the sensitivity level in the membrane. Our results show that the plasma mem-

24

brane from each leaf has its own sensitivity to auxin, and identifies some plasma membrane polypeptides as potential markers of the sensitivity to the hormone.

Materials and methods

Biological material

Tobacco plants (Nicotiana tabacum cv Xanthi) were grown from seed in a controlled chamber (20 0 C, 70% relative humidity, 16 h photo-period, 16000 lux) as previously described [17, 18]. In these culture con­ditions the floral induction time, as determined from the rate of leaf emergence [15], occurred ca 50 days after sowing; the first flower buds were detected ca 15 days later and full flowering occurred at days 100--110; seed formation was displayed over a ca 30 day period and flowering was completely finished at days 150--160. According to the experiment, 3 kinds of leaf samples were used: (i) all the non-senescent leaves, (ii) sets of leaves corresponding respectively to the top (5 or 6 youngest leaves), the middle (3 leaves under the top sample) and the bottom of the plants (3 leaves under the middle sample), or (iii) the eighth leaf which appeared on plants. Plasma membrane vesicles were purified from a microsome suspension by phase parti­tioning as previously described [17, 18]. Proteins were assayed according to Bradford [4].

Membrane characterisation and assay of the sensitivity to 1M

Characterisation of the ATPase activity was performed by colorimetric determination of Pi released in the pres­ence of various substrates or inhibitors [17, 25]. For investigation of the auxin effect on the H+ -ATPase, the ATPase proton translocation activity and ATP hydrol­ysis were simultaneously and continuously monitored on a two-channel spectrofluorometer (Aminco SLM 8000). Briefly, ca 30 pg of native plasma mem­brane vesicles were introduced into a cuvette contain­ing 10 mM/Tris buffer at pH 6.5, 100 mM KCl, 60 pM NADH, 1 mM phosphoenolpyruvic acid (PEP), 50 pg/ml pyruvate kinase (PK) , 50 pg/ml lactate dehydrogenase (LDH) and 2 pM 9-amino-6-chloro-3-methoxy-acridine (ACMA). In addition, the assay medium contained 1 % acetonitrile (controls) or was supplemented by 1 % of a 100-fold concentrated IAA solution in acetonitile. After addition of 500 pM ATP, the proton translocation was monitored on one

channel by the fluorescence quenching rate of ACMA using excitation at 411 nm and detection through a narrow long-pass filter (50% transmission at 455 nm). ATP hydrolysis was measured on the second channel by the NADH fluorescence decrease associated to ATP regeneration in the presence of PEP and PK, and sub­sequent reduction of pyruvic acid into lactic acid in the presence ofLDH (excitation and emission wavelength of respectively 353 nm and 427 nm). Both activities were quantified by the initial rate of the corresponding fluorescence decrease after ATP addition.

Polypeptide analysis

Two-dimensional gel electrophoresis was performed according to O'Farrell [16] using pH 3.5-10 ampholytes for isoelectric focusing and a 10% acry­lamide/bisacry lamide gel in the second dimension [13, 19]. After silver staining proteins [5], the intensity of spots was quantified on an image analysis system (SAMBA 2005, Alcatel-TITN, Grenoble, France) fitted with a black and white CCD camera and an image processing card (4 x 512 x 512 x 8 bits, Matrox MVP/ AT) as previously described [13, 19]. Briefly, the grey levels of spots (G) and of background (Go), and hence optical density (log GoIG, were first computed. Five spots, the optical density of which was found to correspond to a constant fraction of the sum of optical densities, were taken as internal references. The rela­tive amount of spots of interest was then calculated as the percentage of their optical density over the sum of optical densities of references.

Results

The ATPase activity was 95% dependent on the pres­ence of magnesium (Fig. 1) and strongly inhibited by 250 pM vanadate with Ki in the range of 6 to 8 pM (not shown). On the other hand, the ATPase activity was not affected by nitrate, an inhibitor of the tonoplastic ATPase. Oligomycin and azide, inhibitors of the mito­chondrial ATPase also had no effect on the ATPase activity. A very low activity was measured when ATP was replaced by IDP, a substrate for the IDPase of the Golgi apparatus, or by PNPP as substrate of phos­phatases.

Both ATP hydrolysis and proton translocation were stimulated by auxin in a biphasic way, and the optimal IAA concentration was nearly the same for the two activities (Fig. 2). This behaviour was also observed

Control

- Magnesium

+ Vanadate

+ itrate

+ Oligomycin

+ Azide

+ lOP

+PNPP

o 20 40 60 80 100 120

ATPase activity

Fig. 1. Characterisation of phosphohydrolase activities on mem­brane fractions. Activities were measured by colorimetric determi­nation of Pi. Control: 3 mM ATP as substrate (specific activity: 2.2 iLmol·min-l.mg-I); - Magnesium: no magnesium in the assay medium; + Vanadate: + 250 iLM orthovanadate; + nitrate: 50 mM KN03 in the place of KCI; + Oligomycin: + 5 mg 1-1 oligomycin; + Azide: +lmM sodium azide; + IDP: 3 mM IDP in the place of ATP; + PNPP: 3mM PNPP in the place of ATP.

140 o A TP hydrolysis • Proton translocation

130

120

110 •

100 •

IAA (M)

Fig. 2. Auxin effect on tobacco plasma membrane H+ -ATPase. ATP hydrolysis and proton translocation were simultaneously recorded by the initial rate of fluorescence decrease of respectively NADH and ACMA after ATP addition. Activities are normalised to those of the control in the presence of I % acetonitrile. IAA was added from 100 times concentrated solutions in acetonitrile.

with plasma membrane vesicles obtained from one leaf, together with vesicles purified from either a set of leaves or using all the non-senescent leaves. How­ever, the width of the stimulation peak was found to increase when the heterogeneity of the sample increased (Fig. 3).

According to the stage of development, the sen­sitivity to IAA of the plasma membrane H+ -ATPase

""' '0 .... -C Q U .... <I> ;.. Q

~ '-"

c: 0 .... ... ('IS CJ 0 -I"Il c: ('IS

'"' ... c: 0 ... 0

'"' ~

130 All leaves

110

100

130 Leaf n08

120

• 110

100

90L-__ -L ____ ~ __ -L ____ ~ __ ~

10 -9 10 -8 10 -7

AlA 10 ·6 10-5

(M)

25

Fig. 3. Comparative auxin effects on proton translocation in vari­ous leaf samples. Proton translocation was measured by the initial fluorescence quenching rate of ACMA after ATP addition, and is expressed as percentage of control in the presence of I % acetoni­trile. Plasma membrane vesicles were prepared from a homogeneous batch of plants, using either only the eighth leaf (when numbering from the top), or leaves 7,8, or 9 (middle leaves), or leaves I to 12 (all leaves).

presented complex variations which were similar in all leaves whatever their location on plants (Fig. 4). The same behaviour was also observed when plasma membrane vesicles were prepared using only one leaf (eighth leaf, Fig. 5). However, in this later case, it

26

Proton translocation A TP hydrolysis

10 -4 c::: 10.5 "tl

"tl 10 .6 • f'I)

""I

10 -7 ...... f'I) - III

~ 10 ·8 <: f'I) - 10 -9 f./l

~ 10 -4 ~ - 10.5 ....

0 Q. .....

10-6 Q. ......

.c I'D

10 ·7 -.... I'D :> 10 -8

III .... <: ..... .... I'D {/l 10 -9 f./l = Q,j

{/l

Q,j 10-4 •

(/l - • I'd 10 -5 • t"""

~ 0 f-4

10 -6 ~ < I'D

10.7 ""l ...... I'D

10.8 III <:

10.9 f'I) f./l

40 60 80 100 120 140 60 80 100 120 140

Days after sowing

Fig. 4. Evolution of the ATPase sensitivity to auxin during plant development in various sets of leaves. Proton translocation and ATP hydrolysis were measured as in Fig. I on plasma membrane vesicles prepared from an homogeneous batch of plants, using either the 6 first leaves (from the top, upper leaves), leaves 7 to 9 (middle leaves), or leaves 10 to 12 (lower leaves).

Proton translocation ATP hydrolysis

>. .... 10 -4 .....

:> ..... .... .-. 10 -5 ·til ~

I=: , QJ< {/l< 10 -6

- 10 -7 QJ ...... {/l

fU 10 -8 ~

f-4 <

40 50 60 40 50 60

Days after sowing

Fig. 5. Evolution of the ATPase sensitivity to auxin during plant development in the eighth leaf. ATPase sensitivity was measured as in Fig. 4 using plasma membrane vesicles prepared using only the eight leaf of a homogeneous batch of plants.

3 4 1 2 3 3 4 5 1 2

·5 \ ~ 10.5

= 10 'j( ·7 10.7 := 10 ~

g 10.9 10.9

a .s; ·5 ,\ ~ \ ~

·5 -= 10 10 .~

= ., ., ... 10 10 til

10.9 10.9

1 2 1 2 1 2 1 2

Relative abundance (arbitrary units)

Fig. 6. Relationship between the relative abundance of some plasma membrane polypeptides and the sensitivity to IAA of the ATPase. Results are derived, for each polypeptide, from the analy· sis of couples of data (sensitivity, relative abundance) obtained on 42 plasma membrane samples. Polypeptides are named by arbitrary numbers.

was not possible to continue the experiment after 65 days, as the eighth leaf became senescent. In addition, both the ATP hydrolysis activity and proton translo­cation activity exhibited the same sensitivity changes. The sensitivity pattern was characterised in all leaves by 3 features: (i) a relatively low sensitivity for veg­etative plants (ii) a large (2 to 3 orders of magnitude) and transient increase of sensitivity at a time period corresponding to floral induction, and (iii) a low sensi­tivity for pre-floral and flowering plants. On the other hand, the level of sensitivity appeared to depend on the location of leaves in plants: the plasma membrane H+ -ATPase in the ca 10 youngest leaves (upper and middle leaves, Fig. 4) was systematically more sensi­tive to auxin, by ca one order of magnitude, than in bottom leaves.

The polypeptide composition of the plasma mem­brane vesicles used above was investigated by 2-D gel electrophoresis. For each of the 14 development states and of the 3 leaves locations, the relative abundance of 110 polypeptides was quantified (4 to 6 gels per sample). By using the preceding results (Fig. 4), 42 couples of data relating the abundance of the polypep­tide in the plasma membrane to the sensitivity to auxin ofthe same membrane sample were computed. Finally, the abundance values were distributed into classes corresponding to the sensitivity and the mean abun­dance was calculated for each sensitivity class. The analysis of the "abundance Isensitivity" relationship identified 8 polypeptides, the abundance of which changed consistently according to the sensitivity of the H+ -ATPase (Fig. 6) to IAA.

27

Discussion

The membrane vesicles prepared from tobacco leaves are able to accumulate protons upon ATP addition and possess an ATPase activity which is very sensitive to vanadate and dependent on the presence of magnesium. These features are characteristic of the plasma mem­brane H+ -ATPase [27]. On the other hand, no other phosphohydrolase activity was detected. Finally, no significant change was observed during plant devel­opment: for instance, the mean sensitivity to vana­date over 42 determination from vegetative state to flowering state amounted to 94±3%. Therefore, it can be assumed that these membrane fractions are highly enriched in plasma membrane, in agreement with previous results obtained using the same purifica­tion procedure in tobacco [13, 17, 18].

In all the plasma membrane fractions tested, the H+ -ATPase appears to be sensitive to IAA. In addition the hormone induces the same activation of both the ATP hydrolysis activity and the proton translocation activity. This suggests that the two activities are closely linked. In previous reports [10, 17, 18,21], the auxin was mainly investigated at the proton translocation level. As this kind of activity is vectorial, its modu­lation by an effector could result from changes in the activity of any system which contributes to dissipate the proton electrochemical gradient. In this view, our results indicate that the proton overtranslocation inside the vesicles, in the presence of IAA is mainly due to ATPase activation. It can also be concluded that ATPase activation by auxin is a property common to all leaves whatever the plant developmental stage and the location of the leaf on the plant. However, the effec­tive auxin concentration range increases as the number of different leaves increases in the sample. This indi­cates that the plasma membrane H+ -ATPase from each leaf has its own sensitivity to auxin and suggests that the overall response of a set of leaves corresponds to the envelope of the individual responses of leaves. On this point of view, the ATPase response to auxin, at a given developmental stage appears to be hetero­geneous according to leaf age. Until now, two kinds of heterogeneity in the ATPase response to IAA have been identified: according to plant developmental state (see below and [17, 18]), and, at a given develop­mental state, between plasma membrane subpopula­tions purified from a sample containing various leaves [13]. No attempt was made here to purify plasma mem­brane subpopulations starting from a sample of one given leaf. Therefore, it cannot be concluded whether

28

previously characterised plasma membrane subpopula­tions correspond to vesicles originating from different leaves, nor if the vesicles obtained here from one leaf are homogenous for their response to auxin or not.

The sensitivity to IAA of the plasma mem­brane H+ -ATPase changes during plant development, whatever the location of the leaf on plants. A tran­sient sensitivity increase is observed at ca 50 days, depending on the time of year when culturing is per­formed. According to the rate of leaf appendage [15], this increase can be associated to floral induction. Sim­ilar sensitivity changes at floral induction have been already observed in tobacco using all plant leaves [18]. In addition, this behaviour was also observed in other plants [3, 8, 14] and was proposed to be typical of day neutral- and long- day plants [14]. The fact that we observe it, even using one leaf and whatever the loca­tion of the leaf, corroborates the assumption that an increase, at floral induction, of the ATPase sensitivity to auxin could be a general plasma membrane leaf response common to all leaves. However, differences concerning the extent ofthe sensitivity changes seem to occur according to the leaf location. Firstly, the lower leaves appear to be systematically less sensitive to IAA than other leaves. In the same way, when looking at the eighth leaf, the desensitisation after floral induc­tion is more pronounced (ca 4 orders of magnitude in 20 days, see Fig. 5) as compared to that occurring during the same time interval in the 3 sets of leaves which were investigated (ca 2 orders of magnitude in 20 days, see Fig. 4). This suggests the occurrence of another source of heterogeneity between leaves occurs. One possible explanation is that the eighth leaf belongs to the set of middle leaves at floral induction, but is one of lower leaves 20 days later. By this way, it can be proposed that the sensitivity behaviour of a given leaf is heterogeneous with time and integrates both (i) sensitivity changes controlled by plant age, dur­ing the plant development, and (ii) sensitivity changes controlled by leaf age, according to leaf location on plant. The quantitative analysis of polypeptide pat­terns has shown that the polypeptide composition of the plasma membrane changes during plant develop­ment. Such changes have already been observed at given development or growth states such as the flo­ral induction [14] or the sink to source transition [9]. A first level of analysis of the relationships between polypeptide abundance in the membrane and the mem­brane sensitivity to IAA was to simply correlate the accumulation of polypeptides with the sensitivity at time periods where the sensitivity is particularly high,

as at floral induction for instance. However, such an approach cannot distinguish between potential markers of the sensitivity and potential markers of floral induc­tion. Therefore, we used a systematic classification of polypeptide amounts according to the sensitivity to IAA of the membrane whatever the origin of mem­branes (location in plants and age of plants). Using this method some polypeptides were identified which could be taken as potential markers of the level of sensitivity to IAA of the plasma membrane H+ -ATPase. Whether the polypeptides described here actually participate to signal perception and transduction remains to be elucidated. One meaningful point is the likelihood that the accumulation of several polypeptides can be correlated to the level of sensitivity of the membrane. This could suggest that the sensitivity of the ATPase to auxin, as it is measured, includes the participation of various polypeptides, such as those participating in the perception and transduction of the auxin signal, as well as any polypeptide which can modify the proton electrochemical gradient. Few molecular data are cur­rently available concerning the plant plasma membrane [26]. These data mainly concern a few carriers, chan­nels and transport systems. On the basis of molecu­lar weight and pI values, no tentative identification of the polypeptides presented here can be proposed. Investigation of their nature is currently in progress by polypeptide microsequencing.

In conclusion, this work shows that the plasma membrane is heterogeneous towards its response to IAA and its polypeptide composition. The combined and systematic use of functional and structural hetero­geneities can be proposed as an alternative approach to identify the pathway leading the H+ -ATPase activation by auxin.

Acknowledgement

This work was supported by an ARN fellowship to EM. and by the AlP "Biologie du Development" of INRA.

References

I. Barbier-Brygoo H, Ephritikhine G, KUimbt D, Ghislain M and Guem J (1989) Functional evidence for an auxin receptor at the plasmalemma of tobacco mesophyll protoplasts. Proc Natl Acad Sci USA 86: 891-895

2. Barbier-Brygoo H, Ephritikhine G, Kliimbt D, Maurel C,Plame K, Schell J and Guem J (1991) Perception of the auxin signal at

the plasma membrane of tobacco mesophyll protoplasts. The Plant Journal I: 89-93

3. Bellamine J, Pene! C and Greppin H (1993) Proton pump and IAA sensitivity changes in spinach leaves during the flowering induction. Plant Physiol Biochem 31: 197-203

4. Bradford MM (1976) A rapid and sensitive method for the quantification oi microgram quantities of protein utilising the principle of protein binding. Anal Biochem 72: 248-254

5. Damerval C, Le Guilloux M, Blaisonneau J and de Vienne D (1987) A simplification of Heukeshoven and Demick's silver staining of proteins. Electrophoresis 8: 158-159

6. Einspahr KJ and Thompson GA Jr (1990) Transmembrane signalling via phosphatidylinositoI4,5-biphosphate hydrolysis in plants. Plant Physiol93: 361-366

7. Ettlinger C and Lehle L (1988) Auxin induces rapid changes in phosphatidylinositol metabolites. Nature 331: 176-178

8. Fran~ois JM, Berville A and Rossignol M (1992) Development and line dependent variations of Petunia plasma membrane H+ -ATPase sensitivity to auxin. Plant Sci 87: 19-27

9. Frommer W3, Hummel S, Lemoine R and Delrot S (1994) Developmental changes in the two-dimensional protein pattern of plasma membrane vesicles between sink and source leaves from sugar beet. Plant Physiol Biochem 32: 205-209

10. Gabathuler R and Cleland RE (1985) Auxin regulation of a proton trans locating ATPase in pea root plasma membrane vesicles. Plant Physiol 79: 1080-1085

I I. Jones AM (1994) Auxin-binding proteins. Annu Rev Plant Physiol Plant Mol Bioi 45: 393-420

12. Lozhnikova V, Machackova I, Eder J, Dudko N, Krekule J and Chailakhyan MK (1990) Changes in free IAA levels in the leaves of short- and long- day tobacco during flowering and the effects of applied IAA on the transition to flowering. Bioi Plant 32: 339-345

13. Masson F, Rakotomavo M and Rossignol M (1993) Charac­terisation in tobacco leaves of structurally and functionally different membrane fractions enriched in vanadate sensitive H+ -ATPase. Plant Sci 92: 129-142

14. Masson F, Santoni V and Rossignol M (1994) Functional and structural changes at the plasma membrane during the induc­tion of flowering in tobacco leaves. Flowering Newsletter 17: 39-43

15. McDaniel CN (1992) Determination to flower in Nicotiana, in current topics in developmental biology (Pedersen R A ed.) New York Academic Press Vol. 27: 1-37

29

16. O'Farrell PH (1975) High resolution two-dimensional elec­trophoresis of proteins. J Bioi Chern 250: 4007-4021

17. Santoni V, Vansuyt G and Rossignol M (1990) Differential auxin sensitivity of proton translocation by plasma membrane H+ -ATPase from tobacco leaves. Plant Sci 68: 33-38

18. Santoni V, Vansuyt G and Rossignol M (1991) The chang­ing sensitivity to auxin of the plasma membrane H+ -ATPase: relationship between plant development and ATPase content of membranes. Planta 185: 227-232

19. Santoni V, Vansuyt G and Rossignol M (1993) Indoleacetic acid pre-treatment to tobacco plants in vivo increases the in vitro sensitivity to auxin of the plasma membrane H+ -ATPase from leaves and modifies the polypeptide composition of the membrane. FEBS Lett 326: 17-20

20. Schell J, Palme K, Reiss B and WaldenR (1993)Recentadvan­tages in the search for genes involved in the mechanisms of action of auxin and cytokinins. J Plant Res 3: 221-227

21. Scherer GFE (1984) Stimulation of ATPase activity by auxin is dependent on ATP concentration. Planta 161: 394-397

22. Scherer GFE and Andre B (1989) A rapid response to a plant hormone: auxin stimulates phospholipase A2 in vivo and in vitro. Biochim Biophys Res Commun 163: 111-117

23. SchererGFE and Andre B (1993) Stimulation of phospholipase A2 by auxin in microsomes from suspension-cultured soybean cells is receptor-mediated and influenced by nucleotides. Planta 191: 515-523

24. Sitbon F, Sandberg B, Olsson 0 and Sandberg G (1991) Free and conjugated Indoleacetic acid (IAA) content in transgenic tobacco plants expressing the iaaM and iaaH IAA biosyn­thesis genes from Agrobacterium tumefaciens. Plant Physiol 95: 480-485

25. St Marty-Fleurence F, Bourdil I, Rossignol M and Blein JP (1988) Active vanadate-sensitive H+ -translocation in com roots membrane vesicles and proteoliposomes. Plant Sci 54: 177-184

26. Sussman MR (1994) Molecular analysis of proteins in the plant plasma membrane. Annu Rev Plant Physiol Plant Mol Bioi 45: 211-234

27. Sze H (1985) H+ -translocating ATPases: advances using membrane vesicles. Annu Rev Plant Physiol 36: 175-208

28. Zbell B and Walter-Back C (1988) Signal transduction of auxin on isolated plant cell membranes: indications for a rapid polyphosphoinositide response stimulated by indoleacetic acid. J Plant Physiol133: 353-360

A. R. Smith et al. (elis.), Plant Hormone Signal Perception and Transduction, 31-36. © 1996 Kluwer Academic Publishers.

31

Elementary auxin response chains at the plasma membrane involve external abpl and multiple electrogenic ion transport proteins

Helene Barbier-Brygool, Sabine Zirnrnennann I, Sebastien Thorninel , Ian R. White2 ,

Paul Millner2 & Jean Guern l lInstitut des Sciences Vegetales, CNRS, Avenue de la Terrasse, F-9 1198 Gif sur Yvette, France; 2 Department of Biochemistry and Molecular Biology, University of Leeds, Leeds, LS2 9JT, UK

Key words: al'.xin receptor, ion channels, auxin-binding protein, protoplasts, electrophysiology

Abstract

Studies of membrane electrical responses of isolated protoplasts to auxin have demonstrated the existence of elementary response chains to auxin at the plasma membrane, presently defined only by their uttermost ends. At one side, as demonstrated by several lines of evidence, the auxin perception unit involves proteins homologous to ZmER -abp 1 (abp 1), the most abundant auxin-binding protein from maize coleoptiles. At the other side, multiple ion transport proteins appear as targets of the auxin signal; the proton pump ATPase, an anion channel and potassium channels. We investigated early electrical responses to auxin at the plasma membrane of tobacco protoplasts. The work presented here will initially focus on abpl and its functional role at the membrane. The C-terminus abpl peptide (pzI51-163) was recently reported to modulate K+ currents at the plasma membrane of intact guard cells from broad bean [23] and induce plasma membrane hyperpolarisation of tobacco mesophyll protoplasts. These results further demonstrate that proteins involved in plasma membrane responses to auxin are related to maize abpl, and provide clues as to the region of the protein possibly involved in the interaction of abpl with the plasma membrane. Secondly, this report concentrates on one of the targets of auxin, a voltage-dependent and ATP­regulated anion channel that we characterised on protoplasts from tobacco cell suspensions. This anion channel was specifically modulated by auxin, as already observed for the anion channel of guard cells [14]. Further work will be needed to assess if this auxin modulation involves a direct interaction between the hormone and the anion channel protein(s), or follows from the activation of a perception chain including abpl homologues.

Introduction

Despite recent breakthroughs in the isolation and molecular characterisation of a variety of auxin­binding proteins which constitute putative receptors [reviewed in 11, 24] no genuine auxin receptor(s) have yet been unambiguously identified. Among the functional approaches aiming at tracking such recep­tors [reviewed, 1], studies of membrane electrical responses of isolated protoplasts to auxin have demon­strated the existence of elementary response chains to auxin at the plasma membrane [8]. Such chains are at present defined only by their uttermost ends: the auxin perception unit and target effector protein(s).

As to the proteins involved in auxin perception at the plasma membrane and their ability to trigger these electrical responses, several lines of evidences point to the involvement of proteins homolgous to ZmER­abpi (abpI), the most abundant auxin-binding protein from maize coleoptiles [2, 3, 17]. At the other side of the chain, several types of electrogenic units at the plasma membrane appear as targets of the auxin signal and may participate in the hormone-induced changes in membrane potential [4]. In order to account for auxin effects on excised organs, it has been proposed that hyperpolarisation of the plasma membrane follows from activation of the proton pump ATPase by auxin [7, 22]. This hypothesis is now well documented in

32

protoplasts from various materials (tobacco leaves [2], broad bean stomatal guard cells [13], maize coleoptiles [17]). The stimulation by auxin of H+ -translocation activity of the ATPase monitored on plasma membrane vesicles from tobacco leaves [18, 19] demonstrates that this elementary response chain operates at the mem­brane independently of cytoplasmic factors. In guard cell protoplasts, auxin was also shown to modulate the anion channel GCACI [14]. The hormone effect could be observed in isolated membrane patches, showing again that a complete response chain is present at the membrane. Finally, experiments with intact guard cells revealed that auxin regulated the activity of potassium channels. On one hand the hormone stimulated the out­ward rectifying K+ channel and on the other hand it exerted a bimodal control of the inward rectifying K+ channel possibly involving the modulation of cytosolic pH [5].

In the work reported here, we investigated early electrical responses to auxin at the plasma membrane of tobacco protoplasts, focusing on one hand on abp 1 and its functional role at the membrane, and concen­trating on the other hand on one of the targets of auxin, a voltage-dependent and ATP-regulated anion channel.

Materials and methods

Cell culture and protoplast isolation

Cell suspensions of tobacco (Nicotiana tabacum cv Xanthi) were cultured and protoplasts isolated as described in [26]. Mesophyll protoplasts were isolated as described in [3].

Electrophysiological investigations

Patch-clamp experiments were performed with freshly isolated protoplasts from tobacco cell suspensions as described [26]. Cell currents were measured in the whole-cell configuration and single channel activity was recorded from outside-out patches. Measurements were performed in bathing medium containing (mM) 50 CaCh, 5 MgCh, 300 mannitol, 10 Mes/Tris, pH 5.6. Pippettes were filled with (mM) 150 KCI, 2 MgCI2,

0.1 EGTA, 150 mannitol, 10 Tris/Mes, pH 7.2 and 10 MgATP.

Transmembrane electrical potential difference (Em) was measured on mesophyll protoplasts by the microelectrode technique [3].

Results and discussion

abp 1 has a functional role at the plasma membrane of tobacco mesophyll protoplasts

On tobacco mesophyll protoplasts, auxin was shown to induce hyperpolarisation of the plasma membrane with an inverted bell-shaped dose-response curve [6]. This electrical response to auxin was antagonised by poly­clonal antibodies to ZmER-abpl (anti-abpl antibody) [2, 3]. In contrast, a polyclonal antibody raised to a synthetic peptide based on the putative auxin-binding domain of abp 1 (D 16 antibody) exhibited auxin agonist activity of this electrical response [25]. More recently, Ruck et al. [17] showed with protoplasts from maize coleoptiles that these anti-abpl and D16 antibodies exhibited antagonist and agonist activities, respec­tively, on the activation of the proton pump current by auxin. These data demonstrated that abpl-related proteins were present at the plasma membrane and involved in electrical responses to the hormone. The fact that the auxin sensitivity of tobacco protoplasts could be markedly enhanced by incubation with very low concentration of purified maize abp 1 revealed that abpl itself was able to associate with the protoplast surface and to play an active role in auxin signalling [3]. To account for these results, we proposed a model for the organisation of auxin perception units at the plasma membrane [3]. In this model a soluble excreted abp 1 (or an homologous auxin binding protein in tobacco) associates with a transmembrane protein to form a functional receptor able to bind auxin at the cell surface and to transmit the signal inside the cell.

More recently, studies using synthetic peptides based on reproducing different abp 1 domains, Thiel et al. [23] reported that a peptide based on reproducing the 12 C-terminal residues (pz 151-163) rapidly and reversibly modulated the activity of K+ channels in the plasma membrane of intact guard cells from broad bean. The peptide induced a strong inhibition of the inward K+ rectifier and a slight stimulation of the out­ward K+rectifier, resulting in the hyperpolarisation of the plasma membrane.

We investigated the effects of the abp I C-terminus peptide on the membrane potential of mesophyll protoplasts, aiming to further study the interaction of abpl with the plasma membrane. Applying pz 151-163 to the protoplasts in the absence of auxin resulted in plasma membrane hyperpolarisation within one minute. Figure 1 presents a dose-response curve showing membrane potential variations induced by

-00 -1 3 -12 -11 -1 0 -9 -8 -7 -6 -5 -4 -3

log [Pz151-153) (M)

Fig. I. Dose-response curve of the transmembrane potential differ­ence (Em) of tobacco mesophy II protoplasts to the C-terminus peptide of ZmER-abpl (PzI51-163, [23]). The Em variations induced by the peptide from the mean control value (il.Em) are plotted as a function of peptide concentration in the external medium, in the absence of auxin. Each dot is a mean value from 15 measure­ments on individual protoplasts, and maximal standard error does not exceed OAm V. Different symbols represent independent experi­ments. The mean Em variation induced in these experiments by the optimal auxin concentration (3 iLM I-NAA) was -4.6 mY.

increasing concentrations of the peptide. A maximal amplitude of hyperpolarisation of about -5mV was obtained for concentrations of 10-7 M and higher. This response was monophasic whereas the dose-response curve to auxin is biphasic [3]. This difference has already been observed in guard cells for the modu­lation of the inward potassium channel by pz 151-163 and auxin [5, 23]. This may indicate that the peptide interacts with the plasma membrane at a site different from the abp 11 auxin complex and thus induces another type of response. However, the fact that auxin and the peptide induce maximal hyperpolarisation of identi­cal amplitude does not favour this idea of independent sites. Another possible explanation would be that the interaction of the peptide with the membrane occurs at the same transmembrane protein(s) associating with abpl/auxin but it is less efficient or different in terms of transduction coupling. Interestingly, in guard cells, the peptide mimicked the effects of supra-optimal auxin concentrations, i.e. it inhibited the inward K+ current, whereas in tobacco protoplasts the peptide reproduced the effects of infra-optimal auxin concen­trations. The mechanisms involved in the peptide­induced hyperpolarisation in tobacco (activation of the

33

proton pump or modulation of ion channels) have still to be determined.

Altogether, the results obtained with pz 151-163 further demonstrate the functional role of abp 1 at the exterior surface of the cell and support our working model of the two-component auxin perception units. In addition, they point to the importance of the C-terminal region of abp 1 in its interaction with plasma membrane protein(s). The use of this peptide as an affinity ligand already yielded a low abundance 33-35 kDa protein from microsomal membranes of maize seedlings [9]. Further characterisation of this protein will reveal if it is located in the plasma membrane and may thus constitute the transmembrane protein thought to inter­act with abp1 in order to initiate transduction cascades leading to changes in ion transport activities. In our group, work is also in progress in tobacco towards the molecular characterisation of the two elements form­ing the auxin perception units, the abpl homologue and the transmembrane protein.

An anion current at the plasma membrane of tobacco protoplasts shows ATP-dependent voltage regulation and is modulated by auxin.

To dissect the different components of the electrical response of tobacco protoplasts to auxin, we stud­ied ion channels at the plasma membrane by the patch-clamp technique, with a special focus on anion channels. In the whole-cell configuration, a voltage­dependent current with a current maximum around -90 m V was observed that displayed a reversal poten­tial close to the Nernst potential for chloride (ECl- =

+9 mY) [26] (Fig. 2A). This whole-cell current was identified as an anion current by replacing the internal Cl- with glutamate. The main characteristics of the tobacco suspension anion channel (TSAC) are listed in Table 1 for comparison with those of the two voltage­dependent anion channels described in guard cell protoplasts from Vicia faba: the fast anion channel designated as GCACI or R-type and the slow, or S-type, channel (see the corresponding references in Table 1). The amplitude of the peak current of TSAC could be decreased by classical anion channel inhibitors such as DIDS (4,4' -diisothiocyano-stilbene-2,2' -disulfonate), A -9C (anthracene-9-carboxylate) and NPPB (5-nitro-2,3-phenylpropylaminobenzoic acid) in a range of concentrations between 10 and 100 j.tM. These inhibitors were also active on guard cell channels, but with different efficiencies or modes of action. For instance A-9C or NPPB induced only an

34

;;c- 0.5

.s c 0 ~ :l (,)

Q) -0 .5 u ci> '0 .c := -1.0

-120 -80 -40 o 40

Membrane potential (mV)

-20

> .s 'iii -10

'E Q)

"5 Q.

o:.! III

0 Q) Q. <I

10 ~ ~ ~ ~ ~ ::1. ::1. ::1. ::1. c:

Ll) 0 0 0 0 « 0 0 Ll)

« « « « (0

;;:;: « ;;:;: « « 0

;;:;: z .,.... N

Fig. 2. A. Current voltage relation of the whole-cell anion cur­rent measured on protoplasts from tobacco cell suspensions. Voltage ramps from -150 mV to +60 mV (3 sees) were applied every 30 sec. An I/V curve resulting from this ramp is shown, for solutions as described in Materials and Methods. Negative current deflec­tions correspond to anion efflux from (or cation influx into) the protoplasts. The measured reversal potential is close to the Nemst potential of chloride (EC1 - = +9 mY). B. Modulation of the anion current by 1-NAA, 2-NAA and the auxin agonist antibody D16. The shifts in the peak current potential (ll. peak potential ± SE) are shown for the different effectors. I-NAA induced a concentra­tion-dependent negative shift of Epeak (n=5-9), whereas 2-NAA (100 /lM) induced a small positive shift (n=4). The antibody D16 (50 nM IgG, n=ll) raised against the putative auxin binding site of the protein ZmER-abp I from maize induced an auxin-like negative shift of the peak potential.

inhibition of the anion current in tobacco whereas they evoked both negative shift and a block in the voltage­dependent activity of GCAC1, possibly through the interaction with two different channel sites. TSAC exhibited fast activation/deactivation and slow inacti­vation kinetics with voltage-dependent time constants in the range of milliseconds and seconds, respectively, similar to those observed on GCACI. Major differ­ences appear in the nucleotide dependence of tobacco and V. faba channels. In guard cells, ATP or other nucleotides are needed to activate GCAC 1. In tobacco, the voltage dependence of the whole cell current reflecting a fast deactivation at potentials more nega­tive than -100 mY (at -160 mY, r= 4 ms) was observed only in the presence of internal ATP. When ATP was omitted from the pipette solution, a slower current decrease occurred at hyperpolarised potentials with a time constant amounting to hundreds of milli­seconds (at -160 mY, r = 402 ms). The fast deactiva­tion kinetics could be maintained when ATP was replaced by the protein phosphatase inhibitor okadaic acid, but were suppressed by staurosporine, a pro­tein kinase inhibitor [26]. This set of data suggests that phosphorylation/dephosphorylation events may be involved in the control of the voltage regulation of TSAC, either at the channel protein itself or at a regula­tory subunit. In outside-out patches obtained from the whole-cell configuration, single channel activity was detectable. Single channel analysis of the amplitudes in the range of -40 to -100 mY resulted in a linear current-voltage relationship with a channel conduc­tance of 15 pS. The extrapolated reversal potential of the IIV curve corresponded to the Nernst potential for Cl-, suggesting that this channel may be responsible for the observed whole-cell anion current.

The addition of the active auxin I-NAA to the bath solution induced a time- and concentration-dependent shift of the activation potential ofTSAC towards more negative potentials. The response saturated for I-NAA concentrations higher than 25 pM, with a maximal shift of the peak potential of -17 mY (Fig. 2B). This response was specific for the active auxin 1-N AA, as 2-NAA applied at 100 pM induced a small positive shift of the peak potential (Fig. 2B). In addition, TSAC reacted to the auxin agonist antibody D 16, which mimicks auxin action, providing evidence for the recognition of the signal at the outer face of the plasma membrane. Benzoic acid had no significant effect on TSAC current (data not shown). The effect of auxin, which shifts the activation potential of TSAC towards hyperpolarised values and brings it closer to the rest-

35

Table I.' Characteristics of the anion channel of protoplasts from tobacco cell suspensions (TSAC) as compared to those of the fast (R-type or GCAC l) and slow (S-type) anion channels of protoplasts from Vida faba guard cells

TSAC

Peak potential (Epeak) -90mV

Effect of DIDS Maximal inhibition of

50% at 50 ",M

Effect of A-9C Inhibition

Effect of NPPB Inhibition

Activation time constant IOms

(at the peak potential)

Deactivation time constant 4ms

(at potentials <Epeak)

Inactivation (time constant Yes

at the peak potential) (t1l2 6-28 sec)

Nucleotide dependence ATP requirement for

fast deactivation

(phosphorylation involved)

Effect of l-NAA Negative shift of

(l00 ",M) Epeak (-17 mY)

Conductance single 15 pS

channels (for 100 mM ext. Cl-)

References [26]

* Characterized only in the presence of ATP.

ing potential of plant cells, would result in anion channel opening and consequent plasma membrane depolarisation. Such an effect which is observed for auxin concentrations higher then 5 J-l M could account, in tobacco mesophyll protoplasts, for the relative depolarisation induced by supra-optimal auxin concen­trations in the range 5 to 100 J-lM. The effects of auxins are very similar in TSAC and GCACI in terms of time-dependence, range of active concentrations and amplitude in the shift of the peak. potential [15]. In guard cells, auxin effects on GCACI are thought to participate in the process leading to stomatal opening induced by the hormone. Further work is needed on the tobacco channel to assess if auxin modulation involves a direct interaction between the hormone and the anion channel protein(s), as suggested for GCACI [15], or results from the activation of a perception chain involv­ing abp 1 homologues.

R-type (GCAC1) S-type

-30 to -40mV Around - 30 m V

Ki = 0.2 ",M No significant inhibition

at 100 ",M

Shift of Epeak Not tested

and inhibition

Shift of Epeak Inhibition

and inhibition

10ms 1-2 min

<20ms Tens of sec

Yes No

(t1l2 10-12 sec)

Nucleotide-dependent ?* activation

Negative shift of Not tested

Epeak(-37mV)

39 pS 33 pS (for 90 mM ext. CI- , (for 90 mM ext. Cl-)

dependent on ext. Cl-)

[10,14-16] [12,20,21]

Conclusion

Auxins exert a multi targeted action at the plasma membrane, modulating ion transport activities and consequently altering membrane potential. Auxin effeCts on the proton pump ATPase and on the voltage­dependent anion channel were shown to result from the activation of response chains exclusively located at the plasma membrane [17-19]. In contrast, auxin modulation of potassium channels may be more indi­rect, at least for the inward K+rectifier, and would need intermediary transduction steps in the cytoplasm such as variations in cytosolic pH [4,23]. For some of these membrane responses, data from several groups point to the involvement of abp 1 or related auxin­binding proteins in the perception of the auxin signal. Investigations are in progress to identify the transmem­brane protein interacting with abpl and forming the first element of the transduction cascade. Further char-

36

acterising of the transduction steps linking the auxin perception units to the target ion transport proteins, and evaluating the consequences of the activation of these elementary auxin response chains on the development of more integrated auxin responses such as gene acti­vation, cell elongation or cell division now represent the next goals in the unravelling of auxin action.

References

I. Barbier-Brygoo H (I 995) Tracking auxin receptors using func­tional approaches. Crit Rev Plant Sci 14: 1-25

2. Barbier-Brygoo H, Ephritkhine G, KHimbt D, Ghislain M and Guem J (1989) Functional evidence for an auxin receptor at the plasmalemma of tobacco mesophyll protoplasts. Proc Natl Acad Sci USA 86: 891-895

3. Barbier-Brygoo H, Ephritkhine G, Klambt D, Maurel C, Palme K, Schell J and Guem J (1991) Perception of the auxin signal at the plasma membrane oftobacco mesophyll protoplasts. Plant J I: 83-93

4. Blatt MR and Thiel G (1993) Hormonal control of ion channel gating. Ann Rev Plant Physiol Plant Mol Bioi 44: 543-567

5. Blatt MR and Thiel G (1994) K+ channels of stomatal guard cells: bimodal control of the inward-rectifier evoked by auxin. Plant J 5: 55-68

6. Ephritkhine G, Barbier-Brygoo H, Muller J-F and Guem J (1987) Auxin effects on the transmembrane potential differ­ence of wild type and mutant tobacco protoplasts exhibiting differential sensitivity to auxin. Plant Physiol 83: 801-804

7. Felle H, Peters W, and Palme K (1991) The electrical response of maize to auxins. Biochim Biophys Acta 1064: 199-204

8. Goldsmith MHM (1993) Cellular signalling: New insights into the action of the plant growth hormone auxin. Proc Natl Acad Sci USA 90: 1442-1445

9. Groarke A, Websterl, White IR and Millner PA (1993) Identi­fication of a membrane receptor for the auxin binding protein. Biochm Soc Trans 21: 227S

10. Hedrich R, Busch H and Raschke K (1990) Ca2+ and nucleotide dependent regulation of voltage dependent anion channels in the plasma membrane of guard cells. EMBO J 9: 3889-3892

II. Jones AM (1994) Auxin-binding proteins. Ann Rev Plant Physiol Plant Mol Bioi 45: 393-420

12. Linder B and Raschke K (1992) A slow anion channel in guard cellS', activating at large hyperpolarisation, may be principal for stomatal closing. FEBS Lett 313: 27-30

13. Lohse G and Hedrich R (1992) Characterisation of the plasma membrane H+ -ATPase from Vicia faba cells. Modulation by extracellular factors and seasonal changes. Planta 188: 206-214

14. Marten I, Lohse G and Hedrich R (1991) Plant growth hor­mones control voltage-dependent activity of anion channels in plasma membrane of guard cells. Nature 353: 758-762

15. Marten I, Busch H, Raschke K and Hedrich R (1993) Modula­tion and block of the plasma membrane anion channel of guard cells by stilbene derivatives. Eur Biophys J 21: 403-408

16. Marten I, Zeilinger C, Redhead C. Landry DW, Al-Awqati Q and Hedrich R (1992) Identification and modulation of a voltage-dependent anion channel in the plasma membrane of guard cells by high-affinity ligands. EMBO J II: 3569-3575

17. Ruck A, Palme K, Venis MA. Napier RM and Felle H (1993) Patch-clamp analysis establishes a role for an auxin binding proteins in the auxin stimulation of plasma membrane current in Zea mays protoplasts. Plant J 4: 41-46

18., Santoni V, Vansuyt G and Rossignol M (1990) Differential auxin sensitivity of proton translocation by plasma membrane H+ -ATPase from tobacco leaves. Plant Sci 54: 177-184

19. Santoni V, Vansuyt G and Rossignol M (1991) The chang­ing sensitivity to auxin of the plasma-membrane H+ -ATPase: Relationship between plant development and ATPase content of membranes. Planta 185: 227-232

20. Schroeder JI and Keller B (1992) Two types of anion channel currents in guard cells with distinct voltage regulation. Proc Natl Acad Sci USA 89: 5025-5029

21. Schroeder JI, Schmidt C and Sheaffer J (1993) Identification of high-affinity slow anion channel blockers and evidence for stomatal regulation by slow anion channels in guard cells. Plant Cell 5: 1831-1841

22. Senn AP and Goldsmith MHM (1988) Regulation of electro­genic proton pumping by auxin and fusiccocin to the growth of Avena coleoptiles. Plant Physiol 88: 131-138

23. Thiel G, Blatt MR, Fricker MD, White IR and MillnerP (1993) Modulation of K+ channels in Vicia stomatal guard cells by peptides homologs to the auxin-binding protein C-terminus. Proc N atl Acad Sci USA 90: 11493-1 1497

24. Venis MA and Napier RM (1995) Auxin receptors and auxin­binding proteins. Crit Rev Plant Sci 14: 27-47

25. Venis MA, Napier RM, Barbier-Brygoo H, Maurel C, Perrot­Rechenmann C and Guem J (1992) Antibodies to a peptide from maize auxin-binding proteins have auxin agonist activity. Proc Natl Acad Sci USA 89: 7208-7212

26. Zimmermann S, Thomine S, Guem J and Barbier-Brygoo H (1994) An anion current at the plasma membrane of tobacco protoplasts shows ATP-dependent voltage regulation and is modulated by auxin. Plant J 6: 707-716

A. R. Smith et al. (efb.), Plant Hormone Signal Perception and Transduction, 37-39. © 1996 Kluwer Academic Publishers.

37

Plant hormone receptors from binding proteins to functional units

Dieter KHimbt Botanisches Institut, Meckenheimer Allee 170, D 53115 Bonn, Germany

Key words: auxin, auxin-binding protein, single copy gene

Abstract

Plant hormones, which have been known for more than fifty years mediate many aspects of plant growth and development. Their pleiotropic effects and well known interactions in many single events cause difficulties when analysing single responses to one plant hormone. In the early eighties some doubts were raised as to the existence of plant hormones.

Plant hormones and gene activation

Today, since we have plenty of data that every known plant hormone regulates gene expression, plant physi­ologists increasingly agree that there is a requirement for signal transduction mechanisms between plant hor­mone perception and subsequent gene activation. As we learn more about the genetic elements controlled by plant hormones it is becoming apparent that some hormones can affect gene transcription via specific promoters. However, the plant hormones dependent regulation of the transacting factors and the signal transduction pathway for the various plant hormones is currently obscure.

Plant hormones and their binding proteins

There is another approach to investigating this prob­lem, starting from the single plant hormones and searching for sequential steps of the signal transduc­tion pathway. The very first step has to be the binding of the hormone to its recognition protein which often acts as a receptor. However, not every binding protein in necessarily a receptor.

Binding proteins are reported for all known plant hormones. The connection between hormone recogni­tion by these proteins and hormone action - however­is mostly missing. For gibberellins there is increasing evidence of the involvement of an integral membrane

receptor in the control of a-amylase induction in aleu­rone cells [6].

The membrane associated auxin-binding protein

The crucial data came from the PhD work of Marian Lobler [7]. This work confirmed the auxin-binding characteristic of micro somes, ER enriched fractions and their solubilised proteins [4, 5, 16, 20]. Subse­quently an auxin-binding protein was purified (ABPl) and polyclonal antibodies were raised against ABPl, which were able to abolish the auxin effect on cell elongation in com coleoptiles [9, 10]. Immunolo­calisation using the anti-ABPI antibodies indicated that the protein was present at the outer epidermis of the coleoptile. It was therefore postulated that ABPI mediates the auxin signal for stimulation of cell elon­gation. Furthermore the essential part of ABPI has to be localised at the outer surface of the plasma mem­brane. Although the growth data in the presence of anti-ABPI could not be confirmed, this was proba­bly due to the use of crude antibody preparations [11, 15]. There are reports of an effect by auxin conjugated to BSA in com coleoptiles, which may be mediated by extra-cytoplasmic ABPI [22]. The most convinc­ing evidence for the function of plasma membrane­associated ABPI has come from electrophysiological measurements of auxin-dependent hyperpolarisation in

38

tobacco mesophyll protoplasts [1,2], and recently from whole cell patch clamp measurements of com coleop­tile protoplasts [14].

It is possible that ABPI is the first member of at least some auxin transduction pathways starting from the extra-cytoplasmic space. This means that ABPI and auxin have to be secreted in order to start auxin­driven signal transduction pathways. One reason for such an unexpected situation may be that it is easier to up-and down-regulate both auxin and its recognition molecule outside the cytoplasm. There seems one addi­tional paradox in that the KDEL C-terminal sequence motif of ABPI would retain ABPI in the ER. In com coleoptiles more than 98% of the total ABPI is indeed ER resident and although the ABPI content in most other plants is two to three orders of magnitude lower than in com, the ratio of plasma membrane associ­ated and ER localised ABPI is quite similar. Every known ABP sequence deduced from both cDNAs and genomic DNA clones revealed the KDEL C-terminal motif.

ABPl, a single copy gene or member of a gene family

In the 1980's it was thought that ABP isoforms lack­ing in KDEL motif would be found but this was not the case. There have been some interpretations of experimental data indicating an ABP gene family [13], but there are reports which unequivocally demon­strate that ABP is a single copy gene in com [8] and Arabidopsis [12]. Genomic DNA of the heterosis com variety Mutin 240 and its three parental inbred lines; KW 1071,KW 5024,KW 5176, has been analysed by Southernhybridisation with ABPI cDNA [18]. Digests of KW 1071 and KW 5175 DNA with two different restriction endonucleases resulted in only one hybri­dising fragment of reasonable size, whereas KW 5024 showed several hybridising fragment of reasonable size, whereas KW 5024 showed several hybridising fragments which may be summed up to one gene size. Digests with the same endonucleases of Mutin 240 gave ~ybridisation patterns similar to those of all three parents. We can conclude that ABP is a single copy gene and all variations reported so far belong to alleleic differences. At this point we are facing a new situation. Physiological differences in auxin sensitivity - shoot versus root - in auxin effects - epidermis cells versus mesophyll cells - and in other responses are not regulated by genetically coded isoforms but by

post-transcriptional and/or post-translational and/or post-auxin recognition events.

Can auxin be replaced for auxin dependent cell responses?

It has been demonstrated that antibodies raised against a 14mer oligopeptideof ABP1 which meets the criteria of a putative auxin binding site [20] behave as an auxin agonist in the hyperpolarisation assay using tobacco mesophyll protoplasts [21], and other workers have independently produced similar results [3]. There is one additional report [17] that the C-terminal 12mer oligopeptide of ABPI evokes rapid and reversible cytoplasmic alkalisation of Vicia faba guard cells in a similar way to auxin. Both types of data indicate that a certain conformation of ABP1 (or parts of ABPl) can elicit, in the absence of auxin, parts of or the complete auxin effect in cell responses.

References

1. Barbier-Brygoo H, Ephritikine G, Klambt D, Shislain M and Guem J (1989) Functional evidence for an auxin receptor at the plasmalemma of tobacco mesophy II protoplasts. Proc Nat! Acad Sci USA 86: 891-895

2. Barbier-Brygoo H, Ephritikine G, KJambt D, Maurel C, Palme K, Schell J and Guem J (1991) Perception of the auxin signal at the plasma-membrane of tobacco mesophyll protoplast. Plant J I: 83-93

3. Bourgeade P, Knauth B, Barbier-Brygoo H and Klambt D (1994) Planta - submitted

4. Dohrmann U, Hertel R and Kowalik H (1978) Properties of auxin binding sites in different subcellular fractions from maize coleoptiles. Planta J 140: 97-106

5. Hertel R, Thomson KS, Russo VEA (1972) In vitro auxin bind­ing to particulate cell fractions from com coleoptiles. Planta 107: 325-340

6. Hooley R, Smith SJ, Beale MH, and Walker RP (1993) In vivo photoaffinity labelling of gibberellin-binding proteins in Avena Jatua aleurone. Aust J Plant Physiol 20: 573-584

7. Uibler M (1984) PhD dissertation University Bonn 8. UiblerM and Hirsch AM (1990)RFLP mapping of the ABPI

locus in maize Zea mays L. Plant Mol Bioi 15: 513-516 9. Uibler M and KJambt D (1985a) Auxin-binding proteins from

coleoptile membranes and com (Zea mays L) I - Purification by immunological methods and characterisation. J Bioi Chern 260:9848-9853

10. Uibler M and Klambt D (l985b) Auxin binding protein from coleoptile membranes of com (Zea mays L) 2 - Localisation of a putative auxin receptor. J Bioi Chern 260: 9854-9859

11. . Napier RM and Venis MA (1990) Monoclonal antibodies detect an auxin-induced conformational change in the maize auxin-binding protein. Planta 182: 313-318

12. Palme K, Hesse T, Campos N, Garbers C, Yanofsky MF and Schell J (1992) Molecular analysis of an auxin binding-protein

located on chromosome 4 of Arabidopsis. Plant Cell 4: 193-201

13. Palme K, Hesse T, Gerbers C, Simmons C and Soll D (1994) In: Davis TD and Haissing BE (eds) Biology of Adventitious Root Formation. Plenum Press New York

14. RiickA,Palme K, VenisMA,NapierRM and Felle HH (1993) Patch clamp analysis establishes a role for an auxin binding protein in the auxin stimulation of plasma-membrane current in Zea mays protoplasts. Plant J 4: 41-46

15. Shimomura S, Sotobayashi S, Futai M and Fukui T (1986) Purification and properties of an auxin-binding protein from maize shoot membranes. J Biochem 99: 1513-1524

16. Tappeser B, Wellnitz D and KHimbt D (1981) Auxin affinity protein prepared by affinity chromatography. Z Pftanzen­physiollOl: 295-302

39

17. Thiel G, Blatt MR, Fricker MD, White IR and Millner P (1993) Modulation of K+ channels in Vida stomatal guard cells by peptide homolgues to the auxin-binding protein C-terminus. Proc Nat! Acad Sci USA 90: 11493-11497

18. Torkler H (1994) PhD dissertation University Bonn 19. Trewavas A (1981) How do plant-growth substances work?

Plant Cell Environ 4: 203-228 20. Venis MA (1977) Solubilisation and partial purification of

auxin-binding sites of com membranes. Nature 266: 268-269 21. Venis MA, Napier RM, Barbier-Brygoo H, Maurel C, Perrot­

Rechenmann C and Guem J (1992) Antibodies to a peptide from the maize auxin-binding protein have auxin agonist activity. Proc Nat! Acad Sci USA 89: 7208-7212

22. Venis MA, Thomas EW, Barbier-Brygoo H, Ephritikhine G and Guem J (1990) Impermeant auxin analogies have an auxin activity. Planta 182: 232-235

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 41-48. © 1996 Kluwer Academic Publishers.

41

Regulation of a class of auxin-induced genes in cell-suspension cultures from Nicotiana tabacum

C.J .M. Boot, B. van Duijn, A.M. Mennes & K.R. Libbenga Institute of Molecular Plant Sciences, Leiden University, Clusius Laboratory, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands

Key words: auxin, auxin-influx carrier, cell-suspension, genes, GUS

Abstract

Protoplasts derived from transgenic tobacco suspension cells, harbouring a chimaeric gene construct consisting of an auxin-inducible promoter and the GUS coding region as a reporter gene, maintained their ability to respond to auxins. Antibodies directed against the presumed auxin-binding site of the major maize auxin-binding protein were recently obtained and shown to have auxin-agonist activity in mesophyll protoplasts from tobacco. This auxin-like induction of the hyperpolarisation of the plasma membrane potential by these D 16 antibodies was confirmed in this study by time resolved analysis for tobacco cell-suspension protoplasts. In contrast, the same antibodies were able to inhibit auxin-induced expression of the chimaeric gene construct and to reduce the accumulation of [14C]2,4-dichlorophenoxyacetic acid (2,4-D) in transgenic tobacco protoplasts. A possible role for an auxin-influx carrier in transmitting the auxin signal will be discussed.

Introduction

Over the last few years a number of research groups have characterised various auxin-inducible genes [1, 6, 13, 20, 23]. In general, the role of these genes in mediating the biological response to auxin is far from clear. In addition, receptors and early trans­ducing components in auxin-induced gene transcrip­tion have not yet been established. Up till now, most progress in auxin signal transduction r~search has been made with respect to auxin-induced activation of the plasmalemma (PM) H+ -ATPase and associated hyper­polarisation of the PM. All evidence obtained thus far indicates that a variety of species (including tobacco) possess homologues of the well-characterised auxin­binding protein (ABP) from maize [7,9, 14, 19,22]. Since a subpopulation of the ABP is supposed to be associated with the external face of the PM, and the ABP has a receptor function in auxin-induced hyper­polarisation of the PM [2], we decided to investigate a possible role of these proteins in auxin-induced gene expression. Interestingly, it was recently reported that antibodies raised against the putative auxin-binding

site of ABP (denoted D16) could act as auxin agonists in inducing hyperpolarisation of the PM [27]. In order to test the activity of D16 antibodies we developed an experimental system consisting of protoplasts from a transgenic tobacco cell-suspension line harbouring a promoter from one of the auxin­inducible genes (GNT35) from tobacco coding for pCNTl03-like mRNAs coupled to the reporter gene ,8-D-glucuronidase (GUS). Here we report the influ­ence of D16 antibodies on auxin uptake, hyperpolari­sation of the PM and activation of the auxin-inducible GNT35 promoter in the transgenic protoplasts. The results suggest that an auxin-import carrier might be involved in auxin-induced transcription activation of genes corresponding to the pCNT103 family.

Materials and methods

Cell-suspension cultures

Transgenic BY2-pBGUS35 Nicotiana tabacum L. cv. Bright Yellow 2 cells were obtained and maintained

42

as described by'van der Zaal et al. [24]. For auxin­starvation experiments the cells were maintained on lower amounts of2,4-D (0.05 mg/L) containing growth medium, and subsequently these cells were transferred to hormone-free medium and grown for 5 days as described before [23].

Protoplast preparation

For preparing protoplasts, 0.4 M mannitol was added to 7-day-old BY2-pBGUS35 maintenance cultures, followed after 30 min by 0.5 g cellulase (Onozuka RS, Yakult Honsha, Japan) and 0.05 g pectolyase Y-23 (Seishin Pharmaceutical, Japan) per 50 ml of medium. After incubation for an additional 2 hat 25°C in the dark on a gyratory shaker, the protoplasts were washed three times by centrifugation (5 min at 100 x g) with 0.4 M mannitol, then diluted to approximately 0.5-1 x 106 protoplasts per ml in hormone-free growth medium supplemented with 0.4 M mannitol.

Induction experiments

Samples of 5 ml from 7 -day-old BY2-pBGUS35 main­tenance cultures were transferred to fresh auxin-free growth medium to which the various inducers were applied. Hormone-starved BY2-pBGUS35 cells were treated with various inducers by injecting concentrated stock solutions into the Erlenmeyer flasks. In both types of experiments, the treatments lasted 5 h and were performed at 25°C in the dark. After incubation, the cells were collected by filtration over a nylon filter and frozen in liquid nitrogen.

Diluted protoplasts were transferred to petri dishes (4 ml per dish) to which the inducers were applied and incubated for 5 h in the dark at 25°C on a shaker. The protoplasts were preincubated for 30 min with the antibodies directed against a peptide of maize ABP [27] before inducers were added. After 5 h incubation the protoplasts were collected by centrifugation and frozen in liquid nitrogen. Each experiment was repeated at least three times.

RNA isolation, Northern blot analysis and GUS assays

RNA was isolated using phenol extraction and LiCI precipitation as described earlier [26]. Assays for GUS activity [10] and protein concentration [4] were done according to published methods.

Membrane potential measurements

Fine tipped, wide taper, 3 M KCI filled intracellular micro-electrodes with a mean resistance of37.6± 13.9 Mohm (n = 16) were used for membrane potential measurements essentially as described [25]. A micro­electrode amplifier with capacitance compensation (WPI Series 700 Micro Probe Model 750, WP Instru­ments, New Haven, CT) was used. Microelectrode capacitance was compensated to obtain rise times (time to reach 66% of the potential response upon a current pulse) faster than 0.05 ms. All potential values were measured with respect to the microelectrode tip poten­tial. To ensure rapid (4 jlrnlO.l ms) and reproducible impalements of cells with minimal lateral vibration a Piezo-stepper device (Piezo-stepper P-2000, Physik Instrumente (PI) Gmbh Co., Waldbronn-Karlsruhe, Germany) was used. This device proved to give min­imal variation in the impalement-induced shunt resis­tance. For microelectrode measurements, protoplasts were kept in a glass bottomed Teflon culture dish [8] with 2 ml extracellular solution (10 mM KCI, 2 mM MgCh, 5 mM CaCh, 1 mM KOH, and 10 mM Mes (pH 5.5) and observed with 40 x or 100 x objective magnification.

Results

A schematic representation of the experimental system used in our studies is shown in Fig. 1. Nicotiana tabacum cell-suspension cultures (denoted BYO.2 or LTO.05) were grown and maintained on medium con­taining 2,4-D as the sole plant growth regulator. Samples of 7-d-old stationary phase cells were either transferred to fresh medium containing 2,4-D (main­tenance culture) or were transferred to hormone-free medium. On hormone-free medium the cells were able to grow for only a limited period of time reaching the stationary phase after 5 days. These cells resumed cell-division activity after injection of 2,4-D into the culture medium.

In a previous study we have described the expres­sion patterns of four auxin-regulated genes encoding pCNTl03, -107, -114 and -115 mRNAs during the growth cycle of LTO.05 either in maintenance cultures or upon the addition of 2,4-D [3]. We found that the genes were transiently expressed during the first 2-8 h after transfer of 7 -d-old stationary phase cells to fresh medium containing 2,4-D, i.e. before the cells entered S-phase. For the genes encoding pCNTl03, -107 and

l T 0.05 / BY 0.2

I""'" I o 7d

: Desensitization

Sensitization I +

- ~I"""'--------il

Hormone starvation

o 7d I I I I I I I

F o

I protoplasts

t I""'" o

5d

t 2,4-0

Fig. 1. Schematic representation of the experimental system used in this study. (For details see text.)

-114 mRNA we could demonstrate that the accumula­tion of the mRN As was due to transcription activation. A similar pattern of these mRNAs was observed when 7 -d-old stationary phase cells were transferred to 2,4-D-free medium, although the levels of the mRNAs were much lower than on 2,4-D-containing medium. We could explain this phenomenon by the finding of Koens et al. [11] showing that residuaI2,4-D in 7-d-old stationary phase cells is rapidly released when the cells are transferred to 2,4-D-Iacking medium. We believe that this residual 2,4-D is responsible for triggering the moderate mRNA accumulation observed.

In this study we used the transgenic cell line BY2-pBGUS35 and found that the expression pattern of pCNT103 mRNA in BY2-pBGUS35 was similar to that in LTO.05. In addition, the expression ofthe hybrid gene (GNT35-GUS) closely resembled the expres­sion pattern of pCNT103 mRNA in these cultures (Fig. 2).

The expression of the hybrid gene in BY2-pBGUS35 was also analysed through monitoring GUS activity (Fig. 3). Figure 3A shows GUS activity in 2,4-D-starved BY2-pBGUS35 5 h after addition of either 2J-lM 2,4-D, 10 J-lM I-naphthaleneacetic acid (I-NAA) or 10 J-lM salicyclic acid (SA). The GUS activity is the average of three independent experiments. As com­pared with the GUS activity before the stimuli were applied (To), we found a 12-fold increase with 2,4-D, an 8-fold increase with I-NAA and a 4-fold increase with SA. These compounds were also effective when 7-d-old stationary phase cells from BY2-pBGUS35 maintenance cultures were transferred to fresh medium, although induction of GUS activity by 2,4-D

43

Table 1. Effects ofDI6 IgG fraction and NAA on Ep, Emax , and Ess of tobacco protoplasts. Mean values ± standard deviation are given with the number of measured protoplasts in parenthesis. All differences between control values and DI6 or NAA values are significant (p < 0.005, Student's t-test)

Control 10-8 MDI6 10-5 MNAA

Ep (mY) -17.7±5.! -27.4± 14.8 -30.5 ± 11.3

(52) (20) (17)

Emax (mY) -10.9 ± 2.4 -14.0± 3.2 -14.9± 5.9

(64) (25) (17)

Ess (mY) -2.3 ± 1.6 -4.7 ± 1.5 -3.7 ± 3.3 (64) (25) (17)

or I-NAA was lower than in auxin-starved cells. When no inducers were added (water control), we found about doubling of GUS activity (Fig. 3B). This effect was probably brought about by release of residual 2,4-D from the cells into the culture medium [11].

The activation of the GNT35 promoter by SA is in agreement with earlier observations of pCNT103 mRNA accumulation in LTO.05 cells[3]. In the present studies we found that yeast extract (YE) (a possible source of elicitors) activated the GNT35 promoter as well (Fig. 3B).

The strongest activation of the GNT35 promoter by auxin analogues was found in hormone-starved cells (Fig. 3A). Unfortunately, it proved impossible to obtain protoplasts from such cells. However, viable proto­plasts could easily be prepared from 7-d-old stationary phase BY2-pBGUS35 maintenance cultures. In such protoplasts induction of GUS activity by 2,4-D or 1-NAA (8-fold and 6.5-fold increase respectively) was about the same as in cells (Figs. 3B, 3C). However, in the absence of inducers (water control), GUS activity in the protoplasts increased to a significantly higher level during the 5-h incubation period than it did in intact cells. A tentative explanation for this observa­tion is that protoplasts react more strongly to residual 2,4-D than intact cells.

On the basis of the published sequence of the major ABP from maize a synthetic peptide has been produced that encompassed the presumed auxin-binding domain of the ABP [27]. Antibodies raised against this peptide (denoted DI6), acted as auxin agonists in electrophys­iological responses of both tobacco [27] and maize protoplasts [18].

44

peNT 103

pBGUS 35

o 2 4 8 11 24 Fig. 2. Northern blot of RNA samples (20 J.Lg per lane) isolated at the indicated times (h) from BY2-pBGUS cells after the transfer of stationary phase cells to fresh medium containing 0.2 mglL 2,4-0. The upper panel was hybridised with 32P-Iabelled pCNTl 03 cONA plasmid, the lower panel with a pBGUS35 containing plasmid.

c 'jjj (5 Ci 0> E

(5 E a.

8 c

To H20 2,4-0 NAA SA To H20 2,4-0 NAA SA YE To H202,4-D NAA SA YE

Fig. 3. The average GUS activity in transgenic BY2-pBGU35 cells and protoplasts derived from these cells. A: GUS activity in hormone-starved cells, B: GUS activity in stationary cells transferred to fresh medium, C: GUS activity in protoplastsobtained from stationary cells and transferred to fresh medium with 0.4 M mannitol. Incubation was for 5 h with 2,4-0: 2 J.LM; NAA: 10 J.LM; SA: 10 J.LM; YE: 0.5% w/v or H20. To represents the GUS activity before the various inducers were added.

We first tested the agOnIstIC activity of D16 antibodies in the electrophysiological response of BY2-pBGUS35 protoplasts in comparison with auxin analogues. The peak value of impalement transient potential (Ep), the most negative potential (Emax) and the steady state potential (Ess) were determined in a large number of protoplasts before and after addition of 10-8 M D 16 to the bathing solution. After addition of D 16, all measured potential values were hyperpo-

larised as compared to control measurements. Addition of 10-5 M I-NAA gave similar results (Table 1). In addition, in three recordings, where a relatively negative steady-state potential could be maintained for more than 10 min, the effect of D 16 on the membrane potential in time could be measured. The D16 anti­bodies brought about a membrane hyperpolarisation within a few minutes (data not shown). During this hyperpolarisation no change in input resistance could

pre 016 pre 0 16

1 2

NAA

Fig. 4. The relative GUS activity (expressed in percentage, with NAA induction as a 100% standard) in protoplasts derived from BY2-pBGUS35 stationary cells after 5 h incubation with IgG frac­tions of DI6 antibodies or pre-immune serum (pre) in the absence or presence of 10 J.LM NAA or H20. Antibodies were used at 10nM (I) or 3 nM (2).

be detected, indicating that the recorded membrane potential change was not due to significant changes in the microelectrode-induced shunt resistance or the membrane resistance. From these results, we con­cluded that the BY2-pBGUS35 protoplasts give a sim­ilar electrophysiological response to D 16 antibodies and auxini"analogues as previously described [27].

In another series of experiments the effect of D16 antibodies on GUS activity was tested in the BY2-pBGUS35 protoplasts. We reproducibly found that 10- 8 M D16 antibodies not only fully inhibited the I-NAA-(or 2,4-D-) induced GUS activity, but also the background GUS activity (water control), whereas pre­immune serum had no effect (Fig. 4). Fab fragments obtained after purification of the total D16 IgG frac­tion on a peptide-affinity column [27], also showed a concentration-dependent inhibition of I-NAA-induced reporter gene expression and background induction (Fig. 5). If indeed the background induction of GUS activity was due to residual 2,4-D, we might conclude

45

that with respect to activation of the GNT35 promoter in BY2-pBGUS35 protoplasts, the D16 antibodies acted rather as auxin antagonists than as agonists. In order to find an explanation for the apparently contro­versial effects of the D 16 antibodies, we looked for other effects of D16 on BY2-pBGUS35 protoplasts and we found an interesting effect on uptake of radio­labelled 2,4-D.

It is well established that protonated forms of auxin analogues are mainly taken up by plant cells through free diffusion [5, 17]. In the alkaline cytoplasm it dis­sociates and the auxin accumulates because of the much lower permeability of the PM for the anion form [15]. In addition, specific influx carriers have been described which mediate uptake of auxin anions together with two protons [16]. Moreover, there is ample evidence indicating the existence of carrier­mediated auxin efflux. Compounds such as NPA and TIBA are considered to be specific inhibitors of the efflux carriers [21].

It is general practice to distinguish carrier-mediated uptake from uptake by free diffusion by adding excess unlabelled ligand. Using BY2-pBGUS35 cells and protoplasts, we found a reduction of steady-state accu­mulationof[14C]2,4-D (0.4 pM) of 20-30% by adding excess unlabelled 2,4-D (2: 10 pM). A similar reduc­tion was found for initial uptake rates, as measured over the first 10-40 s.

From these experiments we concluded that part of the uptake of [14C]2,4-D by BY2-pBGUS35 cells and protoplasts was probably mediated by an auxin influx carrier. Subsequently, we tested D 16 antibodies for their effect on e4C]2,4-D uptake by BY2-pBGUS35 protoplasts. Figure 6 shows that 10- 8 M D 16 IgG fraction as well as Fab fragments reduced [14C]2,4-D accumulation to about the same extent as excess unlabelled 2,4-D. Neither non-absorbed fractions (NA in Fig. 6), nor pre-immune serum (data not shown) had any effect.

Discussion

In summarising the main results we see that:

- Antibodies raised against the putative auxin-binding site of ABP from maize (DI6) act as auxin agonists in inducing hyperpolarisation in protoplasts from the transgenic cell culture line BY2-pBGUS35, thus confirming recently described results [27].

46

1

~o NA Fab

I 1

NA Fab

2 NA Fab

3 NAA NA Fab

4 NA Fab

5

NAA

NA Fab

6

Fig. 5. The relative GUS activity (expressed in percentage, with NAA induction as a 100% standard) in protoplasts derived from BY2-pBGUS35 stationary cells after 5 h incubation with D 16 Fab fragments or with the D 16 affinity non-absorbed IgG fraction (NA) in the absence of presence of 10 J.LM NAA or H20. Antibodies were used at 5 nM (1,4), 0.5 nM (2,5), or 0.05 nM (3,6).

D 16 antibodies strongly suppress in a concentration­dependent way promoter activation in BY2-pBGUS35 protoplasts as monitored through GUS activity. D16 antibodies reduce [14C]2,4-D accumulation in BY2-pBGUS35 protoplasts to the same extent as excess unlabelled 2,4-D.

The first two results are not necessarily contradictory. Hyperpolarisation was measured at the minute-time scale, whereas GUS activity was measured at the hour­time scale. Hence, we cannot exclude the possibility that D16 antibodies act as auxin agonists in triggering early steps in auxin-signal transduction, whereas at longer incubation times they exert (aspecific) inhibi­tory effects on cellular activities, including expres­sion of GUS activity in BY2-pBGUS35 protoplasts. However, preliminary experiments in our laboratory indicate that D 16 antibodies are inactive in suppressing GUS activity induced by non-auxins like SA or YE. So, let us consider another interpretation of the results. It is generally believed that carriers are transmembrane pro­teins that translocate ligands by conformational change [12]. Now, in the case of carriers of signal molecules

such as auxin, one might wonder whether such confor­mational changes serve only to translocate the signal, or whether they activate at the same time particular transducing proteins. If such a mechanism would exist the perturbations in the equilibrium distribution of the signal (auxin) between the outside and the inside of the cell would generate intracellular messages, for exam­ple leading to adaptational responses. We consider it not unlikely that activation of early genes like those encoding pCNTl03-like rnRNAs which codes for a glutathione S-transferase, is an adaptational response, a.o. to perturbations of the equilibrium distribution of auxin. If this response is coupled to the activity of the auxin-influx carrier, then blocking the carrier by D16, i.e. auxin is displaced from the carrier and the carrier cannot translocate the antibodies, would inhibit auxin­induced expression of genes encoding pCNTl03-like rnRNAs and perhaps other classes of (related) genes as well. Searches for proteins that are being recognised by D 16-type antibodies may help to understand effects such as those described in this paper.

%

35

30

25

20

15

10

5

o

Fig. 6. Average percentage of reduction (from two independent experiments) of uptake of [14C]2,4-D by protoplasts derived from BY2-pBGUS35 tobacco cells in the presence of DI6 IgG fraction (D 16), D 16 Fab fragments (Fab), D 16 affinity purified non-absorbed IgG fraction (NA) or cold 2,4-D. The percentage reduction was determined after 20 min op uptake as compared to the uptake of labelled hormone in the absence of 2,4-D or antibodies.

Acknowledgements

The antibodies were a kind gift from Professor Dr. Michael A. Venis (Horticulture International WelIes­bourne, Warwick UK). This work was partly supported by EEC BRIDGE contracts BlOT CT90-00158-C and CT90-0178. BVD was financialIy supported by NWO through BION/SVB thema I project 811-416-112.

Referenc~s

I. Ainley WM, Walker JC, Nagao RT and Key JL (1988) Sequence and characterization of two auxin-regulated genes from soybean. J Bioi Chern 263: 10658-10666

2. Barbier-Brygoo H, Ephritikhine G, Kliimbt D, Ghislain M and Guem J (1989) Functional evidence for an auxin receptor at the plasmalemma of tobacco mesophy II protoplasts. Proc Nat! Acad Sci USA 86: 891-895

3. Boot CJM, Van Der Zaal EJ, Velterop J, Quint A, Mennes AM, Hooykaas PJJ and Libbenga KR (1993) Further char­acterization of expression of auxin-induced genes in tobacco (Nicotiana tabacum) cell-suspension cultures. Plant Physiol 102:513-520

4. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254

47

5. Goldsmith MHM (1977) The polar transport of auxin. Ann Rev Plant Phsyiol 28: 179-187

6. Hagen G, Kleinschmidt A and Guilfoyle TJ (1984) Auxin­regulated gene expression in intact soybean hypocotyl and excised hypocotyl sections. Planta 162: 147-153

7. Hesse T, Feldwisch J, Balshusemann D, Bauw G, Puype M, Vandekerckhove J, Uibler M, KHimbt D, Schell J and Palme K (1989) Molecular cloning and structural analysis of a gene from Zea mays (L.) coding for a putative receptor for the plant hormone auxin. EMBO J 8: 2453-2461

8. Ince C, Van Dissel JT and Diesselhof-den Dulk MMC (1985) A teflon culture dish for high magnification microscopy and measurements in single cells. Pflugers Arch 403: 240-244

9. InoharaN, ShimomuraS, Fukui T and Futai M (1989) Auxin­binding protein located in the endoplasmic reticulum of maize shoots: Molecular cloning and complete primary structure. Proc Natl Acad Sci USA 86: 3564-3568

10. Jefferson RA (1987) Assaying chimeric genes in plants: The GUS gene fusion system. Plant Mol Bioi Rep 5: 387-405

II. Koens KB (1993) The growth regulator 2,4-D as a signal molecule in tobacco cell cultures. PhD Thesis, Leiden Univer­sity' The Netherlands

12. KotykA,JanacekK and KorytaJ (1988) In: Biophysical chem­istry of membrane functions. Eds J Wiley and sons

13. McClure BA, Hagen G, Brown CS, Gee MA and Guilfoyle TJ (1989) Transcription, organization and sequence of an auxin­regulated gene cluster in soybean. Plant Cell I: 229-239

14. Napier RM, Venis MA, Bolton MA, Richardson LI and Butcher GW (1988) Preparation and characterisation of monoclonal and poly clonal antibodies to maize membrane auxin-binding protein. Planta 176: 519-526

15. RavenJA (1975) Transport of indole acetic acid in plant cells in relation to pH and electrical potential gradients and its significance for polar IAA transport. New Phytol 74: 163-172

16. Rubery PH (1978) Hydrogen ion dependence of carrier­mediated auxin uptake by suspension-cultured crown guard cells. Planta 142: 203-206

17. Rubery PH (1987) In: Davies PJ (ed) Plant hormones and their role in plant growth and development, pp 341-362. Martinus NiJboff, Dordrecht

18. Ruck A, Palme K, Venis MA, Napier RM and Felle HH (1993) Patch-clamp analysis establishes a role for an auxin binding protein in the auxin stimulation of plasma membrane current in Zea mays protoplasts. Plant J 4: 41-46

19. Shimomura S, Sotobayashi T, Futai M and Fukui T (1986) Purification and properties of an auxin-binding protein from maize shoot membranes. J Biochem 99: 15/3-1524

20. Takahashi Y, Kuroda H, Tanaka T, Machida Y, Takebe I and Nagata T (1989) Isolation of an auxin-regulated gene cDNA expressed during the transition from Go to S phase in tobacco me sophy II protoplasts. Proc Natl Acad Sci USA 86: 9279-9383

21. Thomson KL, Hertel R, Muller S and Tavares IE (1973) N­I-Naphthylphthalamic acid and 2,3,5-triiodobenzoic acid. In vitro binding to particulate cell fractions and action on auxin transport in com coleoptiles. Planta 109: 337-352

22. Tillman U, Viola G, Kayser B, Siemeister G, Hesse T, Palme K, Uibler M and KHimbt D (1989) cDNA clones of the auxin­binding protein from com coleoptiles (Zea mays L.): Isolation and characterization by immunological methods. EMBO J 8: 2463-2467

23. Van Der Zaal EJ, Memelink J, Mennes AM, Quint A and LibbengaKR (1987) Auxin-inducedmRNA species in tobacco cell cultures. Plant Mol Bioi 10: 145-157

48

24. Van Der Zaal Er, Droog FNJ, Boot OM, Hensgens LAM, Hoge JHC, Schilperoort RA and Libbenga KR (1991) Promoters of auxin-induced genes from tobacco can lead to auxin-inducible and root tip-specific expression. Plant Mol Bioi 16: 983-998

25. Van Duijn B, Ypey DL and Van der Molen LG (1988) Electrophysiological properties of Dictyostelium derived from membrane potential measurements with microelectrodes. J Membrane Bioi 106: 123-134

26. Van Slogteren GMS, Hoge JHC, Hooykaas PH and Schilper­oort RA (1983) Clonal analysis of heterogeneous crown gall

tumor tissues induced by wild-type and shooter mutant strains of Agrobacterium tumefaciens-expression of T-DNA genes. Plant Mol Bioi 2: 321-333

27. Venis MA, Napier RM, Barbier-Brygoo H, Maurel C, Perrot­Rechenmann C and Guem J (1992) Antibodies to a peptide from the maize auxin-binding protein have auxin agonist activity. Proc Natl Acad Sci USA 89: 7208-7212

A.R. Smith et al. (eds.). Plant Hornwne Signal Perception and Transduction. 49-55. © 1996 Kluwer Academic Publishers.

49

The IAA-inftux carrier at the plasmalemma: Properties, regulation, and function in auxin transduction

BemdZbell Botanical Institute. Ruprecht Karls University. 1m Neuenheimer Feld 360, D-69020 Heidelberg, Germany. Present address: Center for Agricultural Landscape and Land Use Research (ZALF), Institutefor Land Use Systems and Landscape Ecology, Eberswalder Straj3e 84, D-15374 Miincheberg, Germany

Key words: auxin perception, auxin transport, Daucus carota, IAA-influx carrier, plasmalemma, suspension cultures

Abstract

The signal perception of auxin was investigated by in vitro binding assays using both microsomal and purified plasma membrane preparations obtained from auxin-dependent carrot suspension cultures at the logarithmic growth phase. All the results presented point to the occurrence of an IAA-influx carrier, but not to an auxin receptor, at the plant plasma membrane. Furthermore it is assumed that the activity of the IAA-influx carrier is regulated by a GTP-binding protein. At the carrier coupling to the GTP-binding protein, and its ligand-dependent receptor have not been identified. To take the physicochemical properties of IAA into consideration the experimental findings will be discussed in order to suggest that the IAA-influx carrier at the plasmalemma is the site responsible for signal perception and transduction of auxin by plant cells.

1. Introduction

Indole-3-acetic acid (IAA) is a natural auxin and acts in plants as an important hormone of growth control. Of the many pleiotropic effects in plants, the most promi­nent physiological responses used in many laboratories as standard experimental systems, are the stimulation of elongation growth of shoot organs (either monocot coleoptile or dicot hypocotyl) and the promotion of cell division in plant cell cultures. For the initiation of these processes a knowledge of the molecular mechanism(s) underlying auxin perception and primary action are either sketchy or inconsistent. This article summa­rizes initial experimental results originating from the analysis of the auxin-stimulated growth of carrot sus­pension cultures together with the search for auxin binding sites in cell membranes possibly involved in auxin perception by these cells. In the latter part these results are discussed in relation to the findings from a calculation of chemiosmotic auxin uptake by a model plant cell. Against this background, the physicochem­ical properties of signaling molecules, as well as the

kinetic properties of membrane-located receptor types, are taken into account in order to obtain an alternative view of auxin perception by plant cells.

2. Analysis of auxin-stimulated growth in carrot suspension cultures

The effect of auxin on plant growth stimulation was studied using carrot suspension cultures as a simple experimental system which offers, in comparison to intact plants, the following advantages: firstly, there are no complications caused by different auxin con­centrations distributed within tissues since each cell is surrounded by auxin-containing nutrient medium so that the hormone can easily reach the target cells. Secondly, after the depletion of auxin from the nutri­ent medium reapplication induces nearly synchronous cell division as a clear hormonal response, and the kinetics of the growth stimulation by auxin displays a clearly defined time-window, i.e. the logarithmic growth phase (Fig. 1). The hormone effect is char-

50

2 ~

C CJ 2.

~

C CJ

c 1. ~ ..c: ~ o. e

CJ

o Control 121 3 pM NPA II 1 pM 2,4-D El 1 pM 3,4-D • 10pM 1-NAA

" "," 2-NAA I

O .U..LJ~""""",,,-'-'.u..J....L<l....

lag (2d) log (5d)

Growth Phase

stat (8d)

Fig. 1. Ligand specificity of growth stimulation by auxin. The daily increase of fresh !Weight of carrot suspension cells was plotted against the age of the culture. The concentrations of auxin derivatives were applied as indicated.

acterized by a high ligand specificity (3,4-0 ~ 2,4-0 > I-NAA» 2-NAA ~ NPA), an ultrasensitive dose response, and low Km-values for growth stimulation (Km/2,4-0 ~ 50 nM; Km/l-NAA ~ 7 f..£M). The tenn ultrasensitive dose response is used according to the definition found in [26] and means that the growth stim­ulation from 10 to 90% by the honnone concentration is within two orders of magnitude (EC90IEC 10 ~ 10). The phytotropin NPA, as well as 2-NAA alone, have no stimulatory effect, but 2-NAA in excess inhibited antagonistically any growth promotion by 2,4-0.

3. Auxin accumulation studies

In order to examine the mechanism of auxin percep­tion either by receptors or carriers, carrot suspen­sion cultures in the logarithmic growth phase were harvested for the preparation of microsomal or plasma-membrane vesicles according to [38] and [19], respectively. In vitro binding assays were perfonned with [3H]IAA as a radio ligand, and vacuum filtration used for the separation of free radioligand from that of vesicle-associated [3]. In keeping with other obser­vations a pH-jump i.e. use of pH 7.5 buffer during membrane preparation but of pH 5.5 buffer during incubation, was necessary to obtain any measur­able extent of [3H]IAA-association to membranes. Under these conditions, a transient auxin accumula­tion into membrane vesicles, but no reversible and saturable binding at the outer or inner membrane sur­face, was detected in all experiments. Indications

for eH]IAA-accumulation into the vesicle lumen and against eH1IAA-binding to a membrane-associated receptor were taken to be the osmotic dependency, the sensitivity to ionophores, the phenomenon of over­shooting kinetics, and stimulation by phytotropins.

Taking these results in turn, first focusing on the osmotic effects; it was observed that there was no [3H]IAA-accumulation to membranes either in the absence of osmoticum in the incubation buffer or after incubation in the presence of sucrose and subsequent tennination of the incubation by a buffer omitting the osmoticum. The extent of eH]IAA-accumulation to membranes displayed an optimum curve in depen­dence of the osmotic strength indicating bursting, swelling, stabilization, and shrinking of the membrane vesicles with corresponding effects on the capacity to retain [3H]IAA accumulated inside the vesicles. Various types of ionophores applied at a 4 f..£M final concentration caused different effects: valinomycin, which dissipates transmembrane [K+]-gradients, has no effect, and CCCP (carbonyl cyanide m-choropheny I hydrazone), which dissipates transmembrane pH­gradients, has only a small inhibitory effect, whereas the equimolar combination of both compounds dras­tically reduced the extent of [3H]IAA-accumulation into these vesicles. Nigericin, with its potency to dissipate the electrochemical gradient created both by transmembrane pH and ionic gradients, abol­ished eH]IAA-accumulation into the vesicles. The equimolar combination of all ionophores caused no synergistic effect. The time-course of eH]IAA­accumulation into membrane vesicles displayed overshooting-kinetics (Fig. 2). Initially, there is a rapid increase in accumulation activity as long as the electrochemical gradient can be used as a thennody­namic driving force and/or proton-motive force. This phase is followed by a short period of equilibrium. Afterwards, the consumption of the electrochemical gradient leads to a subsequent release of auxin from the vesicles which cannot be blocked by phytotropins as inhibitors of the IAA-efftux carrier. After separa­tion of the microsomal membranes by aqueous phase partitioning, auxin accumulation activity was found to be located in plasma membrane vesicles (Fig. 3), and stimulated by NPA, a phytotropin acting as a specif­ic inhibitor of the IAA-efftux carrier [31], whereas it was reduced by 2-NAA, an inhibitor of the IAA-influx carrier [15].

The dose-response relationship of the [3H]IAA­accumulation into microsomal vesicles showed an optimum curve with the characteristics of an ultrasen-

C '0;

e a. '0

E cr @. c ,2 Cii "5 E ::> <) <)

<C <C :! I '2....

600

500

400

300

200

100

0 0

• NIG sensitive

• IAA compebijve

A Diffusion

60 120 180 240 300

Time (5)

Fig. 2. Overshooting kinetics of the eHJlAA-accumulation into microsomal membrane vesicles prepared from carrot suspension cells. The extent of accumulation is plotted as the differences between control assays and assays in the presence of 4 p.M nigericin (NIG sensitive) or 100 p.M IAA (lAA competitive). Diffusion means the difference between the NIG sensitive and IAA competitive accu­mulation.

Upper Phase Microsomes Lower Phase

Fig. 3. Subcellular localization of the IAA accumulation. eHJIAA-accumulation was performed with microsomal membrane vesicles or membrane vesicles prepared from the upper or lower phases after aqueous phase partitioning of microsomes. the extent of accumulation is presented as nigericin-sensitive (upper panel) and lAA-competitive (lower panel) transport activity.

sitive dose response, i.e. stimulation of the transport activity from 10 to 90% within the concentration range from 0.3 to 30 f..£M IAA. Using a Woolf plot for the analysis of transport kinetics, the affinity (Km < 10

51

11,M) and velocity (Vmax -0.5-1 pmolmin-1 mg- 1 pro­tein) of IAA -accumulation into microsomal membrane vesicles were determined. Millimolar concentrations «10 mM) of Mg2+ modulated the transport activity by increasing affinity but not velocity. Scatchard anal­ysis, normally used for the quantification of binding data, revealed an overly high number (density) of microsomal binding sites (>300 pmol mg- 1 protein) with a dissociation constant (Kd < 20 f..£M) indicating again that the [3H]IAA-association to carrot micro­somal membranes originates from accumulation into and not binding at the surface of the vesicles. The ligand specificity, as measured by competition assays, was determined to be in the order 3,4-D ~ 2,4-D > IAA ~ 2-NAA > I-NAA. This order, as well as the magnitude of the inhibitory constants of the corre­sponding compounds, demonstrated similarities with site III from maize [15] and with a plasma membrane­located site from tomato [12]. Again this ligand­specificity favors the view that the IAA-influx carrier was identified instead of a membrane-located auxin binding site with putative receptor function.

Besides the stimulation by Mg2+ of the transport activity of the IAA-influx carrier, Ca2+ was found to be an essential factor, since the auxin accumulation in vitro was progressively inhibited by increasing con­centrations of NaF in the millimolar range. The inhibi­tion is caused by the anion and could be fully restored by the addition of Ca2+, but not of Mg2+ (Fig. 4). Since it is known that F- precipitates low amounts of Ca2+ as the poorly soluble salt CaF2, it is assumed that submicromolar amounts of Ca2+ are essential to main­tain the activity of the IAA-influx carrier. Transport activity was inhibited specifically by G-nucleotides, and this inhibition was dose-dependent as determined for GTP IS, a non-hydrolysable analogue, which at a concentration of 100 f../,M, has the potency to block IAA accumulation activity.

The same kinetic characteristics, as well as properties of regulation of the IAA-influx carrier, were found in auxin accumulation studies with plasmalemma and microsomal vesicles prepared from hypocotyls of Phaseolus vulgaris [25]. In addition, the wasp toxin mastoparan, an oligopeptide mimicking the hydrophobic peptide chain of a G-protein-coupled receptor was able to block the IAA-influx in a dose­dependent manner at very low concentrations «10 f..£M) excluding the non-specific detergent effect.

52

Fig. 4. NaF-inhibition of the IAA-accumulation and its restoration by Ca2+. In the presence of 10 mM NaF only Ca2+ but not Mg2+ is able to restore the accumulation activity whereas Ca2+ in the absence of NaF has not effect.

4. Comparison of chemical signaling in animal and plant cells

In the last chapter the results obtained from the studies of auxin-stimulated growth of carrot suspension cul­tures and from the analysis of radio ligand binding studies with membrane fractions prepared from these cultures will be discussed in connection with some general, but important findings of hormone perception systems in animals as well as some relevant plant data on auxin transport and perception.

In animals signaling molecules can be either water­soluble or lipid-soluble. Hydrophilic signaling mole­cules (neurotransmitters, most hormones, and chem­ical mediators), being unable to permeate the plas­ma membrane, directly bind to receptors on the sur­face of the target cell. Hydrophilic compounds are generally either removed or are broken down very fast (ms/s/min) in the extracellular space that they mediate usually cellular responses of short duration. Hydrophobic signaling molecules (steroid and thyroid hormones), being able to diffuse across the plasma membrane, bind to receptors inside the target cell. Hydrophobic compounds persist in the extracellular space for hours or days and evoke longer lasting responses. What is in the behavior of the natural auxin, IAA, which has amphophilic properties in plant cells?

At the beginning of the 1970's Rubery and Raven developed the hypothesis that IAA in its protonated form is taken up into plant cells by a chemiosmotic

mechanism [29, 32]. From the acidic apoplast space, IAA in its protonated form can easily permeate across the plasmalemma and dissociates in the cytosol. IAA in its ionic form is accumulated in the cytosol until an eqUilibrium concentration of the protonated form is reached. This process leads to a multifold accumula­tion of charged IAA and functions as an ionic trap. The extent of auxin uptake by the chemiosmotic mechanism can be calculated according to the formula as found in [30]:

[auxhn ([H+J;n + K) [aux]ou, ([H+]ou, + K) x

(PlAAH[H+]ou,RT[l - e-FE/ RT] + PIAAKFE)

(PlAAH[H+hnRT[l - e-FE/ RT] + PlAAKFE e-FE/ RT )

where [aux] is auxin concentration, [H+] hydrogen ion concentration, K dissociation constant, P permeability coefficient, R gas constant, T temperature, F Faraday constant, and E membrane potential. The subscripts in

or out refer to inner or outer compartments and lAA or lAAH to ionized or protonated IAA, respectively.

Using the standard parameters as summarized in Table 1 the calculation of chemiosmotic auxin uptake into a model plant cell with dimensions equivalent to a typical carrot suspension cell results in an interesting finding. IAA as a natural auxin with a pKs-value of 4.75 fits optimally to the physiological and physicochemical parameters of a living plant cell to take up the auxin into the cytosol but not into the vacuole (Fig. 5 and 6). Obviously during evolution the process has lead to an optimal drug design for the chemiosmotic IAA uptake into plant cells.

Beside the diffusive mechanism of transmembrane auxin fluxes specific influx as well as efflux carriers for IAA are located on plant plasma membranes [14, 15, 21]. The involvement of these carriers in plant growth control is suggested by many similarities between auxin transport and action [9, 10]. In this context, the action of auxin as an external and/or internal signal of plant cells is controversially discussed [18, 35]. Also the findings that auxin actions in plants last from just a few seconds up to several weeks [7] do not allow any conclusion on the location of auxin perception by plant cells.

In animal cells three main types of membrane­located receptors which can be classified by affinity, density, and time kinetics. Ligand-gated ion channels occur at a very high density (>1000 JLm-2) with a low affinity (~ ~ 7 x 10-5 M) and a time scale for action in ms. Receptors coupled to G proteins are character­ized by a moderate affinity (~ ~ 10-9 - 10-7 M) and

Table 1. Stand3rd parameters for the calculation of the extent of auxin uptake by the chemiosmotic mechanism either form the apoplast into the cytosol or from the cytosol into the vacuole

Cell dimensions

Cell volume (l 00%)

Vacuole volume (89%)

Eytosol volume (11 %)

PHcytosol

pHapoplast

pHvacuole

Potential Eplasmalenuna

Potential Eronoplast

Permeability PIAAH Permeability PIAA Temperature T (+25 0c)

100 x 20 x 20j.Lm 4OOOOj.Lm-3

35739 j.Lm- 3

4261 j.Lm- 3

7.5

5.5

4.5

-120mV

+20mV 1.0 x 10-5 ms- 1

1.0 x 10-8 ms- 1

298K

fig. 5. Chemiosmotic auxin uptake at the plasmalemma into the cytosol. The accumulation ratio is plotted against the pK.-values of auxins and the pH in the apoplast.

a time scale for action in s, and are found at low den­sity with the possible occurrence of spare receptors. The third type, receptors with intrinsic tyrosine kinase activity act in min with a very high affinity (~ ~ 10-10

M) at a very low density. Obviously in animal cells some general principles of structure-function relation­ships of membrane-located receptors are established which are expressed in their kinetic properties. First, there is an inverse correlation between the magnitude of the affinity and the number of receptors, and second, the time scale for action can be related to the affinity of a distinct receptor type [33].

5.3 4 .843 . 36 3.3 2.6

pKs

o ~-

pH Cytosol

53

Fig. 6. Chemiosmotic auxin uptake at the tonoplast into the vacuole. The accumulation ratio is plotted against the pK.-values of auxins and the pH in the cytosol.

In plant cells, it has been suggested that high­affinity lAA binding sites act as receptors for the initiation of signal transduction chains leading to the control of plasma-membrane-Iocated enzymes like the H+ -ATPase [2], phosphoinositidase C [8, 37, 38], phospholipase A [1], and NADH oxidase [5]. These reactions are thought to be controlled by as yet unknown auxin receptors or homologous proteins of the auxin binding site I (ABP). The maize ABP has been purified and the genes coding for it and its isoforms cloned and sequenced by several groups [II, 13, 34]. On the basis of the sequence data avail­able, there is no evidence for a transmembrane span­ning motif of the ABP as it is a characteristic of all animal membrane-located receptors independent of their molecular types. The presence of a C-terminal KDEL-sequence suggests sequestration of the ABP in the ER lumen, and this fact corresponds with the inabil­ity to detect any significant lAA-binding at the plant plasma membrane. In contrast to these findings anti­bodies to the maize ABP block the auxin stimulation of H+ -ATPase [2], the NADH oxidase [6] and elon­gation growth [20]. In summary, the function of the maize ABP and its homologues in other species to act as lAA receptor on the plant plasma membrane remains controversial [10, 16, 17,23,27]. The current models of transmembrane signaling of lAA do not explain all aspects of the hormone's physiological actions and do not correspond to known animal models.

In this paper an alternative model of auxin per­ception at the plasmalemma is proposed (Fig. 7); The

54

Cytosol pH:::: 7.5

Signal ? +

P t . hytotropln

IAAH + H+

Apoplast pH < 5.5

IAA- + 2 H +

. Ca2+ Ca2+

Fig. 7. Model of the auxin perception at the plasmalemma by the IAA-infIux carrier and its regulation.

IAA-influx carrier functions as one perception site for auxin. Plant cells expressing the IAA influx carrier function as sinks for auxin flow in comparison to those cells lacking the carrier. In addition, plant cells express­ing the efflux carrier are sources for auxin flow. Both carrier types act as sensors for transmembrane IAA gradients at the plasmalemma, and in cooperation a continuous and directional auxin flow is established in plant tissues. The auxin flow is constitutive, but it is controlled at the carrier level by endogenous lig­ands, i.e. by phytotropin for the efflux carrier [31] and by a chemically unidentified compound for the influx carrier [10]. The molecular mechanisms that control the transport activities of these carriers are as yet not clarified, but in the model a mechanism is proposed, where the endogenous ligands bind to receptors cou­pled to G-proteins which inhibit the activity of the carriers (Fig. 7). The synthesis of these endogenous ligands may be related to environmental stimuli. As a result environmental stimuli modulate the auxin flow

in vivo, as has been discussed in relation to gravity or light [4, 24, 36]. Besides the important function to catalyse the auxin transport at the plasmalemma, the IAA-influx carrier may be directly involved in auxin transduction by controlling gene expression in plant cells as discussed in this volume [22]. This view also explains the good correlation between ligand specificity and dose-response curves obtained from the analysis of auxin-stimulated growth of carrot suspen­sion cultures and from auxin transport studies with membrane fractions prepared from these cultures.

References

1. Andre B and Scherer GFE (1991) Stimulation by auxin of phospholipase A in membrane vesicles from an auxin-sensitive tissue is mediated by an auxin receptor. Planta 185: 209-214

2. Barbier-Brygoo H, Ephritikhine G, Klllmbt D, Ghislain M and Guem J (1989) Functional evidence for an auxin receptor at

55

the plasmalemina oftobacco mesophyll protoplasts. Proc Nat! Cucurbita and Zea: a possible reflection of cell polarity. Planta Acad Sci USA 86: 891-895 177: 304-311

3. Benning C (1986) Evidence supporting a model of voltage- 22. Mennes AM, Boot EI, van der Zaal EI, Hooykaas PJJ and dependent uptake of auxin into Cucurbita vesicles. Planta 169: Libbenga KR (1994) Auxin-regulated gene expression in 228-237 tobacco. Intern Symp on Plant Hormone Signal Perception

4. Briggs WR and Baskin TI (1988) Phototropism in higher plants and Transduction, September 4-10, 1994, Moscow, Russia. - Controversies and caveats. Bot Acta 101: 133-139 Abstract pp 54

5. Brightman AO, Barr R, Crane FL and Morre OJ (1988) Auxin- 23. Napier RM and Venis MA (1991) From auxin-binding protein stimulated NADH oxidase purified from plasma membrane of to plant hormone receptor? Trends Biochem Sci 16: 72-75 soybean. Plant Physiol 86: 1264-1269 24. Nick P, Schafer E and Furuya M (1992) Auxin redistribution

6. Brightman AO and Morre OJ (1991) NADH oxidase of the during first positive phototropism in com coleoptiJes. Micro-plasma membrane of plants. In: Crane FL, Morre DJ and !-Ow tubule reorientation and the Cholodny-Went hypothesis. Plant HE (eds) Oxidoreduction at the Plasma Membrane: Relation to Physiol99: 1302-1308 Growth and Transport. Vol II Plants, pp 85-110. Boca Raton, 25. Nickel R (1992) Das auxinstimulierte Streckungswachstum Ann Arbor, Boston: CRC Press und sein molekularer Mechanismus. Vergleichende in vivo -

7. Brummell DA and Hall JL (1987) Rapid cellular responses und in vitro - Untersuchungen am Hypokotyl von Phaseolus to auxin and the regulation of growth. Plant Cell Environ 10: vulgaris. PhD thesis, FakultAt ftlr Biologie, Ruprecht-Karls-523-543 UniversitAt, Heidelberg

8. Ettlinger C and LehIe L (1988) Auxin induces rapid changes 26. Nissen P (1985) Dose responses of auxins. Physiol Plant 65: in phosphatidylinositol metabolites. Nature 331: 176-178 357-374

9. Hertel R (1983) The mechanism of auxin transport as a model 27. Palme K and Schell J (1991) Plant signaling: auxin receptors for auxin action. Z Pflanzenphysiol 112: 53-67 take shape. Curr BioI 1: 228-230

10. Hertel R (1994) A critical view on proposed hormone action: 28. Parker KE (1991) Auxin metabolism and transport during grav-the example of auxin. In: Smith CJ, GalIan J, Chiatante D and itropism. Physiol Plant 82: 477-482 Zocchi G (eds) Biochemical Mechanisms Involved in Plant 29. Raven JA (1975) Transport of indoleacetic acid in plant cells Growth Regulation, pp 1-15. London: Clarendon Press in relation to pH and electrical potential gradients, and its

11. Hesse T, Feldwisch J, Balshtlsemann D, Bauw G, Puype M, significance for polar IAA transport. New Phytol 74: 163-175 Vandekerckhove J, !-Obler M, KIlImbt D, Schell J and Palme 30. Rubery PH (1980) The mechanism of transmembrane auxin K (1989) Molecular cloning and structural analysis of a gene transport and its relation to the chemiosmotic hypothesis of from Zea mays (L.) coding for a putative receptor for the plant the polar transport of auxin. In: Skoog F (ed) Plant Growth hormone auxin. EMBO J 8: 2453-2461 Substances 1979. Proc 10th Intern Conf Plant Growth Sub-

12. Hicks GR, Rayle DL, Jones AM and Lomax TL (1989) Specific stances, Madison, Wisconsin, July 22-26, 1979, pp 50-60. photoaffinity labeling of two plasma membrane polypeptides Berlin, Heidelberg, New York: Springer-Verlag with an azido auxin. Proc Nat! Acad Sci USA 86: 4948-4952 31. Rubery PH (1990) Phytotropins: receptors and endogenous

13. Inohara N, Shimomura S, Fukui T and.Futai M (1989) Auxin- ligands. Symp Soc Exp Bioi 44: 119-146 binding protein located in the endoplasmic reticulum of maize 32. Rubery PH and Sheldrake AR (1973) Effect of pH and surface shoots: molecular cloning and complete primary structure. charge on cell uptake of auxin. Nat New Bioi 244: 285-288 Proc Nat! Acad Sci USA 86: 3564-3568 33. Taylor CW (1990) The role of G proteins in transmembrane

14. Jacobs M and Gilbert SF (1983) Basal localization of the pre- signaling. Biochem J 272: 1-13 sumptive auxin transport carrier in pea stem cells. Science 220: 34. Tillmann U, Viola G, Kayser B, Siemeister G, Hesse T, Palme 1297-1300 K, !-Obler M and KIlImbt D (1989) cDNA clones of the auxin-

15. Jacobs M and Hertel R (1978) Auxin binding to subcellular binding protein from com coleoptiJes (Zea mays L): isolation fractions from Cucurbita hypocotyls: in vitro evidence for an and characterization by immunological methods. EMBO J 8: auxin transport carrier. Planta 142: 1-10 2463-2467

16. Jones AM (1990) Do we have the auxin receptor yet? Physiol 35. Vesper MJ and Kuss CL (1990) Physiological evidence that Plant 80: 154-158 the primary site of auxin action in maize coleoptiles is an

17. KIlImbt D (1990) A view about the function of auxin-binding intracellular site. Planta 182: 486-491 proteins at plasma membranes. Plant Mol Bioi 14: 1045-1050 36. Young LM, Evans ML and Hertel R (1990) Correlations

18. Knauth B and KIlImbt D (1990) Is cell elongation regulated by between gravitropic curvature and auxin movement across extracellular auxin? Bot Acta 103: 103-106 gravistimulated roots of Zea mays. Plant Physiol 92: 792-798

19. Larsson C, Widell S and Kjellbom P (1987) Preparation of 37. Zbell B and Walter C (1987) About the search for the molec-high-purity plasma membranes. In: Packer L and Douce R (eds) ular action of high-affinity auxin binding sites on membrane-Plant Cell Membranes, pp 558-568. New York: Academic localized rapid phosphoinositide metabolism in plant cells. In: Press KIlImbt D (ed) Plant Hormone Receptors, pp 141-153. Berlin,

20. !-Obler M and KIlImbt D (1985) Auxin-binding protein from Heidelberg, New York: Springer-Verlag coleoptiJe membranes of com (Zea mays L) II. Localization of 38. Zbell B and Walter-Back C (1988) Signal transduction of a putative auxin receptor. J Bioi Chem 260: 9854-9859 auxin on isolated plant cell membranes: Indications for a rapid

21. L!ltzelschwab M, Asard H, Ingold U and Hertel R (1989) Het- polyphosphoinositide response stimulated by indoleacetic erogeneity of auxin-accumulating membrane vesicles from acid. J plant Physiol 133: 353-360

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 57-65. © 1996 Kluwer .1cademic Publishers.

57

Cytokinin signalling systems From a whole plant to the molecular level

O.N. Kulaeva, N.N. Karavaiko, S.Y. Selivankina, I.E. Moshkov, G.Y. Novikova, Y.V. Zemlyachenko, S.Y. Shipilova & E.M. Orudgev Timiryazev Institute of Plant Physiology, Russian Academy of Sciences, ul. Botanicheskaya 35,127276 Moscow, Russia

Key words: cytokinins, cytokinin-binding proteins, protein kinase, transcription regulation

Abstract

A role of endogenous cytokinins as the hormonal signal, by which the roots regulate leaf metabolism and prevent leaf senescence in particular, is discussed. Cytokinin signal perception and transduction in leaf cells were studied on fully expanded first leaves of 1 0-13-day-old barley plants (Hordeum vulgare L. cv. Viner). Their high sensitivity to exogenous cytokinins depends on dramatic decrease in endogenous cytokinin content during leaf growth. Cytokinin-binding protein of 28-30 kD was isolated from barley leaf cytosol by its affinity to synthetic cytokinin benzyl adenine (BA). The 30-kD protein was involved in cytokinin-dependent activation of RNA synthesis in vitro in the system containing chromatin-bound RNA polymerase I from barley leaves. Multistage purification of the protein included affinity chromatography on trans-zeatin-Sepharose or zeatin riboside-Sepharose resulted in isolation of barley leaf cytosol 67-kD protein up to electrophoretic homogeneity. The protein was revealed as a single band in Western blot analysis developed with anti-idiotype antibodies from antiserum to zeatin. In concert with trans-zeatin, the 67 -kD protein activated transcription elongation directed by RNA polymerase I (in the system containing chromatin-bound RNA polymerase I from barley leaves) and by RNA polymerase II (in nuclei isolated from barley leaves). The protein effect strongly depended on cytokinin concentration. The maximum activation was observed at trans-zeatin concentration of 10- 8 M. cis-Zeatin had no effect. These results together with data on reversible [3H]zeatin-binding moiety of the 67-kD protein [8] provide a definitive proof to consider this protein as one of the cytokinin receptors in barley leaf cells which is responsible for cytokinin activation of transcription elongation directed by both RNA polymerase I and RNA polymerase II.

Cytokinin-sensitive protein kinase activity was detected in barley leaf chromatin. Stimulation of this protein kinase was specific for physiologically active cytokinin trans-zeatin and was not realized by its non-active isomer cis-zeatin. The protein kinase was co-isolated from chromatin with RNA polymerase I and phosphorylated its subunits. The results of this study are discussed in the context of the latest evidence on regulation of transcription elongation in eucariotic cells.

The suggestion was put forward on the involvement of protein kinase and cytokinin-binding protein in cytokinin­dependent transcription regulation in leaves.

Introduction

A hormonal signal which is translocated from the roots to the shoots and participate in regulation of shoot growth and metabolism was predicted independently

in the middle of this century by Chibnall [4], Sabinin [37], Kursanov [21], and Mothes [28]. In particular, Chibnall showed that roots are essential to prevent leaf senescence [4]. Mothes demonstrated that roots performed this function even when they did not supply

58

leaves with mineral nutrition and water [28]. He assumed that some unknown substance is responsible for such root effect. Unexpectedly, it was shown that just discovered kinetin effectively prevent senescence of detached Xanthium leaves [33]. This phenomenon was studied in details on detached Nicotiana rustica leaves in the laboratory headed by Mothes [29, 30]. Later, in Kulaeva's experiments with Nicotiana rustica plants it was established that endogenous cytokinins moved from roots to shoots with xylem sap which could be collected as exudate of decapitated roots [10]. Such natural cytokinins were very effective in preven­tion of senescence of detached leaves [10]. Thus, it was discovered that in an intact plant cytokinins play the role of a hormonal signal by which roots control physiological processes in shoots and prevent leaf senescence in particular. Later, this conclusion was confirmed in a number of laboratories. Kende [9] isolated zeatin and zeatin riboside from sunflower root exudate, and the correlation between cytokinin content in xylem sap and growth rate of shoots was demon­strated [43].

Cytokinins as well as all other phytohormones are involved in regulation of many physiological processes in plants [11, 13, 24, 26, 44]. They participate in induction of cell division and shoot differentiation [44], activate cell growth in leaves and cotyledons of dicotyledon plants [13,26], promote chloroplast differ­entiation [13], increase sink activity of leaf cells [13], prevent leaf senescence [10, 29, 30], induce stomata opening [13], participate in regulation of tuber forma­tion [47], are involved in antiviral responses of plants [16], etc.

Until the present, it is unknown whether various types of cell responses to cytokinins are realized via the common or various receptors and transduction systems. Therefore, to investigate perception and transduction of cytokinin signal in plant cells one should choose the distinct type of cell response to the phytohormone and should not extrapolate conclusion obtained to other types of cell response.

To study cytokinin signal perception and transduc­tion, we used fully expanded first leaves of 10-13-day-old barley plants. Exogenous cytokinins prevent senescence of these leaves without promotion of cell growth and division or any differentiation processes. For leaf cells endogenous cytokinins play the role of a very important exogenous signal by which roots regu­late leaf growth, development, and senescence [10, 11]. By this reason, detached leaves are highly sen­sitive to exogenous cytokinins. Cytokinin-dependent

prevention of detached barley leaf senescence is corre­lated with activation of RNA synthesis in leaf cells performed by both RNA polymerases I and II [20]. Such activation was reproduced by addition of cytokinin to leaf homogenate followed by chromatin isolation and estimation of in vitro RNA synthesis in the system containing chromatin-bound RNA poly­merase I [39]. No response to cytokinin was revealed with purified chromatin. That was the reason to sug­gest that a non-chromatin factor(s) is involved in cytokinin-dependent activation of RNA synthesis in leaf cells. Analogically to steroid hormones in animals, we assumed that this factor(s) might be receptor-like protein(s) and attempted to isolate such protein(s) from barley leaf cytosol.

In the beginning of this study, a protein frac­tion was isolated from barley leaf cytosol by affinity chromatography on benzyl adenine-coupled Sepharose (BA-Sepharose). This fraction activated RNA syn­thesis in vitro in the presence of cytokinin in the system containing chromatin-bound RNA polymerase I from barley leaves [34].

The present work was undertaken to isolate and characterize a protein(s) participating in cytokinin­dependent activation of RNA synthesis and to study its possible cytokinin receptor function in leaf cells. We also wanted to study protein kinases which could be involved in cytokinin signal transduction.

Materials and methods

Barley seedlings (Hordeum vulgare L. cv. Viner) were grown as described earlier [17]. The first leaves of 1 0-13-day-old plants were used for cytokinin-binding protein (CBP) isolation and for studying cytokinin­sensitive protein kinases.

Isolation of antibodies to benzyl adenine (AbBA) and anti-idiotype antibodies (Aba_i) from antiserum against benzyladenine (BA) was described elsewhere [17]. Antibodies to trans-zeatin (Abz) and anti­idiotype antibodies from antiserum to trans-zeatin were isolated by the similar procedure.

CBP isolation by affinity chromatography on BA­Sepharose and Aba_i-Sepharose was conducted as described earlier [17]. CBP isolation by trans­zeatin-Sepharose (Z-Sepharose) and zeatin riboside­Sepharose (ZR-Sepharose) was performed as described by Karavaiko et al. in this issue [8].

Polypeptide composition of proteins was studied by SDS-PAGE [23]. CBP(s) was revealed after SDS-

14

12 ± 8

~ <.>

!:! 8 ~ I ..., <:> <=l

~ '0 '; 8 4 ~ Pi "'" + "'" 0 II I I 0

I 3 6 9 12 15 18

Plant age, days

Fig. 1. Alterations in zeatin (Z) and zeatin riboside (ZR) levels during the growth of the first barley leaves. Cytokinin content was measured by competitive ELISA.

PAGE by Western blot technique [45] with Aba-i isolated from antiserum against zeatin.

The effect of isolated proteins and cytokinins on the RNA synthesis in vitro was examined in two different systems: (i) in the system containing RNA polymerase I associated with chromatin from barley leaves [17] and (ii) in isolated nuclei from barley leaves under condi­tions optimized for RNA polymerase I or RNA poly­merase II [20]. Chromatin isolation was previously described [42]. Estimation of protein kinase activity associated with barley leaf chromatin was presented elsewhere [41] . Purification of RNA polymerase I from barley leaves and measurement of protein kinase activity associated with the enzyme was performed according to Refs. [18, 41]. Endogenous cytokinin content in barley leaves was determined by ELISA as described earlier [16].

Results and discussion

Cytokinin-binding proteins from barley leaf cytosol

The growth of the first leaves of barley seedlings is accompanied by dramatic decrease in endogenous cytokinin content (Fig. 1). As a result, cytokinin con­tent in fully expanded (9-13-day-old) barley leaves was extremely low. Such leaves after detachment are very sensitive to exogenous cytokinins which prevent their senescence. These leaves were used for study of CBPs and cytokinin-dependent protein kinases.

59

30 A B 17

19

30

15

14

- Migration - -- Migration _

Fig. 2. SDS-PAGE scans of barley leaf cytosol CBP isolated with Aba_i-Sepharose (A) and BA-Sepharose (B). Numbers indicate mol wts of the polypeptides in each CBP preparation in kD.

Table 1. Effect of BA (5 x 10-7 M), CBP, AbBA, and Aba-i on RNA synthesis in vitro in the system containing chromatin-bound RNA polymerase I from barley leaves

CBP

+ +

+

Aba-i

+ +

AbBA

+ +

RNA synthesis (% to control)

-BA +BA

99 97 92

104 107

254

116

97 112

106

In the beginning of this work, CBP(s) was isolated from cytosol of barley leaves by two independent pro­cedures based on protein affinity to BA and Aba-i from antiserum to BA. A protein fraction with the same polypeptide pattern was isolated by both procedures (Fig. 2). In both cases SDS-PAGE revealed the princi­ple polypeptide with mol wt of 28-30 kD.

Cytokinin-binding properties of the proteins iso­lated by both procedures were demonstrated by their competition with AbBA for complex formation with immobilized BA in ELISA [17]. Functional activity of CBP was tested in the in vitro system for RNA syn-

60

~ ..... ~

~ r- eo? 0 0 ..;. co ~ eo? N .....

~ ~ ~ ~ ~ ~

.e-

.~ II)

't:I

iii u

:;1 ~ 0

: :;1 ell "il ~

Kigration • Fig. 3. Densitometer tracing of Western blot of barley leaf cytosol ZBP. ZBP separated by SOS·PAGE was transferred to nitrocellulose and then developed with Ab'_i from antiserum against zeatin. Arrows indicate the positions of protein standards.

thesis containing chromatin-bound RNA polymerase I from barley leaves [17]. The proteins isolated from barley leaf cytosol on BA- and Aba_i-Sepharose acti­vated RNA synthesis in vitro in the presence of BA more than two times (Table 1). Aba_i (as antibodies to a putative cytokinin receptor) and AbBA blocked tran­scription activation promoted by CBP in the presence ofBA. Hence this activation is really specific for CBP in concert with BA. This in vitro effect of CBP and BA on RNA synthesis agrees well with in vivo cytokinin activation of RNA synthesis in barley leaves [13].

All these data allowed us to consider this protein(s) as a putative cytokinin receptor mediating the phyto­hormone, activation of RNA synthesis in barley leaf cells.

As mentioned above, this protein was isolated based on its affinity to synthetic cytokinin BA which differs in many aspects from the natural cytokinin trans-zeatin. For instance, CBP isolated from wheat embryos had high affinity to BA (KD = 6.5 X 10-7

M) but possessed IOO-fold lower affinity to trans­zeatin. It was one of the arguments against its receptor role [2]. According to these considerations in further experiments we isolated CBP basing on its affinity to trans-zeatin. Two types of affinity columns were pre­pared: (i) Z-Sepharose and (ii) ZR-Sepharose. Addi­tional steps of protein purification were introduced in

Table 2. Effect of trans· zeatin (10-7 M) and 67 ·kD ZBP from barley leaf cytosol on RNA synthesis in vitro in the system containing chromatin·bound RNA polymerase I from barley leaves

Protein' -Zeatin +Zeatin

cpmper % cpmper %

20J.LgDNA 20J.Lg DNA

1942 100 1829 95

+ 1955 100 3850 198

'The 67-kD protein was separated in SDS·PAGE, eluted from a gel, renaturated, and added into the assay for RNA synthesis estimation.

the procedure: chromatography on Phenyl-Sepharose and Thiol-Sepharose (for details see Karavaiko et al., this issue [8]). Consequent purification of CBP on Phenyl-Sepharose, ZR-Sepharose, and Thiol­Sepharose resulted in yielding a single protein which was revealed by SDS-PAGE followed by Western blot developed with Aba-i from antiserum against zeatin as a polypeptide with mol wt of 67 ± 2 kD (Fig. 3). The same results were obtained by protein purification on Z-Sepharose. Nondenaturing PAGE also revealed the single protein band with mol wt of 67 ± 2 kD [8]. These data showed that the protein was purified to electrophoretic homogeneity. Chromatography on Superose 12 confirmed that mol wt of the protein was 67 ± 2 kD [8].

Aba-i from antiserum against zeatin can be con­sidered as antibodies against zeatin-binding proteins (ZBPs). Their interaction with 67-kD protein in Western blot analysis demonstrated that this protein belongs to ZBP-family. This conclusion was confirmed by [3H]zeatin binding to the protein [8]. This binding was specific and reversible. Hence, the 67-kD protein isolated from barley leaf cytosol is really a new ZBP possessing the capacity to bind reversibly the natural cytokinin trans-zeatin.

ZBP of 67 kD was eluted from SDS-gel and rena­tured. After such procedure the protein in the presence of trans-zeatin activated RNA synthesis in vitro in the system containing chromatin-bound RNA poly­merase I from barley leaves (Table 2). Hence, the ZBP possessed functional activity. It mediated cytokinin activation of transcription elongation.

The next aim of the study was to examine specificity of the complex of ZBP and trans-zeatin in transcription activation. To clarify this problem we compared effect of ZBP on RNA synthesis in vitro in the presence of trans-or cis-zeatin. In bioassays, cis-zeatin is known to

.. I

!:: .. 25 -;-z "" ... 20 ::s.. c:> N ........ a 15 ... ~

Ii 0

:::I 10 • .. 0

eo

:tl ~~ 0 u .9

! = - 5

., - 8 -7 - 6 ~

19 [e], M

Fig. 4. The effect of trans· and cis-zeatin on ZB~-~ediated regulation of RNA synthesis in vitro in the system contammg chro­matin-bound RNA polymerase I from barley leaves. (0), control, RNA synthesis without ZBP and zeatin addition. Kulaeva et al. (1995) FEBS Lett 366: 26-28.

be at least 100 times less active than trans-zeatin [38]. Chen et al. [3] proposed the hypothesis which explains intramolecular inactivation of cis-zeatin. Their model experiments based on X-ray christallography demon­strated that the side-chain hydroxyl group of cis-zeatin could form a hydrogen bond to W of the purine ring which must be free for cytokinin activity of a sub­stance [25]. Hence a hydrogen bond between the OH group and W of the purine ring must block the cis­zeatin interaction with its molecular target and as a result would inhibit phytohormonal activity of the compound. Such bonding is conformationally impos­sible for trans-zeatin. Therefore cis-zeatin is the best control compound to test specificity of trans-zeatin action in concert with ZBP.

As Fig. 4 shows, RNA synthesis in vitro in the sys­tem containing chromatin-bound RNA polymerase I from barley leaves was highly sensitive to trans-zeatin in the presence of ZBP. The highest effect was revealed at trans-zeatin concentration of 10-8 M. cis-Zeatin had no effect in a wide range of concentrations. Hence this effect is highly specific for physiologically active form of zeatin. We also observed transcription activation by ZBP in the presence of BA (data not shown). There­fore ZBP realized transcription activation in concert with physiologically active cytokinins and no effect could be detected in the presence of their inactive ana­logues.

61

Table 3. Effect of ZBP and trans-zeatin (10-7 M) on RNA synthesis in nuclei isolated from barley leaves under conditions optimized for RNA polymerase II

ZBP trans-Zeatin a-Amanitin, 4p,gml- 1

+ +

+ + + + +

+

[a_33 PI incorporation

into RNA, cpm per

20/J.g DNA

6203

5940

7538

32785

3741

3169

ZBP in the presence of trans-zeatin activated also RNA synthesis in nuclei isolated from barley leaves (for details see Karavaiko et aI., this issue [8]). This activation was detected under conditions for RNA polymerase I. Low sensitivity of RNA synthesis to a-amanitin confirmed that it was performed by RNA polymerase I [8].

Unexpectedly, ZBP in the presence of trans-zeatin increased RNA synthesis in isolated nuclei under con­ditions for RNA polymerase II (Table 3). Activation of RNA polymerase II by ZBP in the presence of trans­zeatin was proved by complete abolishing this activa­tion by a-amanitin.

Experiments with nucleotide triphosphates labeled with e3p] in a- or ,-position showed that ZBP and trans-zeatin activated transcription elongation. It was true for both RNA polymerase 1- and RNA poly­merase II-directed RNA synthesis (data not shown). HenceZBP belongs to the family of trans-factors and is involved in cytokinin-dependent activation of tran­scription elongation.

To our knowledge the data presented are the first conclusive evidence on ZBP with the definite func­tional activity which fits to all requirements for zeatin receptor:

(i) The 67-kD protein bound eH]trans-zeatin. The binding was specific and reversible.

(ii) In the presence of trans-zeatin the protein caused activation of transcription elongation by RNA polymerases I and II.

(iii) ZBP activation of RNA synthesis in vitro strongly depended on trans-zeatin concentration in the reac­tion medium. The reaction was highly sensitive to trans-zeatin (the highest activation was observed

62

at 10-8 M) ~at stressed high affinity of the protein to cytokinins.

(iv) ZBP activation of RNA synthesis in vitro was spe­cific in relation to physiologically active cytokinins (trans-zeatin and BA) and could not be demon­strated in the presence of physiologically inactive cis-zeatin.

(v) ZBP was isolated from highly sensitive to cytokinin plant material, namely, fully expanded barley leaves.

(vi) Cytokinins induce activation of RNA synthesis in barley leaves [13]. Hence, ZBP in concert with trans-zeatin reproduced in vitro typical in vivo effect of cytokinins.

Therefore, the data obtained provide the definitive proof to consider 67-kD ZBP as one of cytokinin receptors in barley leaf cells which is responsible for cytokinin activation of transcription elongation by both RNA polymerase I and RNA polymerase II.

It is important to discuss these data in context of the latest advances in the study of transcription regulation in eucariotic cells. It was established that the stim­ulation of elongation could be as important as the stimulation of initiation in activating a reporter gene expression in animal cells [7, 49]. A variety of trans­activators stimulated transcription elongation were characterized [6]. Some of them are involved in acti­vation of transcription elongation directed by RNA polymerase II as well as RNA polymerase I [7]. According to this evidence participation of 67-kD ZBP in cytokinin-dependent stimulation of transcrip­tion elongation by RNA polymerase I and RNA poly­merase II could be the key mechanism of cytokinin activation of RNA synthesis in leaf cells which leads to prevention of isolated leaves senescence. In this context ZBP(s) sequencing should be very helpful to elucidate whether this protein(s) belongs to the family of transfactors participating in regulation of transcrip­tion elongation in eucariotic cells.

Presently, a number of CBPs was isolated from different plant sources. These data were analyzed in Brinegar's latest review [2]. It is necessary to empha­size that just from barley leaf cytosol three cytokinin­binding proteins were isolated in our laboratory: pro­teins with mol wts of 28-30 kD [17], 40 kD [35], and 67 kD which is discussed in this paper. As it was shown in our laboratory, 30-kD protein could not be revealed by Western blot with Aba_i from antiserum against zeatin. On the other hand, elution of 30-kD polypeptide from SDS-PAG followed by its renatu­ration gave us a possibility to reveal its interaction

with Aba-i from antiserum to zeatin. These data give a support to assume that 30-kD CBP could be one of the domain of 67 -kD protein or alternatively two inde­pendent CBPs have a common immunodeterminants in the cytokinin-binding site which were recognized by Aba-i. Determination of the protein sequences is necessary to discriminate these two alternatives. A function of 4O-kD CBP [35] is still unknown. This protein cannot discriminate cis- and trans-zeatin in competitive dihydrozeatin binding test [36]. It was not active in cytokinin-dependent regulation of RNA synthesis in vitro (data not shown). Therefore now it is difficult to understand the role of this protein as a cytoknin receptor. On the other hand, last data showed extremely complicated organization of polypeptide complexes which are involved in regulation of gluco­corticoid hormone-receptor interaction in animal cells [32]. These data allow us to assume that cytokinin­receptor interaction can also involve a number of pro­teins. This is a problem for further investigation.

At the last time, a new CBP with mol wt of 130 kD was isolated from tobacco leaves [27]. The pro­tein possesses S-adenosyl-L-homocysteine hydrolase activity. This protein consists of two subunits with mol wts of 57 and 36 kD. Antibodies against 57-kD subunit kindly provided us by Dr Wakasugi showed cross-reactivity with 67-kD ZBP from barley leaves. These data indicate that different CBPs have common immunodeterminants and, perhaps, common organi­zation of cytokinin-binding sites. The study of CBP family is a very intriguing problem which could give a key to elucidate how plant cells choose the type of physiological response to cytokinin.

Cytokinin-sensitive protein kinases which could be involved in plant cell response to cytokinins

It is well-known that phosphorylation/dephosphory­lation of proteins is involved in hormonal signal trans­duction and amplification in animal cells [1, 5]. Last time essential attention is paid to elucidate the role of protein kinases in the mechanisms of phytohormone action in plants [46]. In our previous work we showed that chromatin isolated from barley leaves contained a protein kinase which could be activated in vitro by BA [40,41].

Our new data demonstrated that this activation is highly specific for physiologically active natural cytokinin trans-zeatin (Fig. 5) and could not be repro­duced by its inactive analogue cis-zeatin. Chromatin­bound protein kinase possessed high sensitivity to

80

~ 60 a

0 .-....., a:s :> .- 40 ....., C)

a:s Q,) (1)

a:s 20 ~ .-..!:.:l

~ .-Q,) ....., 0 0 0 ' :--. ,... • p..., .. cis-Z

- 20 ,1-''''----_--'-1 __ --'-__ .1.-_-----'-1 _ _ --'

-10 - 9 - 8 - 7 - 6 - 5

19 [C], M

Fig. 5. In vitro effect of trans- and cis-zeatin on protein kinase associated with barley leaf chromatin. The results are expressed as the percentage activation of the control protein kinase activity measured in the absence of zeatin. Bars denote S.E.

A 16

B

190 120 669 «0 232 140

1 (( (

2

- - \ligTotion --- --- lI.igrotiOD -

Fig. 6. Densitometer tracing of purified RNA polymerase I from barley leaves. (A), nondenaturing PAGE. Arrows indicate the posi­tion of protein standards. (B), subunit composition of the enzyme resolved in SDS-PAGE (I) and the scan of in vitro [32Pl-labeled polypeptides after enzyme incubation in protein kinase assay mix­ture (2). Numbers indicate mol wts of the polypeptides in kD.

63

trans-zeatin (the highest response was observed at 10- 9 M). This cytokinin-dependent protein kinase could discriminate plus and mines isomers of synthetic cytokinin analogues [15] that stressed its extremely high specificity to functionally active cytokinins. As our previous data demonstrated, cytokinin-sensitive protein kinase was coisolated from barley leaf chro­matin with RNA polymerase 1[14,41]. We could not separate these two enzyme activities despite of RNA polymerase I was purified up to electrophoretic homo­geneity [18, 19]. Associated with RNA polymerase I protein kinase phosphorylated subunits of RNA poly­merase I (Fig. 6) and did not phosphorylate casein and histones H5 and HI [41]. This protein kinase was dramatically activated by BA addition into the reaction mixture for the enzyme activity assay [14, 41]. Zeatin and kinetin also induced in vitro activa­tion of this enzyme. Inactive analogues of cytokinins, namely, adenine and 6-methyladenine had no effect on the enzyme activity. Other phytohormones were also not active in this system [41]. Hence activation of the protein kinase, which is associated with RNA poly­merase I and phosphorylates its subunits, is highly specific for physiologically active cytokinins. These results were confirmed on isolated lupine cotyledons [50]. BA (l0-5M) addition to the medium containing RNA polymerase I isolated from cotyledon cell nuclei increased 10-fold activity of protein kinase associated with RNA polymerase I. It is especially important that the same results were obtained with RNA polymerase II. The enzyme isolated from cotyledon nuclei was also associated with protein kinase and cytokinin in vitro dramatically increased this kinase activity. But it should be emphasized that cytokinins directly affected protein kinase in vitro without activation of RNA poly­merase. For its activation CBP described above is abso­lutely necessary.

It is important to compare these data with last evidence on transcription regulation in animal cells which show that phosphorylation of RNA polymerases is important for their interaction with transfactors acti­vating elongation of transcription [7,31]. In fact, the phosphorylation of C-terrninal domain oflarge subunit of RNA polymerase II is not necessary for basal tran­scription in vitro but it could be required for transfactor­dependent activation of elongation [49]. In context of these findings, it seems to be probable to assume that cytokinin-induced promotion of protein kinase, which is involved in RNA polymerase phosphory lation, could be essential for activation of the enzymes by CBP in

64

concert with cyt6kininS. Verification of this idea is one of the most important aim of future our work.

Considering our data on CBP and protein kinase(s) participating in the regulation of transcription it is nec­essary to take into account that plant cells respond to cytokinin not only on the transcription level but also on the posttranscription one [12, 22]. In this connec­tion data of our laboratory is of interest showing that phosphorylation of ribosomal proteins is under con­trary cytokinin and abscisic acid (ABA) control in plant cells and can play an important role in phytohormone regulation of activity of protein synthesis machinery [481. A protein kinase which could be involved in cytokinin-ABA antagonistic interaction was demon­strated in b8fley leaf cytosol [18]. The discovery in barley leaves of a protein kinase with properties of the protein kinase C-type and elucidation of its sen­sitivity to cytokinins [18] make probable cytokinin involvement in modification of membrane proteins and regulation of membrane-dependent processes. Further investigations should clarify how different levels of cytokinin action are integrated in general cell response to the phytohormone.

Conclusion

The data presented give support to the thesis that CBP 67 ± 2 leD from barley leaf cytosol is one of the cytokinin receptors in leaf cells which are responsible for cytokinin activation of transcription elongation by both RNA polymerase I and RNA polymerase II.

Cytokinin-sensitive protein kinase was detected in barley leaf chromatin. The enzyme was stimulated in vitro by natural physiologically active cytokinin trans­zeatin but not by cis-zeatin. Cytokinin-sensitive pro­tein kinase was coisolated from chromatin with RNA polymerase I and participated in phosphorylation of its subunits.

Recent advances in the study of regulation of transcription elongation in euk8fYotic cells allow us to suggest that cytokinin-dependent protein kinases as well as cytokinin receptors with the properties of a transfactor are involved in cytokinin regulation of tran­scription elongation in leaf cells. Further investigations are necessary to elucidate the relationship between these components of the regulation system.

Acknowledgements

This work was supported by Russian Foundation for Fundamental Research, Grant No 93-04-6881, by INTAS Grant 93-0678 and by International Science Foundation, Grant No MDJOOO.

References

1. Berridge MJ (1987) Inositol triphosphate and diacylglycerol: two interacting second messengers Annu Rev Biochem 56: 159-193

2. Brinegar C (1994) Cytokinin-binding proteins and receptors. In: Mok D and Mok M (eds) Cytokinins: QJ.emistty. Activity and Function. pp 217-232 Boca Raton: CRC Press.

3. Chen C-M. JinG. Andersen BR and Ertl JR(1993) Modulation of gene expression by cytokinins Aust J Plant Physiol20: 609-619

4. Chibnall AC (1939) Protein Metabolism in the Plant. New Haven

5. Cohen P (1985) Hormones. second messengers and the reversible phosphorylation of proteins BioEssay 2: 63--67

6. Jones KJ and Peterlin BM (1994) Control of RNA initiation and elongation at the HIV-I promoter. Annu Rev Biochem 63: 717-743

7. Kane CM (1994) Transcript elongation and gene regulation in eukaryotes. In: Conaway RC and Conaway JW (eds) Transcrip­tion: Mechanisms and Regulation. pp 279-296. New York: Raven Press

8. Karavaiko NN. Selivankina SY. Brovko FA. Zemlyachenko YV. Shipilova SV. Zagranichnaya TK. Lipkin VM and Kulaeva ON (1995) Zeatin-binding proteins participating in cytokinin­dependent activation of transcription. Ibid

9. Kende H (1964) Prevention of chlorophyll in leaf sections by substances obtained from root exudate Science 145: I ()6(r.

1067 10. Kulaeva ON (1962) The infiuence of roots on leaf metabolism

in relation to kinetin action Soviet Plant Physiol 9: 229-239 II. Kulaeva ON (1973) Cytokinins. their Structure and Functions.

Moscow: Nauka 12. Kulaeva ON (1981) Cytokinin action on transcription and

translation in plants In: Guem J and Peaud-Lenoel C (eds) Metabolism and Molecular Activity of Cytokinins. pp 218-227. Heidelberg: Springer-Verlag

13. Kulaeva ON (1982) Hormonal Regulation of Physiological Processes in Plants on the Levels of RNA and Protein Synthesis The 40th Tuniryazev Lecture Moscow: Nauka

14. Kulaeva ON (1990) The possible role of protein kinases in the plant cell response to phytohormones In: Pharis R (ed) Plant Growth Substances 1988. pp 547-55 I. Berlin: Springer-Verlag

15. Kulaeva ON. Corse J and Selivankina SYu (1995) Effect of trans- and cis-zeatin and optical isomers of synthetic cytokinins on protein kinase activity in vitro. J Plant Growth Regul (in press)

16. Kulaeva ON. Fedina AB. Burkhanova EA. Karavaiko NN. Karpeisky MY. Kaplan m. Taliansky ME and Atabekov 10 (1992) Biological activities of human interferon and 2'-5' oligoadenylates in plants. Plant Mol BioI 20: 383-393

17. Kulaeva ON. Karavaiko NN. Moshkov IE. Selivankina SY and Novikova GV (1990) Isolation of a protein with cytokinin-

receptorprope[ties by means of anti-idiotype antibodies. FEBS Lett 261: 410-412

18. Kulaeva ON, Karavaiko NN, Moshkov IE, Selivankina SY, Novikova GV, Pereverzeva IN and Yakovleva LA (1994) Cytokinin-binding protein(s) and protein kinases in cytokinin signal transduction. In: Smith CJ, Gallan J, Chiatante D and Zocchi G (eds) Biochemical Mechanisms Involved in Plant Growth Regulation, pp 123-138. Oxford: Clarendon Press

19. Kulaeva ON, Novikova GV, Selivankina SY, Karavaiko NN and Moshkov IE (1992) Protein kinases and cytokinin-binding proteins in plant response to cytokinin. In: Kaminek M, Mok DWS and Zazimalova E (eds) Physiology and Biochemistry of C:ytokinins in Plants, pp 121-125. The Hague: SPB Academic Publishing

20. Kulaeva ON, Selivankina SYu, Romanko EG, Nlkolaeva MK and Nichiporovich AA (1979) Cytokinin activation of RNA polymerase activity in isolated nuclei and chloroplasts. Soviet Plant Physiol 26: 10 16-1 028

21. Kursanov AL (1955) On the physiological significance of Ficus sp. ear roots. Fiziologiya Rastenii 2: 271-276

22. Kusnetsov V, Oelmuller R, Sarwat MI, Porfirova SA, Cherep­neva GN, Herrmann RG and Kulaeva ON (1994) Cytokinins, abscisic acid and light affect accumulation of chloroplast proteins in Lupinus luteus cotyledons without notable effect on steady-state mRNA levels. Specific protein response to light/phytohormone interaction. Planta 194: 318-327

23. Leammli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685

24. Letham DS (1978) Cytokinins. In: Letham DS, Goodwin PB and Higgins TJV (eds) Phytohormones and Related Compounds - A Comprehensive Treatise 1, pp 205-263. Amsterdam: Elsevier

25. Matsubara S (1990) Structure-activity relationships of cytokinins. Critical Rev Plant Sci 9: 17-57

26. Miller CO (1961) Kinetin and related compounds in plant growth. Annu Rev Plant Physiol 12: 395-408

27. Mitsui S, Wakasugi T and Sigiura M (1993) A cDNA encoding the 57 kDa subunit of a cytokinin-binding protein complex from tobacco: the subunit has high homology to S-adenosy 1-L-homocystein hydrolase. Plant Cell Physiol 34: 1089-1096

28. Mothes K (1956) Stoffliche Beziehungen zwischen Wurzel und Spross. Angew Bot 30: 125-128

29. Mothes K (1960) Ober das Altern der Blatter und die M6g1ichkeit ihrer Wiederverjungung. Naturwissenschaften 15: 337-351

30. Mothes K, Engelbrecht Lund Kulajewa 0 (1959) Ober die Wirkung des Kinetins auf Stickstoffverteilung und Eiweissyn­these in isolierten Blattern. flora A 147: 445-464

31. O'Brien T, Hardin S, Greenleaf A and Lis JT (1994) Phos­phorylation of RNA polymerase II C-terminal domain and transcriptional elongation. Nature 370: 75-77

32. Pratt WV (1993) The role of heat shock proteins in regulat­ing the function, folding and trafficking of the glucocorticoid receptor. J BioI Chern 268: 21455-21458

33. RichmondAA and Lang A (1957) Effect of kinetin on protein content and survival of detached Xanthium leaves Science 125: 650-651

65

34. Romanko EG, Selivankina SY, Ovcharov AK and Kulaeva ON (1980) Activation of RNA synthesis in vitro by cytokinin­receptor complex from barley leaves. Doklady Akad Nauk SSSR 255: 1009-1011

35. Romanov GA, Taran VY, Khvojka L and Kulaeva ON (1988) Receptor-like cytokinin-bindingprotein(s) from barley leaves. J Plant Growth Regul 7: 1-17

36. Romanov GA (1992) The current status of major cytokinin­binding proteins from cereal plants. (Personal insight) In: Kaminek M, Mok DWS and Zazimalova E (eds) Physiology and Biochemistry of Cytokinins in Plants, pp 218-227 The Hague: SPB Academic Publishing

37. Sabinin DA (1949) On the Role of Roots in Vital Functions of Plants. The 9th Timiryazev Lecture Moscow: AN SSSR

38. Schmitz RY, Skoog F, Play tis AJ and Leonard NJ (1972) Cytokinins: synthesis and biological activity of geometric and position isomers of zeatin. Plant Physiol 50: 702-705

39. Selivankina SYu, Romanko EG, Kuroedov VA and Kulaeva ON (1979) Activation of chromatin-bound RNA polymerase by cytokinin addition during chromatin isolation. Soviet Plant Physiol26: 41-47

40. Selivankina SY, Romanko EG, Novikova GV and Kulaeva ON (1987) Cytokinin regulation of protein kinase associated with chromatin and RNA polymerase I in barley leaves. Doklady Akad Nauk SSSR 292: 767-769

41. Selivankina SY, Romanko EG, Novikova GV, Muromtseva DG and Kulaeva ON (1988) Effect of cytokinin and other phytohormones on protein kinases associated with chromatin and RNA polymerase I in barley leaves. Soviet Plant Physiol 35:205-212

42. Selivankina SY, Romanko EG, Ovcharov AK and Kharchenko VI (1982) Involvement of cytokinin-binding proteins from barley leaves in cytokinin activation of chromatin-bound RNA polymerase. Soviet Plant Physiol29: 274-281

43. Sitton D, Itai C and Kende H (1967) Decreased cytokinin production in the roots as a factor in shoot senescence Planta 73:296-300

44. Skoog F and Miller CO (1957) Chemical regulation of growth and organ formation in plant tissue cultured in vitro. Sympos Soc Exptl Bioi II: 118-231.

45. Towbin H, Staehelin T and Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 76: 4350-4354

46. Verhey SD and Lomax TL (1993) Signal transduction in vascular plants. J Plant Growth Regul 12: 179-195

47. Wareing PF and Jennings AMV (1979) Hormonal control of tuberisation in potato. In: Skoog FB (ed) Plant Growth Substances, pp 293-300. New York: Springer-Verlag

48. YakovlevaLA and Kulaeva ON (1987) The effect ofphytohor­mones on phosphory lation of ribosomal proteins in detached pumpkin cotyledons. Biochem Physiol Pflanzen 182: 359-365

49. Yankulov K, BlauJ, Purton T, Roberts S and Bentley DL (1994) Transcriptional elongation by RNA polymerase II is stimulated by transactivators. Cell 77: 749-759

50. Zayakin V, Nam IY and Kulaeva ON (1989) Effect of cytokinin on protein kinase activity associated with RNA polymerase in lupine cotyledons. Soviet Plant Physiol36: 11-17

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 67-75. © 1996 Kluwer Academic Publishers.

67

Zeatin-binding proteins participating in cytokinin-dependent activation of transcription

N.N. Karavaiko', S.YU. SelivarJkina', EA. Brovko2, Ya.V. Zernlyachenkol, S.Y. Shipilova1,

T.K. ZagrarJichnaya2, V.M. Lipkin2 & O.N. Kulaeva1

I Timiryazev Institute of Plant Physiology, Russian Academy of Sciences, ul. Botanicheskaya 35, Moscow, 127276 Russia; 2Branch of Shemyakin & Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Pushchino, Moscow Region, 142292, Russia

Key words: barley, cytokinin receptor, maize, RNA polymerase I, trans-zeatin, zeatin-binding protein

Abstract

A new zeatin-binding protein (ZBP) with molecular weight of 67± 2 kD was isolated from cytosol of first leaves of 1 O-day-old barley plants and revealed by non-denaturing PAGE as a single polypeptide. Its zeatin-binding capacity was established (i) by its ability to bind reversible [3H]trans-zeatin, (ii) by its interaction with anti-idiotype antibodies (Aba_i) from antiserum raised against zeatin, and (iii) by its ability to displace antibodies to zeatin (Abz) from its complex with immobilized trans-zeatin in competitive ELISA. In concert with trans-zeatin the ZBP activated transcription elongation in the system containing chromatin-bound RNA polymerase I from barley leaves and in isolated nuclei. Our results proved that 67 ± 2 kD ZBP is a receptor of natural cytokinin in leaf cells which mediates cytokinin-dependent activation of transcription elongation. ZBP- and trans-zeatin-induced activation of RNA synthesis in the system containing chromatin-bound RNA polymerase I depended on leaf age used for chromatin isolation and corresponded to age-dependence of leaf response to cytokinins. ZBP of 70 ± 2 kD was also isolated from the shoots of etiolated 5-day-old maize seedlings. This protein reversibly bound [3H]dihydrozeatin, was recognized by Aba-i isolated from antiserum raised against zeatin and activated RNA synthesis in vitro in the system containing chromatin-bound RNA polymerase from barley leaves in the presence of trans-zeatin. Hence,

. ZBP-mediated cytokinin-dependent activation of RNA synthesis is not species-specific. Thus, it was discovered the new family of ZBPs with the properties of cytokinin receptor which is involved in cytokinin-dependent activation of transcription elongation in plant cells.

IntrodU(;tion

Cytokinin-binding proteins (CBPs) were demonstrated in a variety of plants but their function(s) was not revealed [1]. In this context data of our laboratory on barley leaf CBP mediating cytokinin-dependent activation of RNA synthesis is of interest. At the beginning of this study, a protein fraction from barley leaf cytosol was isolated by affinity chromatography on benzy ladenine-coupled Sepharose (B A -Sepharose). In the presence of benzyladenine (BA), this fraction promoted RNA synthesis in vitro in the system contain­ing chromatin-bound RNA polymerase I from barley leaves [23,27]. It was also shown that the protein frac-

tion isolated from barley leaf cytosol by BA-Sepharose activated RNA synthesis in isolated nuclei under con­ditions optimized for both RNA polymerase I and RNA polymerase II [16]. A protein fraction with similar properties was found in nucleoplasm of barley leaf cells [5]. In further experiments, a cytokinin-binding protein with mol. wt. of 28-30 kD was purified from barley leaf cytosol by its affinity to BA [14]. In the pres­ence of BA, this protein enhanced the transcription in vitro in the system containing chromatin-bound RNA polymerase I from barley leaves. Activation was abol­ished by antibodies against BA as well anti-idiotype antibodies (Aba_i) isolated from antiserum against BA [14]. The results obtained allowed us to discuss this

68

protein a putative cytokinin receptor involved in the cytokinin regulation of transcription. However, this protein was isolated due to its affinity to synthetic cytokinin BA [14] which differs considerably from the natural cytokinin trans-zeatin, BA is more hydro­phobic. It is more stable in plant cells [18], hence, its interaction with enzymes participating in cytokinin metabolism can differ from that of trans-zeatin. An especially dramatic difference was revealed in BA and trans-zeatin interaction with CBP from wheat germ [1, 2,6,7]. This protein was isolated due to its high affinity to BA but its affinity to trans-zeatin was 1 OO-fold lower [1] .. It was one of the arguments against cytokinin receptor function of this protein in plant cells [1]. The proteins with high affinity to trans-zeatin were also isolated from various plant materials [1, 19,20,24,25] but up to now their function is not elucidated [1].

For this reason, the main goal of our work was to isolate zeatin-binding protein(s) (ZBP) from barley leaf cytosol and to study its functional activity in the regulation of RNA synthesis.

It is well-known that leaf response to cytokinin is age-dependent [13, 22, 26]. Cytokinins enhance sink activity of leaf cells, prevent leaf senescence and induce an activation of RNA synthesis in fully­expanded mature leaves, but do not exert these effects in young growing leaves [13,22,26]. For this reason, the second goal of our work was to elucidate whether such age-dependent response to cytokinin can be revealed in vitro in the system containing chromatin­bound RNA polymerase I isolated from leaves of various age. With this aim in view, chromatin was isolated from young (4-day-old) barley leaves, which are insensitive to cytokinin, and from 10013-day-old mature leaves possessing high sensitivity to this phyto­hormone, and response of chromatin-bound RNA polymerase I to ZBP in concert with trans-zeatin was studied.

The third aim of our work was to test species­specificity of functional activity of ZBPs. For this pur­pose, ZBP was isolated from shoots of etiolated maize seedlings, and its capacity to regulate RNA synthesis in the system containing chromatin-bound RNA poly­merase I from barley leaves was studied.

Materials and methods

Plant material

Barley plants (Hordeum vulgare L. cv. Viner) were grown in boxes with soil in growth chambers under conditions described elsewhere [14]. Fully-expanded first leaves of 1 O-13-day-old plants were used for ZBP isolation. Maize seedlings (Zea mays L. cv. Elbrus) were grown in darkness on moist filter paper at the constant temperature of 25 0 C and relative humidity of 95%. Shoots were detached from 5-day-old etiolated seedlings and used for ZBP isolation.

Preparation of affinity matrices

Zeatin riboside-Sepharose (ZR-Sepharose) was pre­pared by immobilization of trans-zeatin riboside to AH-Sepharose 4B according to [21]. Zeatin-Sepharose (Z-Sepharose) and adenine-Sepharose were obtained by immobilization of trans-zeatin or adenine, respec­tively, to epoxy-activated Sepharose 6B as described in [20]. Adenosine-Toyopearl (Ado-T) and trans-zeatin riboside-Toyopearl (ZR-T) were prepared by immo­bilization of adenosine or trans-zeatin riboside to aminopropyl-Toyopearl-65 as described in [9]. Before immobilization trans-zeatin riboside and adenosine were oxidized according to [4].

Antibodies against zeatin (Abz) were isolated from antiserum raised against zeatin by chromatography on ZR-Sepharose. Abz were immobilized to CNBr­activated Sepharose 4B. Abz-Sepharose was used for isolation of anti-idiotype antibodies (Aba-i) by immunoaffinity chromatography. Aba-i were isolated from either antiserum raised against zeatin after an extended period of rabbit immunization or antiserum raised against monospecific antibodies to zeatin.

ZBP isolation

All procedures of ZBPs isolation were carried out at 2-4 0 C. Barley leaves Here homogenized in 3-4 volumes of buffer A (20 mM Tris-HCI, pH 7.7; 10 mM MgCI2;

250 mM sucrose; and 5 mM 2-mercaptoethanol). To remove low molecular substances the supernatant (160000 x g, 2 h) was passed through a Sephadex G-50 column (bufferB: 20 mMTris-HCI, pH 7.7; IOmM MgCh; 0.5 M NaCl; and 5 mM 2-mercaptoethanol) followed by hydrophobic chromatography on phenyl­Sepharose. ZBP was identified at all steps of isolation by its interaction with Aba-i in direct ELISA. Phenyl-

69

Supernatant (160,000 g, 2 h)

I Sephadex G-50

I Phenyl-Sepharose

I t-H20

trans-Zeatin­Sepharose

1 M NaCl

ZBP

trans-Zeatin riboside­Sepharose

0.25 M NaOH

SDS-PAGE Non-denaturing Sup erose 12 1

Competitive

-I Reaction with

Ab a-i in EUSA

Activation of RNA synthesis in vitro

PAGE [ 3H]Zeatin

binding

Fig. 1. The scheme of ZBP isolation from barley leaf cytosol and its analysis in different systems.

Sepharose colunm was washed with 20 mM Tris-HCI buffer, pH 7.7. Proteins were eluted with distilled water. Further purification of ZBP was carried out by affinity chromatography. Two types of affinity sorbents were used: ZR -Sepharose or Z-Sepharose. The protein fraction was applied to affinity matrices in 20 mM Tris-HCI buffer, pH 7.7, with 20 mM NaCl. ZBP was eluted from ZR-Sepharose with 0.2 N NaOH and from Z-Sepharose with 1 M NaCI in 50 mM Tris-HCI buffer, pH 8.9. The protein isolated by both affinity sorbents was dialyzed against 20 mM Tris-HCI buffer, pH 7.7, and used for analysis.

ZBP isolation from etiolated maize shoots was carried out at 2-4 0 C. The shoots were homogenized in 3-4 volumes of buffer C (25 mM Tris-acetate, pH 8.0; 50 mM NaCl; 2 mM MgCh; and 2 mM EDTA). Homogenate was centrifuged (4500 x g, 15 min), then ammonium sulfate (AS) was added to the supernatant (35% of saturation) followed by centrifugation at 8000 x g for 20 min. Then the supernatant was used for protein purification by hydrophobic chromatography

on Toyopearl HW60. Proteins were eluted from the colunm with reverse linear gradient of AS (35%-0% of saturation) in buffer C. The ZBP-containing fraction (eluted with 7.5-10% of AS saturation) was desalted on a Sephadex G-25 colunm. To remove adenine-binding proteins the sample was chromatographed on Ado-T colunm. Then ZBP was isolated by affinity chromatog­raphy on ZR-T. ZBP was eluted from this matrix with 25 mM NaOH, neutralized and concentrated in an Amicon cell using YM 1 0 membranes. At all steps of isolation ZBPs were identified by their capacity to bind [3H]dihydrozeatin.

ZBP analysis

Polypeptide composition of proteins was studied by SDS-PAGE electrophoresis according to Laemmli [17]. The same system without SDS was used for non­denaturing PAGE of ZBP. The gels were stained as described earlier [14].

70

1 kD 2 kD

94 669

- 67 - 440

- 232

-43 - 140

- 94 -30

-67

-43 - 20.1

-30

- 14.4

Fig. 2. Electrophoresis of ZBP isolated from barley leaf cytosol and purified on Z-Sepharose. 1 - SDS-PAGE (10%), 2 - non-denaturing PAGE (4--20%). Gels were stained with Coomassie Brilliant Blue R-2S0. Numbers indicate molecular weights of protein markers (kD).

OD 492 1.0

0.5

m - prelmmune serum

o -Abo_I

~ - Ab Z

Fig. 3. Interaction of Aba-i from antiserum raised against zeatin with barley leaf cytosol proteins isolated on ZR-Sepharose (A), Z-Sepharose (B) and adenin-Sepharose (C). Data obtained in direct ELISA.

The interaction of leaf proteins with Aba-i from antiserum raised against zeatin was studied by direct ELISA. The proteins to be tested were immobilized on rnicrotitration plate followed by Aba-i treatment. Aba-i associated with immobilized proteins were esti­mated by second anti-rabbit antibodies labelled with horseradish peroxidase and a-phenylenediamine was used as a chromogen. The reaction was recorded at 492 nm [14].

The effects of ZBP and cytokinins on the transcrip­tion in vitro was studied in two different systems: (i) in the system containing RNA polymerase I associ­ated with chromatin from barley leaves [27] and (ii) in isolated nuclei from barley leaves under conditions optimized for RNA polymerase I or RNA polymerase II [16]. Chromatin was isolated from barley leaves as described previously [27]. Nuclei were isolated from barley leaves according to the procedure described in [8].

Dpm bound

600 -

300 -

o 1 2 3

Fig. 4. [3Hjtrans-Zeatin binding to ZBP from barley leaf cytosol isolated with ZR-Sepharose. [3Hjtrans-Zeatin binding assay was performed in 200 ttl of incubation medium containing 50 rnM Tris-HCl (pH 7.9), 10 rnM 2-mercaptoethanol, 10 rnM MgClz, ZBP (3 ttg), and 5.6 x 10-9 M [3Hjtrans-zeatin . Ovalbumin (30 ttg) was added as a protein-carrier in the assay mixture. For competition assay 5 x 10-7 M cold trans-zeatin was used. I - ZBP, ovalbumin, eHjtrans-zeatin; 2 - ZBP, ovalbumin, eHjtrans-zeatin, nonlabeled trans-zeatin; 3 - ovalbumin, [3Hj-trans-zeatin.

0.5 ;-;--- ;---

0.4 r-

~ 0.3 r-en ..... .----

C 0

0.2 r-.---

0.1 -

0 2 3 4

Fig. 5. Competitive inhibition of Abz interaction with immobi­lized trans-zeatin in competitive ELISA by barley leaf proteins. Control test without protein addition (I); proteins obtained with adenine-Sepharose (2); ZBP obtained with ZR-Sepharose (3 and 4): 0.\ ttg (3) and 0.2 ttg (4).

71

Cytokinin-binding properties of isolated proteins were tested by two different procedures. (i) By their ability to displace Abz from its complex with immobilized trans-zeatin in competitive ELISA of cytokinin determination [14]. Abz associated with immobilized zeatin were estimated by second anti­rabbit peroxidase-labelled antibodies [14]. (ii) By protein ability to bind reversibly [3H]trans-zeatin or [3H]dihydrozeatin. For this purpose, ammonium sulfate precipitation assay was used [10]. [3H]trans­Zeatin (sp. act. 95 GBq/mmol) and [3H]dihydrozeatin (sp. act. 92 GBq/mmol) were synthesized in the Institute of Nuclear Biology and Radiochemistry (Czech Republic). Protein concentration was deter­mined according to Bradford [3].

Results and discussion

ZBP was isolated from cytosol (160000 x g, 2 h) of 1O-day-old barley leaves which are very sensitive to cytokinins. The scheme of isolation is presented in Fig. 1. It included ZBP purification by affinity chromatography on Z-Sepharose or ZR-Sepharose. ZBP was detected at all steps of purification by its interaction with Aba-i from antiserum raised against zeatin. These Aba_ i are considered as poten­tial antibodies against ZBP. ZBP-Aba-i interaction was tested in direct ELISA. The major fraction con­taining protein(s) interacting with Aba-i was eluted from Phenyl-Sepharose with distilled water. This frac­tion was subjected to affinity chromatography on ZR­Sepharose or Z-Sepharose. ZBP could be eluted from ZR-Sepharose only with 0.2 M NaOH. ZBP elution from Z-Sepharose was performed with 1 M NaCI.

Non-denaturing PAGE of the protein isolated by both affinity matrices revealed a single polypeptide with molecular weight of 67 ± 2 kD (Fig. 2). Gel filtra­tion on Superose 12 confirmed that molecular weight of ZBP is 67 ± 2 kD (data not shown) .

SDS-PAGE analysis of protein fraction eluted from both affinity matrices demonstrated two polypeptides with mol wts of 67 ± 2 kD and 64 ± 2 kD (Fig. 2).

67 ± 2 kD protein isolated by affinity chroma­tography on Z-Sepharose or ZR-Sepharose interacted with Aba_i in direct ELISA (Fig. 3). ZBP did not react with pre-immune serum and with Abz used as a con­trol test for non-specific binding. The protein isolated from barley leaf cytosol with adenine-Sepharose did not interact with Aba-i. These results showed that the protein isolated by both affinity matrices was specif-

72

Table 1. Effect of trans-zeatin and ZBP isolated from 4- or 10-day-old barley leaves on RNA synthesis in vitro in the system containing chromatin from 4- or 10-day-old barley leaves

Barley leaf trans-Zeatin, 1O-7M eRJAMP incorporation into

age,days Chromatin ZBP RNA, cpm per 50 J.Lg DNA

10 ll173 ±916

+ 8649 ± 323

+ 8846 ± 1002

+ + 36928 ± 2534

4 38100 ± 2000

+ 29961 ± 2107

+ 33942 ± 1361

+ + 29529 ± 3364

Table 2. Effect ofZBP and trans-zeatin on RNA synthesis in nuclei isolated from 10-day-old barley leaves under conditions optimized for RNA polymerase I

ZBP

+ +

I 2

--

trans-zeatin, 10-7 M

+ + +

94 68

43

- 20

a-arnanitin,

4J.LgmI- 1

+

+

Fig. 6. SDS-PAGE (7-12%) of ZBP isolated from etiolated maize shoots with trans-zeatin riboside-Toyopearl column. 1 - 5 J.Lg ZBP; 2 - standard proteins. The numbers indicate mol wts of the protein standards, kD. The gel was stained with Coomassie Brilliant Blue R-250.

ically recognized by anti-idiotype antibodies against zeatin. The data obtained give support to the conclusion that 67 ± 2 kD protein has zeatin-binding site(s).

[a_33PJAMP incorporation into

RNA, cpm per 20 J.Lg DNA

5236 ± 121

6597 ± 994

4597 ± 870

17590 ±525

14929 ± 2574

This conclusion was supported by eH]trans­zeatin-binding assay of the protein. The results of a representative experiment are shown in Fig. 4. The data demonstrate that 67 ±2 kD protein bound labeled zeatin from its solution (5.6 x 10-9 M). Unlabelled trans­zeatin (5 x 10-7 M) displaced [3H]zeatin from its com­plex with ZBP resulting in the radioactivity decrease to the level of non-specific label adsorption by oval­bumin added into the test mixture as a protein-carrier. Hence, trans-zeatin binding to ZBP was reversible and specific. High level of non-specific binding seems to be the result of the ovalbuminlZBP proportion (10: 1) in the assay.

Data obtained in [3H]zeatin binding test agree well with the results of the protein analysis in competitive ELISA (Fig. 5). In this test, the protein displaced Abz from their complex with immobilized trans-zeatin, the displacement being dependent on protein amount added. The protein fraction from adenine-Sepharose (control protein fraction) did not possess such proper­ties. Hence, zeatin-binding ability of 67 ± 2 kD protein was proved in two independent assays.

Dpm bound

2000 r---------------.

1000

o 1 2 3

Fig. 7. [3HjDihydrozeatin binding with ZBP(s) purified with ZR-T from etiolated maize shoots. 1-ZBP, ovalbumin, [3Hjdihydrozeatin; 2 - ZBP, ovalbumin, eHjdihydrozeatin, unlabeled isopenteny­ladenin; 3 - ovalbumin, eHjdihydrozeatin. eHjdihydrozeatin binding assay was perfonned in 200 III volume of incubation medium containing 20 Ilg ofZBP and 10-9 M [3 Hjdihydrozeatin. Ovalbumin (40 Ilg) was added as a protein-carrier in the assay mixture. For c:Jm­petition assay 5 x 10-7 M cold isopentenyladeninewas used.

The involvement of 67 ± 2 kD ZBP in trans-zeatin­dependent activation of RNA-synthesis in vitro was examined in three different systems: (i) chromatin­associated RNA polymerase I from lO-day-old barley leaves, (ii) chromatin-associated RNA polymerase I from 4-day-old barley leaves, and (iii) nuclei isolated from lO-day-old barley leaves.

The transcription elongation in the system contain­ing chromatin-bound RNA polymerase I from mature lO-day-old barley leaves was stimulated by ZBP in the presence of trans-zeatin (Table 1). Being added alone, ZBP or zeatin had no activity in the system. This stimulation was almost insensitive to a-amanitin (data not shown). Activation of RNA synthesis depended strictly on trans-zeatin concentration in the incubation medium with the optimum concentration of 10-8 M [15]. cis-Zeatin did not enhance RNA synthesis [15]. This fact proves the high specificity of trans-zeatin action.

300

~ o ~ 200 .~ --> (,)

<

100 - 00

73

-8 .... 7 - 6

Fig. 8. trans-Zeatin- and maize ZBP-dependent activation of RNA synthesis in vitro in the system containing chromatin-bound RNA polymerase I from barley leaves. Maize ZBP was isolated as described in Material and methods.

In the system containing chromatin-bound RNA polymerase from growing 4-day-old barley leaves, ZBP and trans-zeatin did not activate RNA synthesis (Table 1).

As was mentioned above, leaf response to exoge­nous cytokinins is age-dependent. Originally it was shown in the experiments with Nicotiana rustica L. leaves. [22]. Only fully-expanded mature leaves were sensitive to kinetin. Young leaves had no response to kinetin. In our previous work strong age-dependence was documented for BA-induced activation of RNA synthesis in barley leaves [13,26]. RNA synthesis was insensitive to BA in young growing (4-day-old) and old senescent (l5-day-old) barley leaves, but BA activated dramatically RNA synthesis in fully-expanded mature 8-IO-day-old leaves. The data presented in Table 1 show that in vitro chromatin response to ZBP and trans-zeatin also is age-dependent. We do not know yet why chromatin from young leaves has no response to ZBP and trans-zeatin. Three explanations are pos­sible: (i) the system is saturated with endogenous ZBP in complex with trans-zeatin and insensitive to addi­tional amount of the hormone-receptor complex; (ii) age-dependent changes of chromatin or (and) RNA polymerase are responsible for different sensitivity of the system to ZBP and trans-zeatin, (iii) age-dependent changes of ZBP are responsible for this difference.

74

Further investigations are necessary to verify what suggestion is true. But it is necessary to stress that typical age-dependent leaf response to cytokinin was reproduced in vitro in the system of RNA synthesis containing chromatin isolated from the leaves of differ­ent age.

ZBP and trans-zeatin effect was also studied in the system containing nuclei isolated from 10-day-old barley leaves. In the presence of trans-zeatin, ZBP was shown to activate RNA synthesis in this system optimized for RNA polymerase I (Table 2). Experi­ments with o:-amanitin inhibiting RNA polymerase II confirmed ZBP and trans-zeatin stimulation of RNA synthesis directed by RNA polymerase I in isolated nuclei. The same activation was also detected in our experiments with RNA synthesis in isolated nuclei under the conditions optimized for RNA polymerase II [15]. Hence, in concert with trans-zeatin ZBP activated both RNA polymerase I and RNA polymerase II directed RNA synthesis. As it was demonstrated in special experiments (data not shown), in both cases RNA synthesis is the result of transcription elongation. In concert with trans-zeatin, ZBP activated the tran­scription elongation under conditions optimized for RNA polymerase I as well for RNA polymerase II. In the context of these results, it is necessary to emphasize that recently in animal systems, the activation of tran­scription elongation was shown to be a very important mechanism for regulation of gene expression [11, 12, 28]. Many transfactors are involved in this regulation. It can be assumed that 67 ± 2 kD zeatin-binding pro­tein is a cytokinin receptor participating in cytokinin­dependent regulation of gene expression as a special transfactor in leaf cells.

The next task of our work was to study whether it is possible to find ZBP with the similar proper­ties in other plant species and in the plant tissues differing from mature leaves. For this purpose, the shoots of 5-day-old etiolated maize seedlings were chosen. Two types of affinity sorbents were used for ZBP isolation from cytosol of etiolated maize shoots. Adenine-binding proteins were removed by Ado-T from the protein fraction preliminary purified by chromatography on Toyopearl HW60. After that, the affinity chromatography on ZR-T was used for ZBP isolation. Polypeptide composition of the pro­tein isolated from cytosol of etiolated maize shoots withZR-T is shown in Fig. 6. SDS-PAGE revealed the major polypeptide with the molecular weight of70 kD. Additional polypeptide with lower molecular weight (66 kD) also was identified. The 70-kD polypeptide

is very unstable. Its partial destruction was observed during storage that led to the formation of the poly­peptides with lower molecular weights. It cannot be also excluded that 66-kD polypeptide is a product of partial 70-kD protein degradation. This problem needs a special clarification, the polypeptide sequenc­ing being especially useful for this purpose.

Protein(s) isolated from cytosol of etiolated maize shoots by the affinity matrix ZR-T was recognized by Aba-i from antiserum raised against zeatin in direct ELISA. The protein absorbed on immunotitration plate bond Aba_ i which were revealed by second anti-rabbit antibodies labelled with horseradish peroxidase (data not shown). These results give a support to consider the protein as ZBP.

This conclusion was confirmed by cytokinin­binding assay (Fig. 7). The protein(s) from etiolated maize shoot cytosol was tested for its ability to bind specifically [3H]dihydrozeatin. The unspecific bind­ing in the presence of a 100-fold excess of nonlabelled isopentenyladenine (10- 7 M) was 5--6 times lower than the specific binding. As Fig. 7 shows, this nonspecific binding was mainly a result of label absorption by ovalbumin added to the test-system as a carrier for pro­tein precipitation with ammonium sulfate. Hence, the [3H]dihydrozeatin-binding to 70-kD protein isolated by RZ-T actually was specific and this protein belongs to ZBP-family.

We also tested the ability of 70-kD protein from cytosol of etiolated maize shoots to activate RNA synthesis in vitro in the system containing chromatin­bound RNA polymerase I isolated from barley leaves (Fig. 8). In the presence of trans-zeatin, ZBP from maize enhanced significantly RNA synthesis in the heterological system containing chromatin-bound RNA polymerase I from barley leaves. This activa­tion depended on trans-zeatin and was revealed at 10- 8 M trans-zeatin concentration in the medium. The high level of activation was observed in the range of cytokinin concentration from 10-8 M up to 10-6 M. ZBP alone and trans-zeatin alone were not active. From these data the conclusion can be drown that the transcription elongation system containing chromatin and RNA polymerase I from barley leaves can recog­nize ZBP from maize shoots and respond to ZBP in concert with trans-zeatin by transcription activation. Hence, ZBP from barley and maize plants have similar functional properties and are not species-specific. It is important to study this problem on greater number of plant species.

The comparison of ZBPs isolated from barley leaves and maize etiolated shoots gave the possibility to conclude that new family of zeatin-binding proteins is discovered. These proteins possess the properties of trans-zeatin receptors mediating cytokinin-dependent regulation of transcription elongation in plant cells. Further investigations are necessary to elucidate the relationship of this protein family participating in cytokinin regulation of transcription with other zeatin­binding proteins which were earlier isolated from barley leaves [25] and maize etiolated shoots [24], but whose functions are not known yet.

Acknowledgements

This work was supported by Grant of INTAS-93-0678, by Russian Foundation for Fundamental Research, Grant No. 93-04-6881 and by International Science Foundation, Grant No. MDJOOO.

References

I. Brinegar AC (1994) Cytokinin-binding proteins and receptors. In: Mok D and Mok M (eds) Cytokinins: Chemistry, Activity and Function, pp 217-232. Boca Raton: CRC Press

2. Brinegar AC, Stevens A and Fox JE (1985) Biosynthesis and degradation of a wheat embryo cytokinin-binding pro­tein during embryogenesis and germination. Plant Physiol 79: 706-710

3. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254

4. Erlander BF and Beiser SM (1964) Antibodies specific for DNA and their reaction with DNA. Proc Natl Acad Sci 52: 68-74

5. Fedina AB, Burkhanova EA and Kharchenko VI (1987) Func­tional activity of cytokinin-binding nuclear proteins from barley leaf protoplasts. Soviet Plant Physiol 34: 324-328

6. Fox JE (1992) Molecular modeling of cytokinins and the CBF-I receptor. In: Kaminek M, Mok DWS and Zazimalova E (eds) Physiology and Biochemistry of Cytokinins in Plants, pp 127-132. The Hague, SPB Academic Publishing

7. Fox JE and GregersonE (1982) Variation in a cytokinin bind­ing protein among several cereal crop plants. In: Wareing PF (ed) Plant Growth Substances, pp 207-214. Academic Press, London

8. Hamilton RH, Kunsch U and Temperli A (1972) Simple rapid procedures for isolation of tobacco leaf nuclei. Anal Biochem 49:48-57

9. Isamu MYI and Nobuko S (1982) Preparation of affinity adsor­bent with toyopearl gels. J Chromatography 239: 747-754

10. Jayabakaran Ch (1990) Isolation and characterization of a cytokinin-binding protein from cucumber cotyledons. Plant Growth Regulation 9: 9-17

75

II. Jones KJ and Peterlin BM (1994) Control of RNA initiation and elongation at the mV-I promoter. Annu Rev Biochem 63: 717-743

12. Kane CM (1994) Transcript elongation and gene regulation in eukaryotes. In: Conaway RC and Conaway JW (eds) Transcrip­tion: Mechanisms and Regulation, pp 279-296. New York, Raven Press

13. Kulaeva ON (1979) Cytokinin Action on Enzyme Activities in Plants. In: Skoog F (ed) Plant Growth Substances 1979, pp 119-128. Berlin, Springer-Verlag

14. Kulaeva ON, Karavaiko NN, Moshkov IE, Selivankina SYu and Novikova GV (1990) Isolation of a protein with cytokinin­receptor properties by means of anti-idiotype antibodies.FEBS Lett 261: 410-412

15. Kulaeva ON, Karavaiko NN, Selivankina SYu, Moshkov IE, NovikovaGV, Zemlyachenko Ya V, Shipilova SV and Orudgev EM (1996) Cytokinin signalling systems: from a whole plant to the molecular level. Ibid

16. Kulaeva ON, Selivankina SYu, Romanko EG, Nikolaeva MK and Nichiporovich AA (1979) Cytokinin activation of RNA polymerase activity in isolated nuclei and chloroplasts. Soviet Plant Physiol26: 1016-1028

17. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685

18. Letham" DS and Palni LMS (1983) The biosynthesis and metabolism of cytokinins. Annu Rev Plant Physiol 34: 163-197

19. Mitsui S and Sugiura M (1993) Purification and properties of cytokinin-binding proteins from tobacco leaves. Plant Cell Physiol 34: 543-547

20. Momotani E and Tsuji H (1992) Isolation and characterization of a cytokinin-binding protein from the water-soluble fraction oftobacco leaves. Plant Cell Physiol33: 407-412

21. Moore III PH (1979) A cytokinin-binding protein from wheat germ. Isolation by affinity chromatography and properties. Plant Physiol64: 594-599

22. Mothes K, Engelbrecht Land Kulajewa 0 (1959) Dber die Wirkung des Kinetins auf Stickstofferteilung und Eiweissyn­these in Isolierten Bllittem. Flora A 147: 445-464

23. Romanko EG, Selivankina SYu, Ovcharov AK and Kulaeva ON (1980) Activation of RNA synthesis in vitro by cytokinin­receptor complex from barley leaves. Doklady Acad Nauk SSSR 255: 1009-1011

24. Romanov GA (1992) The current status of major cytokinin­binding proteins from cereal plants (Personal insight). In: Kaminek M, Mok DWS and Zazimalova E (eds) Physiology and Biochemistry of Cytokinins in Plants, pp 218-227. The Hague, SPB Academic Publishing

25. Romanov GA, Taran VYa, Khvojka Land Kulaeva ON (1988) Receptor-like cytokinin-bindingprotein(s) from barley leaves. J Plant Growth Regul 7: 1-17

26. Selivankina SYu, Romanko EG, Kuroedov VA and Kulaeva ON (1979) Activation of chromatin-bound RNA polymerase by cytokinin addition during chromatin isolation. Soviet Plant Physiol26: 41-47

27. Selivankina SYu, Romanko EG, Ovcharov AK, Kharchenko VI (1982) Involvement of cytokinin-binding proteins from barley leaves in cytokinin activation of chromatin-bound RNA polymerase. Soviet Plant Physiol29: 274-281

28. Yankulov K, Blau J, Purton T, Roberts S and Bentley DL (1994) Transcriptional elongation by RNA polymerase II is stimulated by transactivators. Cell 77: 749-759

A. R. Smith et al. (eds.). Plant Hormone Signal Perception and Transduction. 77-8l. © 1996 Kluwer Academic Publishers.

77

A cytokinin-binding protein complex from tobacco leaves The 57 kDa subunit has high homology to S-adenosyl-L-homocysteine hydrolase

Shinichi Mitsui, Tatsuya Wakasugi & Masahiro Sugiura Center for Gene Research. Nagoya University, Nagoya 464-01, Japan

Key words: cytokinin, cytokinin-binding protein, S-adenosyl-L-homocysteine hydrolase, tobacco (Nicotiana sylvestris)

Abstract

A cytokinin binding protein complex (CBPI30) has been purified from tobacco leaves (Nicotiana sylvestris). It contains two protein species of 57 and 36 kDa (CBP57 and CBP36). The cDNAs encoding CBP57 have been isolated from a tobacco cDNA library. Their predicted amino acid sequences showed significant homology between CBP57 and S-adenosyl-L-homocysteine (SAH) hydrolase, which catalyzes the reversible hydrolysis of SAH, a methyltransferase inhibitor. A combination of gel filtration and western blot analysis revealed that both CBP57 and benzyl adenine (BA)-binding activity were eluted at a peak of 130 kDa. A purified CBP130 fraction contains SAH hydrolase activity. We discuss possible CBP57 as a cytokinin receptor subunit and its possible role as a regulator of methylation.

Introduction

Cytokinin is a phytohormone known to enhance cell division, to retard senescence and to regulate other growth processes in various plant tissues [9,12]. Appli­cation of cytokinin usually enhances protein and RNA synthesis [1, 6, 8, 13, 14, 20, 26, 39, 41], but the molecular mechanism of cytokinin action is still unclear. Identification of cytokinin receptors is essen­tial to understand the signal transduction pathway of cytokinin in higher plants.

Cytokinin-binding proteins have been isolated from a variety of plants [7, 15, 16, 19, 24, 25, 30, 32, 40], however, no information on the structure of these proteins is currently available. A partial amino acid sequence of the cytokinin-binding domain of CBF-1 has been reported [5]. CBF-1 is a cytokinin sequester protein in wheat seeds. Previously we reported a 130 kDa cytokinin-binding protein complex (CBP130) from tobacco leaves [21]. CBP130 consists of at least two subunits of 57 and 36 kDa (CBP57 and CBP36). The structure and expression of cDNAs encoding

CBP57 have been studied and CBP57 was found to share extensive sequence homology with SAH hydro­lase from other organisms [22].

Materials and methods

Cytokinin-binding-assay. Cytokinin binding activity was measured using [14C-]benzyladenine (BA) by gel filtration as previously described [21].

Enzyme assay. The synthase activity of SAH hydro­lase was assayed since monitoring SAH formation is easier than its hydrolysis. The method of Poulton and Butt [31] was modified. A reaction mixture (50 J.LI) containing 50 mM Tris·CI (pH 8.5), 1 mM DTT, 10 mMDL-homocysteine, 50 J.LM [8_ 14C] adenosine (1.85 MBq/mmol) and a protein fraction was incubated at 37°C for 30 min. After adding 10 J.LI of 50% TCA followed by incubation on ice for 30 min, the mixture was centrifuged 13,000 x g for 15 min. Five J.LI aliquots of the supernatant were applied onto a cellulose thin

78

d c 0 0 c 'a; -0 ... Il.

t 0.2

0.1

0 0 10 20 30 40 50

Fraction Number

E Q. (.) ->--:~ -(.) « C) c ,., c m

SOO,S

o

c :;: o ->-o m

Fraction Number

20 , . . , 25 . . 30

Fig. 1. Elution profile of CBP57 and BA-binding. 200 III of CBP130 fraction supplemented with soybean trypsin inhibitor was applied to Superose 12 HR. Fractions were collected 0.6 ml each and analysed by binding assay (upper part), and by western blot analysis (lower part). Upper part; closed circle; protein concentration, shadow; BA-binding activity. Lower part; western blot analysis of the Superose fractions. CBP57 blotted to a membrane filter was detected by anti-CBP57 serum.

layer precoated on plastic sheet. The chromatogram was developed in acetone/water (5/2 v/v) and SAH was visualized under ultraviolet light. The radioactivity of the spot was measured by liquid scintillation counter. Protein was quantified by the method of Bradford [4] using BSA as a standard.

Western blot analysis - Western blot analysis was carried out as previously described [22].

Results

Correlation between CBP57 and BA-binding activity

To analyse the relationship between CBP57 and BA­binding activity, BA-binding assay and western blot analysis were carried out. The combination of gel filtra-

Table 1. SAH hydrolase activity in CBPI30 fraction (Fraction numbers correspond to those in Figure I.)

Fraction no. 21 30

Protein concentration 0.09 0.6

(mg/ml)

Cytokinin binding activity 12962 444

(cpmlmg protein)

SAH hydrolase activity 29874 48

(x 103 cpmlmg protein)

tion and western blot analysis (Fig. 1) showed that both CBP57 and BA-binding activity were eluted at a peak of 130 kDa (fractions 20-24), supporting the hypothesis that CBP57 is a component ofCBPl30 and has cytokinin binding activity.

79

Cytokinins

Alteration of SAH/SAM ratio

Regulation of methylation/demethylation

/~ Chloroplast

Regulation of chlorophyll synthesis and gene expression in chloroplasts

Nuclear

Regulation of gene expression

Fig. 2. A hypothesis for the function ofCBP130.

SAH hydrolase activity in CBP 130 fraction

The sequence analysis revealed that CBP57 was highly homologous to SAH hydrolase [22]. CBP57 has two conserved active cysteines and a dinucleotide binding site, whereas it has a characteristic 41 amino acids insertion of plants. The SAH hydrolase activity in the fraction of CBP130 has been assayed. Table 1 shows SAH hydrolase activity both in a fraction containing CBP130 and in a peak fraction of protein concentra­tion. This result indicated that purified CBP130 was indeed functional as a SAH hydrolase. Compared to the mammalian enzymes (about 47 kDa), CBP57 has a larger molecular weight because of the insertion of

41 amino acids. Similar insertions are found in SAH hydrolase from other plant species, suggesting that this insertion might be connected with cytokinin action.

Discussion

SAH hydrolase is a major adenosine and cAMP­binding protein in mouse liver, human lymphoblasts and human placenta [17, 33]. Incubation of SAH hydrolase from slime mold with cAMP or 2'­deoxyadenosine [18] or incubation of the rat enzyme with ATP [10] results in inhibition of the enzyme activity. Therefore, some adenine analogues are

80

thought to regulate SAH hydrolase actIvIty [27]. CBP 130 is a major cytokinin-binding entity in tobacco leaves. The BA-binding activity was inhibited by A1P and cAMP. These observations suggest that adenine analogues such as cytokinins may also modulate SAH hydrolase activity in plants.

SAH hydrolase catalyses reversible cleavage of SAH into adenosine and homocysteine [11]. SAH is one of the products of methyl-transfer reactions from S-adenosyl-L-methionine (SAM) and is a competitive inhibitor of all SAM-dependent methyl-transfer reac­tions. DNA and protein methylation is a widespread. modification event in all organisms. Several lines of evidence that DNA methylation regulates gene expres­sion and replication have been reported [3, 23,28,35, 37, 42]. Protein methylation has also been reported to control signal transduction in various organisms [2, 29].

In Rhodobacter, the involvement of SAH hydrolase in bacteriochlorophyll biosynthesis has been reported [36]. It is suggested that SAH hydrolase affects bacteriochlorophyll biosynthesis via the intracellular SAM/SAH ratio. Cytokinins have been known to modulate chlorophyll biosynthesis [9, 34, 38]. There­fore, cytokinins may regulate chlorophyll biosynthesis by altering the intracellular SAM/SAH ratio.

From these observations, we proposed a hypothe­sis that one of the functions of cytokinin is to control methylationldemethylation by regulating the intracel­lular SAM/SAH ratio via SAH hydrolase in CBP130 (Fig. 2).

References

I. Abdelghani MO, Suty L, Chen IN, Renaudlin J-P and Teyssendier de la Serve B (1991) Cytokinins modulate the steady-state levels of light-dependent and light-independent proteins and mRNA in tobacco cell suspensions. Plant Sci 77: 29-40

2. Alam M, Lebert M, Oesterhelt D and Hazelbauer GL (1989) Methyl-accepting taxis proteins in Halobacterium halobium. EMBO J 8: 631-639

3. Boye E and L0bner-Olesen A (1990) The role of dam methyl­transferase in the control of DNA replication in E. coli. Cell 62:981-989

4. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254

5. Brinegar AC, Cooper G, Stevens A, Hauer CR, Shabanowitz J, Hunt DF and Fox JE (1988) Characterization of a benzyl­adenine binding-site peptide isolated from a wheat cytokinin­binding protein: sequence analysis and identification of a single affinity-labelled histidine residue by mass spectrometry. Proc Natl Acad Sci USA 85: 5927-5931

6. Chen C-M (1989) Cytokinin-modulated macromolecular synthesis and gene expression. In: Kung SD and Arntzen 0 (eds) Plant Biotechnology, pp 245-256. Boston: Butterworths

7. Chen C-M, Melitz DK, Petschow B and Eckert RL (1980) Isolation of cytokinin-binding protein from plant tissues by affinity chromatography. Eur J Biochem 108: 379-387

8. Crowell DN, Kadlecek AT, John MC and Amasino RM (1990) Cytokinin-induced mRNAs in cultured soybean cells. Proc Natl Acad Sci USA 87;.8815-8819

9. Davies PJ (1987) The plant hormones: Their nature, occur­rence, and functions. In: Davies PJ (ed) Plant Hormones and their Role in Plant Growth and Development, pp 1-11. Dordrecht: Martinus Nijhoff

" 10. De la Haba G, Agostini S, Bozzi A, Merta A, Unson C and Cantoni G L (I986) S-adenosy Ihomocysteinase: Mechanism of reversible and irreversible inactivation by ATP, cAMP, and 2' -deoxyadenosine. Biochemistry 25: 8337-8342

11. De la Haba G and Cantoni GL (1959) The enzymatic synthesis of S-adenosyl-L-homocysteine from adenosine and homocys­teine. J Bioi Chern 234: 603-608

12. Evans ML (1984) Functions of hormones at the cellular level of organisation. In: Scott TK (ed) Encyclopedia of Plant Physiology, vol. 10, pp 23-79. Berlin: Springer-Verlag

13. Flores S and Tobin EM (1986) Benzyladenine modulation of the expression of two genes for nuclear-encoded chloroplast proteins in Lemna gibba: Apparent post-transcriptional regu­lation. Planta 168: 340-349

14. Flores S and Tobin EM (1988) Cytokinin modulationofLHCP mRNA levels: the involvement of post-transcriptional regula­tion. Plant Mol Bioi II: 409-415

15. Fox JE and Erion JL (1975) A cytokinin-binding protein from higher plant ribosomes. Biochem Biophys Res Comm 64: 694-700

16. Hamaguchi N. Iwamura H and Fujita T (1985) Fluorescent anticytokinins as a probe for binding: Isolation of cytokinin­binding proteins from the soluble fraction and identification of a cytokinin-binding site on ribosomes of tobacco callus cells. Eur J Biochem 153: 565-572

17. Hershfield MS and Kredich NM (1978) S-adenosylhomo­cysteine hydrolase is an adenosine-binding protein: A target for adenosine toxicity. Science 202: 757-760

18. Hohman RJ, Guitton MC and Veron M (1985) Inactivation of S-adenosyl-L-homocysteine hydrolase by cAMP results from dissociation of enzyme-bound NAD+. Proc Natl Acad Sci USA 82: 4578-4581

19. Kulaeva ON, Karavaiko NN, Moshkov IE, Selivankina SY and Novikova GV (I 990) Isolation of a protein with cytokinin­receptor properties by means of anti-idiotype antibodies. FEBS Lett 261: 410-412

20. Memelink J, Hoge mc and Schilperoort RA (1987) Cytokinin stress changes the developmental regulation of several defence-related genes in tobacco. EMBO J 6: 3579-3583

21. Mitsui S, Sugiura M (1993) Purification and properties of cytokinin-binding proteins from tobacco leaves. Plant Cell Physiol 34: 543-547

22. Mitsui S, Wakasugi T and Sugiura M (1993) A cDNA encod­ing the 57 kDa subunit of a cytokinin-binding protein complex from tobacco: the subunit has high homology to S-adenosyl­L-homocysteine hydrolase. Plant Cell Physiol 34: 1089-1096

23. Momotani E, Kinoshita I, Yokomura E and Tsuji H (1990) Rapid induction of synthesis and doubling of nuclear DNA by benzyladenine in intact bean leaves. Plant Cell Physiol31: 621-625

24. Momotani E and Tsuji H (1992) Isolation and characterization of a cytokinin-binding protein from the water-soluble fraction of tobacco leaves. Plant Cell Physiol 33: 407-412

25. Moore III FH (1979) A cytokinin-binding protein from wheat genn: Isolation by affinity chromatography and properties. Plant Physiol 64: 594-599

26. Naito K, Tsuji Hand Hatakeyama I (1978) Effect of benzyla­denine on DNA, RNA, protein and chlorophyll contents in intact bean leaves: Differential responses to benzyladenine according to leaf age. Physiol Plant 43: 367-371

27. Ogawa H, Gomi T, Mueckler MM, Fujioka M, Backlund Jr PS, Aksamit RR, Unson CG and Cantoni GL (1987) Amino acid sequence of S-adenosyl-L-homocysteine hydrolase from rat liver as derived from the cDNA sequence. Proc Nat! Acad Sci USA 84: 719-723

28. Paroush Z, Keshet I, Yisraeli J and Cedar H (1990) Dynamics of demethylation and activation of the Q-actin gene in myoblasts. Cell 63: 1229-1237

29. Perez-Sala D, Tan EW, Canada FJ and Rando RR (1991) Methylation and demethylation reactions of guanine nucleotide-binding proteins of retinal rod outer segments. Proc Natl Acad Sci USA 88: 3043-3046

30. Polya GM and Davis AW (1978) Properties of a high-affinity cytokinin-binding protein from wheat genn. Planta 139: 139-147

3l. Poulton JE and Butt VS (1976) Purification and properties of S-adenosyl-L-homocysteine hydrolase from leaves of spinach beet. Arch Biochem Biophys 172: 135-142

32. Romanov GA, Taran VY and Venis MA (1990) Cytokinin­binding protein from maize shoots. J Plant Physiol 136: 208-212

33. Saeb0 J and Ueland PM (1978) An adenosine 3'5'-monophos­phate adenosine-binding protein from mouse liver: Association with S-adenosylhomocysteinase activity. FEBS Lett 96: 125-128

81

34. Seyer P and Lescure AM (1984) Evidence for changes in plastid mRNA populations during cytokinin-induced chloro­plast differentiation in tobacco cell suspensions. Plant Sci Lett 36:59-66

35. Seyfert VL, McMahon SB, Glenn WE, Yellen AJ, Sukhatme VP, Cao X and Monroe JG (1990) Methylation of an immediate-early inducible gene as a mechanism for B cell tolerance induction. Science 250: 797-800

36. Sganga MW, Aksamit RR, Cantoni GL and Bauer CE (1992) Mutational and nucleotide sequence analysis of S-adenosyl-L­homocysteine hydrolase from Rhodobacter capsulatus. Proc Natl Acad Sci USA 89: 6328-6332

37. S0rensen MB (1992) Methy lation of B-hordein genes in barley endospenn is inversely correlated with gene activity and affected by the regulatory gene Lys3. Proc Nat! Acad Sci USA 89: 4119-4123

38. Sugiura M (1963) Promotion of chlorophyll synthesis by kinetin. Bot Mag Tokyo 76: 309-310

39. Sugiura M, Umemura K and Oota Y (1962) The effect of kinetin on protein level of tobacco leaf disks. Physiol Plant 15: 457-464

40. Takegami T and Yoshida K (1975) Isolation and purification of cytokinin binding protein from tobacco leaves by affinity column chromatography. Biochem Biophys Res Comm 67: 782-789

41. Teyssendierde la Serve B, Axelos M and Peaud-Leoel C (1985) Cytokinins modulate the expression of genes encoding the protein of the light-harvesting chlorophyll alb complex. Plant Mol Bioi 5: 155-163

42. Weber H, Ziechmann C and Graessmann A (1990) In vitro DNA methylation inhibits gene expression in transgenic tobacco. EMBO J 9: 4409-4415

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 83-88. ~ 1996 Kluwer Academic Publishers.

83

Photoaffinity labelling of a cytokinin-binding integral membrane protein in plant mitochondria

Chris Brinegar) , Gayatri Shah) & Geoffrey Cooper J Department of Biological Sciences, San Jose State University, San Jose, CA 95192, USA; 2Zeneca Agricultural Products, 1200 S. 47th St., Richmond, CA 94804, USA

Key words: alternative respiration, benzylaminopurine, cytokinin-binding, mitochondria, photoaffinity labelling

Abstract

Two target polypeptides were detected by photoaffinity labelling of purified mung bean mitochondria using tritiated 2-azido-N6 -benzy laminopurine. SDS-PAGE and fluorography of total mitochondrial proteins after the photoaffinity reaction showed a labelled 32 kDa polypeptide (intensely labelled) and a57 kDa polypeptide (less intensely labelled). The latter was assumed to be the 0: and/or j3 subunit of FJATPase since it was the most abundant polpeptide in gels stained with Coomassie Blue. Partial purification ofFJATPase demonstrated that the 32 kDa polypeptide was not a component of the ATPase complex. Fractionation experiments showed that the 32 kDa protein was integrally associated with mitochondrial membranes and could be emiched by simple washing and detergent extraction procedures.

Introduction

The alternative (cyanide-resistant) respiratory path­way in plant mitochondria is thought to branch off from the main electron transport chain at ubiquinone. When electron flow is diverted through the alterna­tive pathway, less ATP and more heat is generated [7]. An increase in alternative respiration has been detected during several physiological responses in plants, such as pollination and fruit ripening [7], seed germination [22], and thermogenesis [16]. Some cytokinins, especially 6-benzylaminopurine (BAP), are known inhibitors of alternative electron transport in isolated plant mitochondria [8, 19.,..21] and intact tis­sues [23,24].

Isolated mitochondria are reported to have a strong affinity for BAP [15]. Our laboratory has used 2-azido­N6-m-tritiobenzylaminopurine ([3H]-AzBAP) to pho­toaffinity label BAP-binding proteins in isolated mung bean hypocotyl mitochondria undergoing approxi­mately 20% alternative respiration [5]. Labelling specificity was low in that study, with at least five polypeptides reacting with the photoaffinity reagent. Recent modifications of labelling conditions, however,

have increased the specificity. In this report, we show that there are two primary mung bean mitochondrial targets of [3H]-AzBAP - one being the 0: and/or j3 sub­units of the F J ATPase and the other an unidentified 32 kDa integral membrane polypeptide.

Materials and methods

Plant material and isolation of mitochondria

Growth of etiolated mung beans (Phaseolus aureus) and Percoll purification of mitochondria were per­formed as described previously [5].

Photoaffinity labelling

[3H]-AzBAP (2.5 mM in methanol, 11.1 Ci mmol- J) was synthesized according to Cooper et at. [6]. Mito­chondria were suspended at a protein concentration of 0.1 mg ml- J in 0.5 M mannitol, 1 mM disodium ethylenediaminetetraacetic acid, 10 mM dipotassium hydrogen phosphate, 20 mM magnesium chloride, 10 mM dipotassium hydrogen phosphate, 20 mM HEPES,

84

pH 7.5 (suspension buffer). To aliquots of 0.5 ml, eH]­AzBAP was added dropwise with continuous swirling to a final concentration of 100 p,M. After incubation on ice for 5 min, samples were transferred to a 1 cm quartz cuvette placed 1 cm from an ultraviolet light source (Ultra-violet Products, Inc. San Gabriel, CA 500 /-LW cm -2 at 254 om) and irradiated for 5 min at room temperature. For low temperature labelling, 0.25 ml of suspended mitochondria were transferred (after the 5 min eH]-AzBAP incubation) to the wells of a 96-well microplate and placed on crushed dry ice (-70°C). Irradiation was for 5 or 15 min from 1 cm above the surface of the plate. Samples were analysed on 12.5% polyacrylamide gels by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) [17] followed by fluorography [25].

Partial purification ofF lATPase and the 32 kda protein

A fraction enriched in F 1 ATPase was prepared from purified mung bean hypocotyl mitochondria [13]. For enrichment of the 32 kDa protein, purified mitochon­dria were lysed osmotically by adding 15 ml of dis­tilled water to 0.25 ml of mitochondria in suspension buffer. After centrifuging at 27,000 x g for 30 min at 4°C, the supernatant was discarded and the pellet, containing mitochondrial membrane fragments, was suspended in 0.2 ml of 6M urea in 50 mM Tris-HCI, pH 7.6. The suspension was transferred to a 1.5 ml microcentrifuge tube and centrifuged at 10,000 x g for 5 min at room temperature. The pellet was washed twice more with the u~ea solution as above, and the final pellet was resuspended in 0.2 ml of 1.0% SDS in 50 mM Tris, pH 7.0. Insoluble material was removed by centrifugation and the supernatant (enriched in the 32 kDa polypeptide) was recovered.

An aJternative method involved resuspending the 27,000 x g mitochondrial membrane pellet in 1 mlof 250 mM Tris-HCI, pH 7.6 at room temperature and adding 0.25 ml of chloroform. After vigorous vortex­ing, the phases were separated by a brief centrifugation at 10,000 x g. The aqueous phase was discarded and the insoluble interface material was transferred to a clean microcentrifuge tube. An equal volume of 1.0% Triton X-100 in 50 mM Tris-HCI, pH 8.0 was added followed by vortexing and centrifugation at 10,000 x g for 10 min. The resulting supernatant was enriched in the 32 kDa polypeptide.

Results

Effects of reaction parameters on labelling specificity

Previous experiments using room temperature labelling showed linear incorporation of eH]-AzBAP into mitochondrial protein up to a concentration of lOO p,M and that the ultraviolet induced activation of the reagent was complete within 3-5 min of irradiation [2]. At 50 /-LM and 3 min irradiation five major polypeptides (33,34,45,57 and 70 kDa) and several minor polypep­tides were labelled [5]. In the present study using low temperature labelling, a more specific labelling pattern was observed (Fig. 1) The general labelling pattern was similar in samples that were irradiated at -70°C for 5 min (lane 1) or 15 min (lane 2). A major band at 32 kDa and a minor band at 57 kDa were most prominent in the fluorogram. However, the 32 kDa band in the 15 min sample was relatively more intense than in the 5 min sample. This 32 kDa polypeptide corresponds to the 33 kDa polypeptide in the previous study [5]. The minor band at 57kDa corresponds in size to the 0:

and f3 subunits of FlATPase (ATP synthase) of maize mitochondria [9].

Incorporation of eH]-AzBAP into mitochondrial protein increased by nearly 50% with the addition of 0.05% Triton X-lOO to the suspension buffer. Increas­ing the concentration beyond that resulted in a 65% decrease in incorporation compared to controls with­out added Triton. Triton at any concentration had little effect on labelling patterns (data not shown).

Comparison of the 32 kDa polypeptide with the, subunit of FlATPase

The possibility that the labelled 32 kDa polypeptide was a component of the F 1 ATPase complex was exam­ined since the subunit of maize F 1 ATPase has a similar molecular weight of 35 kDa [9]. A fraction enriched in FlATPase was prepared from purified mung bean mitochondria and compared to total mitochondrial pro­teins by SDS-PAGE (Fig. 2). The enriched FlATPase fraction (lane 3) contained a major band at 57 kDa corresponding to the 0: and 13 subunits. A minor band migrating near 35 kDa is probably the , subunit. Since the FlATPase stoichiometry is 0:3133,&, one would expect, polypeptides to stain weakly relative to the dominant polypeptides. The 32 kDa polypeptide which is prominently stained in the total mitochondrial pro-

85

57

32

Fig. 1. SDS-PAGE fluorogram of mitochondria labelled with eHl-AzBAP at -70 0c. Lane 1,5 min irradiation. Lane 2, 15 min irradiation. Numbers at right are estimated molecular weights of bands in kilodaltons.

92 66 45

31

21

14

1 2 3

Fig. 2. Comparison of FJ ATPase with total mitochondrial proteins by SDS-PAGE (Coomassie Blue staining). Lane I, molecular weight standards. Lane 2, total mitochondrial proteins. Lane 3, fraction enriched in FJ ATPase. The arrow indicates the 'Y subunit. Numbers at left are molecular weights of the standards in kilodaltons.

86

tein sample (lane 2) was not enriched in the FJATPase preparation.

Partial purification of the 32 kDa polypeptide

Attempts at fractionating peripheral from integral membrane proteins by washing mitochondrial mem­branes with 1 M sodium carbonate were unsuccessful, as most of the FJATPase remained associated with the membranes (data not shown). However, when a washing buffer containing 6 M urea was substituted, the FJATPase 0: and f3 subunits (57 kDa) were read­ily removed as was some of the 32 kDa polypeptide (Fig. 3, lane 1). Subsequent urea washes (lane 2 and 3) extracted more of the 32 kDa polypeptide, but most of it remained associated with the membranes until solubilized with SDS (lane 4).

Chloroform extraction of mitochondrial mem­branes resulted in an insoluble interface between the buffer and chloroform phases. Recovery of this mate­rial and extraction with Triton X-I 00 yielded a fraction enriched in the 32 kDa polypeptide (Fig. 4, lane 3). A significant amount, however, remained in tbe interface material and was solubilized only with SDS, along with many other contaminating proteins (lane 4). The degree to which the 32 kDa polypeptide was enriched by this method was more variable than the urea wash­ing procedure.

Discussion

The photoactivation of the azido group to a nitrene radical results in a highly reactive reagent capable of nucleophilic attack at many potential sites in proteins. By reducing the temperature of the photoaffinity reac­tion, fewer mitochondrial polypeptides were modified by eH]-AzBAP as compared to our previous report [5]. The associated re\iuction in kinetic energy and molecular motion of [3H]-AzBAP at low temperatures is probably responsible for the decrease in non-specific labelling. Low temperature photoaffinity labelling has also been used successfully in the identification of auxin-binding proteins [14]. A longer photoactivation time (15 min) increased the relative labelling intensity of the 32 kDa polypeptide (Fig. 1), but it is possi­ble that this was due to UV-induced degradation of the 57 kDa polypeptide(s) rather than a more specific labelling of the 32 kDa polypeptide (Aducci, personal communication).

There is little doubt that the 57 kDa labelling targets are the 0: subunits (ADPI ATP binding sites) and/or f3 subunits (catalytic sites) of the FJATPase, which together comprise approximately 12% of the stainable protein on two-dimensional gels of plant mitochondrial protein [18]. The sheer amount of these subunits, their accessibility at the surface of the inner membrane, and the fact that BAP is an adenine derivative make the F J ATPase a very tempting target for non-specific labelling by [3H]-AzBAP. In view of the more intense labelling of the 32 kDa polypeptide, our working hypothesis is that the most likely specific eH]-AzBAP binding site will be found there.

Since eH]-AzBAP is capable of reacting with the FJATPase 0: and/or f3 subunits, the possibility was considered that the 32 kDa polypeptide was also a component of the enzyme. This proved not to be the case, since the 'Y subunit of FJATPase, which has a molecular weight of 35 kDa, was definitely larger than the 32 kDa polypeptide when the two were compared electrophoretically.

Evidence that the 32 kDa polypeptide is integrally associated with mitochondrial membranes was pro­vided when repeated washing of mitochondrial membranes with 6 M urea (a very effective protein solubilization reagent) left most of the 32 kDa polypep­tide in the membrane fragments. This urealSDS method and the chloroform/Triton X-IOO treatment resulted in a substantial enrichment of detergent­soluble 32 kDa protein. While these methods are good initial purification steps (for possible sequence analy­sis), it is doubtful that the 32 kDa protein will retain its activity after extraction with concentrated detergents. Therefore, identification of the protein based on an assay of possible activities is not a reasonable course of action at this point.

A high resolution two-dimensional electrophoresis technique for the resolution of mitochondrial proteins has recently been developed [18]. In maize mitochon­dria 329 polypeptides were detected by Coomassie Blue staining. When only mitochondrial membrane proteins were analysed, 23 polypeptides were iden­tified in the molecular weight region of 30-35 kDa with 15 of those being in the more narrow range of 31-33 kDa. Assuming that a similar situation exists in mung bean mitochondria, it will be necessary to further purify the "labelled" 32 kDa polypeptide away from other proteins of similar molecular weights prior to sequencing attempts.

A survey of the literature on proteins involved in plant mitochondrial electron transport has yielded

1 2 3 4 5 6 Ii 45

31

21

14

87

Fig. 3. Partial purification of the 32 kDa polypeptide by SDS solubilization of urea-washed mitochondrial membranes. Lanes 1,2 and 3, proteins solubilized from membranes by the first, second and third washes with 6 M urea, respectively. Lane 4, proteins solubilized from the urea-washed membranes with 1% SDS. Lane 5, mitochondrial membranes prior to urea washing. Lane 6, molecular weight standards.

1 2 3 4 5 Ii 45 31

21 14

Fig. 4. Partial purification of the 32 kDa polypeptide by Triton X-IOO solubilization of chloroform disrupted mitochondrial membranes. Lane I, total mitochondria. Lane 2, mitochondrial membranes. Lane 3, Triton-soluble protein from chlorofonnlbuffer interface material. 4, Triton-insoluble interface protein (extracted with SDS). Lane 5, molecular weight standards.

a number of polypeptides in the 30-35 kDa range. Wiskich and Menz [26] have identified a 33 kDa polypeptide from NADH dehydrogenase (complex 1). Polypeptides ranging from 30-36 kDa in cytochrome c reductase (complex III) have been identified as cytochrome b and cytochrome Cl [4], while cytochrome C oxidase (complex IV) has a 33.5 kDa polypeptide among its components [10]. The alter­native oxidase from Arum maculatum ranges from 30-35 kDa [3], but in other species the molecular weight is slightly higher - 38 kDa in Symplocarpus

foetidus [1] and 35-37 kDa in Sauromatum guttatum [11, 12]. Using antibodies raised to S. guttatum alter­native oxidase, a 35 kDa immunopositive polypep­tide was detected in Western blot analysis of mung bean mitochondrial proteins [12]. Therefore, based on molecular weight comparisons, it is unlikely that the eHl-AzBAP labelled 32 kDa polypeptide in our study is an alternative oxidase, but there is a possibility that it is a component of the electron transport chain.

Future experiments will focus on the photoaffinity labelling of submitochondrial fractions, including the

88

various complexes of the electron transport system, and attempts will be made at resolving the labelled 32 kDa polypeptide from unlabelled contaminants to facilitate a sequence analysis.

References

I. Berthold DA, Fluke OJ and Siedow IN (1987) A detennina­tion of the molecular weight of the aroid alternative oxidase by radiation inactivation analysis. In: Moore AL and Beechey RB (eds) Plant Mitochondria: Structural, Functional and Physiological Aspects, pp 113-116. New York: Plenum Press

2. Blumenthal SSD (1990) Photoaffinity labelling of benzy la­denine-binding proteins in plant mitochondria, M A Thesis, San Jose State University

3. Bonner WD Jr, Clarke SD and Rich PR (1986) Partial purifi­cation and characterisation of the quinol oxidase activity of A. maculatum mitochondria. Plant Physiol 80: 838-842

4. Braun HP, Emmennann M and Schmitz UK (1987) Cyto­chrome c reductase from potato mitochondria: a protein com­plex involved in respiration and protein import. In: Brennicke A and Klick U (eds) Plant Mitochondria, pp 307-313. New York: VCH Publishers

5. Brinegar AC, Blumenthal S and Cooper G (1992) Photo­affinity labelling of mung bean mitochondrial proteins using [3Hl-2-azido-N6-benzylaminopurine. In: Kamfnek M, Mok DWS and Zazfmalova E (eds) Physiology and Biochemistry of Cytokinins in Plants, pp 301-307. The Hague: SPB Academic Publishing

6. Cooper G, Bourell J, Kamfnek M and Fox JE (1988) Methods for synthesis of 2-azido-N6-m-tritiobenzylaminopurine, a photoaffinity label for cytokinin-binding proteins in plants. J Labelled Comp Radiophann 25: 957-962

7. Day DA, Arron GP and Laties GG (1990) Nature and control of respiratory pathways in plants: The interaction of cyanide­resistant respiration with the cyanide-sensitive pathway. In: Davies DD (ed) The Biochemistry of Plants, Vol 2, pp 197-241. New York: Academic Press

8. Dizengremel P, Chauveau M and Roussaux J (1982) Inhibi­tion by adenine derivatives of the cyanide-insensitive electron transport pathway of plant mitochondria. Plant Physiol 70: 585-589

9. Douce R (1985) Mitochondria in Higher Plants: Structure, Function and Biogenesis. New York: Academic Press

10. Douce R and Neuburger M (1987) General organisation of the respiratory chain and matrix-associated specific dehydro­genases in higher plant mitochondria. In: Moore AL and Beechey RB (eds) Plant Mitochondria: Structural, Functional and Physiological Aspects, pp 1-15. New York: Plenum Press

II. Elthon TE and Mcintosh L (1987) Identification of the alterna­tive tenninal oxidase of higher plant mitochondria. Proc Nat1 Acad Sci USA 84: 8399-8403

12. Elthon TE, Nickels RL and Mcintosh L (1989) Monoclonal antibodies to the alternative oxidase of higher plant mitochon­dria. Plant Physiol89: 1311-1317

13. Hack E and Leaver CJ (1983) The a-subunit of the maize F I-ATPase is synthesised in the mitochondrion. EMBO J 10: 1783-1789

14. HicksGR, Rayle DL and Lomax TL (1989) The diageotropica mutant of tomato lacks high specific activity auxin binding sites. Science 245: 52-54

IS. Keirn P, Erion J and Fox JE (1981) The current status of cytokinin-binding moieties. In: Guem F and Peaud-Lenoel C (eds) Metabolism and Molecular Activities of Cytokinins, pp 179-1901. New York: Springer-Verlag

16. Knutson RM (1974) Heat production and temperature regula­tion in Eastern Skunk cabbage. Science 186: 746-747

17. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophatge T4. Nature 227: 680-685

18. Lund AA, Johnson SC and Elthon TE (1993) Two-dimensional map of com mitochondrial proteins. In: A Brennicke and Kuck U (eds) Plant Mitochondria, pp 253-260. New York: VCH Publishers

19. Miller CO (1979) Cytokinin inhibition of respiration by cells and mitochondria of soybean, Glycine max (L.) Merrill. Planta 146: 503-511

20. Miller CO (1980) Cytokinin inhibition of respiration in mito­chondria from six plant species. Proc Nat! Acad Sci USA 77: 4731-4735

21. Miller CO (1982) Cytokinin modification of mitochondrial function. Plant Physiol 69: 1274-1277

22. Morohashi Y and Matsushima H (1983) Appearance and dis­appearance of cyanide-resistant respiration in Vigna mungo coty ledons during and following gennination of the axis. Plant Physiol 73: 82-86

23. Musgrave ME, Miller CO and Siedow IN (1987) Do some plant responses to cytokinins involve the cyanide-resistant res­piratory pathway? Planta 172: 330-335

24. Musgrave ME and Siedow IN (1985) A relationship between cyanide-resistant respiration and plant responses to cytokinins. Physiol Plant 64: 161-166

25. Skinner MK and Griswold MD (1983) Fluorographic detec­tion of radioactivity in polyacrylamide gels with 2,5-dipheny loxazole in acetic acid and its comparison with existing procedures. Biochem J 209: 281-284

26. Wiskich JT and Menz RI (1987) The NADH-oxidising enzymes of plant mitochondria. In: Brennicke A and Klick U (eds) Plant Mitochondria, pp 261-274. New York: VCH Publishers

A. R. Smith et al. (edr.), Plant Hormone Signal Perception and Transduction, 89-96. © 1996 Kluwer Academic Publishers.

89

Specific photo affinity labelling of a thylakoid membrane protein with an azido-cytokinin agonist

F. Nogue', R. Momet2 & M. Laloue' 1 Laboratoire de Biologie Cellula ire, Institut National de la Recherche Agronomique, 78000 Versailles, France; 2Laboratoire de Chimie Fondamentale et Appliquee, Faculte des Sciences, 49045 Angers, France

Key words: cytokinins, cytokinin binding protein, photoaffinity, thylakoid membrane

Abstract

A cytokinin-binding peptide (CBP) of 46 kDa (Thy46) has been identified in thylakoid membranes of pea chloro­plasts, by photoaffinity labelling with tritiated 1-(2-azido-6-chloropyrid-4-yl)-3-phenylurea (eH]azidoCPPU), a urea-type cytokinin agonist. The labelled peptide is also detected in Nicotiana plumbaginifolia, Nicotiana tabacum and spinach thylakoid membranes, but is absent in thylakoid membranes of Chlamydomonas reinhardtii. A phar­macological study of the interaction of this peptide with different cytokinin agonist molecules has been achieved. Urea derivatives are the most efficient competitors of photolabelling, and this efficiency is in good agreement with the cytokinin activity of these compounds. A quantitative analysis of the displacement of the photoaffinity labelling of the peptide by increasing concentrations of CPPU indicates an apparent dissociation constant of I fJM for this ligand. Purine-type cytokinins are weaker competitors than urea-type molecules, but the efficiency of the competition is also correlated to their respective cytokinin activity. A partial purification of Thy46 by a protocol involving ion exchange chromatography and 2D-gel electrophoresis is described.

Introduction

Cytokinins are known to be involved in the regula­tion of a variety of developmental processes such as organogenesis, delay of senescence, control of apical dominance and chloroplast differentiation. Although the molecular mechanisms of cytokinin action are still unclear, it is generally believed that cytokinins, like other phytohormones, act through molecular interac­tions with specific receptors [26].

Cytokinin binding proteins (CBPs) have been described, using different techniques such as binding assay [23, 25, 32], affinity chromatography [24, 33] or anti-idiotype antibodies [14], from various plant tis­sues (for a review see [2]). The first one isolated and best characterized is CBF-I, a 165 kDa homotrimer present in cereal embryos [4, 8, 10]. Some of the cytokinin binding proteins mentioned above satisfy, in part, the criteria generally defined for receptors i.e., saturable, reversible, high affinity and specific binding. However, in no case, has the binding of cytokinins to

these proteins been demonstrated to result in a defined biological response.

The technique of photoaffinity labelling pro­vides a powerful method for the identification of phytohormone-binding proteins. It has already been used for the characterization of auxin-binding proteins [29] and, more recently, gibberellin-binding proteins [13]. A photoactivable derivative ofBA, [3H]azidoBA, has also permitted the identification of the peptide sequence involved in the BA binding site ofCBF-1 [3]. AzidoCPPU is a photoactivable derivative of CPPU, a highly active urea type cytokinin agonist [40]. The [3H]azido CPPU we have synthesized [17] has a strong cytokinin activity and has been proved to be functional as a photo affinity ligand for CBPs using CBF-I as a model. The [3H]azidoCPPU has already permitted the identification of a novel cytokinin binding pro­tein, a glutathione S-transferase, in the soluble fraction of Nicotiana plumbaginifolia leaves (Gonneau et aI., submitted).

90

We report here the application of [3H]azidoCPPU for the identification of a 46 kDa cytokinin binding polypeptide from pea thylakoids, which we have par­tially purified.

Materials and methods

Chemicals

BA [6-(benzylarnino)purine], and zeatin were pur­chased from Sigma. CPPU [l-(2-chloropyrid-4-yl)-3-phenylurea] was prepared according to [40]. PU 60 [l-(2-chloropyrid-4-yl N)-oxide-3-phenylurea] was prepared according to [11]. R-Me BA and S-Me BA [R and S stereoisomers of 6-[(-methylbenzylarnino) purine] were a gift from Dr Corse, USDA Agricul­tural Service, Albany, CA, USA. BM1153 was a gift from Dr Bisagni, Institut Curie, Faculte des Sci­encesd'Orsay, France. PPP [3-methyl-7-(pentylarnino) pyrazolo[ 4,3-d]pyrimidine] was prepared according to [38]. Synthesis of [3H]azidoCPPU will be described in detail elsewhere.

Isolation of chloroplasts and thylakoid membranes

Chloroplasts were isolated as described in [22]. Leaves (20 g) of 30-day-old dwarf pea (Pisum sativum) seedlings grown in the greenhouse were harvested, cut into small pieces and homogenized in a Waring­blender for 5 s at high speed with 80 ml of ice­cold chloroplast extraction medium (50 mM N­tris-(hydroxymethyl)methylglycine (tricine)-KOH, pH 7.9,2 mM ethylenediamine tetraacetic acid (EDTA), 1 mM MgC 12, 330 mM sorbitol and 0.1 % w/v BSA). The homogenate was filtered through 2 layers of muslin and 2 layers of Miracloth (Calbiochem, San Diego, CA, USA) and about 30 ml of filtrate placed in 50 ml centrifuge tubes. The filtered homogenate was under­layered with 14 ml of Percoll medium (50 mM tricine, pH 7.9, 40% (v/v) Percoll, 330 mM sorbitol and 0.1 % BSA). Chloroplasts were pelleted by centrifugation at 2500 x g for 1 min in a swing-bucket rotor. Pellets were resuspended gently in a "photoaffinity labelling" buffer, referred further as PL buffer, (25 mM Tris­acetate pH 7.5,50 mM K acetate, 2.5 mM Mg acetate, 2 mM CaCI2) containing 330 mM sorbitol to a final chlorophyll (ChI) concentration of 3 mg ml- 1• The chloroplasts were mostly intact (85%), as estimated by the ferricyanide test described in [19]. Chloroplasts of leaves of two-month-oldNicotiana plumbaginifolia

and Nicotiana tabacum plants were prepared by the same protocol. Spinach chloroplasts were isolated as described in [27].

For the isolation of thylakoid membranes, chloro­plasts were pelleted by centrifugation at 2500 x g for 1 min (swing-bucket rotor). The pellet was resuspended and homogenized in PL buffer without sorbitol. Thylakoids were pelleted by centrifugation at 10000 x g for 15 min (swing-bucket rotor) and then resuspended and homogenized gently by repeated aspirations through an Eppendorf tube in PL buffer to a final chlorophyll (ChI) concentration of 3 mg ml- 1• Chlamydomonas reinhardtii thylakoid mem­branes were a gift of Dr Dubertret, CNRS, Gif-sur­Yvette, France and prepared according to [7].

Photoaffinity labelling of Thy46

Chloroplasts or thylakoid membranes were diluted to a final concentration of 50 J.lg ml- 1 of Ch 1 in 1 mlofPL buffer (PL buffer + sorbitol 330 mM for chloroplasts) and incubated 30 min at 4°C, with 0.05 J.lM tritiated azidoCPPU in the presence or absence of competi­tors at a concentration of 50 J.lM. After transfer to a shallow container, giving a suspension depth of 1 cm, samples were irradiated for 5 min with a 254 nm, 6 W lamp (Bioblock Scientific) located 25 cm (energy = 0.3 mW cm-2 ) from the container. Thylakoid mem­branes were pelleted by centrifugation at 10000 x g for 10 min in an Eppendorf centrifuge. In the case of chloroplasts, proteins were precipitated with 10% w/v TCA (trichloroacetic acid) for 30 min at 4 °C and pelleted by centrifugation at 10000 x g for 10 min in an Eppendorf centrifuge. Thylakoid and total chloro­plastic protein pellets were washed twice with cold acetone and stored in acetone at - 20 ° C.

Proteins and chlorophylls determination

Proteins were estimated according to [1] using a kit from Bio-Rad (Hercules, CA, USA). Chlorophylls were determined spectrophotometric ally from 80% acetone extracts of chloroplasts [5].

SDS-page andfluorography

The purification steps and photo affinity labelling were monitored by gel electrophoresis. For one-dimensional gel electrophoresis, the different [3H]azidoCPPU­labelled samples stored in acetone were vacuum-dried for 30 minutes, suspended in 20 J.lI of Laemmli buffer,

heated to 70 °C for 5 min and separated through a 1 mm thick, 12% polyacrylamide gel with a 5% stacking gel according to [16]. Peptides were visualized either by Coomassie blue or silver staining.

For fluorographic analysis, the Coomassie blue stained gels were soaked in glacial acetic acid con­taining 20% diphenyloxazole (w/v) according to [37]. Radiolabelling was visualized after exposure at -70 °C to pre-flashed Kodak X-O-Mat films. The fluorographic response was quantified after digital­ization of the signal with an OmniMedia 6CX-XRS scanner and analysis of the data on a BioImage 1D software (Millipore).

Solubilization (lnd partial purification ofThy46

After photoaffinity labelling, 40 ml of the thylakoid­membrane suspension was pelleted by centrifugation at 10000 x g for 10 min and the pellet suspended in 2 ml of 20 mMTris-HC1 buffer (pH 8), 5 mM CHAPS. After gentle stirring for 30 min at 4 ° C unso1ubilized mate­rial was sedimented (50000 x g, 1 h). The supernatant was loaded on a QMA anion-exchange column (Mem­Sep 1000, Millipore) previously equilibrated with the solubilization buffer. The column was eluted with a gradient of NaCl in the same buffer.

2D gel electrophoresis

Post anionic exchange column fractions were separated by two-dimensional gel electrophoresis according to [35] with a Multiphor II apparatus from Pharmacia (Pharmacia LKB Biotechnology, Uppsala, Sweden). Samples were treated as for one-dimensional gel elec­trophoresis, but after solubilization in the Laemmli buffer and centrifugation at 10000 x g for 15 minutes the proteins of the supernatant were precipitated by the addition of 180 JlI of cold acetone. Following overnight precipitation at - 20 ° C, proteins were pelleted by centrifugation at 10000 x g for 15 min, vacuum­dried for 30 min, suspended in 20 JlI of first-dimension isoelectric focusing (IEF) buffer, and subjected to IEF (34000 V h- 1). For the second dimension, the IEF gel strips were transferred onto the surface of a horizon­tal excelGel™ (Pharmacia, 8 to 14% gradient SDS­polyacrylamide) according to the procedure described by Pharmacia. Electrophoresis was carried out at 20 rnA in the stacking gel and 50 rnA in the running gel. Peptides were visualized by Coomassie blue staining. For fluorography, gels were removed from their gel­bond support and treated as SDS-PAGE gels.

91

Results

A polypeptide is labelled to high specific activity

Several polypeptides were labelled in the chloroplastic fraction of pea leaves, especially the subunits of CF1 ATPase, the D 1 protein of the photosystem I! complex, the 27 kDa apoprotein ofLHCP, a 23 kDa peptide (pre­sumably the 23 kDa extrinsic polypeptide of PSI!) and a 46 kDa peptide (Fig. 1b). Most of them are major proteins of the chloroplasts (compare to Coomassie­stained gel in Fig. 1 a) and the labelling was not decreased in the presence of 50 JlM CPPU, suggesting that this labelling resulted from non-specific interac­tions of the probe with these proteins. However, a pep­tide of molecular weight of 46 kDa (Thy46) appeared specifically labelled since its labelling was completely abolished in the presence of CPPU.

Furthermore, this labelled peptide is associated with the thylakoid membranes prepared from those photolabelled chloroplasts (Fig. 1a). Thy46 is also detected when the isolated thylakoids were subjected to photoaffinity labelling (results not shown, same pat­tern of labelling as Fig. 1 b). The Thy46 peptide could not be visualized in these conditions after Coomassie staining gel (Fig. 1 a), confirming the high specificity of its labelling.

Identification of a similar peptide in other species

In the same conditions of photoaffinity labelling, a specifically labelled peptide of 44 kDa in the thylakoid membrane of Nicotiana plumbaginifolia and Nicotiana tabacum and 46 kDa in the thylakoid membrane of spinach chloroplasts can be detected (Fig. 2). Dura­tion of exposure for the flu oro grams are longer in these cases (five days for pea, 20 days for other experiments), explaining the significant background. The specificity of the labelling is comparable to the one obtained with Thy46, indeed the labelling of these 44 or 46 kDa pep­tides of the thy lakoid membrane of these three species, as in pea, is the only one efficiently inhibited by the addition of cold CPPU as competitor.

No specifically labelled peptide can be detected in the thylakoid membranes of Chlamydomonas reinhardtii under these conditions (Fig. 2) even after prolonged exposure (results not shown).

Solubilization and partial purification of Thy46

The Thy46 peptide of pea thylakoid membranes was solubilized in the presence of CHAPS (Fig. 3). Most

92

a chloropia thylakoid I cpPU CPPU

b chloroplast I CPPU

thylakoids CPPU

MW + + kDar-________________ ~----------, + +

67

45

36

29 24

21

14L-~~ __ ~ ______ ~ ________ ~

Fig. 1. High-specific-activity photoaffinity labelling of a chloroplastic protein. Coomassie-stained gel (150 Jlg of protein per lane) of chloroplast and thylakoid proteins separated in SDS-PAGE (a). The corresponding fluorogram (b) shows labelling with eHjN3CPPU (50 nM) in the absence (-) or presence (+) of 50 JlM of CPPU. Asterisks indicate position of (I) f3 subunits of CF1 ATPase. (2) D lof PSII. (3) 27 kDa apoprotein of LHCP. (4) 23 kDa extrinsic polypeptide of PSII. Arrows indicate position of the 46 kDa polypeptide estimated from aligment with the fluorogram. Molecular weight marker proteins (from Sigma) (lane MW) are indicated.

Nkotimul Nkotimul Spinach ChJlJlnydomolUU

plumbGginifolUJ lDINu:um n inJuudIiJ

I CPPU I CPPU I CPPU I CPPU I MW + MW + MW + MW

+ kDa kDa kDa

67 67 67 67 45 45 4S 45 36 36 36 36 29 29 29 29 24 24 24 24

21 21 21 21

14 14 14 14

Fig. 2. High-specific-activity photoaffinity of peptides with similar molecular weight in several species. F1uorograms shows labelling with eH]N3CPPU (50 nM) in the absence (-) or presence (+) of 50 JlM of CPPU. Molecular weight marker proteins (lane MW) are given.

of the labelled proteins are present in the solubilized fraction, however approximately 80% of the 27 kDa apoprotein ofLHCP is still unsolubilized in these con­ditions. The solubilized proteins have been separated on an anionic exchange column (Fig. 4a). A large part of the radioactivity is due to non-specific binding of the probe to proteins and lipids. This high background did not allow us to localize the labelled Thy46 peptide directly by radioactivity measurement. However we were able to screen for the presence of Thy46 in the different fractions by SDS-PAGE and ftuorographic detection. The labelled Thy46 was detected in the 0.35

to 0.45 M NaCl fractions (result not shown). These fractions still contain four major peptides in addition to Thy46, visible in silver stained SDS-PAGE (Fig. 4b).

Two-dimensional electrophoresis a/fractions 0.35 to 0.45 M NaCl

Two dimensional gel analysis of azido-CPPU -labelled­peptide enriched by anionic exchange column chroma­tography indicates the presence of five major groups of spots (Fig. Sa), corresponding to the silver stained

a solubilized

MW otcins

kDa

67

45 36

29 24~"_.1

21

b pellet

solubilized olCins pellet

Fig. 3. Solubilization ofThy46 with CHAPS. Coomassie-stained SDS-PAGE gel (150 J.Lg of protein per lane) of solubilized and non-solubilized thy lakoid membrane proteins in presence of CHAPS 5mM after photoaffinity labelling (a). Fluorogram (b) shows the presence of eHjN3CPPU labelled Thy 46 in the solubilized fraction .

bands visible in SDS-PAGE (Fig. 4b). However Thy46 is the only labelled peptide in this fraction (Fig. Sb). The corresponding stained spot is well separated from the other spots and is localized at a pI of approximately 4.S.

Specificity of the labelling ofThy46 by azido-CPPU

The dissociation constant (Kd) ofThy46 for CPPU was estimated by measuring the reduction of the labelling by [3H]azidoCPPU in the presence of increasing con­centrations of CPPU. As shown in Fig. 6a, labelling of Thy46 decreased rapidly as CPPU concentrations increased. By comparison, labelling of the 27 kDa apoprotein ofLHCP was not significantly reduced. The Kd of CPPU for Thy46 was estimated to be about 1 J1.M (Fig."6b).

Urea and purine derivatives have been tested for their ability to decrease the labelling of Thy46 by the eH]azidoCPPU (Table 1). The most effective com­petitors belong to the urea family. Reductions of the labelling obtained with thidiazuron, a highly active cytokinin agonist, and PU42, a putative cytokinin antagonist (Laloue, unpublished), are comparable to the reductions obtained with CPPU. PU60, the N-oxide form of CPPU and a poor cytokinin agonist [11], is a weak inhibitor of the labelling. Among the purine type molecules, BA, zeatin and kinetin decrease weakly the labelling of Thy46. Adenine, adenosine, AMP,

93

ADP, ATP and BM IIS3, the 7 -deaza analogue of BA, a weak cytokinin [21], are not competitors for the photoaffinity labelling. The optical isomer S-MeBA, which is almost inactive in terms of cytokinin activity [6] is not a competitor for the labelling while the R­MeBA optical isomer, which is 8 fold more active than BA prevents SO% of the labelling. PPP, a cytokinin antagonist [38] also inhibits 30% of the azido-CPPU photoaffinity labelling.

Discussion

Plastids are known to be a target for cytokinin action. Numerous authors have described the implication of cytokinins in plastid development (for a review see [30]) and especially in the etioplastlchloroplast transition in greening seedlings, cotyledons [20], or suspension cultured cells [36]. Cytokinins also delay senescence in detached leaves by stabilizing or enhanc­ing the synthesis of plastid components [18,39].

Cytokinins act in the cooperation between the plas­tids and nuclear genomes and are known to enhance the steady-state level of both type of transcripts [3S, 28,31]. However, their mode of action on the chloro­plast is unknown, and it is still a controversy whether this regulation is due to enhanced transcription rates and/or post-transcriptional events [9, IS].

Until now, no soluble or membrane-bound cyto­kinin binding proteins have been found in chloro­plasts. The fact that the detection of membrane bound cytokinin binding proteins in general has not been suc­cessful may be due to the fact that solubilized proteins no longer bind the ligand.

The photoaffinity technique is a good tool to over­come this problem. However a major difficulty with the use of azido compounds on membrane fractions is the non-specific labelling, due to the lipophilic properties of most of these molecules. Under the conditions used, we can observe the labelling of many chloroplastic peptides. This is mainly due to non-specific labelling which is not abolished by photolabelling at -196 0 C (results not shown), a technique that has been used with success by others [12]. Nevertheless, we have been able to prove the specificity of the binding of azido-CPPU to Thy46, the first cytokinin-binding pro­tein described in the thylakoid fraction of plant leaves, by competition with cold CPPU.

Thy46 is conserved with respect to size and bind­ing properties among several plant species. However, Thy46 is either absent in thylakoids of Chlamy-

94

a 0,2 100000 b

I MW

~ kDa

~ 67

50000 '~ :;; 0,1 - 45

i J: 36 ......

29

! 24

.D

< 21

14

0 5 10 15 20 25 30 35 40 45 50

Fraction number

Fig. 4. Anionic!exchange chromatography on QMA MemSep 1000 of CHAPS solubilized proteins. (a) I ml of CHAPS solubilized proteins (2 mg of protein) were loaded on a QMA MemSep 1000 column equilibrated with a 20 mMTris/HCI buffer (pH 8), 5 mM CHAPS and eluted at a flow rate of 4 ml min-I . Radioactivity has been measured by scintillation counting of 1/100 of each fractions (I ml). (b) Silver stained SDS-PAGE analysis of a 10 ILl aliquot of the 26 to 28 pooled fractions (0.22 to 0.25 M NaCI; indicated by arrows). Molecular weight marker proteins (lane MW) are given.

7

~ ~ ~ ,.,

Fig. 5. Two dimensional gel electrophoresis of [3HJN3CPPU labelled Thy46 after anionic exchange chromatography. Peptides present in the 0.22 to 0.25 M NaCI eluted fractions were applied to first-dimension IEF in pH 4-7 ampholytes, the second dimension was SDS-PAGE. A Coomassie stained gel (a) and the corresponding fluorogram (b) are shown for comparison. Arrows indicate position of Thy46 which is visible in the stained gel and the correspond­ing spot on the fluorogram. Molecular weight marker proteins (lane MW) are given.

domonas reinhardti or it does not bind azidoCPPU. This could be related to the fact that Chlamydomonas reinhardtii chloroplasts do not seem to be affected by cytokinins (Dr Herrin, personal communIcation).

a concentration UlM) 0.05 0.5 1 5 10 SO 100 o

Thy46

LHCP

b 0.4

0.3

8 0.2

0.1

o 0.001 0.01 0.1 10 100

concentration UlM)

Fig. 6. Decrease ofThy46 and 27 kDa apoprotein ofLHCP labelling on a range of CPPU. Thylakoid membranes have been labeled by [3HJN3CPPU in the presence of a range of CPPU concentrations, and subjected to SDS-PAGE. Fluorograms (a) show Thy46 specific labelling and LHCP non-specific labelling. The intensity of Thy46 labelling has been estimated by digitalization of the signal with an OmniMedia 6CX-XRS scanner and analysis of the data on a Biolmage ID software (Millipore). Results were plotted on a graph (b).

The CPPU concentration required to abolish the labelling by eH]azidoCPPU is higher than expected

Table 1. Inhibition (two experiments) of Thy46labeling by 50 nM of [3HJazidoCPPU in presence of competitors 50 JlM. Results are expressed as % of the displacement obtained with CPPU. Assay duplicates differed by no more than 2%.

Added compound Inhibition of [3HJazido CPPU Biological

specific Thy46 labeling (%) activity

Urea-type CK

CPPU 100 +++

Thidiazuron 100 +++

PU60 50 ± PU42 90 Antagonist

Purine-type CK

Zeatin 20 ++

BA 30 ++

R-MeBA 50 +++

S-MeBA 5 Inactive

PPP 40 Antagonist

BMI153 5 ± Adenosine None Inactive

Adenine None Inactive

AMP None Inactive

AOP None Inactive

ATP None Inactive

(50 J.lM), however, other authors who have used azido probes have made the same observation [12]. At this point we have no hypothesis to explain this observa­tion. Nevertheless we can still estimate that Thy46 binds CPPU with an apparent Kd of 1 J.lM. We have also demonstrated that the binding ofThy46 is specific for cytokinin active molecules, even if it appears to have higher affinity for urea type than for adenine type cytokinins. Results obtained with the enantiomers of a-methyl derivatives of BA are of particular interest. The higQer capacity to decrease the labelling of the (R) isomer of methyl-BA, as compared to the (S) isomer, and at a lower level to BA, is compatible with their capacity to promote the growth of soybean callus [6]. The higher affinity of Thy46 for urea derivatives than for purine derivatives can be related to the strong cytokinin activity of urea derivatives compared to adenine derivatives in some biological assays [21].

The properties of Thy46 presented here, i.e., low abundance of this protein in the thylakoid mem­brane, its affinity for CPPU, and for cytokinin active molecules in general, give this protein the main char­acteristics of a putative receptor for cytokinins. Further purification of this peptide is in progress. The objective

95

is to obtain partial peptide sequence in order to clone the corresponding gene_

Acknowledgements

The authors thank Dr M. Gonneau and Dr K. Schonorr for critical reading of the manuscript and making useful suggestions.

References

I. Bradford MM (1976) A rapid and sensitive method for the quantification of microgram quantities of proteins utilizing the principle of protein binding. Anal Biochem 72: 248-254

2. Brinegar AC (1994) Cytokinin binding proteins and receptors. In: Mok OWS and Mok MC (eds) Cytokinins: Chemistry, Activity, and Function, pp 217-232. Boca Raton: CRC Press

3. Brinegar AC, Cooper G, Stevens A, Hauer C, Shabanowitz J, Hunt OF, and Fox IE (1988) Characterization of a benzy­ladenine binding site peptide isolated from a wheat cytokinin­binding protein: Sequence analysis and identification of a single affinity-labelled histidine residue by mass spectrometry. Proc Natl Acad Sci USA 85: 5927-5931

4. Brinegar AC, Stevens A and Fox JE (1985) Biosynthesis and degradation of a wheat embryo cytokinin-binding protein during embryogenesis and germination. Plant Physiol79: 706-710

5. Bruinsma J (1961) A comment on the spectrophotometric determination of chlorophyll. Biochem Biophys Acta 53: 576-587

6. Corse J, Pacovsky RS, Brandon OL and McKeon TA (1992) Identification of cytokinin receptors by means of structure­activity response. In: Kamineck M, Mok OWS and Zazimalova E (eds) Physiology and Biochemistry of Cytokinins in Plants, pp 211-214. The Hague: SPB Academic Publishing bv, The Netherlands

7. Oelepelaire P and Chua NH (1979) Lithium dodecyl sulfate! polyacrylamide gel electrophoresis of thylakoid membranes at 4 0 C: characterization of two additional chlorophyll a-protein complexes. Proc Natl Acad Sci USA 76: 111-115

8. Erion JL and Fox IE (1981) Purification and properties of a protein which binds cytokinin-active 6-substituted purines. Plant Physiol67: 156-162

9. Flores S and Tobin EM (1988) Cytokinin modulationofLHCP mRNA levels: the involvement of post-transcriptional regula­tion. Plant Mol Bioi II: 409-415

10. Fox JE and Erion JL (1975) A cytokinin binding protein from higher plant ribosomes. Biochem Biophys Res Commun 64: 694-700

II. Henrie RN, Green CM, Yeager WH and Ball TF (1988) Activity optimization of pyridinyl N-oxide urea cytokinin mimics. J. Agric Food Chern 36: 626-633

12. Hicks GR, Rayle OL, Jones AM and Lomax TL (1989) Specific photoaffinity labelling of two plasma membrane polpeptides with an azido auxin. Proc Natl Acad Sci USA 86: 4948-4952

13. Hooley R, Smith SJ, Beale MH and Walker RP (1993) In vitro photoaffinity labelling of gibberellin-binding proteins in Avena Jatua aleurone. Aust J Plant Physiol 20: 573-584

14. Kulaeva ON, Karavaiko NN, Moshkov IE, Selivankina SY and Novikova GV (1990) Isolation of a protein with cytokinin-

96

receptor properties by means of anti-idiotype antibodies. FEBS 261: 410-412

IS. Kustnetsov VV, Oelmiiller R, Sarwat MI, Porfirova SA, Cherepneva GN, Herrmann RG and Kulaeva ON (1994) Cytokinins, abscisic acid and light affect accumulation of chloroplast proteins in Lupinus luteus cotyledons without notable effect on steady-state mRNA levels. Planta 194: 318-327

16. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227: 680-685

17. Laloue M, Mornet R, Pethe C and Gonneau M (1991) Receptors for cytokinins: Synthesis and application of a photo active analog of the cytokinin agonist N-(2-chloro-4-pyridyl)-N I-phenylurea. In Plant Science Today. Y de Kouchkowski editor. INRA Ed, P 96

18. Lamattina L, Anchoberri V, Conde RD and Lezica RP (1987) Quantification of the kinetin effect on protein synthesis and degradation in senescing wheat leaves. Plant Physiol 83: 497-499

19. Lilley RMC, Fitzgerald MP, Rientis KG and Walker DA, (1975) Criteria of intactness and the photosynthetic activity of spinach chloroplast preparations. New Phytol 75: 1-10

20. Longo GPM, Bracale M, Rossi G and Longo CP, (1990) Benzyladenine induced the appearance of LHCP-mRNA and of the relevant protein in dark-grown excised watermelon cotyledons. Plant Mol Bioi 14: 569-573

21. Matsubara S (1990) Structure-activity relationships of cytokinins. Plant Sci 91: 17-57

22. Mills WR and Joy KW (1980) A rapid method for isolation of purified, physiologically active chloroplasts, used to study the intracellular distribution of amino acids in pea leaves. Planta 148:75-83

23. Mitsui S and Sugiura M (1993) Purification and properties of cytokinin-binding proteins from tobacco leaves. Plant Cell Physiol 34: 543-547

24. Momotani E and Tsuji H (1992) Isolation and characterization of a cytokinin-binding protein from the water-soluble fraction of tobacco leaves. Plant Cell PhysioI33(4): 407-412

25. Nagata R, Kawachi E, Hashimoto Y and Shudo K (1993) Cytokinin-specific binding protein in etiolated mung bean seedlings. Biochem Biophys Res Commun 191: 543-549

26. Napier RM and Venis MA (1990) Receptors for plant growth regulators: Recent advances. J Plant Growth Regul9: 113-126

27. Nelson N, Drechhsler Z and Neumann J (1970) Photophos­phorylation in digitonin sub-chloroplast particles. J Bioi Chern 245: 143-151

28. Ohya T and Suzuki H (1991) The effect of benzyladenine on the accumulation of messanger RNAs that encode the large and small subunits of Rubis co and light harvesting chlorophyll alb-protein in excised cucumber cotyledons. Plant Cell Physiol 32:577-580

29. Palme K (1993) From binding protein to hormone receptors? J Plant Growth Regul12: 171-178

30. Parthier B (1979) The role of phytohormones (cytokinins) in chloroplast development. BiochemPhysiol Pflanzen 174: 173-214

31. Reski R (1994) Plastid genes and chloroplast biogenesis. In: Mok DWS and Mok MC (eds) Cytokinins: Chemistry, activity, and function, pp 217-232. Boca Raton: CRC Press

32. Romanov GA, Taran VY and Venis MA (1990) Cytokinin­binding protein from maize shoots. J Plant Physiol 136: 208-212

33. Sakai S and Kamei N (1992) Purification of a soluble cytokinin­binding protein from etiolated mung bean seedlings. Biosci Biotech Biochem 56: 504-507

34. Santoni V, Bellini C and Caboche M (1994) Use of two­dimensional protein-pattern analysis for the characterization of Arabidopsis thaliana mutants. Planta 192: 557-566

35. Serve BT, Axelos M and Peaud-Lenoel C (1985) Cytokinin modulate the expression of genes encoding the protein of the light-harvesting chlorophyll alb complex. Plant Mol Bioi 5: 155-163

36. Seyer P and Lescure AM (1984) Evidence for changes in plastid mRNA populations during cytokinin-induced chloro­plast differentiation in tobacco cell suspensions. Plant Sci Lett 36:59-66

37. Skinner MK and Griswold MD (1983) Fluorographic detection of radioactivity in polyacrylamide gels with 2,5-diphenyloxazole in acetic acid and its comparaison with exist­ing procedures. Biochem J 209: 281-284

38. Skoog F, Schmitz RY, Bock RM and Hecht SM (1973) Cytokinin antagonists: synthesis and physiological effects of of 7-substituted 3-methylpyrazolo(4,3-d)pyrimidines. Phyto­chemistry 12: 25-37

39. Smart CM, Scofield SR, Bevan MW and Dyer TA (1991) Delayed leaf senescence in tobacco plants transformed with Imr, a gene for cytokinin production in Agrobacterium. The Plant Cell 3: 647-656

40. Takahashi S, Shudo K, Okamoto T, Yamada K and Isogai Y (1978) Cytokinin activity of N-phenyl-NI-(pyridyl)urea derivatives. Phytochemistry 17: 1207-1207

A. R. Smith et al. (eds.), Plant Homwne Signal Perception and Transduction, 97-108. © 1996 Kluwer Academic Publishers.

97

Isolation and characterisation of cDNAs for cytokinin-repressed genes

Haruhiko Teramoto, Eiki Momotani, Go Takeba l & Hideo TsuW Department of Botany, Faculty of Science, Kyoto University, Kyoto 606-0] , Japan; I Laboratory of Applied Biology, Faculty of Living Science, Kyoto Prefectural University, Kyoto 606, Japan epresent address: Department of Biology, Kobe Women's University, Suma, Kobe 654, Japan)

Key words: benzyladenine, cucumber cotyledon, Cucumis sativus, cytokinin, cytokinin-repressed gene

Abstract

As an approach to the primary action of cytokinins, we studied the repression of gene expression which occurs shortly after the application of this hormone. First we studied the changes in the translatable mRNA population during dark incubation of etiolated cucumber cotyledons with benzyl adenine (BA). Two dimensional gel electrophoresis of basic and neutral proteins showed that several spots changed I or 2 h after BA application. Among them, three were markedly repressed. Next we isolated cDNA clones for the cytokinin-repressed genes CR9 and CR20 by differential screening. The CR9 cDNA is 588 bp long, and would encode a protein consisting of 137 amino-acid residues, having a molecular mass of 15 kDa. The composition of amino-acid residues indicates that the protein is either neutral or weakly acidic. The hydropathy plot showed that it is probably soluble rather than associated with membranes. The deduced amino-acid sequence shows that it contains two similar sequences of 18 amino-acid residues, each containing two conserved cysteines at an interval of 7 residues. It shows 48% identity with lir], a light-induced gene from rice [24]. The CR9 transcript began to decrease as early as 1 h after BA application, reaching an extremely low level at 4 h, preceding the initiation of BA-induced cotyledon expansion, although, it began to recover after 8 h. The repression is BA-dose dependent, and highly specific for cytokinins. The CR9 transcript was abundant in mature and senescent leaves, but was not found in roots or young leaves. Wounding and illumination also caused a transient decrease in the CR9 transcript level. When seedlings were grown under a light/dark cycle, expression of CR9 exhibited diurnal fluctuation with an increase in the light period. Expression of another cytokinin-repressed gene, CR20, showed the same pattern of changes as that of CR9 in terms of cytokinin­repression, BA-dose response, cytokinin-specificity, wounding and light effects, although it showed a broad organ specificity. It also exhibited diurnal changes, but opposite to those observed with CR9, showing an increase in the dark period. The nucleotide sequence of CR20 cDNA is quite different from that of CR9 and shows no significant homology with any sequences in the databases. There are many stop codons, hence no long open reading frame to encode a polypeptide. Possible roles of CR9 and CR20 in cytokinin-induced physiological changes are discussed.

Introduction

There are a large number of reports on the effect of cytokinins on different aspects of plant growth and development in a variety of plant materials. However, the molecular mechanism of the effect of cytokinins still remains unknown. As an approach to the under­standing of the mechanism, modulation of gene expres­sion by cytokinins has been studied by a number of workers (for review see [2]). For example, cytokinins

accelerate the light induction of genes for chloro­plast proteins, such as light-harvesting chlorophyll alb protein and the small subunit of ribulose-l ,5-bisphos­phate carboxylase/oxygenase [10, 11, 16, 23, 31]. BA stimulates light induction of nitrate reductase in excised barley leaves in the presence of nitrate [17, 18]. Cytokinins also affect the expression of phos­phoenolpyruvate carboxylase [25,27], the apoprotein of phytochrome [3], and some other proteins [19, 20, 35]. However, most authors observed changes after

98

long periods of- cytokinin treatment or modification by cytokinins of the effects of other factors such as light or inducers. Therefore, it seems difficult to relate such changes to the primary action of this class ofhor­mone. There are a few reports dealing with fairly rapid changes, e.g., within several hours after application of cytokinins. Several cDNAs for mRNAs that show rapid increase or decrease in response to treatment with cytokinins have been isolated by differential screening from cultured cells of soybean [5, 6] and tobacco [7], but their expression is modulated by auxins as well as or better than by cytokinins. Chen et al. [1] showed that abundance of some translatable mRNA in excised pumpkin cotyledons changed 60 min after application ofBA.

In the present study, we focused our attention on the genes whose expression is rapidly repressed by cytokinins. cDNA clones for two such genes were isolated and compared in their structures and patterns of expression.

BA-induced changes in the translatable mRNA population

Dark preincubation of etiolated cucumber cotyledons with cytokinins induces expansion growth of the cotyledons in the dark [32], and stimulates chlorophyll formation after exposure to light [8, 9]. Cytokinin­modulated gene expression probably underlies these effects on developmental changes. In order to obtain a clue to the primary action of this hormone, we stud­ied the genes whose expression is rapidly changed by cytokinins. Here we focused our attention on genes which are repressed by this hormone. Initially we studied BA-induced changes in the translatable mRNA population in excised cucumber cotyledons. Cotyle­dons were excised from 5-day-old etiolated seedlings, and inc~bated on moist filter paper in the dark for 18 h before application of BA to eliminate any effects of wounding. Then they were incubated with 10 J.lM BA. After various periods of incubation with BA, poly (A)+RNA was isolated from cotyledons and translated in vitro. In order to separate both basic and neutral proteins, nonequilibrium pH gradient electrophoresis­SDS polyacrylamide gel electrophoresis (NEPHGE­SDS PAGE) and isoelectric focusing-SDS PAGE were used, respectively.

Figure lA shows the profiles of the separation by NEPHGE-SDS PAGE of basic proteins translated from mRNAs prepared from cotyledons treated with BA or water for 6 h [28]. Spots 1 through 6 were enhanced,

but spots A, B and C disappeared 6 h after BA applica­tion. Figure IB shows the magnification of the region around spot A, and the time-course of changes in the spots in this region. We estimated the intensities of spots relative to the standard spot S which was always abundant and appeared with the same intensity in BA­treated samples and water controls. According to this criterion, spot A began to decrease as early as 1 h after BA application. In the neutral region, seven spots showed marked changes at 2 h [28]. Five of them were enhanced, four of these becoming the major spots at 6 h. However, the remaining two began to decrease at 2 h, being reduced to undetectable levels at 6 h. These polypeptides were neutral (pI 5-6) judging from their migration on the first dimension gel. Thus, levels of several mRNAs for both basic and neutral proteins were markedly reduced within 1 or 2 h of BA treat­ment.

Isolation of cDNAs for BA-repressed genes

We next attempted to clone the cDNAs for mRNAs which are reduced in the early phase of BA treatment. A cDNA library was constructed in >.gtll phages from etiolated cucumber cotyledons without BA treatment [29]. Differential screening was carried out on the library using two sets of 32P-Iabelled cDNA probes prepared form cotyledons with or without 4 h of BA treatment. We isolated seven positive cDNA clones which hybridised with the BA minus probe prefer­entially to the 4-h BA probe. Two of them, CR9 and CR20 (cytokinin-repressed), were sequenced and char­acterised.

Time-course of changes in CR9 mRNA level during BA treatment

Figure 2 shows the time-course of BA -induced changes in the level of the CR9 transcript as determined by Northern blot analysis using the cDNA as a probe [29]. The level of the CR9 transcript began to decrease after 1 h of BA treatment to reach an extremely low level by 4 h. This decrease preceded the BA -induced expansion of cotyledons, which occurred from 4 to 24 h after the application of BA [28]. When the incubation with BA was continued for a longer period, the level of the CR9 transcript began to increase after 8 h, to almost half the initial level at 32 h (Fig. 3A) [30]. NCI cDNA was isolated from the cDNA library as a control which was abundant and showed no changes in level between 0 and 4 h of BA treatment when examined by differential

(A)

kO 66.0

45.0

34.7_

(8)

NEPHGE

Control 6 h

0

fA

2h

2

30 min

2 \.1

; 3

12 h

99

- "6

C

+BA 6 h

2 \.2

;A ,.3 fA !3

1 h

2 "-1

f 3

24 h

Fig. 1. (A) Fluorograms of two· dimensional NEPHGE·SDS PAGE gels from in vitro translation products of poly (A)+ mRNAs from cucumber cotyledons treated with 10 f.LM BA (right) or water (left) for 6 h after 18 h of water preincubation in the dark. The spots enhanced (1-6) or repressed (A·C) by BA treatment are indicated by arrowheads. (B) The time·course of changes in translatable mRNAs from cucumber cotyledons during dark incubation with BA. Samples were harvested at indicated times after application of BA. Each sample shows a part of NEPHGE·SDS PAGE slab gel. Spot S was taken as a standard when the intensities of relevant spots of BA-treated samples were compared with those of the control.

100

( A ) eR9

+BA W

o 1 2 4 4h

(8 ) 120

100

80

iii c Q)

25 s .. C Q) 60 ::: iii Qi 17S " a: ~ +8A (Exp 1)

0.7 kb " --0-- CenITol (Exp 1)

____ +8A (Exp 2)

--D- ConlTol (Exp 2)

Time (h)

Fig. 2. Changes in levels of CR9 mRNA from cucumber cotyledons during dark incubation with BA. (A) Cotyledons were incubated in the same manner as described in the legend to Fig. I. Twenty micrograms of total RNA extracted from cotyledons of each sample was loaded on the gel, electrophoresed and analysed by Northern blotting with 32P-Iabelled CR9 cDNA as a probe. (B) Band intensities were quantified by densitometry. Values are expressed as a percentage of the initial value. Results of two independent experiments are shown.

hybridisation. Northern blotting was also carried out using this cDNA as a probe (Fig. 3B). The transcript did not change during 23 h of BA treatment.

BA-dose response ofCR9 repression

Figure 4 shows the results of Northern blot anal­ysis of the CR9 transcript of 4 h after application of various concentrations of BA (l0-8-1O-5M) [29]. The level of the transcript was reduced with increas­ing concentration of BA. The repression parallels the extent of BA-induced expansion of cotyledons (data not shown).

Specific response ofCR9 to cytokinins

Figure 5 compares the effects of various substances on the level of the CR9 transcript [29]. The transcript level was similarly reduced by three different cytokinins,

i.e., BA, isopentenyladenine and t-zeatin, but was not reduced by adenine, which has no cytokinin activity or 2,4-D, an auxin. Again there is a good correlation between the extent of CR9 repression and the effect of these substances on cotyledon expansion.

Expression of the CR9 gene in various organs of cucumber

It has been known that levels of endogenous cytokinin activity change with ageing of organs [12, 13,26,34], wounding [4,21] or light treatment [14,33]. Therefore, we tried to determine whether the expression of CR9 changes in response to these physiological changes. Figure 6 shows the levels of the CR9 transcript in various organs of cucumber plants, as determined by Northern blot analysis [30]. All plants were grown under a light/dark cycle except for etiolated seedlings (rightmost lane). The CR9 transcript was abundant in

(A) +BA

o 2 4 8 23 h

CR9

0.7 kb ~

(B) +BA

o 2 4 8 23 h

NC1

1.0 kb ~

Fig. 3. Changes in levels of CR9 (A) and NCI (B) transcripts in cucumber coty ledons during prolonged incubation with 10 /-LM BA after 18 h of water preincubation in the dark. Total RNA extracted from each sample was analysed by Northern hybridisation using CR9 and NCI cDNAs as probes. NCI cDNA was isolated from the cDNA library as a control whose level was not changed by BA. Other details are the same as in the legend to Fig. 2A.

120

::- 100 . iii c:

80 Q)

C Q) 60

.2: Cii 40 (j) a:

20

0 0 10-8 10-7 10-6 10-5

SA concentration (M)

Fig. 4. Effect of BA concentration on the expression of the CR9 gene. Cotyledons were treated with different concentrations of BA for 4 h in the dark after 18 h of preincubation with water. Results of Northern blot analysis were quantified by densitometry. Other details are the same as in the legend to Fig. 2A.

101

\\' BAde i de tZ 2,4-D

\ \ \ \ I / CR9

Fig. 5. Specificity of response of the CR9 gene to cytokinins. Coty le­dons were treated with water (W), BA, adenine (Ade), isopentenyl­adenine (iAde), trans-zeatin (tZ) and 2.4-D. All substances tested were used at a concentration of 10-5 M. Other incubation conditions were the same as in the legend to Fig. 4. Northern blot analysis was carried out as described in the legend to Fig. 2A.

cotyledons, mature and senescent leaves, but was not found in roots, apical buds or young leaves, all of which are expected to contain high levels of endoge­nous cytokinins. These patterns of expression could be correlated with the endogenous level of cytokinins. However, when excised cotyledons were continuously treated with BA, the CR9 transcript increased to the initial level after a transient decrease (Fig. 3A). The pattern of CR9 expression in intact plants may be modified in excised cotyledons during the prolonged incubation.

Effects of wounding and illumination on the level of the CR9 transcript

Cotyledons were excised from etiolated seedlings, incubated with water for 18 h in the dark, and then cut in two pieces, which were incubated in the dark for another 23 h. The CR9 transcript level showed a transient decrease 2 h after the first excision, and again it showed a transient decrease 4 h after the second cutting [30]. These results show that the preincuba­tion is necessary to separate the effect of exogenously added BA from the wounding effect. Remember that we incubated excised cotyledons with water for 18 h before the application of BA.

In order to examine the effect of illumination, etiolated seedlings were exposed to light, or cotyle­dons excised from etiolated seedlings were incubated with water in the dark for 18 h and then exposed to light. In either attached or detached cotyledons, light caused a transient decrease in the CR9 transcript level,

102

eR9

0.7 kb ~

Fig. 6. Expression of the CR9 gene in various organs of cucumber. Cucumber plants were grown under a 16 h light/8 h dark cycle at 28°C. Cotyledons, hypocotyls and roots were harvested from 7-day-old seedlings, apical buds from I-month-old plants, and leaves of three different ages (young, mature and senescent) from 4-month-old plants. Etiolated cotyledons were obtained from seedlings germinated for 5 days in darkness. Northern blot analysis was carried out as described in the legend to Fig. 2A.

the effect being more pronounced in attached than in detached cotyledons [30].

Nucleotide and deduced amino-acid sequences of CR9

CR9 cDNA consists of 588 nucleotides, and has a con­sensus sequence for a polyadenylation signal AAT­AAA 28 bases upstream of the poly(A) tail (Fig. 7 A) [29]. The length of the CR9 transcript was estimated to be 0.7 kb from the results of Northern hybridisa­tion. Therefore, this cDNA sequence probably covers most of the full length of its corresponding mRN A. The open reading frame would encode a protein consisting of 137 amino-acid residues and having a molecular mass of 15 kDa. The molecular masses of all three polypeptides translated 'in vitro from mRNA that were quickly repressed by BA were estimated to be less than 18 kDa [28]. There are 18 negatively charged amino-acid residues and 13 positively charged ones in the predicted polyleptide, indicating that it is a neutral or weakly acidic protein rather than a basic one. The CR9 product may correspond to either of the two neu­tral polypeptides whose genes were quickly repressed by BA. The hydropathy plot showed no wide hydro­phobic regions, suggesting that this protein is prob­ably soluble rather than associated with membranes (Fig. 8) [29].

An interesting feature of the deduced amino-acid sequence is that it contains two similar sequences of 18 amino-acid residues (boxed in Fig. 7 A), each contain­ing two conserved cysteines at an interval of7 residues. The two sequences are 77.8 % identical with each other at the amino-acid level, and 72.2% at the nucleotide level (Fig. 7B). The predicted amino-acid sequence of CR9 cDNA is 48% identical to that of a cDNA lirl (light induced rice 1) which has recently been isolated from rice by Reimmann and Dudler [24]. The open reading frame of lirl cDNA also contains two similar sequences with two conserved cysteines at the same interval as our CR9, but their repeated sequences are 3 residues shorter than ours. The above authors also reported that the expression of lir I showed diurnal fluctuations with an increase in the light period. Inter­estingly, when cucumber seedlings were grown under a light/dark cycle, the expression of CR9 also showed diurnal changes with a pattern similar to that of lirI (Fig. 9A) [30]. The level of the NCI transcript did not change during the entire 24-h period (Fig. 9C).

Southern blot analysis of genomic DNA probed with CR9cDNA

DNA prepared from etiolated cucumber seedlings was digested with six restriction enzymes, i.e., EcoRI, HindlII, BamHI, ApaI, KpnI and XhoI (Fig. 10, left),

(A)

1- CCGAACCGAACCATTGTCCATC~CAGTTCCAGGCAGCTCTTTCCATAGCATCTCCATC

1- K Q P Q A A LSI ASP S

61- ATGCTCCCTCCTCCCACCAACAGCCAAATCAATGGCCTTCTCAATCCCAACGAGGTCCAT

C S L L P PTA K S K A PSI P T R S K

121- GCCAAGGCAAAGCAAAGGAACCCTAAAAGCAAAGGCAAGTGCAGTAGGACAAGACCCTTC

P R Q S K G T L K A K A S A V G Q D P S

181- AACTGTTGACTACAGCTCCATGTCCTCTGTTTTTCCAGCAGAGGCTTGTGACACTGTTGG

TV D Y S S K S siv p P A B A C D T V GI

241- AGGTGAAGCTTGTGATGTGGAAATGTATCCTGAAGTAAAGCTAAAACCAGAGGCCAAAAA

IG B A C D V BIK Y P B V K L ][ P B A K K

301- AGGGAATAGTGTTACAGAGCCAGTTGAGAGAGAGTATCTACAATATGACAGTCCCAAGAC

G H S V T B P V B R B Y L Q Y D S P K T

361- AGTCTTTCCAGCGGAGGCTTGTGATGATTTGGGTGGTGAATTCTGTGATCCAGAGTATCA

Iv P P A B A C D D L G G B P C D P B Iy Q

421- AAAAGGAGTTTACTAGAAAAAAATCTTATTGGGAATTAGTACATATAAACAAGTGTTGAG

K G V Y * -137

481- CCTAGGGTCAACTTTCAGTTGTTTTTTAAATTTTCTTCTCTTTTGTTGACTTTCTCTTAT

541- GCCTGTAAATGATT~CTACAAAGCTCTTCAATGCTG~

(8)

Amino acid .• 77.8% I 18 aa

62- VPPABACDTVGGBACDVB -79

******** .*** *. * 113- VPPABACDDLGGBPCDPB -130

Nucleotide •• 72.2% I 54 bp 208- GTTTTTCCAGCAGAGGCTTGTGACACTGTTGGAGGTGAAGCTTGTGATGTGGAA -261

362- GTCTTTCCAGCGGAGGCTTGTGATGATTTGGGTGGTGAATTCTGTGATCCAGAG -415

103

Fig. 7. (A) Nucleotide and deduced amino-acid sequences of CR9 eDNA. Consensus sequences for polyadenylation signals and poly CA) tail are underlined and wavy-underlined, respectively. Double underline and asterisk indicate putative initiation and stop codons, respectively. Repeated sequences are boxed. (B) Comparison of the repeated sequences in the predicted polypeptide of CR9 eDNA. Identical amino-acid residues and nucleotides are indicated by asterisks.

3.0 ,-_ _ _______________ ..,

j ~ 0.0

I ·30

'5' Residue Number

Fig. 8. Hydropathy plot of the predicted amino-acid sequences of CR9 eDNA. Hydropathy index was averaged over a range of five amino acids according to [15).

and hybridised with the CR9 cDNA probe [30]. One or two strong bands with a few weak ones were detected in each lane, suggesting that the coding region of CR9 mRNA is separated by introns and/or there are two or more CR9 genes.

Expression of another cytokinin-repressed gene CR20 in various organs of cucumber

Figure II A shows the patterns of bands of the tran­scripts of another cytokinin-repressed gene CR20 detected by Northern blot analysis of RNA from differ­ent organs of cucumber [30]. In each sample, there were a number of bands hybridised with the CR20 cDNA probe. Three major bands (0.8, 1.4 and 2.3 kb) are indicated by the arrowheads. Gel electrophoretic patterns of rRNA from different organs were almost identical without any detectable degradation products (Fig. lIB). By contrast, various organs showed differ­ent patterns of bands on Northern blots. These results suggest that the observed diversity of the CR20 tran­scripts is a reflection of the situation within the plant rather than an artefact generated during preparation of RNA. The diversity of the CR20 transcripts could

104

(A)

CR9

0.7 kb •

(8)

CR20 2.3 kb •

1.4 kb ~

0.8 kb ~

(C)

NC1

1.0 kb ~

o 3

o 3

o 3

6 9 12 15 18 21 24 h

6 9 12 15 18 21 24 h

6 9 12 15 18 21 24 h

Fig. 9. Diurnal changes in levels of the CR9 (A), CR20 (B) and NCl (C) transcripts in cucumber cotyledons. Seedlings were grown under a 15 h light/9 h dark cycle for 8 days. On the 8th day, cotyledons were harvested every 3 h after the light had been turned on (the light was turned off at 15 h). Total RNA extracted from each sample was analysed by Northern hybridisation with CR9 (A), CR20 (B) and NCl (C) cDNAs as probes. Major bands hybridised with the CR20 cDNA probe are indicated by arrowheads with their estimated lengths. Blank bar, light; shaded bar, darkness.

be due to (1) different members of the gene family, (2) alternative splicing, and/or (3) degradation of the RNAs in intact plants.

The total level of CR20 transcripts (0.8-2.3 kb) was low in cotyledons, hypocotyls, apical buds and young leaves, but was relatively high in roots, and highest in mature and senescent leaves.

We isolated five other CR20 cDNAs by screening a cDNA library from etiolated cucumber cotyledons

using the CR20 cDNA, which had been first isolated from the library by differential screening, as a probe. Two of them were 1.8 kb, one was 1.0 kb, and the rest two were 0.3 kb long. The original CR20 cDNA (1.0 kb) and the other longer one designated CR20L (1.8 kb) were sequenced. Figure 12 shows the cleavage maps of the two cDNAs [30]. CR20L cDNA contains a long insert (0.7 kb) within the same sequence as that of CR20 cDNA, and is a little longer than CR20 cDNA

105

CR9 CR20

kb

-23.13 -

9.42 -

6.56 -

- 4.36-

2.32 -2.02-

1.35 -1.08 -0.87-

0.60 -

0.31 -

Fig. 10. Southern blot analysis of genomic DNA probed with CR9 (left) and CR20 (right) cDNAs. Genomic DNA prepared from cucumber seedlings was digested with six restriction enzymes. Two micrograms of DNA of each digest were electrophoresed on an agarose gel , and analysed by 'Southern hybridisation with CR9 (A) and CR20 (8) cDNAs as probes. The positions of molecular markers are indicated between the two panels.

at each end. Thus, there are at least two types of CR20 transcript that differ in structure. These results suggest that the 1.8 kb cDNA and 1.0 kb cDNA correspond to the longer and shorter transcripts, respectively.

Nucleotide sequence ojCR20 cDNA

Similarly to CR9, CR20 was strongly repressed by cytokinins. However, its nucleotide sequence is quite different from that of CR9, and shows no significant

homology with any sequences in data bases. There are many stop codons, and hence no long open reading frame to encode a polypeptide.

Southern blot analysis oj genomic DNA with CR20 cDNA

Genomic DNA was analysed by Southern hybridis­ation in the same manner as described earlier, except that an EcoRI fragment of CR20 cDNA was used as the

106

(A) CR20

2.3 kb -

1.4 kb -

0.8 kb -

(8) rRNA

255 -

175 -

Fig. 11. (A) Expression of the CR20 gene in various organs of cucumber. The samples were the same as those used in experiments for Fig. 6, and Northern hybridisation was carried out using CR20 cDNA as a probe. Major bands are indicated by arrowheads. (8) The RNA on the gel in (A) was stained with ethidium bromide.

Socl B.mHI

CR20 J J -CR20L I I

I

L-...J

100bp

Comparison of two CR20 eDNAs

HlncllU Sm.1 EcoRl

r···················~~:~·:;:··· ........... . I

HlndlU I - (1.Bkb)

EcoRI

Fig. 12. Restriction maps of two different CR20 cDNAs. Two independent CR20 cDNAs, i.e., CR20 (1.0 kb) and CR20L(1.8 kb) were sequenced. CR20L is identical with CR20 except that it contains an insert of 0.7 kb and is a little longer at each end.

probe (Fig. 10, right). This probe contains HindlII and BamHI sites, but none of the other three sites. Several bands hybridised with CR20 cDNA among fragments generated by EcoRI, HindlII and BamHI, but there were two bands in the case of digestion with ApaI, KpnI and Xhol. This suggests that the CR20 gene does not make up a large and complex family, but a smal1 one.

Comparison ofCR20 with CR9 in their patterns of expression

CR20 showed essential1y the same pattern of changes in expression as CR9, in terms of cytokinin-repression, BA-dose response, specificity for cytokinins, wound­ing and light effects [30]. However, it is different from CR9 in its patterns of expression in the fol1owing two terms. As mentioned above, relatively high levels of the CR20 transcripts were found in roots (Fig. 11), while the CR9 transcript was not detectable there (Fig. 6). CR20 showed a rather broad organ specificity as compared with CR9. It also showed diurnal changes, but opposite to those observed with CR9, showing an increase in the dark period, in respect of the lower two bands (0.8 and 1.4 kb) which were' reproducible (Fig. 9B). These results reveal that the two genes have differ­ent properties in terms of their regulation, perhaps their function.

Conclusions

Expression of genes CR9 and CR20 was markedly repressed within 4 h of incubation with BA in the dark. The repression was dose-dependent and highly specific for cytokinins. The repression of these genes precedes the BA-induced expansion of cotyledons. BA stimu­lates polY,some formation within 6 h after its applica­tion to excised cucumber cotyledons [22]. The timing of the repression of the two CR genes suggests that the repression is closely related to the primary action of this hormone. The products of CR9 and CR20 may block the initiation of cotyledon expansion and its related processes in untreated cotyledons. Cytokinins would initiate these processes by repressing the expression of the genes to release cotyledons from the blockage (Fig. 13). In spite of a number of similarities between the two genes, CR20 showed different patterns of expres­sion in terms of organ specificity and diurnal changes. Moreover, CR20 cDNA has no extensive open reading frame, while that of CR9 contains a coding sequence

CR gene

.......... ~.......... Cytokinin

Product

107

Growth Greening

Fig. 13. A hypothetical schemefor the role of CR genes in blocking developmental processes such as expansion and greening of cotyle­dons. Cytokinins would initiate these processes by repressing the CR genes to release cotyledons from the blockage.

48% identical with a rice cDNA lirI. The transcript of CR20 may be a functional RNA other than mRNA. The physiological function of the products of CR9 and CR20 and how expression of these genes is repressed by cytokinins are subjects of future research.

References

I. Chen C-M, Ertl J, Yang M-S and Chang C-C (1987) Cytokinin­induced changes in the population of translatable mRNA in excised pumpkin coty ledons. Plant Sci 52: 169-174

2. Chen C-N, Jin G, Andersen BR and Ertl JR (1993) Modulation of plant gene expression by cytokinins. Aust J Plant Physiol 200: 609- 619

3. Cotton JLS, Ross CW, Byrne OH and ColbertJT (1990) Oown­regulation of phytochrome mRNA abundance by red light and benzyladenine in etiolated cucumber cotyledons. Plant Mol BioI 14: 707-714

4. Crane KE and Ross CW (1986) Effects of wounding on cytokinin activity in cucumber cotyledons. Plant Physiol 82: 1151-1152

5. Crowell ON and Amasino RM (1991) Induction of specific mRNAs in cultured soybean cells during cytokinin or auxin starvation. Plant Physiol 95: 711-715

6. Crowell ON, Kadlecek AT, John MC and Amasino RM (1990) Cytokinin-induced mRNAs in culrured soybean cells. Proc N atl Acad Sci USA 87: 8815-8819

7. Oominov JA, Stenzler L, Lee S, Schwartz 11, Leisner S and Howell SH (1992) Cytokinins and auxins control the expres-

108

sion of a gene 'in Nicotiana plumbaginifolia cells by feedback regulation. Plant Cell 4: 451-461

8. Fletcher RA and McCullagh D (1971) Benzyladenine as a regulator of chlorophyll synthesis in cucumber cotyledons. Can J Bot 49: 2197-2201

9. Fletcher RA, Teo C and Ali A (1973) Stimulation of chloro­phyll synthesis in cucumber cotyledons by benzy ladenine. Can J Bot 51: 937-939

10. Flores S and Tobin EM (1986) Benzy ladenine modulation of the expression of two genes for nuclear-encoded chloroplast proteins in Lemna gibba: apparent post-transcriptional regula­tion. Planta 168: 340-349

11. Flores S and Tobin EM (1988) Cytokinin modulation of LHCP mRNA levels: the involvement of post-transcriptional regula­tion. Plant Mol Bioi 11: 409-415

12. Henson IE and Wareing PF (1976) Cytokinin in Xanthium strumarium L.: distribution in the plant and production in the root system. J Exp Bot 27: 1268-1278

13. Hewett EW and Wareing PF (1973) Cytokinins in Populus x robusta: qualitative changes during development. Physiol Plant 29: 386-389

14. Kuraishi S, Tasaki K, Sakurai N and Sadatoku K (1991) Changes in levels of cytokinins in etiolated squash seedlings after illumination. Plant Cell Physiol 32: 585-591

IS. Kyte J and Doolittle RF (1982) A simple method for displaying the hydropathic character of a protein. J Mol Bioi 157: 105-132

16. Lerbs S, Lerbs W, Klyachko NL, Romanko EG, Kulaeva ON, Wollgiehn R and Parthier B (1984) Gene expression in cytokinin- and light-mediated plastogenesis of Cucurbita cotyledons: ribulose-I,5-bisphosphate carboxylase/oxyge­nase. Planta 162: 289-298

17. Lu J-L, Ertl JR and Chen C-M (1990) Cytokinin enhancement of the light induction of nitrate reductase transcript levels in etiolated barley leaves. Plant Mol Bioi 14: 585-594

18. Lu J-L, Ertl JR and Chen C-M (1992) Transcriptional regu­lation of nitrate reductase mRNA levels by cytokinin-abscisic acid interactions in etiolated barley leaves. Plant Physiol 98: 1255-1260

19. Memelink J, Hodge JHC and Schilperoort RA (1987) Cytokinin stress changes the developmental regulation of sev­eral defence-related genes in tobacco. EMBO J 6: 3579-3583

20. Memelink J, de Vries SC, Schilperoort RA and Hoge JHC (1988) Changes in the tissue-specific prevalence of translatable mRNAs in transgenic tobacco shoots containing the T-DNA cytokinin gene. Plant Mol Bioi II: 625-631

21. Mitchell JJ and van Staden J (1983) Cytokinins and wounding response in potato tissue. Z Pflanzenphysiol 109: 1-5

22. Ohya T and Suzuki H (1988) Cytokinin-promoted polyri­bosome formation in excised cucumber cotyledons. J Plant Physiol 133: 295-298

23. Ohya T and Suzuki H (1991) The effects of benzyladenine on the accumulation of messenger RNAs that encode the large and small subunits ofribulose-1,5-bisphosphatecarboxy­lase/oxygenase and light-harvesting chlorophyll alb protein in excised cucumber cotyledons. Plant Cell Physiol 32: 577-580

24. Reimmann C and Dudler R (1993) Circadian rhythmicity in the expression of a novel light-regulated rice gene. Plant Mol Bioi 22: 165-170

25. Schmitt JM and Piepenbrock M (1992) Regulation of phosphoenolpyruvate carboxylase and crassulacean acid metabolism induction in Mesembryanthemum crystallinum L. by cytokinin. Modulation of leaf gene expression by roots? Plant Physiol99: 1664-1669

26. Singh S, Palni LMS and Letham DS (1992) Cytokinin biochemistry in relation to leaf senescence V. Endogenous cytokinin levels and metabolism of zeatin riboside in leaf discs from green and senescent tobacco (Nicotiana rustica) leaves. J Plant Physiol139: 279-283

27. Sugiharto B, Burnell IN and Sugiyama T (1992) Cytokinin is required to induce the nitrogen-dependent accumulation of mRNAs for phosphoenol pyruvate carboxylase and carbonic anhydrase in detached maize leaves. Plant Physiol 100: 153-156

28. Teramoto H, Momotani E and Tsuji H (1993) Benzyladenine­induced changes in the translatable mRNA population in excised cucumber cotyledons. Physiol Plant 87: 584-591

29. Teramoto H, MomotaniE, TakebaG and Tsuji H (1994) Isola­tion of a cDNA clone for a cytokinin-repressed gene in excised cucumber cotyledons. Planta 193: 573-579

30. Teramoto H, Toyama T, TakebaG and Tsuji H (1995) Changes in expression of two cytokinin-repressed genes, CR9 and CR20, in relation to ageing, greening and wounding in cucum­ber. Planta 196: 387-395

31. Teyssendier de la Serve B, Axelos M and Peaud-Lenoel C (1985) Cytokinins modulate the expression of genes encoding the protein of the light-harvesting chlorophyll alb complex. Plant Mol Bioi 5: 155-163

32. Tsui C, Tao G, Chen H, Sou Y, Lian H, Tong Z, Li S and Li X (1980) Effect of cytokinins on the expansion and metabolism of excised cucumber cotyledons. Aust J Plant Physiol7: 227-236

33. Uheda E and Kuraishi S (1977) Increase of cytokinin activity in detached etiolated cotyledons of squash after illumination. Plant Cell Physiol 18: 481-483

34. Ulvskov P, Nielsen TH, Seiden P and Marcussen J (1992) Cytokinins and leaf development in sweet pepper (Capsicum annuumL). Planta 188: 70-77

35. Walliton B, Kettmann R, Boxus P and Burny A (1991) Charac­terization of two gene transcripts modulated by cytokinins in micropropagated apple (Malus domestica [L.] Borkh) plantlets. Plant Physiol 96: 479-484

A. R. Smith et al. (eds.), Plant Homwne Signal Perception and Transduction, 109-118. © 1996 Kluwer Academic Publishers.

109

Cytokinin and abscisic acid in regulation of chloroplast protein gene expression and photosynthetic activity

v.v. Kusnetsov 1, R. Oelmiiller2, A.V. Makeev 1, G.N. Cherepneva1, E.G. Romanko1,

S.Yu. Selivankinal , A.T. Mokronosov l , R.G. Herrmann2 & O.N. Kulaeva l

I Timiryazev Institute of Plant Physiology, Russian Academy of Sciences, ul. Botanicheskaya, Moscow, 127276, Russia; 2Botanisches Institut der Ludwig Maximilians Universitiit, Menzinger Str. 67, D-80638 Miinchen, Germany

Key words: abscisic acid, chloroplast proteins, cytokinin, gene expression, lupin, photosynthesis

Abstract

The effect of cytokinin6-benzylarninopurine (BAP) and abscisic acid (ABA) on biogenesis ofthylakoidmembranes of chloroplasts and on the functional activity of pigment-protein complexes in excised lupine yellow cotyledons (Lupinus luteus L.) were studied. Three groups ofthylakoid polypeptides which responded differentially to BAP and ABA were distinguished: (i) cytochrome b559, subunit IV of the cytochrome complex, and the 33 kDa polypeptide of the oxygen-evolving system were induced by BAP in the dark and their synthesis was activated in the light; (ii) accumulation of the P700 chlorophyll a apoprotein of photosystem I and 43 kDa chlorophyll a apoprotein of photosystem II is light-dependent, but it was activated by cytokinin and inhibited by ABA after illumination; (iii) the ,a-subunit of the ATP synthase and cytochrome b6 were already found in the etiolated material and a comparatively weak effect of phytohormones on accumulation of these polypeptides was observed. It was found that phytohormones had negligible effects on the transcript levels of 15 different chloroplast genes. Comparison of mRNA and corresponding protein accumulation in BAP- and ABA-treated cotyledons showed clearly the post-transcriptional regulation of chloroplast gene expression. At the same time, BAP increased significantly accumulation of mRNA of nuclear encoded genes for chloroplast proteins (data not shown) and the activity of nuclear RNA polymerase II. This supports the hypothesis of transcriptional regulation of nuclear-coding genes for chloroplast proteins under cytokinin effect. BAP- and ABA-induced changes in thylakoid membrane polypeptide accumulation correlated well with the phytohormonal effects on the functional activity of both photosystems and on the photosynthetic CO2 assimilation. These results show the biological importance of hormonal regulation of chloroplast biogenesis.

Introduction

A great number of data indicate a crucial role of light [6, 30] and phytohormones (first of all, cytokinins and abscisic acid [4, 11, 21, 26]) in all the phases of chloroplast biogenesis, especially in the etioplast­to-chloroplast transformation. For example, in cell suspension of tobacco [17], cytokinins are indis­pensable to chlorophyll biosynthesis and chloroplast differentiation. Cytokinins accelerate the chlorophyll accumulation in various dicotyledon plants [19, 21, 23], activate differentiation of etioplasts and chI oro-

plasts [26], increase the activity of nuclear and plastid enzymes [3, 7], and stimulate the synthesis of chloro­plast ribosomal RNA [22]. 6-Benzylaminopurine (BAP) affects the mRNA accumulation of chloroplast and nuclear genes encoding chloroplast proteins [4, 16, 25]. However, in the majority of cases, the effect of cytokinin was studied only on the transcript level or on the protein level [13,25]. Furthermore, the results obtained in one plant can be quite different from the data relevant to another plant especially for chloroplast genes [4, 13, 16, 25]. The effect of abscisic acid (ABA) on chloroplast differentiation was shown but the role

110

of this hormone !n chloroplast gene expression is not clear [8, 14,26].

Therefore, the molecular mechanisms of hormonal regulation of chloroplast differentiation are not yet understood. It is necessary to study the effect of phytohormones on functional activity of chloroplasts in relation to their influence on chloroplast protein accumulation. Data on hormonal effect on synthesis of individual pigments and chloroplast proteins are important, but they do not provide complete informa­tion, so newly assembled pigment-protein complexes may not possess functional activity. In this context, the goal of the experiments described here is to study the effects of ABA and BAP on expression of chloroplast protein genes as well as on functional activity of differ­ent pigment-protein complexes and of the chloroplast as a whole.

Materials and methods

Lupin seeds (Lupinus luteus L. cv. Academitcheskii I) were sterilized in 1 % sodium hypochlorite and germi­nated for three days on wetted tissue paper in dark­ness. The cotyledons were cut in dim green light, incubated in darkness for further 24 h on water to decrease endogenous cytokinin and ABA level and placed in Petri dishes on tissue paper soaked with either BAP (2.2 x 10-5 M) or ABA (7.6 x 10-5 M) solu­tions. The optimal concentrations for these hormones were determined in previous experiments [15]. Control cotyledons were placed on water. The cotyledons were incubated at 24 ± 1 DC either in complete darkness or white light (30 W m-2).

Western blot analysis was performed as described in [15]. RNA was isolated from excised cotyledons as described in [14]. Total RNA was used for Northern and dot-blot analysis. For hybridization, DNA-probes specific for plastid and nuclear origin genes from spinach were used [5]. The DNA fragments were excised from plasmids, radiolabelled by random prim­ing and hybridized using standard conditions [14].

Zeatin and ABA were determined in the same sample by competitive ELISA as described in [32].

For determination of RNA polymerase activities, nuclei and chloroplasts were isolated as described pre­viously [12].

Pigment content of greening cotyledons was deter­mined colorimetrically in an 80% acetone extract and calculated according to the formulae cited in [18].

? 350 'ID ~ 16

";; :> ~

.c I' 300 g ~ :>

12 .... ";" 250 :;

'" .... "0

10 200~ E 3 ..2> • !2.

oJ 1.50 IO!. c: OJ

C 100 ~ 0 • "

".

c: • ~o '" <> ~ O! .. ..... 0 D l J 4

Days after sowing

Fig. 1. ABA and zeatin content in cotyledons of developing lupin seedlings and in detached cotyledons. I - ABA, 2 - zeatin. The arrow indicates the time of cotyledon excision.

For isolation of chloroplasts, we used a medium containing 50 mM HEPES [4-(2-hydroxyethyl)-1-piperazine-ethansulfonic acid]-KOH buffer (pH 7.5), 0.33 M sorbitol, 2 mM MgCh, 0.5 g I-I bovine serum albumin, 2 mM EDTA, and 0.1 % {3-mercaptoethanol. Electron transport through photo­system (PS) II was determined by photoreduction of 2,6-dichlorophenolindophenol (DCIP) measured colorimetrically and electron transport through PS I (from reduced DCIP to methylviologen) was measured polarographically as O2 uptake by a Clark-type O2 electrode.

Intensity of potential photosynthesis was deter­mined as 14C02 assimilation rate (exposure length of 3 min, illumination intensity of 10 kLx, temperature of 22°C, 14C02 concentration of 0.27%, 14C02 sp. act. of 200 MBq 1- I) according to the method described elsewhere [24].

All experiments were repeated at least three times. Bars in the Figures represent the mean standard devi­ation from three experiments.

Results

The endogenous zeatin and ABA contents in etiolated lupine cotyledons

The level of endogenous hormones determines a response of a plant to exogenous phytohormones. Therefore, the amounts of endogenous zeatin' and ABA were measured in lupin cotyledons by competitive ELISA. As Fig. 1 shows, ABA was present in relatively high amounts in dry seeds but the level was signifi-

111

s:: >< 0 ~~ - Incubation in ------+ ..... ~ 0

~

~ ;j r:l water, ABA or BAP

0 0 ..... ~ -

D D D I D or L

Kinetics of hormone action

o 72 96 106 156

Hours after sowing Fig. 2. Diagram of the experimental strategy. Lupin cotyledons were detached 72 h after onset of sowing and incubated in water for 24 h in the dark. After that the cotyledons were incubated in water, ABA (6.7 x 10-5 M), or BAP (2.2 x 10-5 M) solutions for 12 h in the dark, then incubation was continued either in the dark or in the light. D - dark, L - light.

cantly decreased during seed germination and seedling growth. In contrast, the level of zeatin was relatively low in dormant seeds but it increased significantly dur­ing the first 3 d of germination. In cotyledons detached from 3-day-old seedlings during their incubation in water in darkness, the content of zeatin decreased markedly. Taking into account these data, all subse­quent experiments were carried out with cotyledons detached from 3-day-old seedlings and preincubated for 24 h in water in darkness to deplete the level of endogenous phytohormones (Fig. 2). Such cotyledons were the most sensitive to exogenous cytokinin and ABA as was demonstrated in preliminary experiments (data not shown).

Hormonal control ofthylakoid polypeptide biosynthesis

Thylakoid apoproteins require both chlorophyll a and chlorophyll b for their incorporation into functional complexes and for stabilization in thylakoid membrane [27]. In addition, carotenoids are required for develop­ment of PS II functional activity [20]. Thus, pigments may play an important role in the functional and struc­tural development of the photosynthetic apparatus. Therefore, kinetics of individual pigment accumula­tion was measured during cotyledon greening under experimental conditions. As Fig. 3 shows, the rates of pigment accumulation were strongly stimulated by BAP and inhibited by ABA.

To study BAP and ABA effect on thylakoid protein biosynthesis, Western analysis was performed with a number of polypeptides relating to all major protein complexes of thylakoid membranes. Results obtained in these experiments were quantified and are presented in Fig. 4. They show that three groups of proteins which had different responses to BAP and ABA could be distinguished. Firstly, cytochrome b559 , subunit IV of the cytochrome complex, and the 33-kDa polypep­tide of the oxygen-evolving complex were not detected in etiolated water- and ABA-treated cotyledons but were present in cotyledons incubated in BAP solu­tion. Hence, BAP induced synthesis of these protein in darkness. In the light, cytokinin activated and ABA inhibited accumulation of these proteins. Secondly, the P700 chlorophyll a apoprotein of PS I and 43-kDa chlorophyll a apoprotein were absent in etiolated cotyledons and appeared only in the light. Cytokinin increased dramatically this proteins accumulation in contrast to ABA which decreased this process. Lastly, the ,a-subunit of the ATP synthase and cytochrome b6 were already found in the etiolated material and the effect of both phytohormones on accumulation of these proteins was relatively weak. The degree of stimula­tion by BAP and light as well as of inhibition by ABA varied for different polypeptides.

112

125 3

A

100

75 ,-.. c 0 '0 V >-

50

+' 0

2 u .. 2S Q) a. 0>

0 3-40 3 ...,

s:: V 30 ..., s:: 0 20 CJ ..., 1 s:: 10 2 QI

S 0 QD 3 ii: 30 C

20

10 2

0

0 24 48 72

Greening time (h ) Fig. 3. Accumulation of chlorophyll a (A). chlorophyll b (B). and the total carotenoids (C) in greening lupin coty ledons. Coty ledons were incubated in water (1). 6.7 x 10-5 M ABA (2). or2.2 x 10-5 M BAP (3) (for details see Fig. 2).

Hormonal regulation of plastid transcript accumulation

Fifteen gene-specific DNA fragments of spinach plastid chromosome (containing the following chloro­plast genes: psaA, psaC, psbA, psbB, psbC, psbD, psbE, psbF, psbH, petA, petB, petD, atpA, atpl, and rbcL) were used for comparative dot-hybridization with RNA isolated from water-, BAP-, or ABA-treated cotyledons. The quantified data of dot-blot analysis are illustrated in Fig. 4B. In most cases, the effect of cytokinin and ABA on the level of chloroplast gene transcripts was not significant. The difference between phytohormonal effects on the steady-state mRNA levels and on protein levels can be seen very clearly from Fig. 5. Despite the similar content of psbE gene transcripts in etiolated cotyledons incubated in water, BAP, or ABA solutions, the amount of corresponding protein (apoprotein of cytochrome b559 )

was dramatically affected by phytohormones. This protein was absent in darkness in cotyledons incubated for 48 h in water or ABA solutions but appeared in BAP-treated cotyledons by 12 h after incubation. The amount increased during cotyledon incubation and light induced the appearance of the protein in water­treated cotyledons. Cytokinin increased and ABA inhibited this protein accumulation throughout these experiment. These data suggest the post-transcrip­tional regulation of expression of chloroplast genes encoding polypeptides of thylakoid membranes. As reported before [15], cytokinin increased the steady­state mRNA levels for nuclear genes coded of chloro­plast proteins.

Hormonal control of RNA polymerase activities

Taking into consideration the very important role of RNA polymerases in the regulation of gene expression, we studied the influence of BAP and ABA on these enzyme activities in nuclei and chloroplasts isolated from cotyledons incubated for 24 h in water, BAP, or ABA solutions both in darkness and in light. As the results in Table 1 show, BAP activated nuclear and chloroplast RNA polymerases in etiolated and green­ing cotyledons. Nuclear RNA polymerase II is the most sensitive to BAP. Light significantly increased the BAP effect on nuclear RNA polymerases I and II. Total RNA polymerase activity in chloroplasts in the dark was stimulated by BAP more than 2-fold.

Hormonal regulation offunctional activity of chloroplasts

The next aim of our work was to study how the phyto­hormonal effects on thylakoid polypeptide accumula­tion correlated with hormone-induced changes in the functional activity of chloroplasts. To estimate the functional activity of photosystems in the hormone­treated cotyledons, we investigated the maximum rates of electron transport of the isolated chloroplasts in the presence of different exogenous artificial acceptors. DCIP photoreduction by PS II in chloroplasts isolated from the ABA-treated cotyledons was suppressed but it was remarkably increased in chloroplasts isolated from BAP-treated cotyledons (Fig. 6B). Hormone-induced changes in PS I activity were similar but less signif­icant (Fig. 6A). Although formation of reducing and energy equivalents (NADPH2 and ATP) in the initial processes of photosynthesis might not be the only lim­iting factor for the rate of C02 fixation, data on the

113

A B 100 Cyt b 559

psbE 100

80 l- 80

60 I- 60

40 l- 40 .-~ 20 '-'"

..f.J 0 d ~ ' oo PSI - I 0

I I-

psaA l-

20 ::0 (b .......

0 P> r+ ~.

100 -< (t)

S 80 ~

60 Q)

> 40 -,-I -t-l ('j

20 ....... Q)

0:: 0

I-

l-

I-

I~ I~ I I I-

80 P>

60 S 0

40 ~ ~ c+

20 /""'

0 ~ ---100 Cyt b 6 petS l- 100

80 80

60 I- 60

40 l- 40

20 I- 20

0 0 12 24 36 46 60 24 .36 48 60 0 12 24 36 24 36 48

Time (h)

~-water D - BAP - ABA Fig. 4. T)1e levels of polypeptides estimated by Western analysis (A) and plastid gene transcripts determined by dot-blot analysis (B) in detached lupin cotyledons. Accumulation of polypeptides and plastid gene transcripts was determined from densitometric quantification of autoradiogram spots. In each panel, data on the left side represent the protein (A) or the transcript (B) levels in etiolated material, those on the right side levels in the light. Abscissa: hours after transfer to the hormone solution (for details see Fig. 2).

influence of hormones on photosystem activities agree well with observed changes in CO2 assimilation in the hormone-treated cotyledons (data not shown).

Discussion

Phytohormone effects on both chloroplast protein gene expression and plastid functional activity were studied

in detached lupin cotyledons which are highly sensi­tive to cytokinins and ABA as has been demonstrated previously [14, 23, 34]. In contrast to previous work which dealt with a steady-state mRNA level of one or a few genes, we analyzed hormonal control of transcript and protein levels for IS plastid and 2 nuclear genes coding chloroplast polypeptides [IS]. It was found that thylakoid polypeptides might be classified on a basis

114

co

~ 0 CD

« co

co

~ ex) ~ ~

.z: .. « \ « ....

Irl ::I: ~ ~ 0 ·c co

co t) -' III

~ CD CI) ~ ~ to r!)

.,&JtO « b « Q.) Cl)

fa s:1 al co

0 Q.)

~ ~ b.O ~ ~ I (\Z

CJ « r:a::I 0 .,&J « ~

Irl ~

cD to) co ..... .a 0

~ ~ ~ CO Q.)

+1 ~ 0 « Q.) <i M +1 ~ s:1 0 0 co p.. cD t)

as I ~ ~ CD .z:

I s:1 til .. en

III « 0 <I{ en ..... :p Irl w ~ as z

C; al N co :::.:: ..... ~

~ '"d ~

..... ~ ~ CI ~ a

s:1 ~ (\Z

~ « <i Cl)

+1 +1 III co r: co 0 ~

~ ~ (\Z .... « CD <I{

<C

Fig. 5. Hormonal regulation of psbE-gene expression in lupin cotyledons. Western analysis for apoprotein cytochrome bSS9 (A) and dot-blot analysis for psbE gene transcripts from lupin cotyledons (B). Proteins and RNA were extracted from cotyledons incubated in ABA (A), BAP (B), or water (W) in the dark or in the light.

115

Table 1. The effect of BAP treatment of detached lupin cotyledons on the activity of RNA polymerase I and II in nuclei and the activity of chloroplast RNA polymerase. Nuclei and chloroplasts were isolated as described previously [12]. Cotyledons were incubated in water or BAP during 36 h; light period was 24 h (for details see Fig. 2).

Activities of RNA polymerases

Treatment Conditions cpm per 10 JLg DNA % of control (water)

RNA polymerase I

Water Dark 5450 ± 1518 100

BAP Dark 7507 ± 157 138

Water Light 7269 ± 1265 100

BAP Light 12800 ± 835 175

RNA polymerase II

Water Dark 6359 ± 1370 100

BAP Dark 10154± 959 160

Water Light 7885 ± 1370 100 BAP Light 27072 ± 4793 343

Chloroplast RNA polymerase

Water Dark 12421 ± 2335 100 BAP Dark 33683 ± 2686 271

of the types of their accumulation in the presence of cytokinins or ABA (Fig. 4A). The weakest response to exogenous BAP and ABA was observed for polypep­tides which were already present in etiolated cotyle­dons. In darkness, cytokinin induced the accumulation of another group of polypeptides (cytochrome b559 ,

subunit IV of the cytochrome b / f complex, and the 33-kDa polypeptide of the water-oxidizing complex). They were not detectable in water- or ABA-treated cotyledons in darkness. Accumulation of the third group of polypeptides (subunit I of PS I and the 43-kDa chlorophyll a-binding protein of PS IT) was strongly light-dependent. Cytokinin activated and ABA inhib­ited the accumulation of these proteins in cotyledons incubated in the light.

The results of dot-hybridizations demonstrate that ABA and BAP effects on the steady-state level of plastid-encoded mRNAs for thylakoid membrane polypeptides are negligible (Fig. 4B). Comparison of hormonal effects on the mRNA and protein accumu­lation (Figs. 4B and 4A) provides strong evidence of post-transcriptional mechanism(s) for the regulation of chloroplast gene expression. It should be noted that the predominance of post-transcriptional control in light regulation of chloroplast gene expression has become more increasingly accepted [2, 5, 9, 10]. Possible ways of post-transcriptional regulation are discussed in the

literature [6, 9, 10, 29]. However, transcriptional control of chloroplast gene expression is apparent in greening seedlings of Sorghum [33].

As has been demonstrated earlier [19, 25, 28], cytokinin stimulates the accumulation of gene tran­scripts of chloroplast proteins coding in nuclei. In our work, this was shown for genes encoding a cab polypeptide of PS I and the ATP-synthase ,-subunit [15]. These data are in agreement with results on BAP-induced increase in nuclear RNA polymerase II activity (Table 1). BAP-induced stimulation of the total chloroplast RNA polymerase activity without a dramatic effect on chloroplast gene transcript accumulation reflects an increase in plastid rRNA synthesis which is under BAP influence [22]. Thus, the expression of chloroplast and nuclear genes coding thykaloid polypeptides are regulated differently by phytohormones. Clearly, hormonal and light regula­tion of thykaloidid protein accumulation is a highly complicated process. It can be illustrated by the exam­ple of accumulation of cytochrome b6 (Fig. 4A) and subunit IV of the cytochrome b / f complex in the pres­ence of BAP [15]. Both polypeptides are the parts of the same functional complex. In spite of this, they differ totally in their regulation by cytokinin (Fig. 4). Phytohormonal regulation of accumulation of PS II polypeptides was found to be also complicated (Figs. 4

116

60 3 r--c 0

Q) -0 ..::t: Q) 45 >.. 0 ....... +-' 0 0.... c.> ::J L...

Q) 30 1 N a.

0 2 I ..c

'0 15 E ::t. -

0

30 3

C ...-... c

0 0 +-' IJ

<..> oJ)

:J $--0 0 20 Q) () I-

0 I... Q)

-+-' a... 0 ..r 0... I

..c 0.... '0 10 0 E 0 ~

1

2 o

o 24 48 72

Greening time (h) Fig. 6. Development of photochemical activities of photosystems in plastids during greening. A - PS I activity. Rates of electron transport were measured by the 02 uptake in the presence of methylviologen with reduced DCIP as electron donor for PSI. B - PS II activity. Photoreduction of DCIP was measured calorimetrically with H20 as electron donor for PS II. Chloroplasts were isolated from cotyledons incubated in water (1),6.7 X 10-5 M ABA (2), or 2.2 x 10-5 M BAP (3).

and 5). In this connection, it was interesting to compare the hormonal influence on levels of different thylakoid polypeptides and on the functional activity of newly synthesized photosynthetic complexes such as PS I andPS II.

Assembly of active complexes is a multi-stage, energy-dependent process requiring the coordinated synthesis of many different pigments and polypep­tides [1,27]. ABA and BAP affected both protein and

pigment accumulation. Electron transport measure­ments showed that these data agree with phyto­hormonal effects on development of photochemical activity of photosystems (Fig. 6). Activity of a photo­system is a function both the centre activity and of reaction centre amount. Preliminary results suggested that hormones could change both the abundance and activity of PS reaction centres (data not shown). Changes in photochemical activity of thylakoid mem-

branes, in tum, l'ead to changes in C02 assimilation. The direct measurements of potential photosynthesis showed that after 48 h of greening in the presence of phytohormones, the CO2 fixation rate was reduced by about 40% in ABA-treated cotyledons and doubled in BAP-treated cotyledons.

Thus, cytokinins and ABA regulate not only the accumulation of individual chloroplast proteins but also the functional activity of pigment-protein com­plexes as a whole.

Acknowledgements

We thank Prof. G.!. Taninucho for kindly donat­ing lupin seeds (Byelorussia, Gorky, Agricultural Academy of Sciences) and Dr. N. N. Karaviako for antibodies against ABA and zeatin (Institute of Plant Physiology, Moscow). This work was supported by the Russian Foundation for Fundamental Research, Grant No.: 95-04-12231 and by the International Science Foundation.

References

I. Akoyunoglou G and Argyroudi-Akoyunoglou J (1986) Post­translational regulation of chloroplast differentiation. In: AkoyunoglouG and Senger H (eds) Regulation of Chloroplast Differentiation, pp 571-582. New York, Alan R. Liss

2. Deng XW and Gruissem W (1987) Control of plastid gene expression during development: the limited role of transcrip­tional regulation. Cell 49: 379-387

3. Feierabend J (1969) Der Einflub von Cytokininen auf die Bildung von Photosyntheseenzymen in Roggenkeimlingen. Planta Berlin 84: 11-29

4. Flores S and Tobin EM (1988) Cytokinin modulation of LHCP mRNA levels: the involvement of post-transcriptional regula­tion. Plant Mol Bioi 11: 409-415

5. Herrmann RG, Oelmiiller R, Bichler J, Schneiderbaur A, Steppuhn J, Webel N, Tyagi AK and Westhoff P (1991) The thylakoid membrane of higher plants: genes, their expression and interaction. In: Herrmann RG and Larkins BA (eds) Plant Molecular Biology 2: 411-428. New York, Plenum Press

6. Herrmann RG, Westhoff P and Link G (1992) Biogenesis of plastids in higher plants. In: Herrmann RG (ed) Plant Gene Research 6: 275-349. Wien, Springer

7. Karavaiko NN, Ohmann E and Kulaeva ON (1975) Effect of cytokinin on enzyme activity in isolated pumpkin cotyledons. S'oviet Plant Physiol 22: 1031-1038

8. Khokhlova VA, Karavaiko NN, Podergina TA and Kulaeva ON (1978) Antagonism in effects of abscisic acid and cytokinin on the structure and biochemical differentiation of chloro­plasts in isolated pumpkin cotyledons. Tsitologiya 20: 1033-1039

117

9. Klaff P and Gruissem W (1991 ) Changes in chloroplast mRNA stability during leaf development. The Plant Cell 3: 517-529

10. Klein RR, Ma~on HS and Mullet JE (1980) Light-regulated translation of chloroplast proteins. I. Transcripts of psaA, psaB, psbA and rbcL are associated with polysomes in dark grown and illuminated barley seedlings. J Cell Bioi 106: 289-30 I

11. Kulaeva ON (1982) Honnonal Regulation of Physiological Processes in Plants on the Levels of RNA and Protein Synthesis. The 41 st TImiryazev Lecture. Moscow, Nauka

12. KulaevaON, SelivankinaSYu, RomankoEG, NikolaevaMK and Nichiporovich AA (1979) Cytokinin activation of RNA polymerase activity in isolated nuclei and chloroplasts. Soviet Plant Physiol 26: 1016-1028

13. Kusnetsov VV, Cherepneva GN and Kulaeva ON (1990) Honnonal regulation of chloroplast gene expression in etiolated wheat seedlings. Doklady Acad Nauk SSSR 312: 253-256

14. Kusnetsov VV, Oelmiiller R, Sarwat M, Porfirova SA, Cherep­neva GN, Herrmann RG and Kulaeva O.N. (1992) Honnones, light and temperature control chloroplast genes expression in isolated cotyledons of yellow lupin. Soviet Plant Physiol 39: 1154-1164

15. Kusnetsov VV, Oelmiiller R, SarwatMI, Porfirova SA, Cherep­neva GN, Herrmann RG and Kulaeva ON (1994) Cytokinins, abscisic acid and light affect accumulation of chloroplast proteins in Lupinus luteus cotyledons without notable effect on steady-state mRNA levels. Specific protein response to lightlphytohonnoneinteraction. Planta 194: 318-327

16. Lerbs S, Lerbs W, Klyachko NL, Romanko EG, Kulaeva ON, Wollgiehn R and Parthier B (1984) Gene expression in cytokinin- and light-mediated plastogenesis of cucurbita cotyledons; ribulose 1,5 bisphosphate carboxylase oxygenase. Planta 162: 289-289

17. Lescure A-M and Seyer P (1981) Effect of cytokinin on plastid differentiation in tobacco cell suspension. In: Quem I and Peand-Lenoel C (eds) Metabolism and Molecular Activities of Cytokinins, pp 289-307. Berlin, Springer-Verlag

18. Lichtenhaler HK and Wellburn AR (1983) Detenninations of total carotenoids and chlorophy lls a and b of leaf extracts in different solvents. Biochem Soc Trans II: 591-592

19. Longo GPM, Bracale M, Rossi G and Longo CP (1990) Benzyladenine induced the appearance of LHCP-mRNA and of the relevant protein in dark-grown excised watennelon cotyledons. Plant Mol Bioi 14: 569-573

20. MarkgrafT and Oelmiiller R (1991) Evidence that carotenoids are required for the accumulation of a functional photo­system II, but not photosystem I in the cotyledons of mustard seedlings. Planta 185: 97-104

21. Mikulovich TP, Khokhlova VA, Kulaeva ON and Sveshnikova IN (1971) Effect of 6-benzylaminopurine on isolated pumpkin cotyledons. Soviet Plant Physiol18: 98-106

22. Mikulovich TP, Wollgiehn R, Khokhlova VA and Kulaeva ON (1978) Synthesis of plastid and cytoplasmic ribosomal RNAs in isolated pumpkin coty)edons. Biochem Physiol Pflanzen 172: 101-110

23. Mlodzianowski F and Gesela E (1974) Effect of kinetin and chloramphenicol on chlorophyll synthesis and chloroplast development in detached lupin cotyledons under low light intensity. Acta Soc Bot Poland XLIII: 149-160

24. Mokronosov AT and Dobrov AV (1973) Chamber for photo­synthetic metabolism studies and detennination of poten­tial photosynthesis in isolated leaves. In: Mokronosov AT

118

(ed) Problems of Photosynthesis Regulation 3: 149-153. Sverdlovsk, Uralskii State University

25. Ohya T and Suzuki H (1991) The effect of benzyladenine on the accumulation of messenger RNAs that encode the large and small subunits of Rubisco and light harvesting chlorophyll a /b protein in excised cucumber cotyledons. Plant Cell Physiol32: 577-580

26. Parthier B (1979) The role of phytohormones (cytokinins) in chloroplast development. Biochem Physiol Pflanz 174: 173-214

27. Shimada Y, Tanaka A, Tanaka Yet al. (1990) Formation of chlorophyll-protein complexes during greening. I. Distribution of newly synthesized chlorophyll among apoproteins. Plant Cell Physiol 31: 639-647

28. Teyssender de la Serve B, Axelos M and Peand-Lenoel C (1985) Cytokinins modulate the expression of genes encoding the protein of the light-harversting chlorophyll a/b complex. Plant Mol Bioi 5: 155-163

29. Stem DB .and Gruissem W (1987) Control of plastid gene expression: 3-inverted repeats act as mRNA processing elements, but do not terminate transcription. Cell 51: 1145-1157

30. Tobin E and Silverthorme J (1985) Light regulation of gene expression in higher plants. Ann Rev Plant Physiol 36: 569-593

31. Walker DA (1985) Oxygen content and chlorophyll fluores­cence measurements. In: Coombs J, Hall DO, Long SP and Scurlock JMO (eds) Techniques in Bioproductivity and Photo­synthesis, pp 167-185. Oxford, Pergamon Press

32. Weiler EW, Eberle J, Martens R, Atzorn R, Feierabend M, Jourdan PS, Arnscheidet A and Wieczorek U (1986) Antiserum- and monoclonal antibody-based immunoassay of plant hormones. Soc Exp Bioi, Seminar ser., 29. Immunology in plant science, pp 3-27. Cambridge, Cambrige Univ. Press

33. Westhoff P and Schrubar H (1991) Greening of etiolated monocots - the impact of leaf development on plastid gene expression. In: Herrmann RG and Larkins BA (eds) Plant Molecular Biology 2: 429-438. New York, Plenum Press

34. Zayakin VV (1984) Isolated lupin cotyledons as a system for studying mechanism action of cytokinin. Soviet Plant Physiol 312:792-795

A. R. Smith et al. (eds.), Plant Hornwne SigTUJI Perception and Transduction, 119-125. © 1996 Kluwer Academic Publishers.

119

Ethylene binding sites in higher plants

N.V.J. Harphaml , A.W. Berryl, M.G. Hollandl , I.E. Moshkov2, A.R. Smith l & M.A. Hall l ,* 1 Institute of Biological Science, University of Wales, Aberystwyth, Penglais Campus, Dyfed Wales, UK SY23 3DA; 21imiriazev Institute of Plant Physiology, Acad. Sci. Russia, 35 Botanichestaya Str. Moscow 127276, FSU (* author for correspondence)

Key words: Arabidopsis, ethylene, ethylene binding protein, signal transduction

Abstract

A review of work carried out on ethylene binding in higher plants is presented. The use of radio-labelled displace­ment assays has identified specific 14C-ethylene binding in all tissues so far studied. virtually all higher plants studied contain at least two classes of ethylene binding site, one of which fully associates and dissociates in about 2 h and a class of sites that takes up to 20 h to become fully saturated. Although the types of site differ in their rate constants of association they have similar and high affinities for ethylene.

A series of Arabidopsis thaliana mutants shown to vary in sensitivity to ethylene have been analysed for 14C_ ethylene binding. One mutant, eti 5, which was shown to be unaffected by ethylene concentrations of up to 10,000 j.tL L -I was also shown to exhibit reduced binding.

In vivo and in vitro studies on pea have shown that ethylene binding can be detected in this tissue. In vitro studies have shown that both membrane and cytosolic fractions contain measurable amounts of ethylene binding. Interestingly, cytosolic ethylene binding consisted only of the fast associating/dissociating type.

Developing cotyledons of Phaseolus vulgaris contain a higher concentration of ethylene binding sites that other tissues and only contain the slow dissociating component. These facets have allowed the purification of ethylene binding protein(s) (EBP) from this tissue. The proteins which bind ethylene can be resolved into two bands of 26 and 28 kDa on semi-denaturing PAGE and the proteins appear to be single entities on a 2-D gels.

Data will be presented which indicate a possible role for heterotrimetric G-proteins in the early stages of the ethylene signal transduction pathway.

Historically, radio-labelled ethylene binding assays have been' used to identify ethylene binding sites in higher plants. [12,13,14]. One of the most extensively studied ethylene binding sites is that from develop­ing cotyledons of Phaseolus vulgaris. The site has a high affinity (KD) for ethylene which is 0.2 j.tL L- 1 in the gas phase or 0.88 . 10- 11 M in the liquid phase. A range of ethylene analogues show good correlation between the known concentration required for biolog­ical activity in ethylene responsive systems and the concentration required to compete with ethylene for occupancy of this site (K;). The affinity of the site for these analogues is at least two orders of magnitude below the affinity for ethylene. This evidence suggests

that ethylene binding detected by this type of assay is highly specific and of biological importance [5]. The majority of tissues studied in vivo have been shown to contain at least two classes of ethylene binding site. One class of site fully associates in 2 h and shows equally rapid association, while a further class takes up to 20 h to become saturated and the rate constant of dissociation is also low. In contrast to this situa­tion the cotyledons of Phaseolus only contain the slow type of binding site and this fact, in combination with the higher concentration of ethylene binding site com­pared to other tissues has made the cotyledon an ideal material from which an ethylene binding protein (EBP) could be purified. Although this site may differ from

120

those found in other tissues, the simplicity and small size of the ethylene molecule and the high affinity of the cotyledon site indicated that this tissue would be useful as a model system for the purification of the EBP.

The cotyledon EBP has been purified using differ­ential centrifugation to produce a membrane pellet that is stripped of extrinsic proteins by a high salt, high pH treatment. Subsequently, the binding activity could be solubilized using non-ionic detergent [16]. This treatment did not significantly alter the ethylene binding characteristics of the protein [17]. Solubilized proteins were subjected to anion exchange on DEAE Sepharose™ and Mono QTM using FPLC™ [7]. The final step of the purification protocol was prepar­ative gel electrophoresis. The EBP is an integral membrane protein which is highly hydrophobic and this has rendered other purification methods ineffec­tive. Cotyledons pre-labelled with 14C-ethylene were subjected to the scheme outlined above, the active fraction from the Mono Q column was mixed with a sample buffer containing Triton X-100TM as a deter­gent but no ,B-mercaptoethanol. The sample was not heated prior to loading to the gel and this semi­denaturing gel system has allowed the retention of 14C_ ethylene activity after electrophoresis. If the gel is then sliced and radio activity is counted the 14C-ethylene activity is clearly associated with two bands of 26 and 28 kDa (Fig. 1). Experiments were conducted to inves­tigate the glycosylation status of the binding proteins using an antibody-based glycan detection kit. A bean cotyledon preparation was purified to produce Mono Q samples which were Western blotted and challenged with antibodies that can detect glycosylated proteins and it appeared that only the upper band was glycosy­lated (Fig. 2).

The 26 and 28 kDa have been excised from gels, electroeluted and subjected to 2-D gel electrophoresis. Figure j shows that each band is a single spot on a 2-D gel and that the proteins have slightly different and basic pI's.

Antibodies have been raised to each of the two proteins eluted from gels and Titremax ™ was used as an adjuvant. Using this method it has been pos­sible to raise antibodies against the 26 and 28 kDa bands. Although the antibodies were ineffective for screening crude extracts they did show a high specific reaction against partially purified preparations. The antibodies have been used to screen Lambda ZAp™ expression libraries from Phaseolus abscission zones and Arabidopsis leaves. This work did not yield posi-

Table 1. Specific 14C-ethylene binding to Triton X- 100 solubilized samples after incubation with radiolabel for 20-h. Values in brackets indicate the time from the start of imbibition. All data are typical of at least two experiments

Source tissue

Cotyledons (24 h) 0.85 \5.1

Cotyledons (6 d) 1.1 7.0

Plumule (6 d) 1.43 1.4

Hypocotyl (6 d) 0.88 0.4

Radicle (6 d) 1.43 1.1

tive results, probably due to the combination of detect­ing a low abundance protein and antibodies which showed low avidity.

Internal and N-terminal sequences have been obtained for the 28 kDa band. A 16 amino acid N-terminal sequence shows no homology to other sequences on the Swiss Prot database. There was some homology for one of the internal sequences which showed 75% identity in an 8 amino acid overlap to a protein kinase substrate. Synthetic polypeptides have been produced based on two of the internal sequences and these are currently being used to screen for homol­ogous peptides in other systems.

1. Ethylene binding in pea

The bean cotyledon system is useful in that it provides a source of material that is rich in a type of binding site that can be purified, albeit with great difficulty. Whilst the immature cotyledons do not have any recorded response to ethylene following imbibition there is a reduction in binding site number in the cotyledons as shown in Table 1. Specific 14C-ethylene binding was also measured in the plumule, hypocotyl and radicle which emerge from the germinated seed.

The lab has worked on the etiolated pea system as it has been characterised as a classical ethylene responsive system [1]. In vivo studies have shown that etiolated peas have at least two classes of ethylene binding site. In pea a typical pattern of association! dissociation would show one class of ethylene bind­ing site associates and dissociates in 2 h; this has been termed the fast site. Incubation of pea epicotyls with radio-labelled ethylene for longer periods demon­strated that a further class of site took some 20 h to become fully associated; this has been termed the

121

L~M S • lD)

/ 114 &7 2 -43 3

I • 4 "'-

30 ------5 ------II \

20·1 7 , •

14-4 II

10 ! 11 • 12

I \ 13

300 400 .... ,If 1.1 .lIc •

Fig. 1. Semi-denaturing SDS-PAGE of low molecular weight markers (left hand lane) and Mono Q purified EBP (right hand lane). The bands detected at 26 and 28 kDa in the Mono Q samples were demonstrated to contain 14C-activity when lanes containing the Mono Q sample were sliced and counted for radio activity.

50S- PAGE

~ £ .. co i

. 0 ..

0 5 0 0 . ;; c c C .. .. 0 0 () 4 ::E ,:

Oa -- - 94 - 6 7 - 43

- 30

- 20.1

Glycan fe ..

'" 2 ~ 0 0 ~ 0 0 c c c 0 0 ..

::E ::E ,:

:: .. 5 ;; " ()

kD8

_ 9 4 - 67 - 43

- 30

- 201

-14 4

Fig. 2. Semi-denaturing SDS-PAGE of active Mono Q fractions, transferrin (a glycosylated protein) and creatinase (unglycosylated protein), together with low molecular weight markers. Western blot analysis using a DIG glycan detection kit (Boehringer Mannheim) suggests that the upper band is glycosy lated, the lower band appears not to be glycosy lated.

slow site [I5]. The fast and the slow sites have iden­tical affinities for ethylene with a KD of 6-8 . 10- 11

M. The fast associating class of sites has high and appropriate affinities for physiologically active ana­logues of ethylene and CO2 is without effect on bind-

ing [15]. Scatchard analysis of ethylene binding data has highlighted the effect of endogenous ethylene pro­duction on the measured affinity of the binding sites. In experiments when endogenous ethylene production was not inhibited a reduction in the apparent affinity

122

pH 3 pH 10 l,' ~E'" 4 4 '. "'.. ). •

94 67 ~~ . 43 _

30 _,...,

20.1

14.4 _

" ~.

pH 3

94 67 43

20.1

14.4

pH 10

28 kDa

Band

26 kDa

Band

Fig. 3. Proteins which retain 14C-ethylene binding activity were electroeluted from semi-denaturing SDS-PAGE and subjected to 2-D gel electrophoresis. The 26 kDa and the 28 kDa band were resolved as single spots using this system.

of the slow site was observed, however there was no appreciable alteration in the binding site number, a phenomenon which is expected of a competitive inhibitor. It is for this reason that all tissue used in binding experiments is now treated with inhibitors of ethylene biosynthesis prior to binding experiments. In vitro studies in pea have shown the distribution of ethylene binding sites in the soluble and particulate fractions following partitioning by high speed centrifu­gation [9]. Figure 4 shows an association/dissociation plot for membrane and soluble fractions from pea epi­cotyl tips. Specific ethylene binding in the membrane fraction was similar to that found in vivo but interest­ingly only the fast site could be detected in the soluble fraction.

A comparison of the KD from in vitro and in vivo studies has shown that the affinity of the site is similar in both cases at 7 . 10- II M in vivo and 1.2 . 10- II

M in vitro. These figures are in good agreement with

the concentration of ethylene required to bring about a half maximal response in etiolated pea epicotyls.

2. Arabidopsis mutants

Another species that has been studied is Arabidop­sis thaliana which also shows well defined responses to ethylene. When Arabidopsis seedlings are treated with ethylene they respond by a reduction in elonga­tion growth, an increase in isodiametric growth and an increase in the curvature of the plumular hook. This effect has provided a simple screen for seedlings that have reduced ethylene sensitivity [2, 4, 6]. The eti series of mutants are perhaps the best characterised in terms of physiological responses and 14C-ethylene binding. Several distinct lines have been isolated and termed eti 3, eti 5, eti 8, eti 10 andeti 13 [6]. The mutant eti 8 has proved to be difficult to work with as a reduced

' .. . I .. c ~ :;;

:.:: u

1.0

0.8 II

./ 061cpla'

Fig. 4. 5-day-old pea epicotyl tips were extracted and centrifuged at 9,000 g for 30 min. The supernatant was subjected to a further cen­trifugation at 96,000 g for 4-h. The resulting pellet was resuspended to produce a membrane-enriched fraction (96 kp), the supernatant from the high speed spin was used as the soluble fraction (96 ks). An association plot for 14C-ethylene binding to an enriched membrane fraction (e-e) and to a soluble fraction (0-0) was produced by incubating with 14C-ethylene for various time intervals. Dissociation from the soluble fraction is also shown, 96 ks(d).

root gravitropic response renders seedling establish­ment difficult. Physiological characterisation of the other mutants in terms of both etiolated seedling and adult plant responses have shown that all the mutants exhibit some reduction in ethylene sensitivity [6].

As an example of the effect of these mutations on ethylene response Fig. 5 shows the effect of ethylene on plumular hook angle. In the presence of ethy lene, wild­type seedlings exhibited hook closure, with a thresh­old between 0.01 and 0.1 jlL L -\, a half maximal response between 0.1 and 1 jlL L -\ and saturation between 10 and 100 jlL L - \. The mutant eti 5 was insensitive to ethylene up to a concentration of 10,000 jlL L -\. Although the other three mutants did show some response to ethylene, none of them showed a response comparable to wild-type in this type of assay even at very high ethylene concentrations. Similar patterns of reduced sensitivity were found in other seedling responses such as the reduction in elongation of both the hypocotyl and radicle [6]. The mutation also affected ethylene responses in adult plants and the induction of soluble and salt extractable peroxidase was measured in wild-type and mutant plants. Salt extractable activity was very low and although the induction by ethylene appeared to be less marked in eti 5 than in wild-type and the other mutants these results must be treated with caution. In the case of sol-

123

270

· · ~ :':! · i 170

1 1 0;

Fig. 5. The effect of ethylene upon plumular hook angle in wild-type and mutant Arabidopsis thaliana. Wild-type (e), eti 3 (0), eti 5 (0), eti 10 (n), eti 13 (s). Bars represent mean ± s.e. of20replicates.

uble activity a threefold stimulation by ethylene was observed for both wild-type and eti 13, with a twofold increase in eti 3. Both eti 5 and eti 10 had higher con­centrations of peroxidase activity than untreated wild­type plants but ethylene had no significant effect upon the activity. The eti 5 mutation also affected the rate of ethylene production in adult plants as can be seen in Table 2.

The results in Table 2 suggest that ethylene autoin­hibits its own production in Arabidopsis. Thus, the rate of ethylene production in wild-type for the first hour of incubation is more than twice that for the whole of the 20-h period. It is notable that eti 5 plants not only pro­duce ethylene at a much higher initial rate but there is also no indication of autoinhibition. In this respect the eti 5 mutant is different to the etr mutant which does not show over-production of ethylene [2]. The ein 1-1 and ein 2-1 mutants showed increased accumulation of ethylene when incubated for 20-h but no data has been presented on rates of ethylene production [4].

The measurement of ethylene binding in wild-type and eti mutant Arabidopsis has been complicated by the high rates of ethylene production and the lack of auto­inhibition in eti 5 [14]. However, the use of inhibitors of ethylene biosynthesis has allowed sensible measure­ments of ethylene binding to be undertaken and Arabidopsis shows a pattern of fast and slow sites that is similar to that found in pea. Table 3 shows a summary

124

Table 2. Ethylene emanation by 6-week-old wild-type and mutant eti 5 Arabidopsis over I, 4 and 20 hour incubation periods. (Mean ± S.E. of three replicates)

Incubation time (h) 0-1 1-4 4-20

Wild-type ethylene emanation 0.165 ± 0.022 0.166 ± 0.005 0.069 ± 0.008 (nmoles g-I fwt. h -I)

eti 5 ethylene emanation 0.714± 0.002 0.871 ± 0.048 0.955 ± 0.074

(nmoles g-I fwt. h- I)

Table 3. 14C-ethylene binding in wild-type and mutant plants of Arabidopsis. Six-week-old plants (10 g) were exposed to 14C-ethylene (52 nL L -I) in the presence or absence of 20 ILL L -I 12C-ethylene to determine specific ethylene binding. Plants were pretreated with 0.1 mM aminoethoxyvinylglycine, 1.0 mM CoCh and 1%02 to inhibit ethylene biosynthesis. Specific 14C-ethylene binding was measured at I and 20-h. BDL = Below Detectable Limit

General order of

sensitivity of ethylene

Wild-type

eti 3 2

eti 5 6

eti 8 3=

eti 10 5

eti 13 3=

of the ethylene binding data obtained for wild-type and eti mutants of Arabidopsis.

Clearly, the results show that there is no obvious correlation between a reduction in ethylene binding and reduced ethylene sensitivity. Although eti 5 does show a reduced fast component, eti 10 which is rela­tively insensitive shows a fast component binding which is comparable to Wild-type. At the moment we do not know what is the functionality of each site and if either is a receptor. The lack of correlation between binding and sensitivity opens up the possibility that some of these mutants may well be altered in the trans­duction of the ethylene stimulus.

3. Signal transduction

Although signal transduction in plants is not as well characterised as it is in animals there is a growing body of evidence that there is some homology in the signalling molecules used by plants and animals [18]. There is evidence for a role for protein phosphoryla­tion in the control of ethylene binding [10] and in the transduction of some ethylene responses [11]. Figure

14C-ethylene binding (pmol [g FW]-I)

Fast associating sites Slow associating sites

0.66

0.76

0.28

0.39

0.73

0.89

0.15

BDL

0.12

BDL

0.12

BDL

6 shows the effect of NaF on specific ethylene bind­ing in membrane-enriched pellets from pea. A 16-h incubation with various concentrations of NaF prior to measuring 14C-ethylene binding over 2-h showed that NaF at low concentrations (10-30 mM) first abol­ished ethylene binding but at higher concentrations of NaF (100 mM) binding is restored. This type of biphasic plot is indicative of a receptor that is linked via a heterotrimetric G-protein [8] and although this type of transduction mechanism is common to many animal hormones only one report has provided this type of evidence for plant systems [3]. This result provides the first tentative evidence for heterotrimetric G-protein involvement in ethylene signalling although other sys­tems may also be involved given the pleiotropy of ethylene effects.

In conclusion, we have identified specific ethy­lene binding sites in all tissues so far examined. The ethylene binding proteins from Phaseolus have been purified to single spots on 2-D gels and anti­bodies have been raised to the entire protein. Sequence analysis has shown that the protein does not share significant homology to sequences contained on databases. Mutants of Arabidopsis showing reduced

" .0

! CI 3.2

...... (5 E

2." ~ II I: II >. 1.6 '5 .. 'a 0.8 I: :::J 0

CD

0.0 o 10 30 100

IN.F) (mllAl

Fig. 6. The effect of NaF on specific 14C-ethylene binding to a post-mitochondrial supernatant prepared from 5-day-old pea epicotyl tips. Samples were pre-treated with the various concen­trations of NaF for 16-h prior to measuring specific 14C-ethylene binding over2-h. Bars represent mean ± s.e. of three replicates.

ethylene sensitivity have been characterised but no clear link between reduced sensitivity and ethylene binding could be demonstrated. There is preliminary evidence for the involvement of heterotrimetric G­proteins in signal transduction although much work is needed in this interesting and challenging area of ethylene biology.

Acknowledgements

This work was funded in part by the European Com­munities' BRIDGE Programme and the BIOTECH Programme as part of the Project of Technological Priority 1993-1996. We would also like to acknowl­edge the support of the Royal Society under the Exchange Visitors Programme, International Associa­tion for the Promotion of Co-operation with Scientists from the Independent States of the FSU (INTAS) and theBBSRC.

References

I. Abeles FB, Morgan W and Saltveit ME Jnr (1992) Ethylene in Plant Biology. San Diego, USA: Academic Press

2. Bleeker AB, Estelle MA, Somerville C and Kende H (1988) Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana. Science 241: 1086--1088

125

3. De Boer AH, van der Molen GW, Prins HBA, Korthout HAAJ and van der Hoeven PCJ (1994) Aluminium fluoride and mag­nesium, activators ofheterotrimetric GTP-binding, affect high­affinity binding of the fungal toxin fusicoccin-binding protein in oat root plasma membranes. Eur J Biochem 219: 1023-1029

4. Guzman P and Ecker JR (1990) Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. Plant Cell 2:513-523

5. Hall MA, Bell MH, Connem C, Raskin I, Robertson D, Sanders 10, Smith AR, Turner R, Williams RAN and Wood CK (1990) Ethylene receptors. In: Molecular Aspects of Hormonal Regu­lation of Plant Development, pp 233-240. The Hague, The Netherlands: SPB Academic publishing bv

6. Harpham NVJ, Berry AW, Knee EM, Rovedo-Hoyos G, Raskin I, Sanders 10, Smith AR, Wood CK and Hall MA (1991) The effect of ethylene on the growth and development of wild­type and mutant Arabidopsis thaliana (L.) Heynh. Ann Bot 68:55-61

7. Harpham NVJ (1992) Studies on ethylene receptors in Arabidopsis thaliana (L.) Heynh. PhD Thesis, UCW, Aberystwyth

8. Higashijima T, Ferguson KM, Stemweis PC, Ross EM, Smigel MD and Gilman AG (1987) The effect of activating ligands on the intrinsic fluorescence of guanine nucleotide-binding regulatory proteins. 1 Biochem 262: 752-756

9. Moshkov lYe, Novikova GV, Smith AR and Hall MA (1993) In vitro study of ethylene binding sites in pea seedlings. In: Cellular and Molecular Aspects of the Plant Hormone Ethylene, pp 195-196. London, UK: Kluwer Academic Publisher

10. NovikovaGV, Moshkov I Ye, Smith AR and Hall MA (1993) Ethylene and phosphorylation of pea epicotyl proteins. In: Cellular and Molecular Aspects of the Plant Hormone Ethylene, pp 371-372. The Netherlands: Kluwer Academic Publishers

11. Raz V and Fluhr R (1993) Ethylene signal is transduced via protein phosphorylation events in plants. Plant Cell 5: 523-530

12. Sanders 10, Smith AR and Hall MA (1989) The measurement of ethylene binding and metabolism in plant tissue. Planta 179: 97-103

13. Sanders 10, IshizawaK, Smith AR and Hall MA (1990) Ethy­lene binding and action in rice seedlings. Plant Cell Physiol 31(8): 1091-1099

14. Sanders 10, Harpham NVl, Raskin I, Smith AR and Hall MA (1991) Ethylene binding in wild-type and mutant Arabidopsis thaliana (L.) Heynh. Ann Bot 68: 97-103

15. Sanders 10, Smith AR and Hall MA (199 I) Ethylene binding in epicotyls of Pisum sativum L. cv. Alaska. Planta 183: 209-217

16. Smith AR, Bell MH, Connem CPK, Harpham NVl, Raskin I, Sanders 10, Thmer R, Wood CK and Hall MA (1990) Ethy­lene receptors in higher plants. In: Mechanisms of Plant Per­ception and Response to Environmental Stimuli, Monograph 20, pp 155-171. Bristol: British Society for Plant Growth Regulation

17. Thomas CJR, Smith AR and Hall MA (1984) The effect of solubilisation on the character of an ethylene-binding site from Phaseolus vulgaris L. cotyledons. Planta 160: 474-479

18. Verhey SD and Lomax TL (1993) Signal transduction in vascular plants. Plant Growth Regul 12: 179-195

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 127-134. © 1996 Kluwer Academic Publishers.

127

Effect of I-methylcyclopropene and methylene cyclopropane on ethylene binding and ethylene action on cut carnations

Edward C. Sisler1, Eve Dupille2 & Margretbe Serek3

I Department of Biochemistry, North Carolina State University, Raleigh NC 27695-7622, USA; 2 ENSAT, 145 Av. de Muret, Toulouse, France; 3 Department of Agricultural Sciences, Section for Horticulture, The Royal Veterinary and Agricultural University, Rolighedsvej 23,1958, Frederiksberg C, Denmark

Key words: 1-Methy1cyclopropene, methylenecyclopropane, ethylene, carnation, Sis-X

Abstract

1-Methy1cyclopropene (l-MCP), formerly designated as Sis-X, has been shown to be an effective inhibitor of ethylene responses in carnation flowers in either the light or the dark. The binding appears to be to the receptor and to be "permanent". A 6 h treatment at 2.5 nll- 1 is sufficient to protect against ethylene, and 0.5 nll- 1 is sufficient if exposure is for 24 h. As carnation flowers age, a little higher concentration appears to be needed. Most of the natural increase in ethylene production during senescence is prevented by treatment with 1-MCP. A closely related compound, methylenecyclopropane shows ethylene activity. A tritium labelled 1-MCP (60 mCi mmol- 1) has been prepared. A higher specific activity is needed for more critical studies.

Introduction

Senescence in carnation petals is associated with an increase in ethylene production [10, 28]. However, the initiation of senescence can be hastened by exposure to exogenous ethylene [9]. This seems to involve a hor­mone receptor according to the criteria for a physiolog­ical receptor [23] and an ethylene binding component has been found in carnation petals [16].

Carbon monoxide, acetylene and vinyl olefins [3, 13] also ,give an ethylene-like response. Compounds that cause ethylene responses are those that are good p-acceptors [4, 14]. If this effect is involved in the ethylene response, the events will likely be (1) binding of the compound, (2) withdrawal of electrons and (3) physiological response.

Silver thiosulphate (STS), olefins such as trans­cyclooctene, trans-cyclooctadines [20] or 2,5-nor­bornadine (NBD) [12] and carbon dioxide [24] are effective inhibitors of ethylene responses, showing an antagonistic effect. The olefins compete with ethylene for the binding receptor [17, 18]. These olefins bind to the receptor but do not initiate a response. All of these compounds are released from the receptor and diffuse

from the binding site over a period of several hours [19]. The photolytic product of diazocyclopentadiene (DACP) has recently been found to bind irreversibly to the ethylene receptor [21] or at least remains bound for many days. In the present work we present a new inhibitor of ethylene action and ethylene binding, 1-methy1cyclopropene (l-MCP), which appears to bind irreversibly to the ethylene receptor in the dark. This compound was previously referred to as Sis-X [5]. Another molecule of similar structure, methylenecy­clopropane (MCP), has been found to be an agonist of ethylene and the chemical differences between these two compounds are important to understand the molec­ular events on ethylene binding.

A 3H 1-MCP has been synthesised and utilised on carnation petals in attempts to purify the ethylene receptor.

Materials and methods

Plant material

Carnation (Dianthus caryophyllus L., cv. White Sim or cv. Sandra) flowers were obtained from a commercial

128

grower and were placed in water at 4 °C until their utilisation. The experiments were run with flowers that were 4 to 21-d old. Unless otherwise indicated, cv. White Sim was used in the experiments.

Chemical treatment

The stem of each flower was cut to 10 cm and placed in a 250 ml Erlenmeyer flask containing water. Indi­vidual flowers were placed in 3 1 jars. Ethylene, or I-methylcyclopropene (I-MCP) was injected into the jar at the desired concentration. Control flowers were held in jars without chemical treatment.

Chemicals

Methylenecyclopropane was obtained from Fluka Chemical Company, Ronkonkoma, New York, 11779-7238, USA and I-methylcyclopropene was synthe­sised as previously described [6, 8].

Ethylene measurement

Flower stems were cut to 2 cm and placed in a 50 ml Erlenmeyer flask containing water. Individual flowers were placed in a 500 ml jar. The flowers were enclosed for 1 h, then a 1 ml gas sample was taken out and analysed for ethylene by gas chromatography using an activated aluminium column and a flame ionisation detector. Flowers were vented for 6 h and then treated with 1000 nil-I ethylene, or 5 nil-I I-MCP for 12 h. Flowers were then vented for 6 h and then enclosed again for 1 h to determine the ethylene production level. The ethylene production was followed for 8 d ..

Assay methods for ethylene binding

Triplicate samples of 3 g of carnation petals were placed in a 2.5 1 desiccator containing 14C ethylene­mercuric perchlorate complex (110 mCi mmol- I) in a 25 ml Erlenmeyer flask. Then, an excess of saturated LiCI was added to the ethylene~mercuric perchlorate complex to release the gaseous ethylene. A magnetic stirrer was used to stir the mixture for 6 min. To deter­mine the amount of binding, 2.5 ml ofunlabelledethy­lene was added to one desiccator [15]. After 2 h of ethylene exposure, the desiccators were opened and the samples were vented for 4 min. Each sample was then placed in a 250 ml jar with 0.2 ml of mercuric perchlorate on a 0.5 cm2 piece of fibre-glass filter in a scintillation vial. After 18 h, the scintillation vials were

removed, scintillation fluid added and the radioactivity counted for each sample.

Measurement of3 H I-MCP diffusion

Carnation petals (3 g) were placed in a 0.5 1 jar in the presence of unlabelled ethylene 3H I-MCP (60 mCi mmol- I) was added for 2 h. The carnation petals were vented and placed in jars with a scintillation vial; after a predetermined time, the vials were removed, scintillation fluid added and then counted for 5 min.

Measurement of3 H I-Mep in carnation extract

50 g of carnations were treated for 12 h with 3H I-MCP. In addition to 3H I-MCP, the control also contained 1000 III 1-1 of ethylene. The carnations were frozen with liquid nitrogen and blended with 2 volumes of 0.5 MK-P04 buffer at pH 6; the extracts were strained through cheesecloth and the filtrate was centrifuged for 15 min at 10,000 x g. The difference in radio­activity between the sample and the control was taken as binding.

Results

Effect of I-MCP in preserving carnations exposed to ethylene at different stages

The treatment of carnations with ethylene hastens the process of senescence with a petal in-rolling phe­nomenon. This responsiveness increases with age [9]; however, this capability does not appear to be due to an increase in ethylene binding capability because the number of ethylene receptors decreases with petal age [2].

Carnations at stage II, with low ethylene production and no visible signs of senescence, or carnations at stage III, showing a beginning of petal in-rolling [27] were treated with different concentrations of I-MCP for 6 h before adding ethylene for 18 h (Table 1.)

For young carnations (Stage II), 2.5 nl I-I of I-MCP was sufficient to afford protection. The minimal concentration of I-MCP preventing the ethy­lene induced senescence was the same when flowers were later treated with 10 or 1000 nil-I of ethylene. If treatment time was 24 h, 0.5 nil-I was adequate to protect carnations. For older (Stage III) carnations, 5 nl 1- I for 6 h was required for complete protection. Perhaps the higher requirement for Stage III was due

Table 1. Effect of I-MCP at 6 h in preserving carnations subse-quently exposed to ethylene for 24 h

Cuitivar Ethylene I-MCP concentration (nlll)

concentration (ILIII) 0 1.25 2.5 5 10

Stage 1I*

Sandra 0 5 5 5 5 5

WhiteSim 0 5 5 5 5 5

WhiteSim 10 2 5 5 5

WhiteSim 1000 2 5 5 5

Stage III

WhiteSim 0 3.5 3.5 3.5 3.5 3.5

White Sim 1000 3.5 3.5

* When treated, 24 h, 0.5 nlll was sufficient for protection. Quality after 4 d: 5, equivalent to a freshly cut bloom; 4, good quality but slightly inferior to 5; 3, moderatedly good with con­siderable vase life remaining; 2, little vase life left and showing signs of sleepiness; I, completely sleepy or dead.

to higher levels of endogenous ethylene in the tissues which competed with I-MCP, although it is possible that a greater number of sites must be inactivated in older carnations to afford protection.

These results on carnations suggest that I-MCP acts as a potent inhibitor of the ethylene response at the receptor level, much as STS, DACP or 2,5-NBD; however, the concentration of 1-MCP needed to protect the flower against ethylene action is much lower that the other chemicals.

Treatment time of I-MCP

I-MCP was added for different times before applying exogenous ethylene. Figure 1 shows that the concen­tration of I-MCP needed to provide protection against an exogenous ethylene effect was inversely related to the treatment time. Five minutes of incubation with about 250 to 300 nil-I of I-MCP was enough to pro­tect the flowers. When they were treated with I-MCP for 24 h, only 0.5 nl I -I was needed to protect them against 1000nll- 1 of ethylene. As would be expected, this shows a wide range of concentrations and times which could be used in protecting carnations.

Irreversible binding of I-MCP to carnations

In earlier studies, it was demonstrated that the photoly­sis product of DACP was 'permanently' bound on the ethylene receptor. In order to know if I-MCP had the same permanent binding flowers were treated with 5

129

1·MCP treatment (h)

Fig. 1. Treatment time and concentration of I-MCP on preser­vation of carnation flowers. Carnation flowers were treated with various concentration of I-MCP for different times, than 1000 nlll of ethylene was added for 18 h and the response was visualised 4 d after I-MCP treatment.

Table 2. Irreversible protective effect of I-MCP on carnations

Ethylene concentration (ILl/I) I-MCP concentration (nlll)

o 5

1000 5

Carnations were treated with I-MCP for 6 h. After aeration, they were stored at room temperature for 10 d, then treated with ethylene for 18 h. See Table I for quality code.

nil-I of product for 6 h, then stored for 10 d at room temperature. Then 1000 nil-I of ethylene was added for 18h. Even 10 d after the I-MCP treatment, ethy­lene had no effect on the treated carnations (Table 2). As with DACP, the binding of I-MCP on carnations seems to be irreversible or at least remains bound for a very long time, and the concentration of product to obtain a protective effect against ethylene is 10 fold less than irradiated DACP.

Carnations need to have an exogenous ethylene exposure of at least 6 hours to have a visible sign of senescence. Treatment with 3 nll- 1 of I-MCP is enough to stop the process and, if the I-MCP is added after 8 h, the process of senescence is stopped. Wang and Woodson [26] obtained similar results using 2,5-norbomadiene.

130

Table 3. Effect of I-MCP on ethylene binding

Ethylene binding (dpm/g)

No treatment

I-MCP

Cl

145

o 145

340 79

261

Carnations were treated then stored at 4 0 C for 4d before the ethylene binding assay. SE= 10

Effect of J-MCP on ethylene production

Senescence in carnation flowers is accompanied by a dramatic increase in ethylene production and ethylene must be present on the plant to stimulate the synthesis of enzymes involved in its production [I,ll]. Flowers in a pre-senescent stage were treated with 5 nIl-I of I-MCP and the senescence process was followed. As with DACP, I-MCP seems to reduce and prevent the autocatalytic production of ethylene, as well as revers­ing the in-rolling process, as was demonstrated before with 2,5-NBD [26]. The addition of ethylene for 6 his enough to have new mRNA synthesis (ACC synthase, ACC oxidase) and to have ethylene production begin, but like DACP, I-MCP does not seem to stimulate non­climacteric ethylene production. Ethylene production by carnations was followed from the beginning of the climacteric production of ethylene (Fig. 2). The ethy­lene treated flower shows a maximum at 2 d. The con­trol shows a rise in the ethylene production beginning at 2 d with a maximum after 4 d from the start of the experiment. When I-MCP was applied to flowers, the maximum ethylene production appeared at the same time as the control but the magnitude was consider­ably less.

Effect of temperature on subsequent ethylene binding to the ethylene receptor

To determine the effect of temperature on the action of I-MCP on the ethylene receptor, flowers were treated with 5 nl I-I of I-MCP and stored for 4 d at room temperature or at 4 °C before the ethylene binding measurements (Table 3) were made. After this length of time, little or no binding was observed indicating the receptor had not become active at either temperature. Longer experiments at room temperature are not possi­ble because the untreated control begins to deteriorate, making binding measurements impossible.

c; ..... :5 -=.. Gl c

'" >. .t:: W

80~-------------------------------.

60

4 0

20

o Control

IJ. ' ·Mep

• Ethylene

o+-~ __ ~~~-.~~~A-~--~--~~ o 10

Time after treatment (day)

Fig. 2. Ethylene production after I-MCP treatment. At zero time, the ethylene production was determined then 5 nUl of I-MCP (Cl) 1000 nlll of ethylene (_) were added for 12 h. The flowers were vented and then ethylene production was followed .

700

600

i lOO "" "0

'if '6 400 a :0 u ; lOO -;:. .<!

~ 200 ~

100 -'-.o......JL.........-L..~.l-. ........... ~-L....~.l-.o........L~....l..-~L.......--' o 10 4() 60 10 100 10 140 160 180 200

I ·Mep 1, •• lm.nt tim. (min)

Fig. 3. TIme of inactivation of ethylene binding site by I-MCP. After the indicated time, sarnpks were vented, then the arnount of ethylene binding was measured.

Time of binding of J-MCP

In carnations higher levels of I-MCP caused a physio­logical effect which was seen after 5 min of treatment. With ethylene binding experiments, it is possible to determine how long it takes for I-MCP to be bound to the ethylene receptor.

S nl I-I of I-MCP was added to cut flowers for various periods of time, and ethylene binding measure-

Table 4. Agonistic effect of I-rnethylenecyclopropane on carnations

Ethylene concentration

(ILl/I)

o

Methylenecyclopropane

concentration (nlll)

o 1.5 3

5 2

See Table I for quality code. Values at 4 d.

ments were then done (Fig. 3). In 1 h, about half of the binding sites appear to be occupied by I-MCP at this I-MCP concentration. The data in Fig. 3 are for cv. White Sim. Similar results were obtained for cv. Sandra.

Agonist ethylene effect of methylene cyclopropane (Mep)

Irradiated DACP had been shown to be an effective inhibitor of 14C-ethylene binding on cut carnations [22]. During the synthesis of I-MCP using sodium amide [8], the product is mostly I-MCP, but some MCP is produced and the two are difficult to sepa­rate. The amount of MCP may be as high as 15% using sodium amide, but it is very low if lithium amide is used [7]. The effect of MCP added to cut carna­tions for 12 h (Table 4) was determined 4 d later. The response was totally different than with I-MCP. The MCP acted as an agonist of ethylene and only 3 nIl-I of MCP was enough to induce senescence on flower carnations. Although the structure of MCP is similar to I-MCP, the double bond is outside the ring and acts differently giving an ethy lene response rather than pro­tecting tissue from ethylene. The low level required is probably because it remains bound for a longer time than ethylene, however, measurements have not been made on how long it remains bound.

Effect of I-Mep and Mep at different concentrations on the ethylene binding from cut carnations petals

In other experiments, the competitive effects between I-MCP, MCP and ethylene on binding were studied. I-MCP, MCP, or a solution containing both (50% of 1-MCP and 50% of MCP) and 14C ethylene were added at the same time as the binding assay. Table 5 gives the Kd values. The Kd values are higher when the products are added at the same time as ethylene than

131

.0-r------------------------------~

-.s 30

<:

~ ~ <: GI <.> 20 <: 0

U i5 GI <J .. Q. 10 rn Ci

o

O~----~------r_----._----._----~

o 20 40 60 80 100

Displaced ("!o)

Fig. 4. Scatchard plot for Sandra (_) and White Sirn (0) binding of I-MCP. Carnation flowers were treated for 6 h with I-MCP.

when they are added alone, before assay of ethylene binding. This result suggests that MCP and I-MCP are effective competitors for the ethylene receptor, and if methylenecyclopropane is present, higher amounts of I-MCP would be needed; but should be easily over­come.

Scatchard plots gave a Kd value of 0.5 nll- 1 for I-MCP (Fig. 4),12.85 nIl-I for MCP and 3.5 nl 1-1 for the solution containing the two compounds, if the carnations were preincubated with the compound (Table 5). These Scatchard plots showed only one binding site in carnations. The Kd values for the two products are much lower than the Kd for DACP which is 120 nIl-Ion cut carnations [22].

Diffusion of3 H I-Mep on carnation petals

In order to label the ethylene receptor, I-MCP [8] was labelled with tritium and the specific activity obtained was 60 mCi mmol- 1 . Diffusion of the compound from the tissues was studied on carnations. The flowers were treated with the compound, with or without a large amount of ethylene. The diffusion was followed for 7 d. Only the flowers which did not have the ethy­lene treatment showed a little diffusion (Table 6) of 3H from the tissue, and this was very low. When the experiment was made at 4°C, the diffusion was non­existent. These results suggested that 3H I-MCP was permanently bound to carnation tissues.

132

Table 5. Comp!lrison of Kd values when I-MCP and MCP are applied to the flowers before or during the ethylene bind­ing measurement

Compound

I-MCP

MCP I-MCP-MCP (50%-50%)

Preincubated before ethylene binding

measurement

0.5

12.8

3.5

Kd values nlll

Mixture present

during ethy lene binding

1.9

22.9 3.5

Kd values were calculated from the formula Kd = Cso(l + K~E) Cso is the concentration for 50% displacement, E is the radioac­tive ethylene concentration, and KdE is the Kd for ethylene [25]. The Kd valu.t for cv Sandra was 2.1 nlll (Fig. 4).

Table 6. Diffusion of 3 H-I-MCP from carnation tissue

Temperature

4°C

24°C

dpmJg I Day

10

10

5 Days

10

25

Values represent the amount of radioactive material trapped by mercury-perchlorate. The petals (10 g samples) were treated at room temperature in the presence and absence of 1000 ILIII of ethy lene, then vented and stored at the indicated temperature. The values represents the difference between samples in the presence or absence of ethylene.

Partial extraction of the ethylene receptor

After treatment with 3H 1-MCP, carnation tissue was extracted. After low-level centrifugation, all the radioactivity was measured in the supernatant. The difference in labelling between the sample and the con­trol (treated with ethylene), suggest that the receptor was inyolved, but the amount of radioactivity is low. Due to quenching and other problems, it will be nec­essary to use higher specific-activity-Iabelled 1-MCP to continue the purification (Table 7). The compound 3H 1-MCP at this specific activity does not appear to be stable in the gas phase for a number of days at room temperature (t 112 about 12 d) and with the use of tritium-Iabelled-1-MCP, it should be possible to obtain the receptor labelled at much higher levels if the specific activity is increased.

Table 7. 3H I-MCP labelling. The difference in labelling repre­sents the radioactivity measured in the sample treated with 3H I-MCP, the radioactivity measured in the control treated with 3H I-MCP and ethylene

Sample

Not treated

Ethylene

dpmJg

840± 36

520± 28

6.dpmJg

320

The sample was a soluble fraction obtained after centrifugation at 10,000 x g for 15 minutes.

Discussion

Many olefins such as 2,5-NBD, have been shown to be effective antagonists of ethylene. The plants need to be permanently exposed to these compounds to give a physiologi~al effect. Besides a high concentration is needed to be effective. DACP has recently been shown to be an effective ethylene antagonist, binding irreversibly on the ethylene receptor after irradiation. In the present work, we report that 1-MCP can prevent ethylene action on carnation without irradiation and is effective at a very low concentration (0.5 nIl-I), thus, the effective concentration of 1-MCP is more than 10 fold less than that DACP concentration needed. As with the light product from DACP, 1-MCP is bound irreversibly on the carnation flowers. Indeed, flowers treated with exogenous ethylene 10 d after the chemical treatment were not sensitive to ethylene. The treatment time of 1-MCP to give an antagonist effect was in the order of minutes at high concentrations. It is worthy to note that 1-MCP is the first gaseous product found to be an irreversible antagonist of ethylene in the dark, and it acts at a very low concentration.

1-MCP also interacts with the ethylene production mechanism and is able to stop irreversibly the autocat­alytic production of ethylene, but this is not thought to be a direct effect on ethylene production. These results agree with the fact that a continuous perception of ethylene is necessary to maintain the production of ethylene.

The sensitivity of flowers to ethylene has been shown to increase with age of the carnations, whereas the ethylene binding capacity decreases. Old flowers require a higher concentration of 1-MCP to be pro­tected against exogenous ethylene than those younger flowers. All these results indicate that 1-MCP is bound on the physiological ethylene receptor, but likely com­petes with endogenous ethylene for binding.

The Kd value for I-MCP was in the physiologi­cal range. The binding of I-MCP on carnation petals was rapid, but to get the maximum effect of low levels longer periods of time are required. These results agree with those obtained on in vivo experiments. When 24-h binding times are used, the amount of I-MCP required (7.5 x 10- 12 moles) is very close to the reported value of 6.0 x 10- 12 moles of ethylene binding sites (recep­tor). This suggests a I: I inactivation of the receptor. Methylenecyclopropane, another molecule of similar structure, was found to act as an agonist of ethylene, and the concentration needed to achieve the same phys­iological effect of ethylene was low.

When I-MCP and MCP were applied together in ethylene binding experiments, the Kd for I-MCP increased, suggesting that there is a competitive effect of these molecules on the ethylene receptor. Although a higher concentration of I-MCP is needed to protect carnations when MCP is present, small amounts should easily be overcome. A close relationship between ethy­lene sensitivity and binding activity was found utilising I-MCP. The extremely low amount of I-MCP nec­essary to inactivate the receptor, and the fact that it remains bound for a long period of time, suggests it to be a very useful compound for controlling ethylene responses. The compound is a gas at normal tempera­tures and is stable in the diluted gas phase for extended periods of time, and one litre of a 1.5% gas mixture would be sufficient to treat 30,000 cubic meters at 0.5 nIl-I. The low amounts required may suggest it as a suitable treatment for edible fruits and vegetables.

Acknowledgements

The experiments were mainly supported by a grant from US Department of Agriculture (NRICGP 91-37304-6580) (E.C. Sisler) and a supplementary grant from the Danish Ministry of Agriculture (NON93-KVL-15) (M. Serek).

References

1. Borochov A and Woodson WR (1989) Physiology and biochemistry of flowers petals senescence. Hort Rev II: 15-43

2. Brown JH, Kegge RL, Sisler EC, Baker JE and Thompson JE (1986) Ethylene binding to senescent carnation petals. J Exp Bot 37: 534-536

3. Burg SP and Burg EA (1967) Molecular requirements for the biological activity of ethylene. Plant Physiol42: 144-152

133

4. Cotton FA and Wilkinson G (1972) Advanced Inorganic Chemistry, A Comprehensive Text. New York: Interscience Publishers

5. Dupille E and ~isler EC (1995) Effect of an ethylene recep­tor antagonist on carnations and other plant material. In: Ait-Oubahou A and El-Otmani M (eds) Postharvest Physiol­ogy, Pathology, and Technologies for Horticultural Commodi­ties: Recent Advances, pp 294-301. Institut Agronomique et Veterinare Hassan II Agadir Morocco

6. Fisher F and Applequist DE (1965) Synthesis of 1-methy1cyclopropene.J Org Chern 30: 2089-2090

7. Koster R, Arora S and Binger P (1973) Methylenecyclopropan sowie I-und 3-methy1cyclopropen aus methally1chloriden und alkalimetallarniden. Liebigs Ann Chern 1973: 1219-1235

8. Magid RM, Clarke TC and Duncan CD (1971) An efficient and convenient synthesis of l-methy1cyclopropene. J Org Chern 36: 1320--1321

9. Mayak S, Vaadia Y and Dilley DR (1977) Regulation of senes­cence in carnation (Dianthus caryophyllus) by ethylene. Plant Physiol59: 591-593

10. Nichols R (1966) Ethylene production during senescence of flowers. J Hort Sci 41: 279-290

11. Nichols R (1968) The response of carnations (Dianthus caryophyl/us) to ethylene. J Hort Sci 43: 335-349

12. Sisler EC and Pian A (1972) Effect of ethylene and cyclic olefins on tobacco leaves. Tob Sci 17: 68-72

13. Sisler EC (1976) Ethylene analogues; effect of some unsatu­rated sulphides (thioethers) on tobacco leaves 20: 6-10

14. Sisler EC (1977) Ethylene activity of some p-acceptor compounds. Tob Sci 21: 43-45

15. Sisler EC (1979) Measurement of ethylene binding in plant tissue. Plant Physiol 64: 538-542

16. Sisler EC, Reid MS and Fujino DW (1983) Investigation of the mode of action of ethylene in carnation senescence. Acta Hort 141: 229-234

17. Sisler EC, Reid MS and Yang SF (1986) Effect of antagonists of ethylene action on binding of ethylene in cut carnations. Plant Growth Reg 4: 213-218

18. Sisler EC and Wood C (1988) Competition of unsaturated compounds and ethy lene for binding and action. Plant Growth Reg 7: 181-191

19. Sisler EC (1990) Ethylene binding receptors - is there more than one? In: Pharis RP and Roods SB (eds) Plant Growth Substances, pp 192-200. Berlin: Springer-Verlag Berlin

20. Sisler EC Blankenship SM and Guest M (1990) Competition of cyclooctenes and cyclooctadienes for ethylene binding and activity in plants. Plant Growth Reg 9: 157-164

21. Sisler EC and Blankenship SM (1993) Diazocyclopentadiene (DACP), a light sensitive reagent for the ethylene receptor in plants. Plant Growth Reg 12: 125-132

22. Sisler EC, Blankenship SM, Fearn JC and Haynes R (1993) Effect of diazocyclopentadiene (DACP) on cut carnations. In: Pech JC, Latche A, Balague C (eds) Cellular and Molec­ular Aspects of the Plant Hormone Ethylene, pp 182-187. Dordrecht: Kluwer Academic Publishers

23. Trewavas AJ and Jones AM (1981) Consequences of hormone binding studies for plant growth substance research. What's New in Plant Physiol 12: 5-8

24. Vota M (1969) Carbon dioxide suppression of ethylene -induced sleepiness of carnation blooms. J Amer Soc Hort Sci 94:598-601

25. Venis MA (1985) Hormone Binding Sites in Plants, pp 191. New York: Longman Inc

134

26. Wang H and Woodson WR (1989) Reversible inhibition of ethy lene action and interruption of petal senescence in carna­tion flowers by norbornadiene. Plant Physiol 89: 434-438

27. Woodson WR (1987) Changes in protein and mRNA popula­tions during the senescence of carnation petals. Physiol Plant 71: 495-502

28. Wu MJ, Zacarias L and Reid MS (1991) Variation in the senescence of carnation (Dianthus caryophyllus L.) cultivars II. Comparison of sensitivity to exogenous ethylene and of ethylene binding. Scientia Hort 48: 109-\\6

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 135-139. © 1996 Kluwer Academic Publishers.

135

Regulation of the expression of plant defence genes

J. F. Bol', A.S. Buchel', M. Knoester', T. Baladin', L.c. Van Loon2 & H.J.M. Linthorst' 1 Institute of Molecular Plant Sciences, Leiden University, Gorlaeus Laboratories, Einsteinweg 55,2333 CC Leiden; 2 Department of Plant Ecology and Evolutionary Biology, Utrecht University, PO Box 800.84, 3500 TB Utrecht, The Netherlands

Key words: pathogenesis-related proteins, plant defence genes, systemic acquired resistance, salicylic acid, tobacco mosaic virus

Abstract

The hypersensitive response of plants to infection by pathogens is associated with the induction of the expression of genes encoding pathogenesis-related (PR) proteins and the development of a systemic acquired resistance of the plant to viruses, fungi and bacteria. The PR genes induced in Samsun NN tobacco mosaic virus (TMV) have been classified into five groups, each encoding acidic extracellular and basic vacuolar proteins. In addition to induction by TMV, many PR genes are induced by treating the plant with salicylic acid (SA). Genes encoding acidic PRs are systemically induced upon TMV infection whereas genes encoding basic PRs are not. In contrast to the genes encoding acidic PRs, the genes encoding basic PRs are induced by ethylene and wounding. Cis-acting regulatory elements involved in the co-ordinate induction of PR genes by TMV and SA have been mapped in most detail in the PR-la promoter. This promoter contains a number of elements that bind a GT-l like transcription factor with different affinities. To study the role of ethylene in the induction of PR gene expression, plants have been transformed with sense and antisense constructs of tobacco cDNAs encoding ACC-synthase and/or ACC-oxidase.

Introduction

Studies in the early sixties showed that tobacco plants reacting hypersensitively to infection with tobacco mosaic virus (TMV) developed a systemic resistance in the virus-free portions of the plant to TMV and unre­lated viruses. About ten years later it was observed that the development of this resistance is accompa­nied by the induction of numerous host genes encoding pathogenesis-related (PR) proteins [for recent reviews see 2, 3, 8]. Initially PR proteins were described as protease-resistant acidic extracellular proteins which could be classified into five groups. Later, additional groups were recognised and it was observed that each group of PR proteins could be subdivided into acidic extracellular and basic vacuolar proteins. The sequence similarity between proteins in one subgroup is generally over 90% whereas the similarity between corresponding acidic and basic proteins in one group is about 50%. Proteins homologous to the tobacco PR

proteins have been identified in many dicot and mono­cot plant species and the available evidence supports the notion that they playa role in general plant defence. PR gene expression is induced by necrotising infec­tions of plants by viruses, fungi or bacteria and the acquired resistance is effective against a wide variety of pathogens. Here we report on the possible role of tobacco PR proteins in plant defence mechanisms and the signal transduction pathways involved in the co­ordinate induction of the expression of PR genes by TMV infection.

Role of PR proteins

Table 1 summarises the properties of the major recog­nised groups of tobacco PR proteins. Recently pro­teinase inhibitors of class I and II have been classified as the PR-6 group, and several additional groups ofPR proteins were proposed [18].

136

Table 1. Properties of tobacco PR proteins.

Extracellular acidic PRs Vacuolar basic PRs

Group Name MolWt Name MolWt Function

la, Ib, Ie 16K Ig 16K antifungal?

2 2a,2b,2c 40K 2e 33K ,6-1 ,3-gluc. IIII

2d 36K ,6-1 ,3-gluc. III

3 3a,3b 28K 3d,3e 33K chitinase IIII

3f 29K 3g 30K chitinase IlIa

29K 3h 39K chitinase V

4 4a,4b 14K 4c,4d 20K chitinase VII

(win-like)

5 5a,5b 24K 5c,5d 24K antifungal?

(osmotin)

6 6a,6b 8K prot. inhib. I

6c,6d 14K prot. inhib. II

a The in situ localisation of proteins 3f and 3g has not yet been determined.

PR groups 1 to 5 can each be subdivided into extra­cellular and vacuolar proteins; in group 6 only vacuolar proteins have been identified so far. Moreover, the acidic and basic PR 1-5 proteins all contain an N­terminal signal peptide involved in the translocation of the polypeptide over the endoplasmic reticulum, and the basic PR 1-5 proteins contain a C-terminal vac­uolar sorting signal that is cleaved during vacuolar targeting [11, 13]. The vacuolar sorting signals of the PR-6 proteins appear to be localised differently.

Little is known about the function of the PR-1 proteins. The observation that the expression of an acidic PR -1 protein in transgenic tobacco results in an increased tolerance of the plants to two oomycete pathogens, suggests a role of PR-1 in an antifungal defence mechanism. The PR-2 group contains several classes of proteins with ,8-1 ,3-glucanase activity. The class I (protein 2e) and class II (proteins 2a, 2b and 2c) enzymes show about 50% similarity to each other but no similarity to the class III enzymes (protein 2d). Group 3 contains several classes of proteins with chiti­nase activity. The class I (3d, 3e) and class II enzymes show about 50% similarity to each other but share no similarity with class III (3f, 3g) or class V (3h) proteins [7, 12]. The class V proteins show a low but significant similarity to bacterial chitinase [12]. The basic class I PR-2 protein and class I and V PR-3 proteins alone showed antifungal activity in vitro assays. Together, the PR-2 and PR-3 class I proteins acted highly syner­gistically in their antifungal effects [15]. Also, the basic

class I and V chitinases showed synergism in their anti­fungal activity [12] whereas no antifungal effect was observed in vitro for the acidic class II PR-2 and PR-3 proteins. Recently, the class III and V chitinase have been renamed as PR-8 and PR-11 protein respectively [18].

The PR-4 proteins of tobacco show extensive sequence similarity with the potato win protein and prohevein from the rubber tree. Like the basic class I chitinases from the PR-3 group, the basic PR-4 protein contains an N-terminal cysteine-rich "hevein" domain that is absent in the acidic PR-3 and PR-4 proteins. In prohevein, this hevein domain is cleaved off but no such processing of the class I chitinase or basic PR-4 protein has been observed. The basic PR-4 protein has a low chitinase activity and shows antifungal activity in vitro which acts synergistically with both PR-2 and PR-3 class I proteins [14]. Finally, the PR -5 proteins show sequence similarity to the sweet tasting protein thau­matin and a maize protease/a-amylase inhibitor. The basic PR-5 proteins, also known as osmotins, showed antifungal activity in vitro assays [21]. Thus, proteins from PR groups 1 to 5 may all be involved in antifungal defences of the plant.

Induction patterns of PR proteins

Figure 1 shows that mRNAs encoding acidic proteins from PR groups 1 to 5 are expressed at relatively low

137

6 - 1, 3 -

Glucanase Chitinase

Heve in I

win-li k e

Thaumatin­

li k e

H S T H S T H S T H S T H S T

ACIDIC -0.8 -1.1 - 1.0 -0.9 -0.7

H S T H S T H S T H S T H S T

- 1.3 BASIC -0.8

-1 .1 - 1.1 - 0 .8

PR -1 PR - 2 PR - 3 PR-4 PR-5

Fig. 1. Induction of PR-mRNAs in Samsun NN tobacco. RNAs were extracted from healthy plants (lanes HO, plants sprayed with 5 mM salicylate at two days after treatment (lanes S), and plant infected with TMV at five days after inoculation (lanes n. The RNAs were loaded to Northern blots and the blots were hybridised to 32P-labelled cDNA clones corresponding to genes encoding acidic and basic proteins ofPR groups 1 to 5.

levels in the leaves of healthy tobacco plants (lanes H) and are all induced by infection of the plants with TMV (lanes T). In addition, a number of PR genes are expressed after spraying the plants with salicylic acid (SA, lanes S).

Endogenous SA has been shown to be required for the expression of systemic acquired resistance (SAR), possibly by modulating the accumulation of active oxygen species [5, 6]. However, SA appears not to be the translocated signal responsible for induction of SAR [19]. After TMV infection, the genes encoding acidic PR's are systemically induced in the virus-free leaves of the plant but the genes encoding the basic PR's are not [4]. In contrast to the genes encoding acidic PR's, the genes encoding basic PR's are consti­tutively expressed in the roots of healthy plants and are locally induced in leaves by wounding and by treat­ing the plant with ethephon which decomposes into ethylene [4]. The expression pattern of class I and II proteinase inhibitors (PR-6) is very similar to that of genes encoding basic proteins from PR groups 1 to 5.

The PR-6 genes are locally induced by TMV infection, ethephon treatment and wounding, but not system­ically [Baladin et al., unpublished]. This is in contrast to the related tomato proteinase inhibitors which are systemically induced by a polypeptide signal molecule, called systemin [10].

Promoter analysis of PR genes

Upstream sequences of tobacco genes encoding acidic PR-l, acidic and basic PR-2 and acidic PR-5 proteins have been fused to the GUS reporter gene and these constructs were used to transform tobacco. A minimum sequence of about 600 bp was required for induction of expression of the reporter gene by TMV infection of the transgenic plants. Additional upstream sequences of up to 1 kb further enhanced this inducibility [1, 16, 17]. A more detailed analysis of the PR-la promoter resulted in the identification of a minimum of four regulatory elements, located between nucleotides -902/-691,

138

-689/-643, -643/-287 and -287/+29 (the tran­scription start site being + 1). These elements alone have no promoter activity and all four are required for a maximum induction of the reporter gene by TMV infection or SA treatment. Constructs containing var­ious combinations of two or three of these elements have about half of the maximum activity. All constructs responded similarly to TMV and SA, supporting a role of SA in the signal transduction pathway leading to expression of the PR -1 a gene [17].

Using PCR the 900 bp promoter region of the PR-1a gene was divided into eight fragments [Buchel et al. submitted for publication]. Band shift assays revealed that all but one of these fragments specifically interacted with nuclear proteins from healthy tobacco. Competition experiments showed that the same nuclear factor binds to various promoter fragments with differ­ent affinity. This factor was found to be homologous to GT-1, a nuclear protein binding to boxes in the rbcS-3A promoter and other promoters. When nuclear extracts from SA treated or TMV infected plants were used a reduction of the binding proteins to promoter frag­ments ofthe -902/-656 region was observed [Buchel et al. submitted for publication]. The results indicate that one step leading to induction of the PR-1a gene by SA or pathogens involves the removal of nuclear protein(s) from a low affinity binding sites located in the far upstream region of the promoter.

Role of ethylene in PR gene expression

The induction of class I PR-2 and PR-3 genes by ethylene in various plant species is well documented [20]. Most genes encoding basic tobacco proteins from PR groups 1 to 6 appeared to be ethylene-inducible. To study the possible role of ethylene in the signal trans­duction pathway we have cloned cDNAs encoding the tobacco.enzymes ACC-synthase (ACCS) and ACC­oxidase or ethylene forming enzyme (EFE) (ACC = 1-aminocyclopropane-I-carboxylate). ACCS converts S-adenosylmethionine into ACC and EFE converts ACC into ethylene. The ACCS and EFE genes were found to be induced by TMV infection, in agreement with a possible role of ethylene in the induction of PR genes. Interestingly, EFE genes were induced by treat­ing the plants with ethephon but ACCS genes were not [Knoester et al. submitted for publication]. The cDNAs have been fused to the 35S promoter in the sense and antisense orientation and were used to transform tobacco. Plants were transformed either with single

A. 1 :I J 4 5 7 H T 8 9 10 11 12 IJ 14 I!> H r

B. 1 :I 3 4 5 6 7 8 H T 9 10 11 1213 1415 H T

c. 1 :I 3 4 5 7 8 9 11 13 15 16 T H

Fig. 2. Accumulation of EFE transcripts in transgenic plants. Samsun NN tobacco was transformed with EFE eDNA in the sense orientation (A), ACCS and EFE cDNAs in the sense orientation (B), and ACCS and EFE cDNAs in the antisense orientation (C). In each construct the ACCS or EFE cDNAs were flanked by the 35S promoter and nos terminator. Independent primary transformants with the indicated line numbers were used to extract RNA. The RNA was loaded to Northern blots and the blots were hybridised to 32P-IabelJed double-stranded EFE eDNA. As controls, the accumu­lation of EFE mRNAs in healthy (lanes H) and TMV-infected (lanes n non-transgenic plants is shown.

genes or with a combination of the ACCS and EFE genes. Figure 2 shows a Northern blot analysis of the accumulation of plus- and minus-sense EFE transcripts in a number of primary transformants. The accumula­tion of ACCS transcripts is currently being analysed. The effect of overexpression of ACCS and EFE genes and the inhibition of expression of these genes on ethy­lene production and induction of PR genes will be investigated.

References

J. Albrecht H, van de Rhee MD, and Bol JF (1992) Analysis of cis-regulatory elements involved in the induction of tobacco PR-5 gene by virus infection. Plant Mol BioI 18: 155-158

2. Bol JF, Linthorst HJM and Cornelissen BJC (1990) Plant pathogenesis-related proteins induced by virus infection. Annu Rev Phytopathol28: 113-138

3. Bowles D (1990) Defence-related proteins in higher plants. Annu Rev Biochem 59: 873-907

4. Brederode FlO, Linthorst HJM and Bol JF (1991) Differential induction of acquired resistance and PR-gene expression in tobacco by virus infection, ethephon treatment, UV light and wounding. Plant Mol Bioi 17: 1117-1125

5. Chen Z, Silva Hand Klessig DF (1993) Active oxygen species in the induction of plant systemic acquired resistance by sali­cylic acid. Science 262: 1883-1886

6. Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Ukness S, Ward E, Kessmann H and Ryals J (1993) Requirement of salicy lic acid for the induction of systemic acquired resistance. Science 261: 754-756

7. Lawton K, Ward E, Payne G, Moyer M and Ryals J (1992) Acid and basic class III chitinase mRNA accumulation in response to TMV infection oftobacco. Plant Mol Bioi 19: 735-743

8. Linthorst HJM (1991) Pathogenesis-related proteins of plants. Crit Rev Plant Sci 10: 123-150

9. Linthorst HJM, Brederode FIb, van der Does C and Bol JF (1993) Tobacco proteinase inhibitor I genes are locally, but not systemically induced by stress. Plant Mol Bioi 21: 985-992

10. McGurl B, Pearce G, Orozco-Cardenas M and Ryan CA (1990) Structure, expression and antisense inhibition of the system precursor gene. Science 255: 1570-1573

II. Melchers LS, Sela-Buurlage MB, Vloemans CP, Woloshuk CP, van Roekel JSC, Pen J, van den Elzen PJM and Cornelissen BJC (1993) Extracellular targeting of the vacuolar tobacco proteins AP24, chitinase and (3-1,3-glucanase in transgenic plants. Plant Mol Bioi 21: 583-593

12. Melchers LS, Apotheker-de Groot M, van der Knaap JA, Pon­stein AS, Sela-Buurlage MB, BolJF, Cornelissen BJC, van den Elzen PJM and Linthorst HJM (1994) A new class of tobac­co chitinases homologous to bacterial exo-chitinases displays antifungal activity. Plant J 5: 469-480

13. Neuhaus J-M, Sticher L, Meins Fjr and Boller T (1991) A short C-terminal sequence is necessary and sufficient for the

139

targeting of chitinases to the plant vacuole. Proc Natl Acad Sci USA 88: 10362-10366

14. Ponstein AS, Bres-Vloemans SA, Sela-Buurlage MB, van den Elzen PJM, Melchers LS and Cornelissen BJC (1994) A novel pathogen- and wound-inducible tobacco (Nicotiana tabacum) protein with antifungal activity. Plant Physiol 104: 109-118

15. Sela-Buurlage MB, Ponstein AS, Bres-Vloemans SA, Melchers LS, van den Elzen PJM and Cornelissen BJC (1993) Only specific tobacco (Nicotiana Tabacum) chitinases and (3-1 ,3-glucanases exhibit antifungal activity. Plant Physiol 10 I: 857-863

16. Van de Rhee MD, Lemmers R and Bol JF (1993) Analysis of regulatory elements involved in stress-induced and organ­specific expression of tobacco acidic and basic (3-1 ,3-glucanase genes. Plant Mol Bioi 21: 451-461

17. Van der Rhee MD and Bol JF (1993) Induction of the tobacco PR-I a gene by virus infection and salicy late treatment involves an interaction of multiple regulatory elements. Plant J 3: 71-82

18. Van Loon LC, Pierpoint WS, BollerTH and Conejero V (1994) Recommendations for naming plant pathogenesis-related proteins. Plant Mol BioI Reporter, in press

19. Vernooij B, Friedrich L, Morse A, Reist R, Kolditz-Jawhar R, Ward E, Ukness S, Kessmann H and Ryals J (1994) Salicylic acid is not the translocated signal responsible for inducing systemic acquired resistance but is required in signal transduc­tion. Plant Cell 6: 959-965

20. Vogeli U, Meins F and BollerT (1988) Co-ordinated regulation of a chitinase and (3-1 ,3-glucanase in bean leaves. Planta 174: 364-372

21. Woloshuk CP, MeulenhofJS, Sela-Buurlage M, van den Elzen PJM and Cornelissen BIC (1991) Pathogen-induced proteins with inhibitory activity toward Phytophthora infestans. Plant Cell 3: 619-628

A. R. Smith et al. (elis.), Plant Hormone Signal Perception and Transduction, 141-146. © 1996 Kluwer Academic Publishers.

141

Fusicoccin and its receptors Perception and signal transduction

Patrizia Aducci 1, Alessandro Ballio2, Daniela Nasta 1, Vincenzo Fogliano3,

Maria Rosaria Fullone2 & Mauro Marra 1

1 Dipartimento di Biologia, Universita di Roma 'Tor Vergata' , via della Ricerca Scientifica, 00133 Roma,ltaly; 2Dipartimento di Scienze Biochimiche 'A. Rossi-Fanelli', Universita di Roma 'La Sapienza', P. Ie A. Mora 5, 00185 Roma,ltaly; 3 Dipartimento di Scienza degli Alimenti, Universita di Napoli 'Federico II', via Universita 1 DO, 80055 Portici, Napoli,Italy

Key words: fusicoccin, receptors, signal transduction, 14-3-3 protein, photoaffinity labelling

Abstract

Purified preparations ofFC receptors from maize, obtained under non-denaturing conditions, showed in SDS-PAGE two doublets of proteins with an apparent molecular mass of 30 and 90 kDa. In this paper the isolation of the 30 kDa protein, its identification as a 14-3-3-like protein, as well as its immunological detection in partially-purified FC-receptor preparations from bean and spinach are described. The 14-3-3 proteins have biochemical properties consistent with potential signalling roles, and their presence in highly purified FC-receptor preparations suggests that they may be involved in FC- signal transduction. Photoaffinity labelling experiments demonstrating that the protein at 90 kDa binds FC are also presented. The evidence presented taken as a whole, suggests the occurrence in maize of a protein complex for FC perception and signal transduction.

Introduction

The wilt-inducing toxin fusicoccin (FC), causes in higher plants hormone-like responses which have been proposed to result from the stimulation of the plasma membrane H+ -ATPase [21]. During recent years, studies on isolated plasma membrane vesicles [25], and on proteoliposomes reconstituted with the H+­ATPase and FC receptors [3, 19], have clearly shown that binding of Fe to its receptors is essential for the stimulation of the H+ -ATPase. More recent studies indicate that the C-terrninal region of the H+ -ATPase of fungi and plants is an autoinhibitory domain, whose displacement allows the enzyme to display full activity [24,27]. It has been proposed that this domain could be sensitive, in different ways, (i.e., phosphorylation, direct binding) to different H+ -ATPase effectors [29] and evidence has been accumulated that FC activa­tion is brought about by C-terminus displacement [14,

26]. The first event of the FC pathway (i.e., binding to membrane receptors) has been firmly established [1] and clues about the mechanism of interaction with its ultimate target are emerging. The intermediate steps, if any, of the FC signalling are instead completely obscure. In fact, components of a possible transduc­tion chain have not yet been isolated and, moreover, even though the purification and identification of FC receptors has been carried out from different tissues [4, 7, 9, 23], partially contrasting results have been obtained and structural information is still lacking.

This paper describes the identification of FC­perception proteins by photoaffinity labelling and presents some information on the signal transduction system with the purification and structure elucidation of the 30 kD protein present in purified preparations of FC receptors.

142

Results

Purification of [3 HI-Fe-receptor complexes

FC receptors, solubilised from microsomes by a method previously described [2], have been incubated with tritium-labelled FC and the eH]-FC-receptor complex has been purified by a four-step HPLC pro­cedure which involves hydroxyapatite (HPT), anion exchange and gel-filtration chromatography. Using this method a 5000-fold increase of the specific activity and a final protein yield of 0.001 % have been obtained. Analysis by SDS-PAGE of the fractions containing eH]-FC-receptor complexes showed the enrichment of two major doublets at 90 and 30 kD. Moreover, a protein at 14 kD, identified as calmodulin, was also present. This pattern, which impaired the unambigu­ous identification of FC receptors (eH]-FC-receptor complexes dissociate in SDS-PAGE) could not be modified either by changing conditions of purification or using different, non-denaturating, chromatography. This persistent co-purification suggests that these proteins could be functionally associated to set up a complex for FC perception.

Isolation of the 30 kD protein and amino acid sequence

The data reported above prompted us to obtain sequence data for the proteins present in this com­plex. The first step was the separation of the 30 and the 90 kD proteins, which was achieved by means of reverse-phase (RP) chromatography performed under denaturing conditions [20]. This method allowed us to isolate the 30 kD protein in amounts suitable for amino acid sequencing. The 90 kD protein was obtain6d only in minor amounts, thus hampering sequence studies. Since the 30 kD protein was N-terminally blocked, sequencing was performed after digestion with endo­proteinase Lys-C and resulting peptides were purified by preparative reverse-phase HPLC. Among these pep­tides three were obtained in pure form and sequenced. Their sequence was 100% homologous with a protein from maize, named GF 14, which belongs to the 14-3-3 family [8].

Production of anti 30 kD protein antibodies

A 20-amino acid peptide corresponding to one of the determined sequences was conjugated to BSA and used to immunize a rabbit [20]. The elicited antibodies

were able to recognize the 30 kD proteins from maize, spinach and broad bean by Western blotting. Whereas two bands were detected in purified maize preparation only one was detected in spinach and broad bean. No cross-reaction was observed with the 90 kD protein when partially purified preparations of FC receptors from maize were tested.

Photoaffinity labelling of partially purified receptors from maize shoots

In order to establish which of the two doublets corre­sponded to the FC receptor photoaffinity labelling studies were attempted. Samples of two-step (HPT followed by anion exchange) partially purified FC­receptors were incubated with 10-6 M photoactivat­able tritium-labelled FC-derivative ([3H]azido-FC) [9] and irradiated with a 1000 W mercury vapour lamp, to allow radioactive covalent tagging of receptors; the resulting [3H]azido-FC-receptor complex was sepa­rated by SDS-PAGE or by RP chromatography.

As protein degradation after UV irradiation is widely described [10, 11], the dependence of the time of irradiation on the binding capability ofFC receptors was tested before running photo affinity experiments. As expected, a progressive reduction in the [3H]-FC­binding activity was observed [4]. Therefore 30 s of irradiation, a time not affecting the eH]-FC-binding activity, was used for the photoaffinity experiments.

The extent of labelling was evaluated by count­ing the radioactivity present in 3 mm slices cut from SDS-PAGE gels or in fractions eluted from the RP column under the conditions described by the pre­vious paragraph to separate the 90 and the 30 kD proteins: all the radioactivity was found in the gel slice or in the chromatographic peak corresponding to the 90 kD protein (Fig. 1). Non-specific labelling was estimated by running the same samples in presence of 10-5 M unlabelled FC. As reported for the binding activity, the photoaffinity labelling of the 90 kD pro­tein was reduced when samples were pre-irradiated for times longer than 30 s in the absence of the eH]azido-FC [4]. Moreover, photoaffinity labelling performed under various irradiation times showed that the radioactivity associated to the 90 kD protein was dramatically reduced at times longer than 30 s, while a corresponding increase of the 30 kD protein was observed. Exhaustive irradiation (8 min) completely abolished labelling (Fig. 2).

143 90kO

Y 0.12 30kO

Y

E lOOO c

== 800 c:.. o ~ 0.08 < ....

600

'0.04 400

200

0.00

0 N ,.... .". on -c ..... x =- = N ,... .,. V'. -c ..... - - - - -

fraction number

Fig. 1. Purification of photo affinity-labeled proteins by reverse phase HPLC. Partially-purified FC-receptors were covalently tagged with [3Hjazido-FC and loaded on a Supelcosil LC 304 column. The solvent system was 0.1 % 'IFA 0.005% OG (octylglucoside) in water (solvent A) and 0.1 % OG in CH3CN (solvent B); the gradient (sketched line) was from 30 to 90% solvent B in 25 min. Fractions of2 min were collected and counted for radioactivity. Shaded bars represent the radioactivity present in each fraction, arrows point the location of the two doublets.

100

00 c:

0) 80 .D .;:: E :>

60 .S x '" E ,.g 40 ..... 0

~ 20

6 8

time of irradiation (min)

Fig. 2. Time-course of the photo affinity labelling. Samples of 0.05 mg of partially purified receptor were labeled with eHjazido-FC using different times of irradiation. Proteins were run on 10% SDS-PAGE. Gel was cut in 3-mm-wide strips and counted for radioactivity. Radioactivity recovered in the 90 kD-region. Radioac­tivity recovered in the 30 kD-region. Data are reported as percentage of the maximun labelling of each region.

Discussion

The presence in SDS-PAGE of highly purified FC­receptor complex of different proteins (Le., 90, 30 kD protein and calmodulin) suggests that they are all involved in the perception and transduction of FC signal. To investigate this hypothesis two strategies were followed; the isolation of single components with elucidation of their primary structure and the identifi­cation of FC receptor by photoaffinity labelling .

The key result obtained by our group [20] and, independently, by Korthout and de Boer [16] from sequence studies is the evidence that the 30 kD protein present in partially purified FC-receptors from maize shoots [20] and from oat roots [16] is a 14-3-3-like protein. The 14-3-3 protein family are well known in mammals where they have a number of physiological functions [6].

In the last few years, members of the 14-3-3 pro­tein family have been identified in plants and some evidence has been accumulated about their multiple role in calcium and/or protein kinase regulation [8, 12, 17,]. In Fig. 3 sequence alignments of the bovine-14-3-3 T) chain and maize GFl4 are shown: though

144

maize t"IAKLAEC)AER 'iEEMV EFMEK ',-/'AKTVDSEEL P./EERN : ll:.S:',.~ -A,/,~· ~·I\.il G~RR

bovine 1") RARLAEQAER VDDMASAt"I ·· KAVTELNEPL Sr··JEDRD :t:.1S~1: AYKf:J.V.VGARR

ma ize 51 AS\·'IR ·tiSSJ{ :bk EEGRGNED RVTLlKDYRG KIETELTKIC DG I LKLLESH

bovi ne 1") SSWRVI.SSl E-:QK r-IADGNEK KLEKVKAVRE KIEKELETVC NDVLALLDKF

maize 101 LVPSST AP " f.:$.I~'~~ f'!~~f:I~; !3P~l ~ P- ~~~As : F KTGAERKDAA EI'lTMVAVKAAQD

bovi ne 1")

maize 151

bovine 1")

. ........ . .. . . . .... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

L I KNCNDFQV E 9K~lF.Y.lKMK :,~Q'i'~·lRY.LAt VASGEKKNSVV EASEAAVKEAFE

IALAELA .TH PIRlI3LALNF:.SVFV YEILNS PDRACSLA /Q AFDEAISELD ... ................. . ................... . . . ....... . . . , . .............................. ............. . ............................. . .... . ...... .. . . ... . . ....... , • •••• •• •••• 0'

I SKEHMC! ; ·+~::·~ ·r~tktIb;i;~;:;~;;5}SV{igit(~:~g~:~t{~:~k·k/6gij:}&6

maize 20 1 .t~~·E.E.S.':/~·p·:3)((M.ij.L~ ·8·p~~(L.I.L.it{t$··. I SE DPAEEIREAP KHDLSEGQ :':-:':.:':.:':.:':,:':.:':.:':.:':.:':.:':.:':,:':.:':,:':.:':.:':.:':.:':.:':.:':.:':.:.:.:':.:.:.:':,:':.

bovine T1 +6M"8W/kBWitt~lH[E~8~ii+{~:;:r:r' IJOD EEAGEGN

108.a. t----;

~,J ---....t : -:. A :-: 1------ ..-----.\+\\\<\\:C H/»»> c I I ~'; 'B"': ;~I"""""""""" """"""" "" ............. ~ ::::" ,,::: ;-:.;.;.;.;.:-;.;.;.;.;.:<.;.;.;:-::-;<.:-;.;.;.;-:.;.:.:.:.:-:

Fig. 3. Sequence alignments of 14-3-3 protein from maize (GFI4) and bovine (7) chain). Boxes A, Band C represent the highly conserved regions (88, 100 and 86 percent respectively). Region A contains the residues reminiscent of the "pseudosubstrate" domain of the protein kinase C. [6]; region B contains an amino acid sequence that is able to prevent association of protein kinase C to plasma membrane [22]; region C contains a sequence that is supposed to bind calcium in Arabidopsis [18].

the amino acid sequence homology is only 50%, three highly conserved regions are clearly defined and for some of them different regulatory functions have been hypothesized [6, 18, 22]. In plants, as has been observed in animals, several isoforms of 14-3-3 pro­teins are present in each species as suggested by South­ern blotting analysis [8, 15, 17, 18] and it is likely that

they are localized in different tissues where they can accomplish different functions [28].

In this respect it is worth noting that the 14-3-3 protein described by our group [20] and by Korthout and de Boer [16] has been isolated from the plasma membrane. This localisation and its association in an Fe-receptor complex offer potential insight into

the molecular mechanisms of FC-signal transduction. In fact, while 14-3-3 are mainly described as PKC regulators, it is known that a possible regulatory mech­anism of the FC physiological target, the H+ -ATPase, can be the phosphorylation of the C-terrninus region of the H+ -ATPase. Hence, the 14-3-3 protein present in purified receptor preparations may represent an important element of the FC-signal transduction chain, mainly related with the regulation of protein kinase C activity [5,6, 13].

As far as the identification of the functional FC-receptor, photoaffinity labelling studies clearly show that in conditions that do not impair the FC­receptor binding activity only the 90 kD protein is labelled, therefore demonstrating that in this system this polyper;tide is the only binding component. Furthermore, the absence of cross-reaction of the 30 kD protein antibodies with the 90 kD protein rules out the possibility that the 14-3-3 protein is, in maize, part ofthe 90- kD polypeptide. On the other hand, the local­ization and the described properties of the 14-3-3 like proteins are consistent with a regulative rather than a perceptive role for the 30 kD proteins.

Nevertheless, further studies on FC-receptor struc­ture are necessary to develop a general model for perception and transduction of the FC signal; in fact, in contrast to our results other authors suggest a subunit molecular size of around 30 kD for FC receptors puri­fied from oat [16] and from broad bean [9], wherein no polypeptide at 90 kD has been detected. However, it is worth noting that a polypeptide of 67 kD is sometimes present in purified FC-receptor preparations from the same tissues [9, 16]. The possible functional role of this component and its relationships with the 90 kD protein needs to be clarified.

In conclusion, the biochemical and functional prop­erties of the proteins present in purified FC-receptor preparations reported here suggest that in perception and transduction of the FC signal a multifunctional complex is involved.

Acknowledgements

The research has been supported by the National Research Council of Italy, Special Project RAISA sub­project No.2. Paper No. 1983. It has also been sup­ported by the Italian Ministry of Agriculture, Food and Forestry, by the Italian Ministry of University and Scientific Research.

145

References

I. Aducci P, Ballio A and Federico R (1982) Solubilisation of fusicoccin binding sites, Plasmalemma and Tonoplast, Their Function in the Plant Cell. In: Marme D, Marre E and Hertel R (eds), pp 279-284. Amsterdam: Elsevier

2. Aducci P, Ballio A, Fullone MR and Persichetti F (1986) Entrapment into liposomes of fusicoccin binding sites. Plant Sci 45: 83-86

3. Aducci P, Ballio A, Blein J-P, Fullone MR, Rossignol M and Scalia R (1988) Functional reconstitution of a proton­translocating system responsive to fusicoccin. Proc Natl Acad Sci USA 85: 7849-7851

4. Aducci P, Ballio A, Fogliano V, Fullone MR, Marra M and Proietti N (1993) Purification and photoaffinity labelling of fusicoccin receptors from com. Eur J Biochem 214: 339-345

5. Aitken A, Ellis CA, Harris A, Sellers LA and Toker A (1990) Kinase and neurotransmitters. Nature 334: 594

6. Aitken A, Collinge DB, van Heusden BPH, Isobe T, Roseboom PH, Rosenfeld G and Soli J (1992) 14-3-3 proteins: a highly conserved, widespread family of eucaryotic proteins. TIBS 17: 498-501

7. de Boer A, Watson BA and Cleland RE (1989) Purification and identification of the fusicoccin binding protein from oat root plasma membrane, Plant Physiol 89: 250-259

8. de Vetten NC, Lu G and Ferl RG (1992) A com protein asso­ciated with the G-box binding complex has homology to brain regulatory proteins. The Plant Cell 4: 1295-1307

9. Feyerabend M and Weiler EW (1989) Photoaffinity labelling and partial purification of the putative plant receptor for the fungal wilt-inducing toxin, fusicoccin. Planta 178: 282-290

10. Galardy RE, Craig LC, Jamieson GD and Printz MP (1974) Photo affinity labelling of peptide hormone binding sites. J Bioi Chern 249: 3510-3518

II. Glazer AN, Delange RJ and Sigman DS (1975) in Chemical modification of proteins. In: Work TS and Work E (eds), pp 167-179. Amsterdam: Elsevier Biomedical Press

12. Hirsch S, Aitken A, Bertsch U and Soli J (1992)A plant homo­logue to mammalian brain 14-3-3 protein and protein kinase C inhibitor. FEBS Lett 296: 222-224

13. Ichimura T, Isobe T, Okuyama T, Takahashi N, Araki K, Kuwano R and Takahashi Y (1988) Molecular cloning of cDNA coding for brain-specific kinase-dependent activator of tyrosine and tryptophan hydroxylases. Proc Natl Acad Sci USA 85:7084-7088

14. Johansson F, Sommarin M and Larsson C (1993) Fusicoccin activates the plasma membrane H+ A1Pase by a mechanism involving the C-terminal inhibitory domain. The Plant Cell 5: 321-327

15. Kidou S, Umeda M, Kato A and Uchimiya H (1993) Isolation and characterization of a rice cDNA similar to the bovine brain specific 14-3-3 protein gene. Plant Mol Bioi 12: 191-194

16. Korthout HAAJ and de Boer AH (1994) A fusicoccin bind­ing protein belongs to the family of 14-3-3 brain protein homologs. The Plant Cell 6: 1681-1692

17. Lu G, De Lisle A, de Vetten NC and Ferl R (1992) Brain protein in plants: an Arabidopsis homolog to neurotransmitter pathway activators is part of a DNA binding complex. Proc Natl Acad Sci 89: 11490-11494

18. Lu G, Sehnke PC and Fer! R (1994) Phosphorylation and calcium binding properties of an Arabidopsis GFI4 brain protein homolog. The Plant Cell 6: 501-510

146

19. Marra M, Ballio A, Fullone MR and Aducci P (1992) Some properties of functional reconstituted plasmalemma H+ -ATPase activated by fusicoccin. Plant Physiol98: 1029-1034

20. Marra M, Fullone MR, Fogliano V, Masi S, Mattei M, Pen J and Aducci, P (1994) The 30 kD protein present in purified fusicoccin receptor preparation is a 14-3-3-like protein. Plant Physiol106: 1497-1501

21. Marre E (1979) Fusicoccin: a tool in plant physiology. Annu Rev Plant Physiol 30: 273-288

22. Mochly-Rosen D, Khaner H, Lopez J and Smith BL (1991) Intracellular receptor for activated protein kinase C. Identi­fication of a binding site for the enzyme. J Bioi Chern 266: 14866-14868

23. Oecking C and Weiler EW (1991) Characterization and purification of the fusicoccin binding complex from plasma membrane of Commelina communis. Eur J Biochem 199: 685-689

24. Palmgren GM, Sommarin M, Serrano R and Larsson C (1991) Identification of an autoinhibitory domain in the C-terminal region of tIle plant plasma membrane H+ -ATPase. J Bioi Chern 266(30):20470-20475

25. Rasi-Caldogno F, De Michelis MI, Pugliarello MC and Marre E (1986) H+ -pumping driven by the plasma membrane ATPase in membrane vesicles from radish: stimulation by fusicoccin. Plant Physiol 82: 121-125

26. Rasi Caldogno F, Pugliarello MC, Olivari C and De Michelis MI (1993) Controlled proteolysis mimics the effect of FC on the plasma membrane H+-ATPase. Plant Physioll03: 391-398

27. Serrano R, Portillo F, Monk B and Palmgren GM (1992) The regulatory domain of fungal and plasma membrane H+ -ATPase. Acta Physiol Scand 146: 131-146

28. Toker A, Sellers AL, Amess B, Patel Y, Harris A and Aitken A (1992) Multiple isoforms of a protein kinase C inhibitor (KCIP-1I14-3-3) from sheep brain. Eur J Biochem 206: 453-461

29. Vera-Estrella R, Barkla BJ, Higgins VJ and Blumwald E (1994) Plant defense response to fungal pathogen. Plant Physiol 104: 209-215

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 147-153. © 1996 Kluwer Academic Publishers.

147

14-3-3 Protein homologues playa central role in the fusicoccin signal transduction pathway

Albertus H. De Boer & Henrie A. A. J. Korthout Department of Plant Physiology and Biochemistry, Institute of Molecular Biological Sciences, Vrije Universiteit, De Boelelaan 1087, 1081 HV Amsterdam, The Netherlands

Key words: Avena sativa, fusicoccin receptor, 14-3-3 proteins, kinase, plasma membrane

Abstract

The plasma membrane located fusicoccin binding protein (FCBP) is an essential element in the fusicoccin (FC) signal transduction pathway. We obtained primary sequence information for the 31 kD subunit of the FCBP. These sequences showed that the FCBP is homologous to members of the 14-3-3 protein family. Both the 31 and 30 kD subunits cross-react with 14-3-3 antibodies. In native form the FCBP occurs as a dimer, but it is also part of a complex with higher molecular mass. The monomeric forms of the FCBP (the 30 and 31 kD subunits) do not have 3H-FC binding activity. We discuss how the FCBP, as a member of the 14-3-3 protein family, may be able to bind FC and how the FC-signal is transduced to the effector protein, the H+ -ATPase.

Introduction

The phytotoxin fusicoccin (FC), a diterpene gluco­side, elicits in plants a number of seemingly unrelated physiological responses [21]. (1) It stimulates cell enlargement, thereby mimicking the natural growth hormone IAA (indole acetic acid), (2) it promotes seed germination, thereby mimicking the effect of gibberllic acid (GA) and antagonising the effect of ABA (abscisic acid), (3) it stimulates stomatal opening in antagonism with ABA. At the cellular level the effect ofFC is char­acterised by a stimulation of the H+ -ATPase, increased uptake of K+, stimulation of ,B-glucan synthase, and gene expression [28]. From this diversity of effects, it can be concluded that activation of the FC-pathway is a central element in celluler signalling.

Two components of the FC-pathway have been studied in more detail: the receptor and one effector protein. The receptor is a protein (FCBP) located in the plasma membrane that binds FC with both high­and low-affinity. The FCBP was purified by means of FC-affinity chromatography from oat root plasma membrane as two polypeptides with molecular mass of 30 and 31 kD [7, 18]. Also it has been concluded

from experiments using photo-reactive azido-3H-FC and from purification by means of a number of chroma­tography steps, that the FCBP is made up of two subunits with molecular mass of around 30 kD [33]. At variance with the abovementioned reports is the conclusion by Aducci et al. (1993) that the FCBP is a polypeptide with a molecular mass of 90 kD. These authors find a 90 kD polypeptide in purified fractions, exhibiting 3H-FC binding, in addition to the 30 kD doublet. From photoaffinity labelling they conclude that the 90 kD labelling protein is the one that is com­petent in 3H-FC binding.

The plasma membrane localised H+ ATPase is one effector protein in the FC-pathway. FC stimulates the H+ -pumping activity and the autoinhibitory C­terminus of the pump is involved in the activation mechanism [17, 25]. Phosphorylation/dephosphory­lation seems to be one mechanism to regulate the pump activity [32], but it is not clear yet whether FC affects the phosphorylation status of the pump.

Evidently, knowledge about the nature of the FCBP is crucial in understanding the FC-pathway. The present study described the identification of the FCBP as a homolog of the so-called 14-3-3 protein family.

148

Some properties of the FCBP will be described and the place of this 1 ¢-3-3 protein in the FC-signa1 transduc­tion pathway will be discussed.

Materials and methods

Oat roots (Avena sativaI L cv. Valiant) were grown on stainless steel screens over a 1 mM CaS04 solution at 25 ° C in the dark. Plasma membrane preparation using the aqueous two phase partitioning method was carried out as described [7]. Prior to solubilization, plasma membrane vesicles were treated with biotiny­lated FC in 20 mM Tris/MES pH 6.0, 5 mM MgS04, 1 mM CaClz, 2.3 mM DTT and 1 mM PMSF to inhibit protease activity, for 2 hat 30 0c. FCBP was purified as described [19].

Size exclusion chromatography

Size exclusion chromatography was carried out on a Superdex-200 column (Pharmacia). The column was calibrated using a gel filtration calibration kit (Phar­macia). Solubilized plasma membrane proteins were loaded on to the column in 20 mM Tris/HCI pH 7.5, 5 mM MgS04, 1 mM CaCh, 2.3 mM PM SF and 0.2% (w/v) Octyl-glucoside (OG) at a flow-rate of 0.4 mL/min. Fractions of 1 mL were collected and tested for 3H-FC binding activity with 5 x 1O- 8 M 3H-FC.

SDS-page and western blot analysis

One dimensional gel electrophoresis and Western blot­ting were carried out using the BioRad Modular Mini Electrophoresis System. Proteins were analyzed on SDS-PAGE using a 15% acrylarnide gel. Gels were stained with 0.2% Coomassie Brilliant Blue R-250. Proteins resolved by SDS-PAGE were trans­ferred to nitrocellulose filters by electoblotting using a Tris-glycine buffer. The Western blot was probed with a polyclonal antibody raised against the BMHI gene translation product, encoding a 1¢-3-3 homo­logue in Saccharomyces cerevisiae. Cross reactivity on the Western blot was visualised using (1) GAR-AP (Goat anti Rabbit conjugated Alkaline Phosphatase or (2) with GAR-HP (Goat and Rabbit conjugated Horseradish Peroxidase) in combination with the Enhanced Chemiluminescent System (ECL) from Amersham (Buckinghamshire, England).

Protein and fusicoccin assay

The protein concentration was determined with the BCA Protein Assay Reagent (Pierce) with BSA as a standard. Binding assays were performed with [3H]_ dihydrofusicoccin (specific activity [May 1986] 35.2 Ci/mmol). Binding conditions: 10-7 M eH] dihydro­fusicoccin in a solution containing 20 mM Tris/HCI pH 7.5,5 mM MgS04, 1 mM CaCh, 2.3 mM DTT, 1 mM PM SF and 0.2% (w/v) OG for 12 h at room temperature.

Hydrophobic interaction chromatography

A purified FCBP sample was loaded in 1 M (NH4)zS04, on a Phenyl Superose HR 515 column. Proteins retained were eluted in a linear gradient run­ning from 1 to 0 M (NH4hS04. Fractions (1 ml) were assayed for 3H-FC binding activity.

Results

The FCBP was purified from oat root plasma mem­brane by a combination of selective precipitation and anion exchange chromatography [19]. Figure 1A (lane 1) shows the purified FCBP; total 3H-FC binding activity in the fraction shown was 10 pmol. The 31 kD band was excised from the gel, digested with tryspin and three peptides were sequenced (Fig. 2). A search in the EMBL databank showed that the 31 kD band was homologous to members of the 1 ¢-3-3 protein family [3].

A polyclonal antibody, raised agaist a 1¢-3-3 homolog from yeast (BmhI-antibody) [31], cross­reacted with both the 30 and 31 kD band in the purified FCBP fraction (Fig. lA, lane 2). So, the two FCBP subunits are immunoloigically related. Because we could not immuno-precipitate the native FeBP with the Bmhl-antibody, we affinity purified the FCBP with biotinylatedFC in combination with a monomeric avidin column[18]. A Western blot, using the Bmhl­antibody, of the fractions eluted from the column shows that the two polypeptides that elute from the column are 1¢-3-3 homologs (Fig. 1B). The peak fraction bound 0.15 pmol 3H-FC.

Recently, it was shown that 1¢-3-3 protein isoforms can form complexes with other proteins in the plasma membrane [9,13]. Therefore, we tested whether 3H-FC binding is associated with different molecular

A 1 2

97.4 66 .0

45 .0

29.0 -

17.0 -

12.4 -

B

29 kOa - - - - - - -

Fig. 1. Purification and identification of the FCBP. (A) SDS-PAGE of purified FCBP stained with Coomassie Brilliant Blue (lane I) and protein gel blot of the purified FCBP immunodetected with the Bmh1 antibody and visualised with GAR-AP (lane 2). (B) protein gel blot of FCBP purified by means ob biotinylated FClavidin chromatog­raphy; fractions were immunodeteced with the Bmh1 antibody and visualized with GAR-HP in combination with the ECL system.

size complexes and whether FC affects such com­plexes. Solubilized plasma membrane proteins were separated according to size on a Superdex column and two 3H-FC binding peaks were seen (Fig. 3); one at around 500 kD and a second at around 70 kD. When the plasma membranes were presented with an FC­conjugate (biotinylated FC), which can be partially

149

displaced by 3H-FC in the binding assay [18], the large molecular weight peak disappeared.

We also addressed the question whether the monomeric form of the FCBP maintains 3H-FC bind­ing activity. In order to get the monomeric forms, the purified FCBP (10 pmol 3H-FC binding activity) was prepared in a solution of 1 M (NH4hS04 (under those conditions the binding activity increases [7]), pumped into a Phenyl-Superose HR 5/5 column and fractioned with a decreasing (NH4hS04 gradient (Fig. 4). The 31 kD band eluted at 0.5 M (NH4hS04 (Fig. 4, lane 1) and the 30 kD subunit eluted at 0.25 M (NH4hS04 (Fig. 4, lane 2). In none of the fractions 3H-FC bind­ing activity could be detected. Therefore, we conclude that the FCBP monomers have no binding activity. This experiment also shows that the 30 kD subunit is more hydophobic than the 31 kD subunit.

Discussion

The relationship between the FeBP and the 30-KD doublet

From oat root plasma membrane the FCBP, active in 3H-FC binding, has been purified as a doublet of 30 and 31 kD by means of three techniques: (1) FC­agarose affinity chromatography [7], (2) biotinylated FCiavidin affinity chromatography [18] and by means of standard chromatography techniques [19] (Fig. 1). For three reasons we believe that the 30 kD doublet forms under native conditions the FCBP that is compe­tent in binding of 3H-FC. (1) Fractions collected from the FC-affinity columns that were still competent in 3H-FC binding showed that in some experiments only the 30 kD doublet, as judged from silver stained SDS­polyacrylamide gel. (2) 3H-FC binding activity in the purified FCBP fractions collected after standard chro­matography is so high that it can only be associated with the highly enriched 30 kD doublet, assuming a 1: 1 stoichiometry (Fig. 1). (3) In a number of different plant species a 30 kD doublet is photo affinity labelled with azido-3H-FC [12,24].

Based on our results we cannot support the conclu­sion by Aducci et at. (1993) (2) that a 90 kD polypep­tide is the functional FC receptor, simply because we do not observe a 90 kD polypeptide in our purified FCBP fractions. However, we cannot preclude the presence of a second FC-binding protein since our purifica­tion protocol is quite different from the one used by Aducci et at. We sometimes do see a 67 kD polypep-

150

Peptide 1 Peptide 2 Peptide 3

KClP

Human zeta

AtGF14 psi

Barley

Maize GF14

Oat FCBP

Fig. 2. Alignment of primary sequences from three peptides of the FCBP with two mammalian and three plant 14-3-3 protein homologs: KCIP [3]. Human ( [3]. AtGFI4 'Ij; [10]. Barley [4]. Maize GFI4 [8]. Peptide 2 is part of a highly conserved motif that has a role in binding of protein kinase C [23].

o 1.5 E Q.

.... {)

< 1.0

0.0

10 7

106

105

-'" 10·

Elution Volume (ml)

~

c a .... ~ Q ~

'" '" OIl ::Ii <-OIl ;:; " OJ

0 ::Ii

Fig. 3. Apparent molecular mass of the native FCBP as determined by size exclusion chromatography. Purified PM vesicles. pretreated with (.) Or without (0) 10-6 M biotinylated FC. were washed two times. solubilized with octy I-glucoside and fractionated on a Superdex-200 column. Fractions were assayed for 3H-FC binding activity.

tide in our purified FCBP fractions and it will be of great importance to find out whether this polypeptide has any relationship to the 90 kD-polypeptide. In this respect the disappearance of the large molecular mass complex after pretreatment with FC is of interest (Fig. 3). It might be that due to binding of biotinylated FC the large molecular weight complex dissociates into

1 2 3

Fig. 4. SDS-PAGE of purified FCBP fractionated by means of hydrophobic interaction chromatography. Purified FCBP (lane 3) was loaded on a Phenyl-Superose HR 5/5 column in 1 M (NH4hS04. The 31 kD subunit eluted at 0.5 M (NH4)2S04 (lane I) and the 30 kD subunit eluted at 0.25 M (NH4)2S04 (lane 2). The gel was silver stained.

the FCBP dimer and unknown components, amongst which the 67-and/or 90 kD polypeptides. However, another explanation is that the FCBP in the large com-

plex represents th,e high affinity state wherein 3H-FC cannot displace bound biotinylated FC.

The FCBP subunits are 14-3-3 homologs

In this study we demonstrate that both the 30 and the 31 leD subunits of the FCBP belong to the family of 14-3-3 homologs. The first indication came from sequence information of the 31 leD subunit (Fig. 2). Further proof came from the cross-reactivity of both subunit~ with 14-3-3 antibodies. Finally, the recognition of the FC-affinity purified 30 and 31 leD polypeptides by the 14-3-3 antibodies made the direct link between the FCBP and 14-3-3. The same relationship has been shown for the 30 leD polypeptide present in fractions highly enriched in 3H-FC binding activity from maize plasma membrane. [2]

What is the physiological role of 14-3-3 proteins?

In plants, yeast and in animals the 14-3-3 proteins are highly conserved and belong to a multi gene family [3]. The physiological role of 14-3-3 proteins was not very clear until recently. The first biological function for this protein was reported when an isoform iden­tified in the brain was shown to have similarity to an activator of tyrosine and tryptophan hydroxylases [15]. However, purified sheep brain 14-3-3 isoforms have been shown not to activate recombinant tyrosine hydroxylase [29]. Zupan et al. (1992) reported that the 14-3-3 ( isoform had PLA2 activity. In contrast, Robinson et al. (1994) found no PLA2 activity in brain 14-3-3 isoforms, including the 14-3-3 ( isoform. A 14-3-·3 homolog that was able to inhibit protein kinase C has been isolated from sheep brain [30]. However, the PKC assay used has been critisized it was found that 14-3-3 proteins can bind histone and alter the properties of histone as a substrate for PKC [5]. The PKC inhibitory activity of the 14-3-3 (has also been reported when MARKS peptide was used as a PKC substrate [26].

In Pseudomonas aeruginosa a member of the 14-3-3 protein family (FAS) was found to be necessary for the activation of exoenzyme S (ExoS) [14]. ExoS is an enzyme that catalyzes the transfer of the ADP-ribose moiety of NAD+ to eukaryotic proteins, preferably small G-proteins like Ras.

151

Very recently, two papers report on the role of 14-3-3 f3 and ( isoforms in the activation of Raf by Ras [13, 16]. Ras is a small GTP-binding protein and Raf is a down-stream effector of Ras with kinase activity. Activation of Ras recruits Raf to the plasma membrane and association of 14-3-3 with Raf in the plasmamem­brane results in activation of Raf. Also the FCBP can be recruited into the plasma membrane of oat roots [19]. In this case FC itself induces the recruitment. Raf contains a zinc finger-like region it has been suggested that 14-3-3 proteins interact with this zinc finger-like domain [13]. PKC, which contains similar zinc finger­like domains, binds to KCIP, a member of the 14-3-3 protein family [23]. The second peptide sequenced from the FCBP (YLAEFK, Fig. 2) is in the middle of the highly conserved PKC binding domain. In plants 14-3-3 proteins were shown to be part of a DNA­binding complex [8]. The mode of action of these 14-3-3 proteins in the DNA-binding complex is not clear yet.

Can plasma membrane bound 14-3-3 proteins act as receptors for fusicoccin?

Hydropathy plots of the primary sequences of 14-3-3 proteins do not reveal prominent hydrophobic regions and until recently it was concluded that they are soluble cytosolic proteins. However, it has recently been demonstrated that the 14-3-3 /' isoform is a phospholipid-binding protein and that it is associated with chromaffin granule membranes [27], Freed et al. (1994) showed that 14-3-3 f3 and ( isoforms are associated with the plasma membrane in mammalian cells.

The FCBP behaves like an integral membrane protein; i.e., 3H-FC binding activity is not released from the membrane in aquaeous buffers of varying ionic strength. However, we demonstrated [18] that the FCBP migrates mainly into the hydrophilic phase during Triton X-114 partitioning. We conclude that the FCBP has (1) either few trans-membrane span­ning domains or (2) that the FCBP is anchored to the inner face of the plasma membrane by some post-translational modification, like myristolation or polyisoprenylation. The first possibility supports the commonly accepted idea that the binding site is extra­cellular. The fact that the 30 leD doublet is glycosylated (AH de Boer and HAAJ Korthout, unpublished) and the presence of an N-glycosylation motif (N-F-S) in

152

the plant 14-3-3 sequences might indicate that part of the protein is indeed outside the cell.

The second possibility is more in line with the idea that 14-3-3 proteins are soluble proteins. Specific isoforms might undergo post-translational modifica­tion. However, when the FCBP is anchored at the inner face of the plasma membrane, the FC should be able to penetrate the membrane in order to reach the binding site. There are some arguments that need to be considered in this respect: (1) the octanol : water partition ratio of FC (30: 1) (PCJ Van der Hoeven and AH de Boer, unpublished) makes penetration of FC in the lipid bilayer possible, (2) Feierabend and Weiler (1988) observed that with increasing polarity of certain FC-conjugates (Fcol = monodeacetyl FC < dideacetyl FC) the biological activity decreased. They concluded that access of FC to the FC-binding site may involve an interaction with the lipid environment. (3) During photoaffinity labeling of FCBP in the plasma mem­brane of Vida faba [11, 12] and A. thaliana [22] low molecular mass components, presumably lipids, were labelled besides the 30 kD bands. Labelling of the low molecular mass components was reduced in the pres­ence of FC and are likely not the result of proteolytic degradation of the FCBP [11]. (4) In purified oat root plasma membrane vesicles, exhibiting 75% latency of the H+ -ATPase, 3H-FC binding showed the same sen­sitivity towards trypsin as did the H+ -ATPase activity: a loss of 30% [6]. This could indicate that the ATP­hydrolytic site and the 3H-FC binding site are located at the same face of the membrane; i.e., the inner face. Other papers describe a much greater loss of 3H-FC binding to PM vesicles [11], but the effect of trypsin upon the H+ -ATPase activity, as a control, is miss­ing. (5) The fact thaat FC conjugated to BSA is able to compete with 3H-FC for binding [1, 11], has often been taken as a strong indication that the FC binding site is in the apoplast. However, FC may not need to pass the membrane in order to bind and it remains to be seen whether BSA prevents partial partitioning of FC into the membrane.

Our results and those obtained by Marra et al. (1994) clearly show that 14-3-3 proteins are an essen­tial link in the FC signal transduction pathway. From our data we conclude that the FC-receptor belongs to the 14-3-3 protein family. In the near future the rela­tionship between the 30 kD doublet and the 90 kD polypeptide [2, 20] should become clear. It will be very interesting to find out whether the FCBPI14-3-3 couples to a protein kinase like in mammalian cells where 14-3-3 proteins interact with PKC and Raf. In

this respect the 67 kD polypeptide that some co-purifies with the FCBP during FC-affinity chromatography [7] will be characterized.

Acknowledgements

The authors are grateful to Dr G.P.H. Van Heusden (University of Leiden, The Netherlands) for his generous gift of the Bmhl antibodies. This work was supported by the Technical Science Foundation (STW).

References

I. Aducci P, Federico R and Ballio A (1980) Interaction of a high molecular weight derivative of fusicoccin with plant mem­branes. Phytopath Medit 19: 187-188

2. Aducci P, Ballio A, Fogliano V, Fullone MR, Marra M and Proietti N (1993) Purification and photo affinity labelling of fusicoccin receptors from maize. Eur J Biochem 214: 339-345

3. Aitken A, Collinge DB, Van Heusden GPH, Isobe T, Rose­boom, PH, Rosenfeld G and Soil J (1992) 14--3-3 Proteins. Trends Biochem Sci 17: 498-501

4. Brandt J, Thordal-Christensen H, Vad K, Gregersen P and Collinge DB (1992) A Pathogen-induced gene of barley encodes a protein showing high similarity to a protein kinase regulator. Plant J 2: 815-820

5. Chen F and Wagner PD (1994) 14--3-3 proteins bind to histone and affect both histone phosphorylation and dephosphory la­tion. FEBS Lett 347: 128-132

6. De Boer AH, Lomax TL, Sandstrom RP and Cleland RE (1987) Solubilization of the fusicoccin receptor and a protein kinase from highly purified plasma membrane from oat roots. In: Wirtz KWA (ed) Membrane Receptors, Dynamics and Ener­getics, pp 181-190. Plenum Pulbishing Corporation

7. De Boer AH, Watson BA and Cleland RE (1989) Purification and identification of the fusicoccin binding protein from oat root plasma membrane, Plant Physiol 89: 250-259

8. De Vetten NC, Lu G and Ferl RJ (1992) A maize protein associated with the G-box binding complex has homology to brain regulatory proteins. The Plant Cell 4: 1295-1307

9. Du X,HarrisSJ, TetazTJ,GinsbergMHand BemdtMC (1994) Association of a phospholipase A2 (14--3-3 protein) with the platelet glycoprotein Ib-IX complex. J Bioi Chern 269: 18287-18290

10. Ferl RJ, Lu GH and Bowen BW (1994) Evolutionary impli­cations of the family of 14--3-3 brain protein homologs in Arabidopis thaliana. Genetica 92: 129-138

II. Feyerabend M and Weiler EW (1988) Characterization and localization of fusicoccin-binding sites in leaf tissues of Vida faba L. probed with a novel radioligand. Planta 174: 115-122

12. Feyerbend M and Weiler EW (1989) Photoaffinity labelling and partial purification of the putative plant receptor for the fungal wilt-inducing toxin, fusicoccin. Planta 178: 282-290

13. Freed E, Symons M, Macdonald SG, McCormick F and Ruggieri R (1994) Binding of 14--3-3 proteins to the protein kinase Raf and effects on its activation. Science 265: 1713-1716

14. Fu H, Coburn J and Collier RJ (1993) The eukaryotic host factor that activates exoenzyme S of Pseudomonas aeroginosa is a member of the 14-3-3 protein family. Proc Natl Acad Sci USA 90: 2320-2324

15. Ichimura T, Isobe T, Okuyama T, Takahashi N, Araki K, Kuqwano R and Takahashi Y (1987) Brain 14-3-3 protein is an activator that activates trytophan 5-monooxygenase and tyro­sine 3-monooxygenase in the presence of Ca2+ , calmodulin­dependent protein kinase II. FEBS Lett 219: 79-82

16. lrie K, Gotoh Y, Yashar BM, Errede B, Nishida E and Matsumoto K (1994) Stimulatory effects of yeast and mam­malian 14-3-3 proteins on the Raf proteins kinase. Science 265: 1716-1719

17. 10hansson F, Sommarin M and Larsson C (1993) Fusicoccin activates the plasma membrane H+ -ATPase by a mechanism involving the C-terminal inhibitory domain. The Plant Cell 5: 321-327

18. Korthout HAAJ, Van der Hoeven PC1, Wagner Ml, Van Hunnik E and De Boer AH (1994) Purification of the fusicoccin­binding protein from oat root plasma membrane by affinity chromatography with biotinylated fusicoccin. Plant Physiol 105: 1281-1288

19. Korthout HAAl and De Boer AH (1994) A fusicoccin bind­ing protein belongs to the family of 14-3-3 brain protein homologs. The plant Cell (in press)

20. MarraM, Fullone MR, Fogliano V, Masi S, Mattei M, Pen 1 and Aducci P (1994) The 30 kD protein present in purified fusioccin preparations is a 14-3-3 like protein present in purified fusioccin preparations is a 14-3-3 like protein. Plant Physiol (in press)

21. Marre, EA (1979) Fusicoccin: A tool in physiology. Annu Rev Plant Physiol 30: 273-288

22. Meyer C, Feierabend M and Weiler EW (1989) Fusicoccin­binding proteins in Arabidopis thaliana (L.) Heynh. Plant Physiol 89: 692-699

23. Mochly-Rosen D, Khaer H, Lopex 1 and Smith BL (1991) Intracellular receptors for activated protein kinase C. 1 Bioi Chern 266: 14866-14868

24. Oeking C and Weiler EW (1991) Characterization and purification of the fusicoccin-binding complex from plasma

153

membranes of Commelina communis. Eur. 1. Biochem. 199: 685-689

25. Rasi-Caldogno F, Pugliarello MC, Olivari C and DeMichelis MI (1993) Conntrolled proteolysis mimics the effect of fusic­occin on the plasma membrane H+ -ATPase. Plant Physioll 03: 391-398

26. Robinson K, 10nes D, Patel Y, Martin H, Madrazo 1, Martin S, Howell S, Elmore M, Finnen Ml and Aitken A (1994) Mech­anism of inhibition of protein kinase C by 14-3-3 isoforms. Biochem 1 299: 853-861

27. Roth D, Morgan A, Martin H, 10nes D, Martens G1M, Aitken A and Burgoyne RD (1994) Characterization of 14-3-3 pro­teins in adrenal chromaffin cells and demonstration of isoform­specific phospholipid binding. Biochem 1 30 I: 305-310

28. Scott 1M (1992) Fusioccin-induced changes in the translatable RNAs of etiolated pea stem tissue. 1 Exp Bot 43: 1361-1365

29. Sutherland C, Alterio 1, Campbell DG, Le Bourdelles B, Mallet 1, Haavik 1 and Cohen P (1993) Phosphory lation and activation of human tyrosine hydroxylase in vitro by mitogen-activated protein (MAP) kinase and MAP-kinase-activated kinases. Eur 1 Biochem 217: 715-722

30. Toker A, Ellis CA, Sellers LA and Aitken A (1990). Protein kinase C inhibitor proteins. Purification from sheep brain and sequence similarity to lipocortins and 14-3-3 protein. Eur 1 Biochem 191: 421-429

31. Van Heusden GPH, Wenzel TJ, Lagendijk EL, Streensma HY, and Van den Berg lA (1992) Characterization of the yeast BMHI gene encoding a putative protein homologous to mammalian protein kinase II activators and protein kinase C inhibitors. FEBS Lett 302: 145-150

32. Vera-Estrella R, Barkla Bl, liggins Vl and Blumwald E (1994) Plant defense response to fungal pathogens. Plant Physiol 104: 209-215

33. Weiler EW, Meyer C, Oecking C, Feyerabend M and Mithofer A (1990) The fusicoccin receptor of higher plants. In: Lamb Cl, Beachy RN (eds) Plant Gene Transfer, pp 153-164. New York: Wiley-Liss

34. Zupan LA, Steffens DL, Berry CA, Landt M and Gross RW (1992) Cloning and expression of a human 14-3-3 protein mediating phospholipolysis. 1 Bioi Chern 267: 8707-8710

A. R. Smith et at. (eds.), Plant Hormone Signal Perception and Transduction, 155-161. © 1996 Kluwer Academic Publishers.

155

Endogenous fusicoccin: receptors and ligands

G.S. Muromtsev Institute oj Agricultural Biotechnology, ul. Timiryazevskaya 42, Moscow, 127550, Russia

Key words: fusicoccin, fusicoccin-like substances, phytohormones

Abstract

Fusicoccin A and fusicoccin-like substances were shown to be present in plant material (including sterile culture) using gas chromatography/mass spectrometry, radioreceptor and radioimmunoassays. Arguments are presented in favor of the multiplicity of endogenous fusicoccin-related compounds and their hormonal role in plants.

Introduction

Following the discovery of fusicoccin by Ballio and co-workers [6] and in parallel with their study on endogenous ligands for fusicoccin-binding sites in plants [2], the search for endogenous fusicoccin has been conducted in our laboratory since the late seven­ties. The premise for this was the striking analogy between fusicoccins and gibberellins: both are metabo­lites of phytopathogenic fungi, chemically belong to the same group of diterpenoids, and exhibit very high and versatile physiological activity of a hormonal type. Gibberellins became known in the late twen­ties as bioactive metabolites of the fungus Gibberella Jujikuroi, and only in mid-fifties they were found in higher plants and accordingly recognized as phyto­hormones. Fusicoccin was first reported by Ballio et al. [5] in the mid-sixties as the toxin of a phytopathogenic fungus Fusicoccum amygdali, and was shown to exert a wide-range physiological effects on most plants studied (activation of plasmalemmal transport systems, stimulation of growth by elongation, opening of stomata, enhancement of seed germination) [6, 10].

A major difficulty in the research on endogenous fusicoccin is that, like quite a few other recently found endogenous plant growth regulators (brassinosteroids, oligosaccharins), it is present in extremely low con­centrations (10- 10-10-9 M). There are two main ways of identifying endogenous bioactive substances. The first one (Fig. lA), which may be called 'conventional biochemical' and is based on extracting a substance

from plant material, purifying it (mostly by chromato­graphic means), and finally establishing its chemical structure by gas chromatography/mass spectrometry (GC/MS) or nuclear magnetic resonance (NMR). The second, more modem approach (Fig. IB) takes advan­tage of the ability of bioactive molecules to interact with certain cell structures (such as membranes) carry­ing specific receptors thereto. The high affinity of ligands to receptors enables the researcher to detect them in extremely low amounts, then concentrate them and, like in the first case, to identify their structure by reliable physico-chemical methods. In our work we tried to combine different approaches to docu­menting the existence of endogenous fusicoccin-like compounds, as well as to test different plant mate­rial.

Materials and methods

Extraction of FC-like substances from plant material (maize roots and cobs, cabbage leaves) was done in accordance with our protocol [12]. An important step of the procedure was extraction with chloroform. The extract was fractionated three-four times by HPLC under conditions for authentic FC A. Then the spec­imens were analyzed by GC/MS in the selected-ion­monitoring (SIM) mode as described earlier [13].

Transformation of horseradish roots was carried out using Agrobacterium rhizogenes [9]. Mature horseradish leaves 15-20 cm long were sterilized first

156

A CONVENTIONAL BIOCHF11ICAL

I EXTRACTION I PURIFICATION

[HPLC]

B FUNCTIONAL DETECTION

RECEPTORS ANTIBODIES (RRA] (RIA]

FINAL IDENTIFICATION

[GC/MS, NMR]

Fig. 1. Two alternatives for identifying endogenous bioactive substances.

with 70% ethanol (5 min), then with chloramine B (20 min), and repeatedly washed with sterile dis­tilled water. Then leaves were cut into pieces of about 1 cm and immersed for 10 min in a suspension of A. rhizogenes grown in LB medium for 18 h [9]. Then the leaves were dried on filter paper and placed on Petri dishes with agar MS medium without hormones [15].

After 1-2 d, when explants were surrounded with a slight halo of bacterial growth, they were again dried and placed on the same medium with cefotaxim (500 mg 1-1). The developing roots were cut off, placed on the antibiotic-containing medium and cultivated at 26 0 C for 4 weeks. Such passages were repeated four to six times till complete disappearance of the bacterial halo. Then the roots were placed on antibiotic-free MS medium. If there was no further bacterial growth, the roots were passed into liquid nutritive medium B5 without hormones [8]. Roots were cultivated at 26 °C in 0.5 1 flasks with 200 ml of medium, shaken in the dark at 80 rpm (Fig. 2). Subcultivating was carried out every 3-4 weeks. The rate of biomass accumulation was assessed by the growth index (biomass at the end of passage to the biomass of the inoculum). The work was carried out with a culture passaged over more than 3 years.

Fresh roots (5-10 g) were homogenized in 100 ml ethanol, and shaken at room temperature for 18 h. Then 20 ml of water was added and the mixture was centri-

fuged at 12000 g (4 °C, 30 min). After evaporation of ethanol, the ligand was extracted from the aqueous phase with an equal volume of chloroform by shaking the mixture at room temperature for 18 h. The chlo­roform phase was collected using a separatory funnel, chloroform was evaporated, and the dry material was stored at -20 °C. Chloroform and water phases were dried separately, and the pellets were extracted with ethanol (1:10 w/v) at 4 °C for 18 h. Extracts were centrifuged for 20 min at 10000 g, 4 0c. The super­natant was combined with 3-5 volumes of the assay medium (phosphate-buffered saline or 5 mM MgS04 in 20 mM HEPES-NaOH, pH 7.3 for RIA and RRA, respectively). Any precipitate was removed by cen­trifugation. Then serial triple dilutions (beginning with 1 :50) of the supernatant were prepared, and a lO-Jil aliquot of every dilution was used for competitive RRA or RIA tests.

Isolation of plant membranes was carried out in accordance to the previously described method [1].

Synthesis of eH]dihydroFC (3 TBq/mmol) and measurement of its binding to plasma membrane recep­tors were carried out as described previously [1]. Measurements were performed in 200 Jil final volume of medittm containing 20 mM Tris-MES (pH 7.2), 5 mM MgS04, 1 nM eH]dihydroFC, 15 Jig of mem­branes, and various amounts of the tested extract. The amount of extract that inhibited eH]dihydroFC bind­ing by 50% was determined. In calculating the concen-

157

Fig. 2. Batch culture oftransfonned horseradish roots.

tration of endogenous ligand, it was assumed that its affinity to the FC receptor is equal to that of FC A. The extent of nonspecific binding of eH]dihydroFC was assessed in the presence of 1 flM nonlabelled FC A.

Conjugation of FC A with bovine serum albumin (BSA) was carried out according to [7]. The conju­gate contained 1.7 mole fusicoccin per mole BSA, as judged by spectrophotometry in concentrated H2S04. Rabbits were immunized with 1 mg FC-BSA in com-

plete Freund's adjuvant, injected in popliteal lymph nodes and subcutaneously. Booster injections were made four times with 30-d intervals. Rabbits were bled at the 7th and 9th days after the last injection. The titer of antifusicoccin antibodies was 1 :2000 in RIA.

Inhibition of eH]dihydroFC binding to antibodies in the presence of various amounts of horseradish root ethanolic extract was measured in 0.2 ml final volume of PBS at room temperature. Each tube received 1 fll

158

1

10

3

10

1\ m/z

~715X10 -----f\ '- 535 x 1 0

---'n~409

349 ~385

~ 289

253xO.1 20 min

~m/z ~715X20

~535X20 409x2

~3B5X2 ~349X2 ~ 289x2

253xO.2

20 min _L.......--

2 ~ m/z

A ~715x10

~~ 535x10 ~ 409

~3B5 ~349 ~289

253xO.1

____ 1~0 ____________ 2~0 ____ ~min

4 m/z

-1t:::- 715x10

535x10

~ 409x2

~ 385x2

~ 349x2

289x2

--"'----- 253xO. 2

10 20 min

Fig. 3. GC/SIM profiles identifying tetraTMS FC A in HPLC fractions of extracts from (I) cabbage leaves, (2) maize cobs, and (3) maize roots; (4) authentic tetraTMS FC A, 5 ng. Abscissa, retention time.

of rabbit antiserum and 1 nM of eH]dihydroFC. After I-h incubation, antigen-antibody complexes were pre­cipitated by adding 0.2 ml of trichloracetic acid; free labelled FC was removed by ultrafiltration (Synpor membrane filters, 0.85 11m pore diameter, Chemapol, Czech Republic). The extent of non-specific binding of [3H]dihydroFC was assessed in the presence of 1 11M non-labelled FC A. As well as in RRA, the amount of extract that inhibited [3H]dihydroFC binding by 50% was estimated. The concentration of endogenous ligand was calculated taking that 10- 10 M reference

FC A caused 50% inhibition of eH]dihydroFC bind­ing to antifusicoccin antibodies.

Results and discussion

The first preliminary evidence for the presence of endogenous fusicoccin in higher plants was published by us in 1980 [11]. Since then we repeatedly found endogenous fusicoccins A and C in various plants using GClSIM [12, 13] (Figs. 3 and 4). It cannot be excluded,

1 /\ m/z '--./ ~ 745x5

~ 715x5

"-J L551x5

~535 _____ 1~0 _____________ 2~0 ___ min

2

10

m/z

~745x10 ~ -715)(10

~ C551X10

~ 535

20 min

159

Fig. 4. GCISIM profiles identifying pentaTMS FC C in HPLC fractions of extract from cabbage leaves (I); (2) authentic pentaTMS FC C, 4 ng. Abscissa, retention time.

homogenization wi th e thanol

c a nt r ! 1ugatton

. ith chloroforM A~S RESIDUE DRY .. ~tr~ction I I' ~P_~ __ I_~_w-T~-.. -va-~-r-a~t1~' o-n--------

Fig. 5. Schematic representation of the extraction and detection of FC-like ligands (horseradish roots).

however, that fusicoccin C is an artifact formed from fusicoccin A during purification and prolonged stor­age.

Scrutiny of the literature revealed that the tricyclic skeleton of fusicoccin (3,7,II-trimethyl-14-isopropyl­dicyclopenta[a , d]cyclooctane) is not a unique occur­rence. Many organisms harbor compounds of this family. The typical fusicoccane core has been found in fungi, lower and higher plants, and even in insects [14]. This argues in favor of the endogenous origin of fusicoccins, which is also in line with a body of indi­rect data [3, 16, 17]. Taking into account our results and the literature, we supposed that endogenous FCs in plants may be represented by more than just one or

100

80 A j\ o~ 60

40

/'0_/"-. / • \/ ro 0

80 D 60 /\. 40

ro / 0" / 0 : \ 0

_. 0 10 ro 3ll 40 50

Fig. 6. RIA detection of FC-like ligands in HPLC fractions (abscissa. ml eluate; ordinate. percentage inhibition) in (A) fresh extract and (B) after two weeks of storage. The vertical dashed line marks the position ofFC A.

two compounds. In this connection, we expanded the scope of experimental approaches by including radio­receptor and radioimmunoassays, which allow detec­tion of groups of substances having comparable affinity to receptors or antibodies.

FC receptors and corresponding ligands are under study in our laboratory since mid-eighties. Babakov and colleagues have clearly documented the existence of the previously reported high-affinity binding site for fusicoccin (Kd = 10-9 M) and in addition revealed another, low-affinity site (Kd = 10-7 M) on plasma membranes [1]. Using the high-affinity receptors, we demonstrated the presence offusicoccin-like ligands in plant extracts [4] and in cultured horseradish (Armora­cia rusticana P.) roots transformed with Agrobacterium rhizogenes [9]. This culture has for several years been

160

Table 1. Quantification of FC-like ligand in ethanolic solution obtained upon chloroform-water fractionation of plant extracts

Material and fraction Total matter, pc

gkg- I

Horseradish roots:

Chloroform" 3.5

15 (14)

Water> 4.7

Cabbage leaves:

Chloroform" 2.2

NO

Water> 66

" Re~idue after evaporation of the chloroform fraction. b Residue after lyophilization of the aqueous fraction.

Oilutiond Ce , nmol kg- 1

RIA RRA RIA RRA

1:2000 1:1700 66 84

1:90 1:80 4 6

1:300 1:250 70 90

NO NO 9 11

C Chloroform-water partition coefficient for endogenous ligand; parenthesized is the same for CH]dihydroFC. d Final dilution of the ethanolic extract producing 50% inhibition of CH]dihydroFC binding. e Molar concentration of endogenous ligand per kg f. wt. of plant material.

used by us as a source of peroxidase. Agrobacterial transformation ensured rapid root growth under sterile conditions in hormone-free medium (Fig. 2) and accu­mulation of substantial biomass in a relatively short time (15-20 d). Observation offusicoccin-like ligands in sterile roots refutes the common objection to such experiments that the ligand originated from microbial contamination. In parallel tests, th~se data were con­firmed by radioimmunoassay (Table 1). We should note some important conclusions stemming from the data in the table. First, this is the high efficiency of purification with chloroform; obviously, the bulk of admixtures is contained in the aqueous phase, while practically all the ligand goes into chloroform. Second, the chloroform­water partition coefficient for the ligand (15 : 1) virtu­ally coincides with that for FC A. As can be seen, the ligand concentration in transformed root culture tissue is in the range of 4-90 nmol kg- 1 •

As follows from Fig. 5, an important step in identi­fying FC and related ligands is HPLC. At the first stages of our work, we used for GC/SIM only the fraction that corresponded in the retention time to FC A; this imposed certain limitations. Indeed, under such condi­tions we could have detected only FC A or very closely related compounds. In a hypothetical case when the specimen under study lacks FC A but contains other FC-like substances, such an identification protocol would yield a negative result. Indeed, over more than a decade of chromatographic analysis along this line we got both positive and negative results. The use

of radioreceptor and radioimmunoassays permits us to cover a far broader scope of substances of the FC family. Moreover, another advantage of these tech­niques is their higher sensitivity (about two orders of magnitude) as compared with GC/MS.

Figure 6 shows the results of a most recent RIA experiment on 12 fractions collected in HPLC; fraction 8 corresponds to fusicoccin A in the retention time. We can see that substances competing with eH]dihydroFC for antibody binding are found not only in this fraction but also at lower polarity. This group ofligands appears to be unstable, and is not revealed with RIA after two weeks of specimen storage. Thus, it can be concluded that fusicoccin A is not the sole and maybe not the main endogenous fusicoccin-related ligand. The fact that it produces the maximal peak may simply be due to that the test system has been developed for this partic­ular compound, and other representatives of the group may have considerably lower affinity to the specific antibodies [7].

Here we again see notable analogy between fusic­occins and gibberellins. It is known that GA3, the main metabolite of Gibberellafujikuroi, is not a typical phytohormone, such as GAl or GAS, and is not at all omnipresent in plants. Possibly a similar place is occu­pied by FC A in the family of FC-like endogenous ligands.

This project has been carried out with participation of V. M. Koreneva, A. V. Babakov, V. D. Voblikova, L. M. Bartova, G. U. Margulis, R. R. Oganyan, N. Yu.

Abramycheva, V. L. Sadovskaya, A. V. Drabkin, I. L. Dridze, and A. N. Maisuryan.

References

1. AbramychevaNYu, Babakov AV, Bilushi SV, Danilina EE and Shevchenko VP (1991) Comparison of the biological activity of fusicoccin in higher plants with its binding to plasma mem­branes. Planta 183: 315-320

2. Aducci P, Crosetti G, Federico R and Ballio A (1980) Fusic­occin receptors. Evidence for endogenous ligands. Planta 148: 208-210

3. Aducci P, Marra M and Ballio A (1990) Fusicoccin receptors and endogenous ligands. In: Roberts J, Kirk C and Venis M (eds) Hormone Receptors and Signal Transduction in Animals and Plants, pp 111-117. Cambridge

4. Babakov AV, Bartova LM, Margulis GU, Oganian RR, Voblikova VD, Maisuryan AM, Dridze IL and Muromtsev GS (1994) Endogenous fusicoccin-like ligand revealed in higher plants. FEBS Lett (in press)

5. Ballio A, Chain EB, De Leo P, Erlanger BF, Mauri M and Tonolo A (1964) Fusicoccin: a new wilting toxin produced by Fusicoccum amygdali Del. Nature 203: 297

6. Ballio A, Pocchiari F, Russi S and Silano V (1971) Effects of fusicoccin and some related compounds on etiolated pea tissues. Physiol Plant Pathol I: 95-103

7. Feyerabend M and Weiler EM (1987) Monoclonal antibodies against fusicoccin with binding characteristics similar to the putative fusicoccin receptor of higher plants. Plant Physiol85: 835-840

161

8. Gamborg OL, Miller RA and Ojima K (1968) Nutrient require­ment for suspension cultures of soybean root cells. Exptl Cell Res 50: 51-54

9. Khadeeva NV, Maisuryan AM, Dridze IL (1993) Rapid method of horseradish propagation in tissue culture. Soviet Plant Physiol40: 115-118

10. Marre E (1979) Fusicoccin: a tool in plant physiology. Annu Rev Plant Physiol 30: 273-288

11. Muromtsev GS, Kobrina NS, Voblikova VD and Koreneva VM (1980) Fusicoccin-like substance in maize ears. Izvestiya AN SSSR Ser Bioi 6: 897-902

12. Muromtsev GS, Voblikova VD, Kobrina NS, Koreneva VM, Sadovskaya VL and Stolpakova VV (1987) Endogenous fusic­occin in higher plants. Soviet Plant Physiol 34: 980-987

13. Muromtsev GS, Voblikova VD, Kobrina NS, Koreneva VM, Sadovskaya VL and Stolpakova VV (1989) Fusicoccin in higher plants. Biochem Physiol Pflanzen 185: 261-268

14. Muromtsev GS, Voblikova VD, Kobrina NS, Koreneva VM, Krasnopolskaya LM and Sadovskaya VL (1994) Occurrence of fusicoccanes in plants and fungi. J Plant Growth Regul 13: 39-49

15. Murashige T and Scoog F (1962) A revised medium for rapid growth and bioassays with tobacco cultures. Physiol Plant 15: 473-497

16. Obrucheva NV and Antipova OV (1992) Fusicoccin as a probable endogenous factor of seed germination. Doklady AN SSSR 325: 412-426

17. Sultanbaev BE, Gilmanov MK, Abramycheva NYu, Stolpakova VV, Ginodman LM and Muromtsev GS (1993) An embryonal factor and fusicoccin induce NADP-specific gluta­mate dehydrogenase in germinating wheat seed. Plant Sci 88: 19-24

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 163-169. © 1996 Kluwer Academic Publishers.

163

Different properties of the inward rectifying potassium conductance of aleurone protoplasts from dormant and non-dormant barley grains

Bert Van Duijn2,3, Marcel T. Flikweert i ,4, Freek Heidekamp4 & Mei Wang4 (Department of Physiology, Leiden University, P.O. Box 9604,2300 RC Leiden, The Netherlands; 2Department of Anaesthesiology, University of Amsterdam, Meibergdreef 15,1105 AZAmsterdam, The Netherlands; 3Institute of Molecular Plant Sciences, Clusius Laboratory, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands; 4Center for Phytotechnology RULITNO, Department of Plant Biotechnology, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands

Key words: dormancy, aleurone, inward rectifying K+ channels, potassium, patch-clamp, barley

Abstract

Isogenic dormant and non-dormant barley grains provide a useful system to study the molecular mechanisms of grain dormancy and the role of plant hormones in this process. As ion fluxes are associated with dormancy-related plant hormone responses, we compared the properties of the inward rectifying potassium conductance in aleurone protoplasts isolated from dormant and non-dormant Triumph grains and in germinating Himalaya grains. Maximal conductance, voltage dependency of steady-state activation, activation and deactivation kinetics were studied in the whole-cell patch-clamp configuration. Activation and deactivation time courses were single exponential. No differences in the above described properties were found between the protoplasts isolated from non-dormant Triumph and Himalaya grains. However, the maximal conductance (corrected for cell size) in protoplasts from dormant Triumph grains was much smaller (65%), and activation time constants were much larger as compared to protoplasts from non-dormant grains. No differences were found in the deactivation kinetics in the three different types of protoplasts. The half-maximal activation potential was slightly more negative in protoplasts from dormant grains than from non-dormant grains.

Introduction

The barley aleurone is a gland-like tissue in the grain which plays an essential role in germination by secret­ing hydrolytic enzymes to the endosperm. The activity of the aleurone cells in the grain is under hormonal control; gibberellins (GA) activate and abscisic acid (ABA) inhibits aleurone activity. By using dormant and non-dormant barley grains with identical genetic background it was shown that the aleurone cells of these two types of grains show different properties with regard to hormone sensitivity and magnitude of responses [17, 18,21]. In addition, it has been shown that both ABA and GA induce responses in barley aleurone cells and protoplasts that are associated with fluxes of different ions, such as H+, K+ and Ca2+ [3, 7,9, 10, 11, 17,22]. To investigate whether differences

in aleurone protoplasts from dormant and non-dormant grains also exist in the properties of the proteins that are involved in ion transport, we performed patch-clamp experiments. As the inward rectifying K+ conductance is the most abundant conductance in barley aleurone protoplasts [3] we firstly concentrated on this conduc­tance.

Inwardly rectifying potassium channels in plants were first shown to exist in guard cells [14] and are likely to play an important role in the uptake of K+ during stomatal opening. In many other cell types, such as com shoot, Arabidopsis thaliana and tobacco cell suspension protoplasts, mesophyll protoplasts and barley aleurone protoplasts, these channels have also been demonstrated [3-5, 12, 20] suggesting a more general role for these channels. Furthermore, these channels have been shown to be under control of plant

164

hormones [2], G-proteins [6], phosphatases [13], Ca2+ and pH [1, 15].' We compared different properties of this conductance in aleurone protoplasts from dormant and non-dormant Triumph grains and the germinating Himalaya grains. In addition to the description of this current in aleurone protoplasts from Himalaya grains by Bush et al. [3], we further characterised this con­ductance with regard to the kinetic properties.

Materials and methods

Plant material

Isogenic dormant and non-dormant barley grains (Hordeum distichem L. cv. Triumph) were grown in the Stockholm Phytotron in 1989 under growing condi­tions as described before [16]. The harvested dormant mature grains were stored at - 20 0 C to preserve the level of dormancy. Hordeum vulgare L. cv. Himalaya grains were harvested in 1985 (Department of Agronomy, Washington State University, Pullman, USA).

Isolaton and treatment of pro top lasts from barley aleurone layers

Aleurone protoplasts were prepared as previously reported [22, 23]. The protoplasts were sieved (100 JIm sieve) and washed twice with APM (see Solu­tions). 5 JlI of protoplasts suspension (which usually contained about 30 protoplasts, which proved useful when making high resistance seals) was added to 1 ml ECS-buffer (see Solutions) in a glass bottom Teflon culture dish and were allowed to settle for 10 minutes. Only protoplasts that were firmly attached to the glass bottom were used for patch-clamp measurements.

Solutions

The Aleurone Protoplast Medium (APM) consisted of 0.385% Gamborg B5 powder, 0.10 mM D-glucose, 10 mML-Arginine, 20 mM CaCh, 10 mM MES, 350 mM Mannitol, 1 % PVP K25, 2 ml ampicillin (25 mg/ml in H20) and 0.2 ml Nystatin (25 mg/ml DMSO). The bath solution (ECS) consisted of 1 mM CaCh, 2 mM MgCh, lOmMMES, lOmMor20mMKCI, KOH (pH 5.6) and was adjusted to 1000 mOsm with mannitol. The pipette solution (ICS) contained 1 mM EGTA, 2 mM MgCI2, 10 mM HEPES, 100 mM K-gluconate, KOH (pH 7.2 or 6.8) and was adjusted to 1000 mOsm

with Mannitol. All solutions, except for APM, were filtered through a 0.2 JIm Nucleopore filter.

Electrophysiology

The patch-clamp technique was standard [8] and applied as described before [20]. The patch pipettes were pulled from haematocrit glass (Type II glass ASTM E438, Dade Diagnostics Inc., USA). The pipette resistance had values between 5-15 Mr2 as measured in ECS. After the giga-seal was formed the whole-cell configuration was obtained by short power­ful suctions to the pipette interior. The amplifier used was the LIM EPC-7 patch-clamp amplifier (List Elec­tronics, Darmstadt, FRG). The signal was low-pass filtered at 3 kHz before it was sent to the analog-digital converter. The signal was recorded via the software program pClamp (version 5.5.1, Axon Instruments, Burlingame, CA), which also generated the voltage pulse protocols. Data was analysed and further pro­cessed with the software programs pClamp and FigP (version 6.0c, Biosoft, Cambridge, UK). The experi­ments were performed at room temperature (21 0 C).

Statistics

Mean values ± standard deviation are presented, unless stated otherwise, with the number of measure­ments (protoplasts) between parenthesis. Significance of differences in mean values was tested with Students' t-test.

Results

Whole-cell currents

After obtaining the whole-cell configuration, the mem­brane potential was clamped at a holding potential (V H) of -50 mY. From this holding potential we applied voltage pulse protocols to the membrane. In all three types of protoplasts (Himalaya, Triumph non-dormant and Triumph dormant) hyperpolarizing voltage pulses caused a time and voltage-dependent activation of an inward directed current (Fig. lA,B). Experiments in which activating hyperpolarizing voltage steps were followed by steps to less nega­tive potentials showed a voltage and time dependent deactivation of this current (Fig. IC,D). From these "tail-current" experiments the reversal potential (Erev) of the current was determined. The measured reversal

A

1"-~ l~ \"-

;~ N

0.5 s

c

--- .. c=J"'.' ~ ...

11)0 .~

· 110 .. ,.

-.,.~ "" .....

ii~·' -:: ::

v-Ir

........

0.5 s

165

8 200

o ______________ ...... _+-+.-i~-.. ............ ,.

-200

< 0. -400

-600

-800

- 1000 I ' I '

-200 -150 -100 -50 0 50 100 150 200

v'" (mV)

D 200 E,

0 ---------------------- - - ~ ------r-- -· .......

- 200

"< ~ -400

-600

-800

-1000

-200 -150 -100 - 50 o 50

v'" (m V)

Fig. 1. Whole cell currents measured in a barley aleurone protoplast isolated from a Triumph non-dormant grain. The membrance capacitance of the protoplast was about 24 pF. Current traces are corrected for the leak-resistance, which was about 1.5 Gfl. Extracellular K+ concentration in this experiment was 10 mM. (A) Current responses upon stepwise changes in the membrane potential from a holding potential of -50 m V. Applied voltage protocol is shown as an inset. For reasons of clarity the current responses for the potential steps to -40, -20 and 20 to 140 m V are omitted from the figure. The voltage- and time-dependent activation of the current can be seen. (B) Steady-state I-V relationship of the responses shown in A. (C) Tail-current experiment for the determination of the reversal potential (Erev) according to the voltage protocol shown in the inset. After application of current activating hyperpolarizing pulses to -180 m V to the pipette interior, depolarising pulses ranging from -180 to +40 m V were applied. For reasons of clarity the responses upon depolarising steps to -20, 0 and +20 m V are omitted from the figure. The current responses on the depolarising test pulses show a reversal of the instantaneous "tail-current" around -50 mY. In addition, the voltage- ,and time-dependent deactivation of the conductance can be seen in the current responses upon the depolarising test pulses. (D) I-V relationship of the instantaneous tail-currents as shown in C.

potentials were around the equilibrium potential for potassium (EK) and not significantly different for the three types of protoplasts used (Table 1). Increase of the extracellular K+ concentration (to 20 mM) caused a shift in Erev to -41.0 ± 3.6 mV (n= 3), which is in the direction of the new EK. From these observations we conclude that the measured inward currents in all three types of pro top lasts are carried by the inward rectifying potassium conductance as was previously described for

aleurone protoplasts from Himalaya grains [3]. In addi­tion, the inward directed current could be completely blocked in all three types of protoplasts by 500 J.lM Ba2+ (Data not shown).

In a small number (about 10%) of protoplasts an outward directed current could be activated upon membrane potential depolariziation. This outward cur­rent, which was similar to the gibberellic acid (GA3) modulated potassium current as described by Bush et

166

Table 1. lkin properties of aleurone protoplasts from Himalaya, Trimph non-dormant and Triumph dormant grains. Mean values ± standard deviation are given with the number of protoplasts between parenthesis

Himalaya Trimph Triumph

Non-dormant Dormant

Erev l (mV) -60.9 ± 22.0 (5) -74.0± 13.1 (12) -78.2± 19.5(5)

~max (nS.pF- l) 0.078 ± 0.032 (5) 0.089 ± 0.057 (6) 0.044 ± 0.014* (4)

VO.5 (mV) -103.3 ± 0.6 (8) -103.6 ± 1.9 (20) -108.2± 1§ (5)

S(mV) 27.1 ± 0.6 (8) 22.1 ± 1.6t (20) 18.5 ± 1.0+ (5)

1 ECS in the bath and ICS in the pipette. * Value significantly smaller than in Himalaya and Triumph non-dormant (p < 0.05)

+ Value significantly smaller than in Himalaya and Trimuph non-dormant (p < 0.005) t Value significantly smaller than in Himalaya (p < 0.005)

§ Value significantly more negative than in Himalaya and Triumph non-dormant (p < 0.005)

al. [3], was not further investigated as the amplitude ran down in time during the whole-cell recording.

Conductance and activation potential of I kin

The maximal steady-state conductance (OK,max) for the inward directed K+ current was determined with the equation OK = I1(Em-Erev) from the steady-state I-V relationship for the different types of protoplasts. For all three types of protoplasts saturation of the inward rectifying conductance occurred at potentials more negative than -150 mY. Table 1 shows the OK,max with respect to the measured whole cell membrane capac­itance (which is a measure for the membrane area). The membrane capacitance ranged between 20 and 37 pF and the mean whole-cell membrane capacitance was not significantly different for the different types of protoplasts used. Table 1 shows that the membrane area corrected OK,max values for the inward rectifying K+ current in Himalaya and non-dormant Triumph aleurone protoplasts are not significantly different. However, the value for dormant Triumph aleurone protoplasts was much smaller (about 71 % and 60% as compared to Himalaya and non-dormant Triumph, respectively). In addition, the normalised steady-state conductance was determined as a function of the applied potential for the different types of protoplasts (Fig. 2). A Boltzmann distribution could be fitted to the normalised steady-state conductance/membrane potential relationship. The mean half-maximal acti­vation potentials (VO.5) were determined from these fits for the different types of protoplasts (Table 1), as were the slopes (S) of the curves (Table 1). Both V05 and S were not significantly different in aleu-

rone protoplasts from non-dormant Triumph grains compared to protoplasts from Himalaya grains. The VO.5 value in protoplasts from dormant Triumph grains, however, was about 5 m V more negative than in non-dormant Triumph and Himalaya. In addi­tion, the slope factor S was significantly smaller in protoplasts from Triumph grains as compared to protoplasts from Himalaya grains. The S value in protoplasts from dormant Triumph grains was some­what smaller than in protoplasts from non-dormant Triumph grains.

Activation kinetics of I kin

The activation of the inward directed K+ current showed in most cases a single exponential time course (Fig. 3A). From fits with single exponentials the acti­vation time constant, Tact was determined as a func­tion of the applied potential for all three types of protoplasts (Table 2). Between Tact and the applied potential a single exponential relationship was found, as the log(Tact) versus Vm curve could be reasonably fitted by a straight line. The slopes of these lines were not significantly different for the relationships found in Himalaya, Triumph non-dormant and Triumph dormant protoplasts. The absolute values of Tact. how­ever, were significantly higher in Triumph dormant protoplasts as compared to the values in Triumph non­dormant and Himalaya protoplasts (Table 2). From this we conclude that, although the voltage dependence of activation is similar for all types of protoplasts, the acti­vation in Triumph dormant protoplasts is slower than in non-dormant Triumph and Himalaya protoplasts.

Triumph non-dormant

0.8

M

Ii 0.6 :.::

C) -:.:: 0.4 C)

0.2

o ; I , ii' i , Ii; , i ' I i

-200 - 150 -100 - 50 o so

Fig. 2. Steady· state activations of the inward K+ currents of barley aleurone protoplasts from Himalaya (. , n = 8), Triumph non-dormant (_, n = 20) and Triumph dormant (0, n = 5) grains. The activation degree (~/~rnax) was calculated with respect to the determined Erev. ~rnax is the maximal conductance as found in protoplasts from Trimuph non-dormant grains K+ concentration in the extracellular solution was 10 mM. Solid lines are the fitted Boltzmann distributions:

~ I ----= ----~~~~ ~rnax 1+ e (Vo.s;Vm )

Correlation coefficients for the fits were >0.996. Bars indicate S.E.M.

Table 2. Ildn activation time constants (Tact} upon steps to different membrane potentials as determined from single exponential fits through the current traces obtained from aleurone protoplasts from Himalaya (n = 10), Triumph non-dormant (n = 12) and dormant (n = 5) grains. VH was -50 mV

Vrn Himalaya Triumph Triumph (mV) Tact (ms) non-dormant dormant

Tact (ms) Tact (ms)

-90 127.8 ± 17.9 128.7 ± 14.6 207.4 ± 53.6*

-120 112.4 ± 12.5 86.6± 11.5 172.8 ± 43.3*

-140 97.4± 9.0 96.3 ± 9.5 164.7 ± 42.2*

-160 76.0± 9.0 67.8 ± 8.4 123.7 ± 32.6*

* Value significantly larger than values measured in protoplasts from Himalaya and Triumph non-dormant grains at similar V rn (p < 0.005).

Deactivation kinetics of I kin

Similar to the activation kinetics, the deactivation of the Ikin showed a single exponential time course (Fig. 3B). From fits with single exponentials the deactivation time constant, T deac, was determined as function of

167

A ----.....------ - 80 mV :---.--..... ---""""'''''''''--,,-,- - 1 00 m V

~~--~~~--~-1 20 mV

i~· ........... ··-160 mV o . ..... . ..... ,,:, ... "" ... ;.......L~...,.".::-;-;::...,.:-..;... - 180 mV o - ............. . -

8

0.5 s

~ ~" .. : .

~ .

20 mV o mV

60 mV 80 mV

~ .... '~-= .. ' . .,..... ~,.......................,.-- 100 mV

il ~~.~~--:--,.,..,...... ........... ~......,. -120 mV

150 ms

Fig. 3. (A) Activation of the lldn ofa barley aleurone protoplast from a Triumph non-dormant grain upon different hyperpolarizing voltage steps (as indicated next to the current traces) from a VH of -50 mY. Solid circles show the measured current traces (presented at 25% of the sampling rate, for clarity reasons). The solid lines show the single exponential fits through the data points. (B) Deactivation of the lldn of the same protoplast as in (A) upon different depolarising voltage steps (as indicated next to the current traces) from a lldn

activating VH of -180 mY. Solid circles show the measured current traces (presented at 50% of the sampling rate, for clarity reasons). The solid lines show the single exponential fits through the data points.

the applied membrane potential for all three types of protoplasts (Table 3). As was found for Tact a single exponential relationship was found between T deac and V m for all three types of protoplasts. In contrast to Tact>

both slopes of the curves and absolute T deac values were not significantly different for Himalaya, Triumph non-dormant and Triumph dormant protoplasts (Table 3). From this we conclude that the deactivation of the Ikin is similar for the three types of protoplasts used.

168

Table 3. IK,in deactivation time constants (Tdeac) upon steps to different membrane potentials from an activating potential of -180 m V as determined from single exponential fits through the current traces obtained from aleurone protoplasts from Himalaya (n = 5), Triumph non-dormant (n = 9) and dormant (n = 3) grains.

Vrn Himalaya Triumph Triumph

(mV) Tdeac (ms) non-dormant dormant

Tdeac (ms) Tdeac (ms)

-110 82.8 ± 14.5 83.6± 32.7 92.8 ± 42.8 -40 75.0 ± 38.9 79.3 ± 24.6 95.9± 39.3

+10 40.1 ± 15.0* 60.7 ± 21.0* 64.9 ± 36.4

+55 42.1 ± 10.1 55.3 ± 19.5* 32.7 ± 24.4*

T deac values at similar V rn 's are not significantly different for the different types of protoplasts used (p > 0.10, * = P > 0.05).

Discussion

In barley aleurone protoplasts from Himalaya grains Bush et at. [3] showed the presence of an inward rectifying potassium conductance with properties sim­ilar to the inward rectifying conductance found in Vida faba guard cells, where it plays a role in K+ uptake during stomatal opening. So far, no clear role for the inward rectifying potassium conductance in other cell­types has been established. A role in potassium uptake and charge balance during H+ -ATPase activation are potential functions of the conductance. In our exper­iments we showed that this conductance, besides in Himalaya grains, is also present in barley aleurone protoplasts from Triumph grains. The kinetic proper­ties (Figs. 1, 2, 3; Tables 1, 2, 3) proved to be not essentially different from the results in other cell types [3-5,12,20].

As the dormancy level of the Triumph grain can be manipulated by the growing conditions [16], this cul­tivar provides a model system of isogenic dormant and non-dormant grains to study dormancy-related pro­cesses. The plant hormones GA and ABA are strongly involved in grain germination and dormancy regulating processes. One method to obtain information about the key components in the mechanisms of grain dormancy is by comparison of potentially involved elements in dormant and non-dormant grain responses. Since both ABA and GA are known to induce responses that are associated with ion fluxes [3, 7, 9, 10, 11, 22], ion channels may playa role in the regulation of dormancy and germination. Therefore, a comparison was made between the Ikin of aleuron.e protoplasts from dormant and non-dormant barley gniins. From our study it is

clear that qualitatively there is no difference between aleurone protoplasts from dormant and non-dormant grains because all show the presence of Ikin. How­ever, the maximal conductance (probably the number of channels) is much lower in the protoplasts from dormant grains as compared to genetically identical non-dormant grains (Table 1). There was no difference in maximal conductance between the two non-dormant grains (Himalaya and Triumph) (Table 1). The acti­vation curve (Fig. 2) showed that the half-maximal activation potential was about 5 mV more negative and that the slope was less steep for protoplasts from dormant grains as compared to non-dormant grains (Table 1). The activation and deactivation of the Ikin followed, in most cases, a single exponential time course (Fig. 3). From single exponential fits of the volt­age dependent activation of hin we found that activa­tion is significantly slower in protoplast from dormant grains as compared to non-dormant grains (Table 2). There was no significant difference in deactivation between the different types of protoplasts (Table 3). From this, we conclude that activation of an Ikin in aleurone protoplasts from non-dormant grains is fast and occurs to a large extent, whereas only a little or no hin is present in protoplasts from dormant grains. This suggests that aleurone protoplasts from dormant grains are less capable for K+ uptake and charge balance dur­ing H+ -ATPase activation. As a (partial) block of this conductance enhances the ABA-induced membrane potential hyperpolarization [9], a similar enhancement may be present in protoplasts from dormant grains. The Ikin difference may be due to differences between Ikin modulators such as pH, Ca2+, G-proteins [1, 6,15] in dormant and non-dormant grains. However, a more direct link between expression of the inward rectifying K+ conductance and dormancy level cannot be ruled out. Future research should be aimed at the regulation of the Ikin in barley aleurone protoplasts by cyto­plasmic factors and hormones, which may lead to a better understanding of its physiological role in the aleurone.

Acknowledgements

The research described in this article was financially supported by the Netherlands Organisation for Applied Scientific Research TNO.

References

I. Blatt MR (1992) K+ channels of stomatal guard cells. Char­acteristics of the inward rectifier and its control by pH. J Gen Physiol99: 615-644

2. Blatt MR and Armstrong F (1993) K+ channels of stomatal guard cells: Abscisic-acid-evoked control of the outward rectifier mediated by cytoplasmic pH. Planta 191: 330-341

3. Bush DS, Hedrich R, Schroeder n and Jones RL (1988) Channel-mediated K+ flux in barley aleurone protoplasts. Planta 176: 368-377.

4. Colombo R and Cerana R (1991) Inward rectifying K+ chan­nels at the plasma membrane of Arabidopsis thaliana. Plant Physiol97: 1130-1135

5. Fairley K, Laver D and Walker NA (1991) Whole-cell and single-channel currents across the plasmalemma of com shoot suspension cells. J Membrane Bioi 121: 11-22

6. Fairley-Grenot K and Assmann SM (1991) Evidence for G­protein regu.lation of inward K+ channel current in guard cells of Fava bean. The Plant Cell 3: 1037-1044

7. Gilroy S and Jones RL (1992) Gibberellic acid and abscisic acid co-ordinately regulate cytoplasmic calcium and secretory activity in barley aleurone protoplasts. Proc Nat! Acad Sci USA 89:3591-3595

8. Hamill OP, Marty A, Neher E, Sakmann B and Sigworth FJ (1981) Improved patch-clamp techniques for high-resolution current recording from cell-free membrane patches. Pftiigers Archiv 391: 85-100

9. Heimovaara-Dijkstra S, Van Duijn B, Heidekamp F and Wang M (1994) ABA-induced membrane potential changes in barley aleurone protoplasts: a possible role for the underlying ion­fluxes in the regulation of rab gene expression. Plant, Cell & Physiology 35: 743-750

10. Heimovaara-Dijkstra S, Heistek JC and Wang M (1994) Counteractive effects of abscisic acid and gibberellic acid on extracellular and intracellular pH and malate in barley aleu­rone. Plant Physiol 106: 359-365

II. Jones RL (1973) Gibberellic acid and ion release from barley aleurone tissue. Plant Physiol 52: 303-308

12. KourieJ and Goldsmith MHM (1992) K+ channels are respon­sible for an inwardly rectifying current in the plasma membrane of mesophyll protoplasts of Avena sativa. Plant Physiol 98: 1087-1097

169

13. Luan S, Li W, Rusnak F, Assmann SM and Schreider SL (1993) Immunosuppressants implicate protein phosphatase regulation of K+ channels in guard cells. Proc Nat! Acad Sci USA 90: 2202-2206

14. Schroeder n, Raschke K and Neher E (1987) Voltage depen­dence of K+ channels in guard cell protoplasts. Proc N atl Acad Sci USA 84: 4108-4112

15. Schroeder nand Hagiwara S (1989) Cytosolic calcium regu­lates ion channels in the plasma membrane of Vicia faba guard cells. Nature 338: 427-430

16. Schuurink RC, Van Beckum JMM and Heidekamp F (1992) Modulation of grain dormancy in barley by variation of plant growth conditions. Hereditas 117: 137-143

17. Schuurink RC, Sedee NJA and Wang M (1992) Dormancy of the barley grain is correlated with gibberellic acid responsive­ness of the isolated aleurone layer. Plant Physiol 100: 1834-1839

18. Van BeckumJMM, Libbenga KR and Wang M (1993) Abscisic acid and gibberellic acid-regulated responses of embryos and aleurone layers isolated from dormant and non-dormant barley grains. Physiol Plant 89: 483-489

19. Van der Veen R, Heimovaara-Dijkstra S and Wang M (1992) Cytosolic alkalinization mediated by abscisic acid is necessary, but not sufficient, for abscisic acid-induced gene expression in barley aleurone protoplasts. Plant Physiol 100: 699-705

20. Van Duijn B, Ypey DL and Libbenga KR (1993) Whole-cell K+ currents across the plasma membrane of tobacco proto­plasts from cell-suspension cultures. Plant Physiol 101: 81-88

21. Walker-Simmons M (1987) ABA levels and sensitivity in developing wheat embryos of sprouting resistant and suscep­tible cultivars. Plant Physiol 84: 61-66

22. Wang M, Van Duijn B and Schram AW (1991) Absisic acid induces a cytosolic calcium decrease in barley aleurone proto­plasts. FEBS Lett 278: 69-74

23. Wang M, Van Duijn B, Van der Meulen RM and Heidekamp F (1992) Effects of abscisic acid and abscisic acid analogues on intracellular calcium level and gene expression in barley aleurone protoplasts. In: CM Karssen, LC van Loon and D Vreugdenhil (eds) Progress in Plant Growth Regulation, pp 635-642. Dordrecht: Kluwer Academic Publishers

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 171-173. © 1996 Kluwer Academic Publishers.

171

Effect of alien ipt gene on hormonal concentrations of plants

R.V. Makarova, T.A. Borisova1, I. Machackova2 & V.I. Kefeli 1

1 Timiryazev Institute of Plant Physiology, Russian Academy of Sciences, ul. Botanicheskaya -15, Moscow, 127276, Russia; 21nstitute of Experimental Botany, Czech Academy ofScien<!es, Ke dvoru 15, Praha 6, CS-16600, Czech Republic

Key words: growth in vitro, Nicotiana tabacum, phytohormones, transgenic plants

Abstract

Transgenic plants carrying isopentenyl transferase (ipt) gene and normal tobacco plants (Nicotiana tabacum L.) were analyzed to compare their phytohormone status. Total cytokinin (zeatin, zeatin riboside, isopentenyladenine and isopentenyladenosine) level and free IAA content were always higher in shoots regenerated from transgenic culture although the concentrations were lower in roots. In transgenic plants, IAA-oxidase activity was lower and the concentration of its protectant chI orogenic acid was increased. Transgenic plants also contained lower concentrations of ABA.

Introduction

The regulation of plant growth by endogenous phyto­hormones is well-established. Each hormone affects diverse processes such as, gene expression and regulation, hormone-receptor complex formation, the regulation of ontogeny and many other processes [4, 6].

Transgenic plants expressing alien genes can be used for studying the effects of phytohormones on growth and morphogenesis [5, 7, 11, 14]. Efficient vector systems for alien gene introduction and expres­sion in the plant genome were produced on the basis of Agrob,acterial plasmids. The various effects of plant specific expression of Agrobacterium tumefa­ciens isopentenyl transferase gene (ipt or gene 4 T­DNA) have been discussed [7, 13]. We have used transgenic tobacco plants carrying the ipt gene from A. tumefaciens as a model to study changes in phyto­hormonal status.

Material and methods

Plant material

In the work, we used normal and cytokinin-transgenic (cyt-T) tobacco plants (Nicotiana tabacum L. cv. Samsun) grown in vitro. Transformation was per­formed as earlier described [5,14]. The final construct of the binary vector contained an Ri plasmid-helper. Rooted transgenic cyt-T and untransformed regen­erants were grown on hormone-free Murashige and Skoog medium [9].

Analysis of cytokinins, lAA, and ABA

Free IAA content in leaves and roots of cyt-T and con­trol plants was determined by HPLC [2]. Cytokinins; zeatin (Z), zeatin riboside (ZR), isopentenyladenine (ZiP) and isopentenyladenosine (ZiPA) were measured by ELISA after fractionation by HPLC [12]. ABA con­tent was measured by the method described in [1].

172

TallIe 1. Content of various cytokinins; zeatin (Z), zeatin riboside (ZR), isopentenyladarnine (ZiP) and isopentenylarlarnine (ZiP A) and lAA in control and cyt-T tobacco plants (ng g-I fr wt)

Plant Experiment Z+ZR Zip + ZiPA IAA

number Leaf Root Leaf Root Leaf Root

Control I 59.8 87.4 100 183.3 40.0 13.3

2 66.7 137.7 117.4 169.8 bdl' bdl

Cyt-T 519.6 40.0 92.3 193.4 112.7 5.0

2 243.1 127.3 293.4 100.3 bdl bdl

, bdl - below detectable limit. In the first experiment plants were analyzed in 6-8 months after transformation, in the second 18-24 months after transformation.

fAA-oxidase activity and chlorogenic acid determination

The extraction and determination of IAA-oxidase activity was performed in a buffer containing 20 mM phosphate buffer (pH 6.1), 1 mM MnCh, 1 mM 2,4-dichlorphenol,l mM IAA, and enzyme extract [3]. The enzyme activity was expressed in g oxidized IAA per mg protein per 1 min. Chi orogenic acid was isolated by two-dimensional chromatography using butan-1-ol/acetic acid/and water 4: 1: I (v/v/v) for the first dimension and 15% acetic acid (v/v) for the second dimension. The spot corresponding to the Rf of a standard sample of chi orogenic acid was eluted and the absorbance of the eluted sample was measured at 280 nm. All experiments were repeated 2-3 times.

Results and discussion

The cyt-T regenerant plants had shorter stems, increased number and increased biomass of leaves but lower root biomass. Total cytokinin concentrations were always higher in cyt-T than in control plants, although, the plants differed in the concentration of individual cytokinins (Table 1). In contrast to this increased cytokinin concentration in the shoots, the concentration of cytokinin in the roots of tranformed plants was lower than in control plants. This trend was not dependent on the time elapsed after transfor­mation, as early or late subcultures all showed similar patterns of cytokinin content. The increased auxin con­tent (Table 1) might be indirectly related to the ipt gene expression via the suggested effect of cytokinins on auxin metabolism [8]. The conversion of tryptophan to IAA and IAA inactivation in transformants differed from those in normal tobacco plants (our unpublished

Table 2. IAA-oxidase activity in control and cyt-T tobacco plants (ttg oxidized IAA min -I mg- I protein)

Plant Organ IAA-oxidase activity

Control Leaves 34.4± 2.2

Roots 62.1 ± 15.2

Cyt-T Leaves 24.1± 3.9 Roots 32.2 ± 8.1

observations). It has also been shown that plant cells transformed by the Ri plasmid of A. rhizogenes were more sensitive to auxin [10]. Preliminary results of comparing the IAA-oxidase activity in normal and transgenic tobacco plants are presented in Table 2.

The transformation of the plants resulted in a decrease in the auxin oxidase activity both in leaves and roots. The auxin protectant chI orogenic acid was identified in the extracts and shown to be present at a higher level in extracts of transgenic plant leaves as compared to the control plants (0.44 and 0.12 j..Lg g-l fr wt, respectively).

ABA content decreased in the leaves of cyt-T plants in comparison with control leaves: 45.5 and 75.7 ng g-l fr wt, respectively.

So, genetically determined changes in nuclear genome expression could not prevent normal devel­opment of regenerants carrying the ipt gene. In early subculture, cyt-T regenerants had higher growth (morphogenesis, shooting, and rooting) rate. The ratio of total leaf cytokinins/total root cytokinins was con­stant for each tobacco plant genotype (in average, 0.6 for normal and 2.5 for cyt-T plants). Therefore, we may conclude that in response to the introduction of a bacterial gene encoding key enzyme of cytokinin synthesis and expression of that gene in plant genome,

the hormone/inhibitorratio shifted in order to maintain the same regeneration potential in cyt -T plants.

References

I. Ciha A, Brenner M and Brun W (1977) Rapid separation and quantification of abscisic acid from plant tissues using high performance liquid chromatography. Plant Physiol 59: 821-826

2. Eder J, Rovenska J, Kutacek M and Cermak V (1988) HPLC analysis of indole compounds in Agrobacterium and trans­formed tobacco cells. In: Kutacek M, Bandurski R S and

" Krekule J (eds) Physiology and Biochemistry of Auxins in Plants, pp 389-390

3. Gamburg KZ (1966) Determination of IAA-oxidase and its inhibiting activity. In: Rakitin YuV (ed) Methods of determi­nation of pljll1t growth substances and herbicides, pp 57-65. Moscow, N auka

4. Kefeli VI (1992) Phytohormones, genome and properties. Ukranian Botanical Journal 49: 81-90

5. Kefeli V, Ranaweera K, Piruzyan E, MakarovaR, Andrianov V and Yusibov V (1990) Phytohormones in transformed tobacco plants. In: Kutacek M, Elliott M and Machackova I (eds) Hormonal regulation of plant development, pp 137-144. The Hague, Academic Publishers

6. Kulaeva ON (1991) Cytokinin action on transcription and translation in plants. In: Metabolism and molecular activities of cytokinins, pp 218-227. Berlin, Springer-Verlag

173

7. Marineau B, Houck M, Sheehy R and Hiatt W (1994) Fruit­specific expression of the A. tumefaciens isopenteny I tranferase gene in tomato: effects on fruit ripening and defense-related gene expression in leaves. Plant J 5: 11-19

8. Montague MJ, Enns R, Siegel N and Jaworski, E (1981) Inhi­bition of 2,4-dichlorphenoxyacetic acid conjugation to amino acids by treatment of cultured soybean cells with cytokinins. Plant physiol67: 701-704

9. Murashige T and Skoog F (1962) A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol Plan­tarum IS: 473-497

10. Petersen S, Stummann B, Olsen P and Henningsen K (1989) Structure and function of root-inducing (Ri) plasmids and their relation to tumor inducing (Ti) plasmids. Physiol Plantarum 77: 427-437

II. Schell J (1987) Transgenic plants as tools to study the molec­ular organization of plant genes. Science 237: 1176-1182

12. Machackova I, Krekule J, Eder J, Seidlova F and Stmad M (1993) Cytokinins in photoperiodic induction of flowering in Chenopodium species. Physiol Plantarum 57: 160-166

13. Vahala T, Eriksson T, Tillberg Eand Nicander B (1993) Expres­sion of a cytokinin synthesis gene from A. tumefaciens T-DN A in basket willow (Salix viminalis). Physiol Plantarum 88: 439-445

14. Yusibov V, Pak Chun II, Andrianov V and Piruzian E (1991) Phenotypically normal transgenic T-cyt tobacco plants as a model for the investigation of plant expression in response to phytohormonal stress. Plant Mol BioI 17: 825-836

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 175-183. © 1996 Kluwer Academic Publishers.

175

Abscisic acid-induced gene-expression requires the activity of protein(s) sensitive to the protein-tyrosine phosphatase inhibitor phenylarsine oxide

S. Heimovaara-Dijkstra, T. J. F. Nieland, R. M. van der Meulen & M. Wang Centre for Phytotechnology RULITNO, Department of Plant Molecular Biology, Wassenaarseweg 64, 2333 AL Leiden, the Netherlands

Key words: abscisic acid, barley aleurone, gene-expression, phosphatase inhibitor, phosphorylation

Abstract

Abscisic acid-induced gene-expression requires the activity of protein(s) sensitive to the protein-tyrosine phos­phatase inhibitor phenyl arsine oxide. It is generally accepted that phosphorylation/dephosphorylation of proteins plays an important role in signal transduction cascades. evidence is now accumulating that for plants the same holds true. To study the role of phosphorylation in ABA signal transduction, we used six different compounds which were reported to inhibit phosphatase action. Three of these inhibitors: phenylarsine oxide (PAO), Calyculin A (CA) and Okadaic Acid (OA) appeared capable of inhibiting ABA-induced gene-expression. The same three inhibitors are shown to bring about hyperphosphorylation of two approximately 40 kDa proteins, present in the membrane­bound fraction of barley aleurone cells. The other three inhibitors had no visible effect on the phosphorylation status of the barley proteins. The hyperphosphorylation of the two 40 kDa proteins coincided with an increase of tyrosine-phosphorylation of two 40 kDa proteins with different pI, as determined with anti-phosphotyrosine antibodies.

1. Introduction

Phosphorylation/dephosphorylation of proteins is an important step in many signal transduction pathways. Several well-studied examples of protein phosphoryla­tion have been shown to act as an essential component in hormonal regulation. Only recently has evidence accumulated that hormone-regulation acts via phos­phorylation processes in plants. Many protein kinases and some protein phosphatases [for review: 24] are now being identified, but the function of these proteins is largely unknown. To date, reports on the effect of phytohormones on protein phosphory lation are scarce. Indications that protein phosphorylation plays a role in ABA action are now appearing and recently, a gene responsible for a wide spectrum of ABA-responses in Arabidopsis was cloned and appeared to be a phosphatase-homologue [16, 18]. Earlier, Koontz and Choi [14] reported that ABA induces relatively rapid dephosphorylation of at least 3 acidic phosphoproteins in somatic carrot embryos. In addition, a gene was

identified whose expression was regulated by water stress and ABA which appeared to be homologous to protein kinases [1]. The role of protein phosphorylation in the action of other plant hormones, e.g. ethylene, is better documented. Raz and Fluhr [20] have shown that ethylene-induction of pathogenesis-related (PR)­proteins can be blocked by protein kinase inhibitors or mimicked by protein phosphatase inhibitors. Auxin has been shown to cause both phosphorylation and dephosphorylation of certain proteins in Avena coleop­tiles [22].

The use of specific inhibitors of protein kinases or phosphatases has proven to be a valuable tool in study­ing of the involvement of these enzymes in several physiological processes. Many such inhibitors are well documented in the animal literature but their action in plants is largely unknown. So far, staurosporine analogues [e.g. 8, 20] and the phorbol ester TPA [19] have been shown to affect the phosphorylation status of plant proteins. In addition, some phosphatase inhibitors have been used with various effects on phys-

176

iological proces~es. Okadaic acid seems to be the most widely used phosphatase inhibitor in plants: it was shown to affect PR-gene induction [20], pollen tube growth in Brassica [21] and appeared to mimic elicitor action in tomato cell suspensions [6, 23]. This latter effect could also be brought about by another phos­phatase inhibitor, Calyculin A.

Here, we report the use of several inhibitors of protein phosphatases to study the role of protein phos­phory lation in abscisic acid signal transduction leading to gene-expression in barley aleurone layers. Besides st\Jdying their effect on AB A-induced gene-expression we also investigated their specific effects on the protein phosphorylation status of barley aleurone proteins.

2. Materials and methods

2.1 Materials

All phosphatase-inhibitors were purchased from Salomon labs LID (Jerusalem, Israel). [,_32p] ATP (>5000 Ci/mmol) was from Amersham (Bucking­hamshire, UK). Monoclonal anti-phosphoserine and anti-phosphothreonine antibodies, (±) cis-trans ABA and ATP were from Sigma (St. Louis, MO). Anti-mouse or rabbit-IgG AP conjugate, 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) and nitro blue tetrazolium (NBT) were from Promega, (Madison, USA). All other chemicals were from Merck (Darm­stadt, Germany).

2.2 Isolation oJprotoplasts

Barley (Hordeum vulgare cv Himalaya) aleurone protoplasts were prepared essentially as described before [25]; aleurone layers were isolated from 3 days H20-imbibed sterile half-seeds and treated overnight with a enzyme-solution (cellulase). The protoplasts were harvested and washed three times with washing buffer (0.5 M mannitol, 10 mM KCI, I mM MgCh, 1.1 mM CaCh, 0.1 mM EGTA, 0.5 mM K2HP04 , 10 mM PIPES-HCI (pH 6.8), the osmolarity being approx. 800 mOsm).

2.3 Gene-expression studies

Barley aleurone protoplasts were incubated at a density of 4 x 105 mL -\ in washing buffer both or without ABA and/or phosphatase inhibitors at 25°C in the dark for 2 hours. RNA isolation, electrophoresis, blot-

ting and hybridisation were performed as described by Heimovaara-Dijkstra et al. [11].

2.4 Protein isolation and phosphorylation reactions

Barley aleurone protoplasts were resuspended in 40 mM HEPES (pH 7.7),0.5 mM EDTA, 50 mM Sucrose, o 0 C at a density of 1 x 106 pp mL - \ . The suspension was pressed though a Nucleorpore membrane filter (pore 0 5 pm) and centrifuged 10 min., 14000 rpm at 0° C. The supernatant, containing soluble proteins, was kept on ice until use. The pellet was washed twice in 10 mMTris-CI(pH 8.2), 2mMMgC}z, 1 mM ATP,20mM DTT at 0 °c. Afterwards, the pellet was resuspended in receptor buffer containing 20 mM Tris.CI (pH 7.5) and protease inhibitors [4] at a density equivalent of 5 x 106 pp mL -\ (approx. 1 pg pL -\). This suspen­sion, consisting of membrane or cytoskeleton-bound proteins, was kept on ice until use. Phosphorylation reactions were carried out by incubating 40 pL protein fraction in 50 pL solution of 0.5 mM CaC}z, 0.5 mM MgClz, 50 pM ATP, 10 pCi [,32p] ATP (facultative) and the indicated amounts of ABA and/or inhibitors. Reactions were performed at room temperature and were stopped by heating 2 min. at 100°C.

2.5 Protein analysis

Protein samples, isolated and treated as described in the previous section, were solubilized and then sepa­rated on 12.5% SDS-PAGE [15]. The gel was dried (for autoradiography) or the proteins were transferred electrophoretically to a nitrocellulose membrane as described by Klein et al. [13]. The nitrocellulose blots were blocked in phosphate buffered saline contain­ing 68.5 mM NaCI and 0.05% (v/v) Tween-20 and 1 % (w/v) BSA for 1 hour and incubated overnight at 4 °C with 1:500 diluted rabbit antiserum against phosphorylated tyrosine residues and subsequently for 1 hour with 1:7500 diluted goat anti-rabbit IgG conjugated to alkaline phosphatase. Specific bands were visualised using 5-bromo-4-chloro-3-indolyl­phosphate/nitro blue tetrazolium as substrate.

For two dimensional electrophoresis, protein sam­ples were first separated according to their isoelectric point on tube gels containing 0.8% ampholytes pH 5-7 and 0.8% ampholytes pH 3.5-10. After isoelectro­focussing (16.5 hours at 375 Volts and 1 hour at 800 Volt) the tube gels were equilibrated in 2% SDS, 10% glycerol, 5% ,8-mercaptoethanol, 62.5 mMTris.Cl (pH

8) for 1 hour and then mounted on a 12.5% SDS­PAGE gel and separated as described in the previous section.

3. Results

3.1 The effect of phosphatase inhibitors on ABA -induced gene-expression

We used 6 protein-phosphatase inhibitors known from animal literature to study the role of protein dephos­phorylationin ABA-signal transduction: Okadaic Acid (OA) [10] and Calyculin A (CA) [2], both being potent inhibitors of serine/threonine-specific protein phosphatases 1 and 2A; Phenylarsine oxide, a putative inhibitor of tyrosine phosphatases (PAO) [7]; Sodium fluoride, a potent inhibitor of acid, alkaline, P-2 and P2A phosphatases (NaF) [9]; Pyrophosphate [3] and vanadate, both general protein phosphatase inhibitors [5].

Using these inhibitors at concentrations suggested in the literature, we found that Calycu1in A slightly inhibited ABA-induced gene-expression and that PAO was capable of complete inhibition of ABA-induced gene-expression (Fig. 1). None ofthe other inhibitors we used significantly affected Rab-mRNA levels. To test whether the observed inhibition by Calyculin A and PAO was specific for ABA-induced gene-expression rather than an overall effect on transcription, we rehy­bridized the blot with GAPDH, a non-ABA-regulated gene. Figure 1 shows that none of the compounds inhibited the GAPDH expression levels.

We subsequently tested the concentration­dependency of the inhibition by PAO, CalyculinA and Okadaic Acid. The latter should give similar results to CA, as both are reported to affect the same classes of phosphatases, although OA is reported to be consider­ably less effective [e.g. 6]. All appeared to bring about a concentration-dependent inhibition of ABA-induced Rab-mRNA levels (Fig. 2). CA was able to cause ~60% inhibition of Rab-mRNA induction at a con­centration of 10-7 M. Doubling of the concentration did not seem to increase the inhibiting effect. Appar­ently maximal inhibition by CA was reached at 10-7

M and CA was able to partially inhibit ABA-induced gene expression. OA was able to inhibit Rab-mRNA induction by approximately 30% at a concentration of 2 x 10-6 M (Fig. 2). PAO, on the other hand, was able to completely inhibit Rab-mRNA induction at a con­centration of 10-7 M. These results suggest that these

177

inhibitors affect the ABA signal transduction leading to Rab-mRNA induction in different ways: PAO is able to completely block the process whereas both CA and OA seem only able of partial inhibition. Rehybridiza­tion with GAPDH showed that these compounds did not affect overall transcription levels at the concentra­tions used.

3.2 Effect of phosphatase inhibitors on the phosphorylation status of barley aleurone proteins

The inhibitors we used are reported to affect dephos­phorylation processes in several organisms. However, there are no data available on their precise action in plants. We therefore investigated the effect of these compounds on the phosphorylation status of proteins from barley aleurone. To this end we used two approaches; studies involving radio-labelled phosphorus and studies using antibodies against phos­phorylated amino acid residues.

To visualise effects on the overall-protein phospho­rylation, barley aleurone proteins were isolated and roughly separated in a membrane (or cytoskeleton)­bound and a soluble fraction as described in Materials and Methods. Both fractions were incubated with 32p

,-labelled ATP in a solution of 0.5 mM CaCh, 0.5 mM MgCh and 50 J-lM ATP (pH 7.5) in the absence or presence of the inhibitors. The phosphorylation status of the proteins in the 'membrane-fraction' (mainly membrane or cytoskeleton-bound proteins) was not visibly affected by NaF, pyrophosphate or vanadate (Fig. 3A). The other three inhibitors, PAO, CA and OA, caused hyperphosphorylation of an ~40 kDa protein­band (Fig. 3A). Quantitative analysis of the relative intensity of this band revealed that OA has an almost negligible effect while CA and PAO brought about a clear increase in phosphorylation; PAO being the most effective. In addition, a decrease in intensity of an ~43 kDa band was brought about by PAO. In con­trast to the hyperphosphorylation effect, this decrease was not consistently observed throughout individual experiments.

The effect of PAO on the hyperphosphorylation of the 40 kDa protein(s) was clearly visible after 5 minutes incubation and increased up to 15 minutes, decreasing again after longer periods of incubation (data not shown). The transient nature of the inhibitory action of PAO on dephosphorylation processes has been described [17]. In the soluble protein fraction no effect of NaF, pyrophosphate or vanadate could been visualised. PAO, CA and OA on the other hand

178

RAB16

GAPDH

« ce O <+

Fig. 1. Barley aleurone protoplasts were incubated in the presence of the following compounds: -, control; ABA,S x 10-6 M ABA: OA, ABA+ I x 10-7 M Okadaic acid; Van, ABA+ I mMVanadate; CA, ABA+ I x 10-7 MCalyculin A; Pyr, ABA+ I mM Pyrophosphate;NaF, ABA+ I mM Sodium fluoride; PAO, ABA+ I mM Phenylarsine oxide. After 2 h, cells were harvested, RNA was isolated and hybridised with the Rab 16-cDNA probe. The blot was then stripped and rehybridized with the GAPDH-cDNA probe. One representative example of three experiments is shown.

caused a decrease in phosphorylation of ~42 kDa soluble protein(s) and no hyperphosphorylation was seen. The inhibitory effect on the relative intensity of the 42 kDa band seemed similar in magnitude for PAD, CA and DA (Fig. 3B). Furthermore, we studied the effect of ABA on phosphorylation of the protein fractions. Attempts to examine the effect of ABA on protein phosphorylation in intact aleurone cells did not reveal any effect (data not shown) and no clear of ABA-specific protein phosphorylation was found for membrane-bound isolated protein fractions (Fig. 4).

As an alternative approach to investigate the action of PAD and ABA, we chose to use anti­bodies against phosphorylated amino acid residues. According to Garcia-Moralez [7] PAD inhibits tyrosine-phosphatases. Increase of phosphorylation due to PAD-inhibition is therefore expected to be found on tyrosine-residues. To further study the char­acter of the phosphorylation that is affected by PAD,

both intact protoplasts and isolated membrane frac­tions were treated with PAD or ABA and extracted proteins were immunoblotted and incubated with an antibody against phosphorylated tyrosine residues kindly provided to us by Dr Maassen, Leiden Univer­sity. It was clearly visible that an ~40 kDa band in the membrane fraction showed a stronger reaction with the Ptyr antibodies when incubated in the presence of PAD; this cross-reaction was not detectable in the absence of PAD. Two dimensional gel-electrophoresis followed by western blotting and immunodetection with the Ptyr antibodies showed that this increase was due to increased tyrosine-phosphorylation of 2 ~40 kDa proteins with different pI's (Fig. 5). Treat­ment with ABA did not reveal any changes in tyro­sine phosphorylation detected by the Ptyr antibodies (two-dimensional analysis, data not shown). Incuba­tion of identical immunoblots with anti-phosphoserine or anti-phosphothreonine antibodies revealed no effect of either PAD or CA on the phosphorylation status of

G)

» '1J o I

:xl » OJ ~

0>

ABA 2.10-70A 2.10-s0A 10-8CA 10-7CA 2.10-7CA 10-7PAO 10-sPAO 10-5PAO 10-"PAO 10-3PAO

179

Fig. 2. Barley aleurone protoplasts were incubated in the presence 5 x 10-6 M ABA (except for the control-) and the inhibitors Okadaic acid (OA); Calyculin A (CA); and Phenylarsine oxide (PAO) in the concentrations indicated (in M). After 2 h. cells were harvested. RNA was isolated and hybridised with the Rab l6-cDNA probe. The blot was then stripped and rehybridized with the GAPDH-cDNA probe. One representative example of two is shown.

these amino acid-residues (data not shown). Appar­ently PAO mainly affects tyrosine phosphorylation, as previously reported [7] . The tyrosine phosphorylation status of cytosolic proteins was not visibly affected by PAO (data not shown).

4. Discussion

Protein phosphorylation is a highly regulated pro­cess, performed by the balancing activities of protein kinases (PK's) and protein phosphatases (PP's). Many hormones exhibit their influence by activating phosphorylation and/or dephosphorylation events. Recently, evidence that plant hormone signal trans­duction pathways involve phosphorylation was pub-

lished, among which data describing that the mutant locus in the Arabidopsis ABA insensitive ABI-mutant encodes a putative serine-threonine phosphatase [16, 18]. Currently, we can demonstrate that the phos­phatase inhibitor PAO (and CA and OA to a minor extend) interfere with ABA-induced gene-expression and barley protein phosphorylation.

Inhibition of ABA-induced gene-expression by PAO was specific: 100 nM of PAO completely inhib­ited Rab-gene induction while concentrations up to 1 mM did not affect expression of the non-ABA inducible gene GAPDH (Fig. 2). The inhibition of Rab-gene-expression by CA and OA was less sensi­tive and apparently involved (an)other mechanism(s); neither CA or OA was able to completely inhibit of the ABA-induced gene-expression (Fig. 2) .

180

200

97 -

68 -

43 -... 29 -

18 -

Membrane Fr.

o «<~;.~ Cl..()OZCl..>

40 kDa-band

1111111

Soluble Fr .

o «<~;.~ Cl..()OZCl..>

42 kDa-b and

I . . . I I I

Fig. 3. A (upper panel): Barley aleurone proteins were isolated and separated into a fraction containing mainly membrane- and cytoskele­ton-bound proteins 'Membrane Fr' and a fraction containing soluble proteins 'soluble Fr', as described in the Materials and Methods section. per sample, 40 IlL of the protein fractions was incubated in 0.5 mM CaCI2, 0.5 mM MgCI2, 50 mM ATP, 20 mM Tris.CI (pH 7.5) in the presence of 10 !lCi b 32p] ATP and the following inhibitors: -, control; PAO, I mM Phenylarsine oxide; CA, 10-7 M Calyculin A; 'OA', 10-7

M Okadaic acid; NaF, I mM Sodium fluoride; Pyr, I mM Pyrophosphate; Van I mM Vanadate. After 15 minutes reactions were terminated by heating for 2 min at 100°C, and proteins were separated by SOS-PAGE, which were dried and exposed to an X-ray film. One representative example of 3 experiments is shown. B (lower panel): relative intensities of the ",40 kOa band (membrane fr.) and the ",42 kOa band (soluble fr.) as compared to the total intensities of the samples. Intensities were determined with a LKB ultrascan.

Research has revealed that phosphatase inhibitors can interfere with several physiological processes in plants [6, 20, 21 , 23]. However, to our knowledge no data are presented yet showing what effect these compounds have on protein phosphory lation in plants. We therefore investigated if and how these compounds

affected phosphorylation of barley aleurone proteins. It appeared that the phosphatase inhibitors used showed diverse effects on protein phosphorylation of isolated barley aleurone proteins. The three compounds that did not affect Rab-gene induction: NaF, pyrophos­phate and vanadate, did not cause any visible effect on

< CD < +

Fig. 4. Membrane-bound protein fraction, isolated as described in the Materials and Methods section, were incubated in 0.5 mM CaCh , 0.5 mM MgCI2, 50 JiM ATP, 20 mMTris.Cl (pH 7.5) in the presence of 10 JiCi [-y 32p] ATP with (+ ABA) or without (-) I x 10-5 M ABA. After 5 minutes reactions were tenninated by heating for 2 minutes at 100 °C, separated by SDS-PAGE, dried and exposed to X-ray film. One representative example of six experiments is shown.

protein phosphorylation under our experimental con­ditions. The other three inhibitors we used showed a dual effect: An caused hyperphosphorylation of an ,,-,40 kDa protein-band in the membrane-bound frac­tion and inhibited the phosphorylation of an ,,-,42 kDa protein-band in the soluble fraction.

We consider that the ,,-,40 kDa membrane-fraction proteins, which were hyperphosphorylated in the pres­ence of PAO, might be involved in ABA-action: the inhibition of dephosphorylation showed similar sen­sitivity for the different compounds as the inhibition of Rab-mRNA induction. In both processes PAO is very effective while CA and OA only induce partial inhibition, OA being the least effective.

181

On the other hand, the inhibition of phosphoryla­tion of the 42 kDa soluble protein(s) seems less likely related to ABA-induced Rab-mRNA induction. First of all, PAO, CA and OA bring about a similar magni­tude of inhibition of the 42 kDa soluble protein(s) (Fig. 3B). The inhibitors are not capable of comparable inhi­bition of Rab-mRNA induction (Fig. 2). the effect of OA, which causes a clear decrease of phosphorylation of the soluble 42 kDa protein at 10-7 M but cannot inhibit ABA-induced gene-expression at this concen­tration providing evidence that the 42 kDa protein may not have a role in ABA-induced gene-expression (Figs. 3B resp. 2). The fact that these putative dephosphoryla­tion inhibitors cause an inhibition of phosphorylation, suggests that we observe an (possible secondary) effect on protein kinase activity.

As the alleged protein tyrosine phosphatase inhibitor PAO specifically inhibited ABA-induced gene-expression and was able to affect barley pro­tein phosphorylation, it is tempting to hypothesise that ABA signal transduction leading to gene-expression involves a protein tyrosine phosphorylation and/or dephosphorylation event. However, we were not able to show any direct effect of ABA on protein phos­phorylation, using either 32P-Iabelled ATP (Fig. 4) or using anti-phosphotyrosine antibodies. This may well be due to experimental shortcomings such as the fact that dephosphorylation of a specific protein can only be visualised if the 'resting-level' of phosphorylation of this protein is at or above the detection limit. We are especially interested in the effect of ABA on the two ,,-,40 kDa membrane-fraction proteins which were hyperphosphorylated in the presence of PAO. How­ever, these proteins were not visibly phosphorylated in the absence of PAO (Fig. 5), probably due to a resting level of phosphorylation which is below our detection limits. Other methods must now be used to establish whether ABA acts via dephosphorylation of these, or other, proteins.

The nature of the barley aleurone phosphatase which seems affected by PAO is as yet unknown. the fact that effect of PAO on dephosphorylation can take place in disrupted cells and in the absence of soluble proteins suggests that the affected phosphatase is itself membrane or cytoskeleton bound and that it is in close contact with its substrate. It cannot be excluded that the (two) 40 kDa protein(s) in the membrane-fraction are themselves phosphatases, exhibiting autodephos­phorylation.

Although we have not been able to establish an effect of ABA on the phosphorylation of these proteins,

182

4.0 7.0

200

97 -

--68 -

43 -

t t 29 -

18 -

200

97 -

--68 -

+PAO 43 -

t t 29

18 -

Fig. 5. Membrane-bound protein fractions. isolated as described in the Materials and Methods section. were incubated in 0.5 mM CaCho 0.5 mM MgClz. SO /-LM ATP. 20 mM Tris.CI (pH 7.5) in the absence (-) or presence (+ PAO) of 100 /-LM PAO. After 20 min reactions were terminated by heating for 2 min at 100°C. Proteins were separated by 2-Dimensional electrophoresis. blotted and incubated with anti-phosphotyrosine antibodies. Arrows indicate spots that were hyperphosphorylated in the presence of PAO. One representative example of five experiments is shown.

they seem attractive candidates for further study con­cerning ABA-signal transduction. Many known pro­teins would fit into the given substrate profile of these membrane or cytoskeleton-bound protein(s); i.e. a 40 kDa protein which is involved in a signal transduction cascade and apparently regulated by tyrosine phospho­rylation/dephosphorylation; one candidate being the previously mentioned Arabidopsis phosphatase which is of the appropriate size [16, 18]. Another appeal­ing possibility would be the family of MAP kinases, which require both tyrosine and serine/threonine phos­phorylation to be activated and which are known to exist in plants [12]. The fact that both ser/thr­phosphatase inhibitors and tyr-phosphatase inhibitors affect ABA-induced gene-expression might support the involvement of a MAP-kinase cascade in ABA­signal transduction, as this kinase is affected by both types of phosphorylation. However, further research is necessary to reveal the identity of both the 40 kDa proteins and the phosphatase involved, giving more insight in the signal transduction mechanism in which they function.

Acknowledgements

We would like to thank Dr Maassen for providing the anti-phosphotyrosine antibodies and for many helpful suggestions and Prof Dr K R Libbenga and Dr B van Duijn for stimulation, discussion and critical reading of the manuscript.

References

1. Anderberg RJ and Walker-Simmons MK (1992) Isolation of a wheat cDNA clone for an abscisic acid-inducible transcript with homology to protein kinases. Proc Natl Acad Sci USA 89: 10183-10187

2. Biolan C and Takai A (1988) Inhibitory effect of a marine­sponge toxin, okadaic acid, on protein phosphatases. Biochem 1256: 283-290

3. Damuni Z (1990) Inactivation of bovine kidney cytosolic protamine kinase by catalytic subunit of protein phosphatase­ZA. Biochem Biophys Res Commun 166: 449-456

4. Das OP and Henderson E (1983) A novel technique for gentle lysis of eukaryotic cells. Isolation of plasma membrane from Dictostelium discodeum. Biochem Biophys Acta 736: 45-56

5. Day ani N, McNaughtRW, Shenolikar S and Smith RG (1990) Receptorinterconversion model of hormone action 2. Require­ment of both kinase and phosphatase activation for conferring estrogen binding activity to the estrogen receptor. Biochem­istry 29: 2691-2698

6. Felix G, Regenass M, Spanu P and Boller T (1994) The protein phosphatase inhibitor Calyculin A mimics elicitor

183

action in plant cells and rapidly induces hyperphosphory la­tion of specific proteins as revealed by pulse labelling with e3Pjphosphate. proc Natl Acad Sci USA 91: 952-956

7. Garcia-Moralez P, Minami Y, Luong EL, Klausner RD and Samelson LE (1990) Tyrosine phosphorylation in T-cells is regulated by phosphatase activity: studies with phenylarsine oxide. Proc Natl Acad Sci USA 87: 9255-9259

8. Grosskopf DG, Felix G and Boller T (1990) K252a inhibits the response of tomato cells to fungal elicitors in vivo and their microsomal protein kinase. FEBS Lett 275: 177-180

9. Gruol Dl and Wolfe KA (1990) Transformation of glucocor­ticoid receptors bound to the antagonist R U 486: effects of alkaline phosphatase. Biochemistry 29: 7958-7966

10. Haystead TAl, Sim ATR, Carling D, Honnor RC, Tsukitani Y, Cohen P and Hardie DG (1989) Effects of the tumour pro­moter okadaic acid on intracellular protein phosphorylation and metabolism. Nature 337: 78-81

II. Heimovaara-Dijkstra S, Van Duijn B, Libbenga KR, Heide­kamp F and Wang M (1994) Abscisic acid-induced membrane potential changes in barley aleurone protoplasts: a possible relevance for the regulation of rab gene expression. Plant Cell Physiol35: 743-750

12. 10nak C, Herberle-Bors E and Hirt H (1994) Map kinases: Universal mUlti-purpose signalling tools. Plant Mol Bioi 24: 407-416

13. Klein P, Vaughan B, Berleis 1 and Devreotes PN (1987) The surface cyclic AMP receptor in Dictyostelium. 1 Bioi Chern 262:358-364

14. Koontz DA and Choi IH (1993) Protein phosphorylation in carrot somatic embryos in response to abscisic acid. Plant Physiol Biochem 31: 95-102

15. Leammli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685

16. Leung 1, Bouvier-Durand M, Morris PC, Guerrier D, Chefdor F and Giraudatl (I 994) Arabidopsis ABA response geneABIl: features of a calcium-modulated protein phosphatase. Science 264: 1448-1452

17. Medema RH, Burgering BMT and Bos lL (1991) Insulin­induced p21 ras activation does not require protein kinase C, but a protein sensitive to phenylarsine oxide. 1 Bioi Chern 266: 21186-21189

18. Meyer K, Leube MP and Grill E (1994) A protein phos­phatase 2C involved in ABA signal transduction in Arabidopsis thaliana. Science 264: 1452-1455

19. Olah Z and Kiss Z (1986) Occurrence oflipid and phorbolester activated protein kinase in wheat cells. FEBS Lett 195: 33-37

20. Raz V and Fluhr R (1993) Ethylene signal is transduced via protein phosphorylation events in plants. Plant CellS: 523-530

21. Rundle SI, Nashrallah ME and Nashrallah 18 (1993) Effects of inhibitors of protein serine/threonine phosphatases on pollination in Brassica. Plant Physiol 103: 1165-1171

22. Veluthambi K and Poovaiah BW (1986) In vitro and in vivo protein phosphorylation in Avena sativa. L. coleoptiles. Plant Physiol81: 836-841

23. Vera-Estalla R, Barkla Bl, Higgins VI and Blumwald E (1994) Plant defence response to fungal pathogens. Plant Physiol 104: 209-215

24. Verhey SD and Lomax TL (1993) Signal transduction in vascular plants. Plant Growth Regul 12: 179-195

25. Wang M, Van Duijn B and Schram A (1991) Abscisic acid induces a cytosolic calcium decrease in barley aleurone proto­plasts. FEBS lett 278: 69-74

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 185-189. © 1996 Kluwer Academic Publishers.

185

Auxin activation of phospholipase A2 generated lipids, and the function of lipid-activated protein kinase

Gunther EE. Scherer Botanisches Institut, Universitiit Bonn, Venusbergweg 22, D-53 I 15 Bonn, Germany

Key words: auxin, lipid-activated protein kinase, phospholipase Az

Abstract

Studies by several groups in recent years have shown that some physiological responses to auxin can be linked to a certain membrane-associated auxin-binding protein. In our laboratory we could add another response linked to this receptor, the activation of a phospholipase Az. Activation can be demonstrated in vivo in cultured plant cells and in hypocotyl tissues as two auxin-responsive model systems. Moreover, isolated plant membranes show the same response so this type of response is amenable to biochemical investigations. In the isolated membrane system, we could demonstrate the participation of the membrane associated auxin-binding protein in triggering the activation of phospholipase Az activity. The lipids derived from the phospholipase Az reaction, fatty acids and lysophospholipids, both activate a membrane-associated protein kinase. Several substrates for the lysophospholipid-activated protein kinase could be identified in purified plasma membrane and in vacuolar membranes among which could be found, by comparison to Western blots, the H+ -ATPase of the plasma membrane and the ,B-subunit of the vacuolar H+ -ATPase. Hence, lysophospholipids may act as second messengers in plants.

Introduction

We assume that a physiological response to a hormone in plant starts with the interaction of the hormone with its receptor or its binding protein which triggers new biochemical reactions or changes the velocity of exist­ing enzymatic reactions. The complete physiological response, e.g. growth or cellular differentiation, may comprise a multitude of biochemical reactions, some of which will be triggered sequentially, one after each other or by the other.

One approach to elucidate the mechanism of action of auxin or other agonists is to identify (an) inter­mediate enzymatic reaction(s) downstream and, if possible, to link this reaction to a particular upstream receptor and to the further downstream reactions or to downstream physiological responses. In principle, such an auxin-triggered enzyme reaction should be embedded in, or linked to known physiological auxin responses (and actually constitute a partial physio­logical response in itself). In animal systems, it has turned out that types and numbers of such inter-

mediate receptor-linked reactions is limited and most often leads to the formation or degradation of second messengers. Second messengers very often control the activity of protein kinases.and of protein phosphatases. These intermediate reactions, including the receptor­agonist interaction, are encompassed in the term signal transduction. In plant systems, such intermediate reac­tions are being determined and, thus, flesh and bones are being added to the term plant signal transduction by the work of many groups in many countries.

Phospholipase Azmay release potential second messengers in plants

We recently described an auxin-activated phospholi­pase Az in plant membranes from zucchini hypocotyls (Cucurbita pepo L.) and from suspension-cultured soybean (Glycine max L.) cells which fulfils the con­dition of a signal transduction reaction [35, 31, 38, 1, 36]. For analytical purposes it is ideal to be able to study this reaction in vivo and in vitro. The

186

suspension-cultured cells depend on auxin for their growth by cell division although their hormone phys­iology is not well understood. The advantage of such a system, however, is that experiments can be made with a uniform cell type which is amenable to labelling techniques and to short-term experiments. Hypocotyl tissue, in contrast, is physiologically very well characterised in its growth response but the anal­ysis of a single reaction is hampered by the com­plexity of the tissue. In the long run, both systems should complement each other. We determined the activity of hormone-activated phospholipase A2 as the release of radioactive lysophosphatidy1choline or lysophosphatidylethanolamine from 14C-choline- or 14C-ethanolamine-Iabelled phosphatidylethanolamine, respectively. We have not, as yet, tried to determine the release of fatty acids.

A known auxin-binding protein participates in phospholipase A2 stimulation

Auxin stimulation of lysophospholipid release in isolated membranes shows properties typical of other auxin responses. Stimulation was found at low auxin concentrations down to 10-8 M and was optimal at 10- 5 M and specific for growth-active auxins [35,31, 38, 1, 36, 40]. Moreover, the optimal pH for hormone activation was found to be pH 5.5 which happens to be the optimal pH for hormone binding of auxin to the well-investigated maize auxin-binding protein (ABP) [18]. When we added an antibody to our assays, raised against maize ABP [43], it abolished the hormone acti­vation of phospholipase A2. A protein serologically related to the maize ABP was present in the mem­branes used by us for the tests, as shown by Western blotting. Since this antibody also inhibited an elec­trophysiological response in tobacco mesophyll proto­plasts [3], this supports the idea that the phospholipase A2 activation was triggered by auxin binding to this membrane-associated ABP. The antibody against this ABP will find its target only at the outer surface of vesicles as it cannot be expected to penetrate the mem­brane. Other compounds, abolishing hormone activa­tion of phospholipase A2 were found to be GDP and ADP. These compounds, however, needed to be added during homogenisation i.e. prior to or during vesicle closure, so that these compounds were trapped inside the vesicles. When added after vesicle closure, GDP and ADP had no effect. Nucleotide triphosphates had no effect, added either inside or outside the vesicles.

potyclonal antibody ~nst receptor

lysoPC Fig. 1. Hypothetical model of the action of auxin on phospholipase Az in an isolated membrane vesicle [1,36]. Auxin interacts with the known ABP [43] at the outside of the vesicle where the inhibitory antibody also binds. Since GDP and ADP abolish the hormone acti­vation only when applied to the vesicle interior it is assumed that the phospholipase Az is also insider the vesicle. Transmembrane signal transduction must be mediated by an as yet unknown transmembrane protein.

Therefore, a nucleotide-sensitive protein participates in the response somehow and it must be located inside the vesicles. The nucleotide-sensitive protein could be a G protein but some properties (e.g. the ADP sensi­tivity) argue against a G protein. The model for the vesicle reaction is shown in Fig. 1. Since dicotyle­doneous ABP's have very similar sequences lacking a transmembrane domain as the maize ABP [42] we should assume that an as yet unknown transmembrane protein serves as a transducer for the ABP-mediated signal to the vesicle interior. Tentatively, the vesicle topology resembles that of an outside-out plasma mem­brane vesicle. It has been argued that the ABP at the outer surface of the plasma membrane is the physio­logical location for auxin action [3, 4]. We have how­ever, not yet investigated the membrane location of the hormone-activated phospholipase A2 so that other compartments cannot be excluded for auxin-activated phospholipase A2.

We have also investigated the activation of phos­pholipase A2 in vivo in suspension-cultured soybean cells and in hypocotyl segments from zucchini and sunflower [35, 31, 38, 33, 34]. The major difference was that cells or tissue responds only to rather high

doses of honnone. For cells, the threshold concen­tration was in the range of 50-100 JlM whereas for hypocotyls it was 100-200 JlM. In most experiments we used 5 x 10-4 M auxin where at least some honnone specificity is retained. In suspension-cultured cells the reaction could be observed to commence within 1-2 min [31] and in hypocotyl tissue after 15 min [34]. The low honnone sensitivity is thought to be a conse­quence of the compartmentation of the reaction which is lost in the total tissue or cell extract and may lead to the observed low sensitivity.

Mastoparan, a peptide from wasp venom, could partially mimic the action of auxin in that it strongly activated the phospholipase Az in vivo and in vitro [32, 33, 34]. Growth, however, was only weakly acti­vated by this compound. The chemical structure of mastoparan certainly does not suggest an interaction of mastoparan with the ABP but rather an action down­stream of the receptor, either directly on phospholipase Az as in animal cells [2] or on G proteins [12,11, 10]. Even though mastoparan has been shown to act on plant G proteins [16] we do not know what G pro­teins in plants might enhance or diminish the growth response to auxin but both kinds might be activated by mastoparan. Either this dual possibility might explain the weak growth response to mastoparan in comparison to auxin, or additionally, the uncoupling effect on H+ transport in plasma membrane vesicles observed by us could serve as an explanation [33, 34]. Nevertheless, the observed similarity of the action of mastoparan and auxin support the notion that phospholipase Az activa­tion is part of the mechanism of action of auxin.

The products of phospholipase Az hydrolysis are activators of plant protein kinase

The reaction products of the phospholipase, Az hydrol­ysis, lysophospholipids and fatty acids, therefore should have the function of second messengers. The precedents for this are found in animal cells [8, 17] but for plant systems this still remains to be demonstrated in more experimental detail. Our proposal was that lysophospholipids activate protein kinase and thereby act as second messengers [41,20,21,30,31, 38] and agonists other than auxin also activate phospholipase A [15]. We have not demonstrated a similar role for fatty acids, however, it has been shown that linolenic acid as a natural higher plant compound and arachidonic acid (perhaps as an unphysiological substitute since

187

it is present only in lower plants and in fungi) exert physiological effects [6, 14] and also activate protein kinase [13, 19]. Data from other laboratories suggests that the lipid-activated protein kinase could be one or several isofonns of the calmodulin-like domain protein kinase which is also activated by calcium ions [28,5]. A dual activation mode by calcium ions and lysophos­pholipids has also been described [41, 20, 21]. The calmodulin-like domain protein kinase is molecularly well characterised and is unique to plants [27].

Our own work on lipid-activated protein kinase in plants concentrated on the activation by lysophos­pholipids and calcium ions [21, 40]. As lysophos­pholipids are reasonable detergents, we compared the effects of lysophospholipids and several chemi­cally umelated detergents on protein kinase activation and in membrane solubilisation [39]. Of the lysophos­pholipids, lysophosphatidylcholine, lysophosphatidic acid and lysophosphatidylinositol (in decreasing order) activated protein kinase, but lysophosphatidyl­glycerol, lysophosphatidylserine and lysophospha­tidylethanolamine were inactive. Detergents also activated protein kinase but at concentrations an order of magnitude higher in contrast to lysophospholipids, the solubilisation of membranes by detergents was much more efficient than by the lysophospholipids. Other activating lipids are phosphatidylinositol-4-phosphate and phosphatidylinositol-4,5-biphosphate [28] so that this specificity for certain lipids indicates a distinct function for the plant lipid-activated pro­tein kinase. Interestingly, this kinase does not respond to diacyglycerol [21, 28], the major lipid second messenger in animal cells [24].

The plasma membrane H+ -ATPase and the vacuolar H+ -ATPase are substrates of the lipid-activated protein kinase

A more precise biochemical definition of the func­tion of lipids in physiological responses can be made by identifying substrates of the lipid-activated protein kinase. In studies with tonoplast and plasma mem­branes purified by free-flow electrophoresis it was found that calcium ions and lysophospholipids stim­ulated the phosphorylation of several polypeptides unique to each activator, indicating the presence of at least two or several different kinases [40]. One of the phosphorylated polypeptides could be identified as the plasma membrane H+ -ATPase and not only the

188

phosphorylation of H+ -ATPase but also its activity was increased by'lysophospholipids [21, 26, 40].

Conceivably, regulation by phosphorylation of the plasma membrane H+ -ATPase [25] could be an important event in auxin action [29]. Moreover, we observed increased proton excretion induced by the lysophospholipid-like lipid platelet-activating factor in cultured soybean cells [37, 23]. Another substrate of the lipid-activated protein kinase identified by us is the ,a-subunit of the tonoplast H+ -ATPase [22]. Although the function of this phosphorylation is, at present, not well understood, lysophospholipids and calcium ions activate the tonoplast H+ -ATPase and the tonoplast is a second major site oflocalisation of the lipid-activated protein kinase [21, 22, 40], indicating the presence of signal transduction pathways at the tonoplast.

Because of the obvious link of plasma membrane H+ -ATPase regulation and auxin action [9, 29], we tested the lysophospholipids and detergents also in the classical growth tests with zucchini hypocotyl segments. Only lysophosphatidic acid was a weak growth activator [34]. We do not know why other lysophospholipids are inactive in this test. Perhaps, an interference rather downstream in a hypothetical signal transduction chain triggered by auxin cannot lead to a strong response since auxin may also trigger additional signal transduction reactions, e.g. activation of phos­pholipase C [7,44], which might be necessary to evoke a full response.

Taken together, our observations are consistent with the working model that auxin activates a phos­pholipase A2 which may lead to increased levels of biologically active lysophospholipids and fatty acids some of which can activate protein kinase and other enzymes, e.g. the plasma membrane H+ -ATPase. This may constitute one of several possible signal transduc­tion pathways. In this sense, the generated lipids are second messengers in the plant membrane(s).

Acknowledgement

This work was supported by grants from the Deutsche Forschungsgemeinschaft and from Bundesministeri­urn Forschung and Technologie.

References

I. Andre B and Scherer GFE (1991) Stimulation by auxin of phospholipase A in membrane vesicles from an auxin-sensitive tissue is mediated by an auxin receptor. Planta 185: 209-214

2. Argolias A and Pisano 11 (1983) Facilitation of phospholi­pase A2 activity by mastoparans, a new class of mast cell degranulation peptides from wasp venom. ] Bioi Chern 258: 13697-13702

3. Barbier-Brygoo H, Ephritikine G, KHimbt D, Ghislain M and Guem ] (1989) Functional evidence for an auxin receptor at the plasmalemma oftobacco mesophyll protoplasts. Proc Natl Acad Sci USA 86: 891-895

4. Barbier-Brygoo H, Ephritikine G, Kllimbt D, Maurel C, Palme K, Schell] and Guem ] (1991) Perception of the auxin signal at the plasma membrane oftobacco mesophyll protoplasts. Plant ] I: 83-93

5. Binder BM, Harper JF and Sussman MR (1994) Characterisa­tion of an Arabidopsis calmodulin-like domain protein kinase purified from Escherichia coli using an affinity sandwich tech­nique. Biochem 33: 2033-3041

6. Choi D, BostockRM, AvdiushkoS and Hilderbrand DF (1994) Lipid-derived signals that discriminate wound- and pathogen­responsive isoprenoid-pathways in plants: Methyl jasmonate and the fungal arachidonic acid induce different 3-hydroxy-3methylglutaryl-coenzyme A reductase genes and antimicro­bial isoprenoids in Solanum tuberosum. Proc Natl Acad Sci USA 91: 2329-2333

7. Ettlinger C and Lehle L (1988) Auxin induces rapid changes in phosphatidylinositol metabolites. Nature 331: 176-178

8. Exton]H (1994) Messenger molecules derived from mem­brane lipids. Curr Op Cell Bioi 6: 226-229

9. Hager A, Menzel H and Kraus A (1971) Versuche and Hypothese zur Primiiwirkung des Auxin beim Streck­ungswachstum.Planta 100: 47-75

10. Higashijima T and Ross EM (1991) Mapping of the mastoparan-binding site on G proteins. Cross-linking of (125 1-Tyr3 ,Cys II ) mastoparan to Go. ] Bioi Chern 266: 12655-12661

II. Higashijima T, Bumier ] and Ross EM (1990) Regulation of G1

and Go by mastoparan, related amphiphilic and hydrophobic amines.] Bioi Chern 265: 14176-14186

12. Higashijima T, Uzu S, Nakajima T and Ross EM (1988) Mastoparan a peptide toxin from wasp venom, mimics receptors by activating GTP-binding regulatory proteins (G proteins).] Bioi Chern 263: 6491-6494

13. Klucis E and Polya GM (1987) Calcium-independentactiva­tion of two plant leaf calcium-regulated protein kinases by fatty acids. Biochem Biophys Res Commun 147: 1041-1047

14. Lee Y, Lee HJ, Crain RC, Lee A and Kom S] (1994) Polyun­saturated fatty acids modulate stomatal aperture and two distinct K+ channel currents in guard cells. Cell Signalling 6: 181-186

15. Lee S-S, Kawakita K, Tsuge T and Doke N (1992) Stimulation of phospholipase A2 in strawberry cells treated with AF toxin 1 produced by Alternaria alternata strawberry phenotype. Physiol Molec Plant Pathol41: 282-294

16. Legendre L, Yueh YG, Crain R, Haddock N, Heinstein PF and Low PS (1993) Phospholipase C activation during elicitation of the oxidative burst in cultured plant cells.] Bioi Chern 268: 24559-24563

17. Liscovitch M and Cantley LC (1994) Lipid second messengers. Cell 77: 329-334

18. wbler M and Kliimbt D (1985) Auxin-binding protein from coleoptile membranes of com (Zea mays L). 1. Purification by immunological methods and characterisation.] Bioi Chern 260:9848-9853

19. Lucantoni A and Polya GM (1987) Activation of wheat embryo Ca2+ -regulated protein kinase by unsaturated fatty acids in the presence and absence of calcium. FEBS Lett 221: 33-36

20. Martiny-Baron G and Scherer GFE (1988) A plant protein kinase and plant microsomal H+ transport are stimulated by the ether lipid-platelet-activating factor. Plant Cell Rep 7: 579-582

21. Martiny-Baron G and Scherer GFE (1989) Phospholipid­stimulated protein kinase in plants. J Bioi Chern 264: 18052-18059

22. Martiny-Baron H, Hecker D, Manolson MF, Poole RJ and Scherer GFE (1992) Proton transport and phosphorylation of tonoplast polypeptides from zucchini are stimulated by the phospholipid platelet-activating factor. PlantPhysiol99: 1635-1641

23. Nickel R, SchUtte M, Hecker D and Scherer GFE (1991) The phospholipid platelet-activating factor stimulates proton extru­sion in cultured soybean cells and protein phosphorylation and ATPase activity in plasma membranes. J Plant Physiol 139: 205-211

24. Nishizuka Y (1992) Intracellular signalling by hydrolysis of phospholipids and activation of protein kinase C. Science 258: 607-614

25. Palmgren MG (1991) Regulation of plant plasma membrane H+ ATPase activity. Physiologia Plantarum 83: 314-323

26. Palmgren MG and Sommarin M (1989) Lysophosphatidyl­choline stimulates ATP-dependent proton accumulation in isolated oat root plasma membrane vesicles. Plant Physiol 90: 1009-10 14

27. Roberts DM and Harmon AC (1992) Calcium-modulated pro­tein: targets of intracellular calcium signals in plants. Annu Rev Plant Physiol Mol Bioi 43: 375-414

28. Schaller GE, Harmon A and Sussman MA (1992) Charac­terisation of a calcium- and lipid-dependent protein kinase associated with the plasma membrane of oat. Biochemistry 31: 1721-1727

29. Scherer GFE (1981) Auxin-stimulated ATPase in membrane fractions from pumpkin hypocotyls (Cururbita maxima L). Plants 151: 434-438

30. Scherer GFE (1989) Ether phospholipid platelet-activating factor (PAF) and a proton-transport activating phospholipid (PAP): potential new signal transduction constituents for plants. In: Boss WF and Morrt~ DJ (eds) Second Messengers in Plant Growth and Development, pp 167-179. Alan Liss Inc., New York

31. Scherer GFE (1990) Phospholipid-activated protein kinase in plants coupled to phospholipaseA2? In: Ranjeva R and Boudet AM (eds) Signal perception and transduction in higher plants NATO-ASI Ser H 47, pp 69-82. Springer, Berlin Heidelberg New York

32. Scherer GFE (1992) Stimulation of growth and phospholipase A2 by the peptides mastoparan and melittin and by the auxin 2,4-dichlorophenoxyacetic acid. Plant Growth Reg II: 153-157

33. SchererGFE (1994) Phospholipid signalling by phospholipase A2 in plants. The role of mastoparan- and Iysophospholipids

189

as "weak auxin-like" agonists. Soc for Exp Bioi Seminar Series, Cambridge Univ Press, Cambridge, UK, vol 58, pp.229-242

34. Scherer GFE (1994) Activation of phospholipase A by auxin and mastoparan in hypocotyl segments and zucchini and sun­flower. J Plant Physiol 142: 432-437

35. Scherer GFE and Nickel R (1988) The animal ether phospho­lipid platelet-activating factor stimulates acidification of the incubation medium of cultured soybean cells. Plant Cell Rep 7:575-578

36. Scherer GFE and Andre B (1989) A rapid response to a plant hormone: auxin stimulates phospholipase A2 in vivo and in vitro. Biochem Biophys Res Commun 163: 111-117

37. Scherer GFE and Andre B (1993) Stimulation of phospholipase A2 by auxin in microsomes from suspension-cultured soybean cells is receptor-mediated and influenced by nucleotides. Planta 191: 515-523

38. SchererGFE, Andre B and Martiny-Baron G (1990) Hormone­activated phospholipase A2 and Iysophospholipid-activated protein kinase: a new signal transduction chain and a new second messenger system in plants? Current Top Plant Biochem Physiol 9: 190-218

39. Scherer GFE, Fiihr A and Schiitte M (1993) Activation of membrane-associated protein kinase by lipids, its sub­strates and its function in signal transduction. In: Battey NH, Dickinson HG and Hetherington AM (eds) Soc for Exper Bioi Seminar Ser 53: Post-translational modifications in plants. Cambridge Univ Press, Cambridge, UK, vol 53: 109-121

40. Scherer GFE, Hecker D and Miiller J (1993) Ca2+ ions and Iysophospholipids activate phosphorylation of different pro­teins in plasma membranes and tonoplast purified by free-flow electrophoresis. J Plant Physiol 142: 432-437

41. Scherer GFE, Martiny-Baron G and Stoffel B (1988) A new set of regulatory molecules in plants: a plant phospholipid similar to platelet-activating factor stimulates protein kinase and proton-translocatingATPase in membrane vesicles. Planta 175:241-253

42. Shimomura S, Liu W, Inohara N, Watanabe S and Futai M (1993) Structure of the gene for an auxin-binding protein and a gene for 7SL RNA from Arabidopsis thaliana. Plant Cell Physiol 34: 633-637

43. Tillmann U, Viola G, Kayser B, Siemeister G, Hesse T, Palme K, UiblerM and KlambtD (1989) cDNA clones of the auxin­binding protein from com coleoptiles (Zea mays L): isolation and characterisation by immunological methods. EMBO J 8: 2463-2467

44. Zbell B and Walter-Back C (1989) Signal transduction of auxin on isolated plant cell membranes: indications for a rapid polyphosphoinositide response stimulated by indoleacetic acid. J Plant Physiol133: 353-360

A.R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 191-199. © 1996 Kluwer Academic Publishers.

191

Phospholipid signalling and lipid -derived second messengers in plants *

GUnther EE. Scherer Botanisches Institut der Universitiit Bonn, Venusbergweg 22, D-53115 Bonn, Germany

Key words: auxin, phospholipase A2, phospholipase C, lipid-activated protein kinase, lipid-derived second messenger

Abstract

Phospholipid signalling is mediated by phospholipid breakdown products generated by phospholipases. The enzymes from animals and plants generating known or potential lipid-derived second messengers are compared. Plants possess a phospholipase C and a phospholipase A2 both of which are agonist-activated. These agonists (auxin, elicitors, perhaps others) bind to the external surface of the plasma membrane. The target enzyme for poten­tial plant lipid-derived second messengers is lipid-activated protein kinase but the possibility that other enzymes may be also lipid-modulated should not be precluded.

Abbreviations: DAG ... diacylglycerol; CDPK = calmodulin-like domain protein kinase; PLA2 = phospholipase A2; PLC - phospholipase C; PLD - phospholipase D; PKC - protein kinase C; PS = phosphatidylserine

Introduction

The concept of lipid-derived second messengers or biologically active lipids in plants is still new and much less well-established than, for instance, Ca2+ as a second messenger in plants [38, 98]. A reason may be that several plant hormones (auxin, abscisic acid, ethylene, perhaps gibberellic acid) are membrane­permeant. However, recent observations show that hormones and elicitors act by binding to receptors at the outer surface of the plasma membrane [3, 6, 7, 17, 20,21,34, 39]. This necessitates transmembrane signal transduction mechanisms and one important pathway is signal transduction by lipid-derived second messen­gers.

In animal systems of every possible type of phos­pholipid or sphingomyelin hydrolysing hydrolase (Fig. 1), almost every one seems to have a function in transmembrane signal transduction. These lipid break­downs products can be activators or inhibitors for certain target enzymes and are, thus, lipid-derived sec­ond messengers (Fig. 2). Comparing Fig. 2 with Fig. 3 for potential plant lipid-derived second messengers Fig. 3, it looks far less crowded. So, either plants are

* This publication is dedicated to the occasion of the retirement of Prof. Dr. A. Sievers

really very different in this aspect of transmembrane signalling or we should expect the discovery of yet more details in the coming years.

The enzymes which generate lipid-derived second messengers

When we compare the enzymes in animals and plants whose function it is to allocate the lipid-derived second messengers we should start with the long-known example, phospholipase C (PLC) [62]. For animal systems, it is clear by now that PLC is not single enzyme but instead, a small gene family of enzymes and each subtype is unique in its mode of activa­tion by different G-protein-subunits or tyrosine phos­phorylation [10]. Besides enzymes which hydrolyze phosphatidylinositol-4,5-bisphosphate to generate two biologically active lipid breakdown products, diacyl­glycerol and inositol-l,4,5-trisphosphate, a second, phosphatidylcholine-specific, PLC was found. The function of this second enzyme is to provide a lasting burstofDAG [51]. DAG is the biologically active lipid generated by all PLC subtypes and it is an activator for

192

o} phospholipase C

r -------~".:~gj:~~_m~i~~ - -~- - - - - - -10

r,PhOSPhOlipGSe D

: C"'o'Y'oT~-o-lpOlar headgroup\ I 0 I I· . J c.... 10 I • '\ : J 0 I phospholipase A2 L ______________________________ J

b) sphingomyelin

Fig. 1. Phospholipases and sphingolipases. (a) The three major phospholipases, phospholipase Az, phospholipase C, and phospholipase D and the bonds hydrolyzed by them in glycerophospholipids are shown. (b) Sphingomyelin as an example for (animal) sphingolipids is chosen to demonstrate which bonds are hydrolyzed by sphingomyelinase and by N-deacylase.

PKC [9,70]. Inositol-I,4,5-trisphosphate, the second breakdown product of phosphatidylinositol-4,5-bisphosphate hydrolysis, activates a calcium channel in the ER in animal cells whereas for phosphorylcholine no second messenger function is known [10].

A plant PLC specific for phosphatidylinositol-4,5-bisphosphate was partially purified [57, 58,97, 103]. For one of the breakdown products, inositol-I,4,5-trisphosphate, it is known that it activates a calcium channel in plant tonoplast [93] and and more evidence for an in vivo function ofPLC in plant systems is accu­mulating [25, 27]. However, the potential function for the DAG breakdown product in plant signal transduc­tion remains mysterious despite two reports on physi­ological effects of DAG in plant cells [45,46] because PKC, the target enzyme for DAG (Fig. 2), seems to be missing in plants.

Phospholipase A2 (PLA2) was the second enzyme in animals found to generate biologically active lipid breakdown product [14]. Besides the Ca2+ -activated cytosolic PLA2 [19, 44, 50, 95] a Ca2+ -independent cytosolic PLA2 was found [1]. Both enzymes are specific for arachidonic acid in the C2 position of the glycerophospholipid backbone and phosphatidyl­choline and phosphatidylethanolamine seem to be preferred substrates [22]. Arachidonic acid as the pre­cursor to leukotrienes and prostaglandins, hormones (first messengers) in their own right [79], has a dual function as lipid-derived second messenger because arachidonic acid also activates a subtype of PKC. For the second lipid breakdown product of PLA2 hydrolysis, lysophospholipid, it was also found that it activates another SUbtype of PKC as lipid second messenger [5,23].

193

Animal Hormone Receptor (5)

Lipid PC Sphingol.

t / I \ /~

;;; ~ Second Messenger ­Generating Enzyme

~~~ W\9 )E) J + ~)

(y Z I ~1-Lipid ­

Derived Second Messenger

~ rr l.l

! I I I I

rT~r-~r=<.-~. I 1 I \

Target Enzyme

PIP)

I PKC o

IF) I

ER/Ca2+

channel

DAG I

PKC o

PA

I PKC o

Lysol. Arach.

I I PKC PKc0 o SMase

Cer Sph

\ / PKCG

Sph-'-P

c~ 2! Cer·activ. PK stores Cer-odiv. Pose

LysoSph

I PKC o

Fig. 2. Lipid-derived second messengers in animals. Major lipids as precursors to lipid-derived second messengers are shown shematically at the top part of the figure. Abbreviations: PIP2: phosphatidylinositol-4,5-bisphosphate; PC: phosphatidylcholine; Sphingol.: sphin­gomyelin. The second messenger-generating enzymes are shown in the row below. PI-3-kin: phosphatidylinositoI3'-kinase; PI-PLC: phosphatidylinositol-specific phospholipase C; PC-PLC: phosphatidylcholine-specific phospholipase C; PLD: phospholipase D; SMase: sphingomyelinase; N-Deac.: N-deacylase. Designations for second messengers: PIP3: phosphatidylinositol-3,4,5-trisphosphate; IP3 : myo-inositol-I,4,5-trisphosphate; DAG: diacylglycerol: PA: phosphatidic acid; Lysol.: lysophospholipid: Arach. arachidonic acid; Cer: ceramide; Sph: sphingosine; Sph-I-P: sphingosine-I-phosphate; LysoSph: lysosphingolipid. Abbreviations for target enzymes: PKC: pro­tein kinase C; Cer-activ. PKlPase: ceramide-activated protein kinase or phosphatase.

A plant phospholipase A, possibly of an A2 type, has been described in plants [4, 86, 87]. As a similarity to animal systems, both fatty acids and lysophospho­lipids modulate protein kinase in plants [12, 47, 53, 55, 56, 81]. A further similarity to animal systems could exist because the fatty acid linolenic acid is the pre­cursor to jasmonic acid [2], a plant hormone in ist own right [74].

The third phospholipase to generate a lipid break­down product from phospholipids is phospholipase D (PLD). One hydrolysis product, phosphatidic acid (PA), may either be a source for the second messenger DAG (generated by phosphatidic acid phosphatase) in animal cells or it may be a biologically active lipid in its own right [64]. A function for phosphorylcholine

in signal transduction is not known. No PLD hav­ing a function in signal transduction in plants has been described as yet, with only preliminary reports of enzymes having the properties of PLD [26].

In animals, sphingomyelinase is involved in a new and important signal transduction pathway [32,35,43, 52] . Plants lack sphingomyelin, so that ceramide, the lipid second messenger generated by sphingomyeli­nase in animals, would have to be generated by an analogous enzyme in plants from other sphingolipids. In animal systems, a cerami de-activated protein kinase was described as well as a ceramide-activated protein phosphatase and, additionally, this lipid inhibits PKC [24, 35, 40, 43, 76]. Lysosphingolipids, generated by N-deacylase, also inhibit PKC but no plant N-

194

Plant Hormone Receptor (5)

Lipid

Second Messenger -Generating Enzyme

PI~ PI

?

PC Sphingol.

? I

? ?

Lipid Derived Second Messenger

~/ \r ~ I I ~T-

? I \

~ I Target Enzyme

TP/ER C02+ cannel

DAG

I ?

PIP LysoL linolenic

PIP2~I/Cid

protein kinase

Fig. 3. Potential lipid-derived second messengers in plants. Lipid precursors to potential plant lipid-derived second messengers are shown schematically at the top part of the figure. Abbreviations: PIP2 : phosphatidylinositol-4,5-bisphosphate; PI: phosphatidylinositol; PC: phosphatidyicholine; Sphingol.: (glyco)sphingolipid. The second-messenger-generating enzymes are shown in the row below: PI-PLC: phosphatidylinositol-specific phospholipase C; PI-Kin: phosphatidylinositol kinase(s); PLD: phospholipase D; PLA2: phospholipase A2 . Designations for potential second messengers: IP3 : myo-inositol- I.4,5-trisphosphate; DAG: diacylglycerol: Lysol.: Iysophospholipid; PIP: phosphatidylinositol-4-phosphate.

deacylase was described and there is only one report for a possible function of sphingosine in plants as an acti­vator for the tonoplast H+ -pyrophosphatase [II).

Since it was found that phosphatidylinositol-3,4,5-trisphosphate is yet another activator for PKC [67] it must be regarded as a lipid-derived second messenger and the respective phosphatidylinositol 3-kinase as a second-messenger generating enzyme albeit it is not a hydrolase (Fig. 2). An analogous (certainly not a homologous) role might be taken by the plant phosphatidylinositol4-kinase (Fig. 3). The generated lipid, phosphatidylinositol-4-phosphate, activates pro­tein kinase [12]_ The properties of this pathway have been investigated in plants [16, 59, 60,101,102].

In animals, a large number of target enzymes interact with lipid-derived second messengers (Fig. 2) and the list seems to be growing [5, 23, 32, 51]. Many of them have a function in protein phosphoryla­tion, namely the different isoforms of PKC, cerarnide­activated protein kinase and cerarnide-activated protein phosphatase which fits into the general pattern for most other animal second messengers, e.g. cAMP, cGMP or Ca2+ I( calmodulin), all of which can activate protein kinases.

The target enzymes for lipid-derived second messengers

Even though our knowledge about potential target enzymes for lipid-derived second messengers in plants is far less complete it is obvious that the ones found so far modulate protein kinase, namely, fatty acids, lysophospholipids, and phosphorylated phosphatidyli­nositols (Fig. 3). As an alternative possibility, however, plants may directly regulate several membrane-bound enzymes without protein kinase as a mediator. Such examples of lipid regulation in plants could be the effects of lysophosphatidylcholine on a plasma mem­brane redox system [13], on plasma membrane H+­ATPase [56, 72, 73, 90, 94] or of acidic lipids on the plasma membrane H+ -ATPase [59, 60], of the lysophospholipid-like platelet-activating factor (PAF) on tonoplastH+ -ATPase [54], offatty acids on a potas­sium channel regulating stomatal aperture [47], and of sphingosine on the tonoplast H+ -pyrophosphatase [11]. These enzymes may be all target proteins for potential lipid-derived second messengers. However, the action of these lipid breakdown products might be also mediated by protein kinase or protein phosphatase as was suggested for the two major plant H+ -ATPases [54, 72]. The lipid specificity of the above-mentioned lipid-enzyme interactions (possibly not involving protein kinase) are less clear so that their function is even more speculative than those for lipid-modulated protein kinase from plants. Therefore, these are not included into the scheme in Fig. 3.

Initially, it was tried to find a protein kinase which was activated by Ca2+ , DAG and PS in plants as direct evidence for a 'plant protein kinase C' [28-30,33,65, 80]. Common to all these experiments were no clear demonstration of specificity or preference for PS as an activator, i.e. other phospholipids tested were equally effective as activating substances. These results can­not be regarded as evidence of a plant PKC. When PS or a mixture of PS and of DAG was added to plant membrane vesicles endogenous membrane-associated protein kinase was not affected by these lipids [56,88]. Similarly, negative results were obtained with purifed CDPK and diolein as activators [81]. In conclusion, the search for a DAG-activated protein kinase from a plant source failed so far despite certainly many more attempts in various laboratories to find it went unre­ported.

A lipid-modulated protein kinase in plants was identified by the finding that rather different lipids were suitable activators for plant protein kinase,

195

namely lysophospholipids and platelet-activating factor, an ether lipid (1-0-alkyl-sn-glycero-2-acetyl-3-phosphorylcholine), which is not found in plants but chemically similar to lysophosphatidylcholine [55, 56, 91]. Platelet-activating factor might be a kind of artifi­cial substitute for lysophospholipidin plants. The other groups of lipid activators are fatty acids [42, 53, 63, 71,75] and inositol phospholipids [12, 36, 81].

The enzymes investigated by Polya and Sussman and coworkers belong to the now well-definded genet­ically and serologically related group of calmodulin­like domain protein kinases (CDPK) [37, 41,77,78, 81,96]. These enzymes can be identified as autophos­phorylating kinases, often membrane-associated, in a molecular range of 45 - 79 kD [8, 12, 81, 96, 99]. The enzyme investigated in the authors laboratory is a membrane-associated Ca2+ Ilysophospholipid­activated protein kinase. Since in our assays always several proteins in a range of 53-62 kD are strongly stimulated in phosphorylation by Ca2+ and by lysophospholipids and, since three proteins in this molecular size range were found in an autophospho­rylation assay [89], it can be tentatively concluded that among this group of autophosphorylatingproteins in our experiments was a Ca2+ Ilysophospholipid­activated protein kinase which is most likely a mem­ber of the CDPK family. This conclusion is further supported by the very similar lipid specificity of the activation of the enzymes investigated in our and in Sussman's laboratory [12, 36, 56, 81, 83, 88].

As the substrates of the lipid-activated protein kinase in plants several unknown polypeptides were identified in tonoplast and plasma membranes [56,57, 69, 90]. The B-subunit of the tonoplast H+ -ATPase [57] and the plasma membrane H+ -ATPase could be identified the latter of which had been identified as a phosphoprotein before [82]. Regulation of plasma membrane H+ -ATPase in plants by phosphorylation is still hypothetical [72]. The evidence for activity regulation by phosphorylation of the homologous yeast enzyme is strong [15, 31, 66]. For CDPK, as another substrate nodulin, a channel-forming protein in the peribacteroid membrane after Rhizobium infection, was identified so that the possibilityoflipid-modulated activity regulation exists [100]. For the plant tonoplast H+ -ATPase, regulation by phosphorylation must be regarded as purely speculative even though one report about animal endosomal H+ -ATPase being regulated by PKC lends support to this idea [68].

The acceptance of a function for lipid-derived second messengers and of lipid-modulated protein

196

kinase in plants depends, at least, on a clear demon­stration of agonist-induced changes in the content of regulatory lipids in plants or plant cells. For PLC evidence for this is now accumulating [18, 25, 27, 49]. and although preliminary, also for PLA2 [48,85, 86, 87, 88]. Also, agonist-induced changes in phos­phorylated phosphatidylinositols were found [16, 59, 60, 101, 102]. What could be misleading, is the sole lingake of the in vivo modulation of potential lipid­derived second messengers in plants to the regulation of plasma membrane H+ -ATPase even though this has been the suggestion of this author, too [69, 84, 92]. Rather, we should expect many different enzymes being regulated by these potential lipid-derived second messengers, directly or indirectly by protein kinases or phosphatases [61].

Both effects might or might not be mediated by regulatory effect on the plasma membrane H+ -ATPase and, additionally, the involvement of the CDPK is not proven by these effects. Hence, all the above­mentioned effects remain purely speculative in their relationship to CDPK (or any other protein kinase) but seem to provide a tantalizingly coherent picture. How­ever, one should also keep in mind the many open questions: is the lipid-modulated protein kinase also modulated in activity by lipids in vivo? Is the CDPK the only lipid-modulated protein kinase (or: is the plant PKC still to be discovered)? What are the (additional) substrates and is their activity really regulated by lipid­dependent phosphorylation-dephosphorylation? What distinguishes the lipid-modulated CDPK isoforms from the other isoforms? Do lipid-derived second messengers in plants really act similarly as their animal counterparts, i.e do they preferentially act on pro­tein kinase(s) and protein phosphatase(s) as target enzymes? Indications of phospholipid signalling with­out participation of protein kinase have been discussed. It will be exciting to see the picture of plant signal trans­duction pathways mediated by lipid-derived second messengers unfold in the coming years.

Acknowledgement

Work in the authors laboratory has been supported by the Deutsche Forschungsgemeinschaft and the Bundesministerium for Forschung and Technologie.

References

I. Ackermann EJ, Kempner ES and Dennis EA (1994) Ca2+ -independent cytosolic phospholipase A2 from macrophage­like P388D I cells. Isolation and characterization. J Bioi Chern 269:9227-9233

2. Anderson JM (1989) Membrane-derived fatty acids as pre­cursors to second messengers. In: Boss WF and Morn! DJ (eds) Second Messengers in Plant Growth and Development, pp 181-212.New York: AlanLiss

3. Anderson B, Ward JM and Schroeder JI (1994) Evidence for an extracellular reception site for abscisic acid in Commelina guard cells. Plant Physiol 104: 1177-1183

4. Andre B and Scherer GFE (1991) Stimulation by auxin of phospholipase A in membrane vesicles from an auxin­sensitive tissue is mediated by an auxin receptor. Planta 185: 209-214

5. Asaoka Y, Nakamura S-I, YoshidaK and Nishizuka Y (1992) Protein kinase C, calcium and phospholipid degradation. Tr Bioch Sci 17: 414-417

6. Barbier-Brygoo H, Ephritikine G, Kiambt D, Ghislain M and Guem J (1989) Functional evidence for an auxin receptor at the plasmalemma of tobacco mesophyll protoplasts. Proc Natl Acad Sci USA 86: 891-895

7. Barbier-Brygoo H, Ephretikine G, Kiambt D, Maurel C, Palme K, Schell J and Guem J (1991) Perception of the auxin signal at the plasma membrane of tobacco mesophyll proto­plasts. Plant J I: 83-93

8. Battey NH and Venis MA (1988) Calcium-dependent protein kinase from apple fruit membranes is calmodulin­independent but has calmodulinclike properties. Planta 176: 91-97

9. Bell RM and Bums DJ (1991) Lipid activation of protein kinase. C J Bioi Chern 266: 4661-4664

10. Berridge MJ (1993) Inositol trisphosphate and calcium signalling. Nature 361: 315-325

II. Bille J, Weiser T and Bentrup F-W (1992) The Iysolipid sphingosine modulates pyrophosphatase activity in tonoplast vesicles and isolated vacuoles from a heterotrophic cell sus­pension culture of Chenopodium rubrum. Physiologia Plant 84:250-254

12. Binder BM, Harper JF and Sussman MR (1994) Characteriza­tion of an Arabidopsis calmodulin-like domain protein kinase purified from Escherichia coli using an affinity sandwich technique. Biochem 33: 2033-2041

13. Brightman A, Zhu X-Z and Morre DJ (1991) Activation of plasma membrane NADH oxidase activity by products of phospholipase A. Plant Physiol 96: 1314-1320

14. Burch RM, Luini A and Axelrod J (1986) Phospholipase Az and phospholipase C are activated by distinct GTP-binding proteins in response to A-adrenergic stimulation of FRTL5 thyroid cells. Proc Natl Acad Sci USA 83: 7201-7205

IS. Chang A and Slay man CW (1991) Maturation of the yeast plasma membrane H+ -ATPase involves phosphorylation dur­ing intracellular transport. J Cell Bioi 115: 289-295

16. Chen Q and Boss WF (1991) Neomycin inhibits the PIP and PIPz stimulation of plasma membrane ATPase activity. Plant Physiol 96: 340-343

17. Cheong J-J and Hahn MG (1991) A specific, high-affinity binding site for the hepta-B-glucoside elicitor that exists in soybean membranes. Plant Cell 3: 137-147

18. Cho MH, Shears SB and Boss WF (1993) Changes in phos­phatidylinositol metabolism in response to hyperosmotic

stress in Daucus carota L. cells grown in suspension culture. Plant Physiol103: 637-647

19. Clark JD, Lin L-L, Kriz RW, Ramesha CS, Sultzman LA, Lin AY, Milona N and Knopf JL (1991) A novel arachidonic acid-selective cytosolic PLA2 contains a Ca2+ -dependent translocation domain with homology to PKC and GAP. Cell 65:1043-1051

20. Cosio EG, Frey T, Verduyn R, van Boom 1 and EbelJ (1990) High-affinity binding of a synthetic heptaglucoside and fungal glucan phytoalexin elicitors to soybean membranes. FEBS Lett 271: 223-226

21. Denarie 1 and Cullimore J (1993) Lipo-oligosaccharidenodu­lation factors: a new class of signalling molecules mediating recognition and morphogenesis. Cell 74: 951-954

22. Dennis E (1994) Diversity of group types, regulation, and function of phospholipase A2. 1 Bioi Chern 269: 13057-13060

23. Dekker LV, Parker PJ (1994) Protein kinase C - a question of specificity. Tr Bioch Sci 19: 73-77

24. Dobrowsky RT, Kamiyabashi C, Mumby M and Hannun YA (1993) Ceramide activates heterotrimeric protein phosphatase 2A. J Bioi Chern 268: 15523-15530

25. Droeback BK (1992) The plant phosphoinositide system. Biocheml 288: 697-712

26. Dyer JH, Ryu SB and Wang X (1994) Multiple forms of phospholipase D following germination and during leaf development of castor bean. Plant Physiol 105: 715-724

27. Einspahr Kl and Thompson GA lr (1990) Transmembrane signaling via phosphatidy linositoI4,5-bisphosphate hydroly­sis in plants. Plant Physiol93: 361-366

28. Elliott DC, Fourier A and Kokke YS (1988) Phosphatidylser­ine activation of plant protein kinase C. Phytochemistry 27: 3725-3730

29. Elliott DC and Kokke YS (1987) Partial purification and properties of a protein kinase C type enzyme from plants. Phytochemistry 26: 2929-2935

30. Elliott DC and Kokke YS (1986) Calcium-dependent, phospholipid-activated protein kinase in plants. Phytochem­istry 25: 39-44

31. Eraso P and Portillo F (1994) Molecular mechanism of regulation of yeast plasma membrane H+ -ATPase by glucose. Interaction between domains and identification of new regu­latory sites. 1 Bioi Chern 269: 10393-10399

32. Exton JH (1994) Messenger molecules derived from membrane lipids. Curr Op Cell Bioi 6: 226-229

33. Favre Band Turian G (1987) Identification ofa caicium- and phospholipid-dependent protein kinase (protein kinase C) in Neurospora crassa. Plant Sci 49: 15-21

34. Gilroy S and 10nes RL (1994) Perception of gibberellin and abscisic acid at the external face of the plasma membrane of barley (Hordeum vulgare L.) aleurone protoplasts. Plant Physiol104: 1185-1192

35. Hannun YA (1994) The sphingomyelin cycle and the second messenger function of ceramide. J Bioi Chern 269: 3125-328

36. Harper JF, Binder BM and Sussman MR (1993) Calcium and lipid regulation of an Arabidopsis protein kinase expressed in Escherichia coli. Biochem 32: 3282-3290

37. Harper JF, Sussman MR, Schaller GE, Putnam-Evans C, Charbonneau H and Harmon A (1991) A calcium-dependent protein kinase with a regulatory domain similar to calmod­ulin. Science 252: 951-954

38. Hepler PK and Wayne PO (1985) Calcium and plant devel­opment. Annu. Rev. Plant Physiol 36: 397-439

197

39. Hooley R, Beale MH and Smith Sl (1991) Gibberellin per­ception at the plasma membrane of Avena Jatua aleurone protoplasts. Planta 183: 274-280

40. Joseph CK, Byun HS, Bittman R and Kolesnik RN (1993) Substrate recognition by ceramide-activated protein kinase. Evidence that kinase activity is proline-directed. J Bioi Chern 268:20002-20006

41. Klucis E and Polya GM (1987) Calcium-independentactiva­tion of two plant leaf calcium-regulated protein kinases by fatty acids. Biochem Biophys Res Commun 147: 1041-1047

42. Klucis E and Polya GM (1988) Localizaton, solubilization and characterization of plant membrane-associated calcium­dependent protein kinases. Plant Physiol88: 164-171

43. Kolesnik R and Golds DW (1994) The sphingomyelin path­way in tumornecrosis factor and interleukin-1 signalling. Cell 77:325-328

44. Kramer RM, Roberts EF, Manetta J and Putnam JE (1991) The Ca2+ -sensitive cytosolic phospholipase A2 is a 100-kDa protein in human monoblast U937 cells. J Bioi Chern 266: 5268-5272

45. Larsen PM, Chen T-L and Wolniak SM (1991) Neomycin reversibly disrupts mitotic spindle progression in stamen hair cells of Tradescantia. J Cell Sci 98: 159-168

46. Lee Y and Assmann SM (1991) Diacylglycerols induce both ion pumping in patch-clamp guard cells and opening of intact stomata. Proc Natl Acad Sci USA 88: 2127-2131

47. Lee Y, Lee HJ, Crain RC, Lee A and KomSJ (1994) Polyun­saturated fatty acids modulate stomatal aperture and two dis­tinct K+ channel currents in guard cells. Cell Signalling 6: 181-186

48. Lee S-S, Kawakita K, Tsuge T and Doke N (1992) Stimulation ofphospholipaseA2 in strawberry cells treated with AF-toxin I produced by Alternaria alternata strawberry phenotype. Physiol Molec Plant Pathol41: 283-294

49. Legendre L, Yueh YG, Crain R, Haddock N, Heinstein PF and Low PS (1993) Phospholipase C activation during elicitation of the oxidative burst in cultured plant cells. J Bioi Chern 268: 24559-24563

50. Lin L-L, Lin Y and Knopf JL (1992) Cytosolic phospholipase A2 is coupled to hormonally regulated release of arachidonic acid. Proc Natl Acad Sci USA 89: 6147-6151

51. Liscovitch M (1992) Crosstalk among multiple signal­activated phosholipases. Tr Bioch Sci 17: 393-399

52. Liscovitch M and Cantley LC (1994) Lipid second messen­gers. Cell 77: 329-334

53. Lucantoni A and Polya GM (1987) Activation of wheat embryo Ca2+ -regulated protein kinase by unsaturated fatty acids in the presence and absence of calcium. FEBS Lett 221 : 33-36

54. Martiny-Baron G, Hecker D, Manolson MF, Poole RJ and Scherer GFE (1992) Proton transport and phosphorylation of tonoplast polypeptides from zucchini are stimulated by the phospholipid platelet-activating factor. Plant Physiol 99: 1635-1641

55. Martiny-Baron G and Scherer GFE (1988) A plant protein kinase and plant microsomal H+ transport are stimulated by the ether lipid platelet-activating factor. Plant Cell Rep 7: 579-582

56. Martiny-Baron G and Scherer GFE (1989) Phospholipid­stimulated protein kinase in plants. J Bioi Chern 264: 18052-18059

57. Melin P-M, Pical J, Jergil B and Sommarin M (1992) Polyphosphoinositide phospholipase C in wheat root

198

plasma membranes. Partial purification and characterization. BiochimBiophysActa 1123: 163-169

58. Melin P-M, Sommarin M, Sandel ius AS and 1ergil B (1987) Identification of Ca2+ -stimulated polyphospoinositide phos­pholipase C in isolated plant plasma membranes. FEBS Lett 223:87-91

59. Memon AR and Boss WF (1990) Rapid light-induced changes in phosphoinositide kinases and H+ -ATPase in plasma membrane of sunflower hypocotyls.1 Bioi Chern 265: 14817-14821

60. Memon AR, Chen Q and Boss WF (1989) Inositol phospho­lipids activate plasma membrane ATPase in plants. Biochem. BiophysResCommun 162: 1295-1301

61. Meyer K, Leube M and Grill E (1994) A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana. Science 264: 1452-1455

62. Michell RH (I985) Inositol phospholipids and cell surface receptor function. Biochim. Biophys Acta 415: 81-147

63. Minichello 1, Polya GM and Keane P1 (1989) Inhibition and activation of oat leaf calcium-dependent protein kinase by fatty acids. Plant Sci 65: 143-152

64. Moritz A, De Graan PNE, Gispen WH and Wirtz KWA (1992) Phosphatidic acid is a specific activator of phosphatidylinositol-4-phosphate kinase. 1. Bioi Chern 267: 7207-7210

65. Mom! D1, Morre 1T and Vamold R (1984) Phosphorylation of membrane-located proteins of soybean in vitro and response to auxin. Plant Physiol 75: 265-268

66. Na S, Perlin S, Seto-Young D, Wang GF and Haber 1E (1993) Characterization of yeast plasma membrane H+­ATPase mutant pmaI-AI35V and its revertants. 1 Bioi Chern 268: 11792-11797

67. Nakanishi H, Brewer KA and Exton 1H (1993) Activation of the zeta-isoform of protein kinase C by phosphatidylinositol 3,4,5-trisphosphate. J Bioi Chern 268: 13-16

68. Nanda A, Gukovskaya A, Tseng J and Grinstein S (1992) Activation of vacuolar-type proton pumps by protein kinase C- role in neutrophil pH regulation. J Bioi Chern 267: 22740-22746

69. Nickel R, Schutte M, Hecker D and Scherer GFE (1991) The phospholipid platelet-activating factor stimulates proton extrusion in cultured soybean cells and protein phosphory­lation and ATPase activity in plasma membranes. 1 Plant Physiol 139: 205-211

70. Nishizuka Y (1992) Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science 258:607-614

71. Olah Z and Kiss Z (1986) Occurrence of lipid and phorbol ester activated protein kinase in wheat cells. FEBS Lett 195: 33-37

72. Palmgren MG (1991) Regulation of plant plasma membrane H+ -ATPase activity. Physiologia Plantarum 83: 314--323

73. Palmgren MG and Sommarin M (1989) Lysophosphatidyl­choline stimulates ATP-dependent proton accumulation in isolated oat root plasma membrane vesicles. Plant Physiol 90: 1009-1014

74. Parthier B (1991) Jasmonates, new regulators of plant growth and development: many facts and few hypotheses on their actions. Bot Acta 6: 446-454

75. Polya GM, Minichiello J, Nott R, Klucis E and Keane PJ (1990) Differential inhibition of plant calcium-dependent pro­tein kinases by long-chain fatty acids and other amphiphiles. Plant Sci 71: 45-54

76. Pushkareva MY, Kahn WA, Allessenko AV and Shayoun N (1992) Sphingosine activation of protein kinase in Jurkat T cells. In vitro phosphorylation of endogenous protein sub­strates and specificity of action. J Bioi Chern 267: 15246-15251

77. Roberts DM (1993) Protein kinase with calmodulin-like domains: novel targets of calcium signals in plants. Curr Op Cell Bioi 3: 242-246

78. Roberts DM and Harmon AC (1992) Calcium-modulated pro­teins: targets of intracellular calcium signals in plants. Annu Rev Plant Physiol Mol Bioi 43: 375-414

79. Samuelson B, Dahlen S, Lindgren JA, Rouzer CA and Serhan CN (1987) Leukotriens and lipoxins: structures, biosynthesis, and biological effects. Science 237: 1171-1175

80. Schafer A, Bygrave F, Matzenauer F and Marme D (1985) Identification of a calcium- and phospholipid-dependent protein kinase in plant tissue. FEBS Lett 20 I: 282-286

81. Schaller GE, Harmon A and Sussman MA (1992) Charac­terization of a calcium- and lipid-dependent protein kinase associated with the plasma membrane of oat. Biochemistry 31: 1721-1727

82. Schaller GE and Sussman MG (1988) Phosphorylation of the plasma membrane H+ -ATPase of oat roots by calcium­stimulated protein kinase. Planta 173: 509-518

83. Scherer GFE (1990) Phospholipid-activated protein kinase in plants coupled to phospholipase A2? In: Ranjeva R and Boudet AM (eds) Signal Perception and Transduction in Higher Plants, NATO-ASI Ser H, 74, pp 69-82. Berlin: Springer, New York: Heidelberg

84. Scherer GFE (l994a) Phospholipid signalling by phos­pholipase A2 in plants. The role of mastoparan and Iysophospholipids as weak "auxin-like" agonists. Society for Experimental Biology Seminar Series, Cambridge University Press Cambridge UK, vol. 58, pp. 229-242

85. Scherer GFE (I 994b ) Activation of phospholipase A by auxin and mastoparan in hypocotyl segments from zucchini and sunflower. J Plant Physiol 142: 432-437

86. Scherer GFE and Andre B (1989) A rapid response to a plant hormone: auxin stimulates phospholipase A2 in vivo and in vitro. Biochem Biophys Res Commim 163: 111-117

87. Scherer GFE and Andre B (1993) Stimulation of phos­pholipase A2 by auxin in micro somes from suspension­cultured soybean cells is receptor-mediated and influenced by nucleotides. Planta 191: 515-523

88. Scherer GFE, Andre B and Martiny-Baron G (1990) Hormone-activated phospholipase A2 and Iysophospholipid­activated protein kinase: a new signal transduction chain and a new second messenger system in plants? Current Top Plant Biochem Physiol9: 190-218

89. Scherer GFE , Fuhr A and Schutte M (1993a) Activation of membrane-associated protein kinase by lipids, its sub­strates, and its function in signal transduction. In: Battey NH, Dickinson HG and Hetherington AM (eds) Society for Experimental Biology Seminar Series. Post-translational Modifications in Plants, vol 53, pp 109-:-121. Cambridge UK: Cambridge University Press

90. Scherer GFE, Hecker D and Muller J (l993b) Ca2+ ions and Iysophospholipids activate phosphorylation of different proteins in plasma membranes and tonoplast purified by free­flow electrophoresis.J. Plant Physiol142: 432-437

91. Scherer GFE, Martiny-Baron G and Stoffel B (1988) A new set of regulatory molecules in plants: a plant phospholipid similar to platelet-activating factor stimulates protein kinase

and proton-translocating AlPase in membrane vesicles. Planta 175: 241:"253

92. Scherer GFE and Nickel R (1988) The animal ether phospho­lipid platelet-activating factor stimulates acidification of the incubation medium by cultured soybean cells. Plant Cell Rep 7:575-578

93. Schumaker K and Sze H (1987) Inositol (1,4,5) trisphosphate releases Ca2+ from from vacuolar membrane vesicles of oat roots. J Bioi Chern 262: 3944-3946

94. Serrano R, Montesinos C and Sanchez J (1988) Lipid require­ments of the plasma membrane AlPase from oat roots and yeast. Plant Sci 56: 117-122

95. Sharp 10, White DL, Chiou XG, Goodson T, Gamboa GC, McClure D, Burgett S, Hoskins J, Skatrud PL, Sportsman JR, Becker GW, Kang LH, Roberts EF and Kramer RM (1991) Molecular cloning and expression of human Ca2+ -sensitive cytosolic phospholipaseA2. J Bioi Chern 266: 14850-14853

96. Suen K-L and Choi JH (1991) Isolation and sequenceanaly­sis of a cDNA clone for a carrot calcium-dependent protein kinase: homology to calcium/calmodulin-dependent protein kinases and to calmodulin. Plant Mol Bioi 17: 581-590

97. Tate BF, Schaller GE, Sussman MR and Crain RC (1989) Characterization of polyphosphoinsoitide phospholipase C from the plasma membrane of Avena sativa. Plant Physiol 91: 1275-1279

199

98. Trewavas A and Gilroy S (1991) Signal transduction in plant cells. Tr Genetics 7: 356--361

99. Verhey SD, Gaiser C and Lomax TL (1993) Protein kinases in zucchini. Characterization of calcium-requiring plasma membrane kinases. Plant Physioll03: 413-419

100. Weaver CD and Roberts DM (1992) Determination of the site of phosphorylation of nodulin 26 by the calcium-dependent protein kinase from soybean nodules. Biochemistry 31: 8954-8959

101. Yang W and Boss WF (1994) Regulation of phosphatidyli­nositol 4-kinase by the protein activator PIK-A49. Activa­tion requires phosphorylation of PIK-A49. J Bioi Chern 269: 3852-3857

102. Yang W, Burckhardt W, Cavallius J, Merrick WC and Boss WF (1993) Purification and characterization of a phosphatidyl-inositol4-kinase activator in carrot cells. J Bioi Chern 268: 392-398

103. Yotsushima K, Mitsui T, Takaoda T, Hayakawa T and Igaue I (1993) Purification and characterization of membrane­bound inositol phospholipid-specific phospholipase C from suspension-cultured rice (Oryza sativa L.) cells. Plant Physiol 102: 165-172

A. R. Smith et ai. (eds.). Plant Hormone Signal Perception and Transduction. 201-208. © 1996 Kluwer Academic Publishers.

201

Site-directed mutagenesis of the cGMP phosphodiesterase inhibitory ry subunit from bovine rods New mechanisms of catalytic subunits inhibition and activation

V.M. Lipkin, A.M. Alekseev, V.A. Bondarenko, Kh.G. Muradov & V.E. Zagranichny Branch of Shemyakin & Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Pushchino, Moscow Region, 142292, Russia

Key words: cGMP phosphodiesterase, photoreceptor, rod outer segment membrane, site-directed mutagenesis, transducin

Abstract

The recombinant and 30 mutant cGMP phosphodiesterase (PDE) , subunit (PDE,) genes were expressed by sequential transcription and translation in vitro. Inhibitory properties of these mutants and their interactions with PDE catalytic and transducin a subunits were studied. To explain the properties ofPDE, mutants we proposed a new mechanism of PDE functioning: (i) There are two sites on the PDE catalytic complex (PDEa,B) for PDE, binding (A and B). PDE, sites interacting with sites A and B are structurally different. The site on PDE, that interacts with the B-site partly overlaps with the binding site for transducin a subunit complexed with GTP (Ta*GTP). (ii) The PDE, bound to the B-site provides the main contribution to inhibition of the PDE catalytic activity. (iii) Ta*GTP first interacts with the PDE, bound to the A-site and removes it in a PDE,*(Ta*GTP) complex. (iv) After removal of PDE, from the A-site, another Ta*GTP molecule is enabled to interact both with PDEa,B and with PDE, bound to the B-site. This interaction results in the formation of a membrane-bound fully catalytically active triple complex, PDEa,B* PDE,* (Ta*GTP).

Introduction

In vertebrate retinal rods, light-activated rhodopsin catalyses the formation of the transducin a subunit complex with GTP (Ta*GTP) [19]. In tum, this com­plex activates cGMP phosphodiesterase (PDE) [5]. PDE is a peripheral membrane protein consisting of three types of subunits: a (98 kDa, PDEa) [16], ,B (98 kDa, PDE,B) [11], and two identical, ones (each of 10 kDa, PDE,) [17]. The latter (PDE,) are respon­sible for non-competitive inhibition of the catalytic heterodimer consisting of a and ,B moieties (PDEa,B) [7]. The degree ofPDE activation depends reciprocally on the concentration ofPDE, and transducin a subunit in a complex with GTP (Ta*GTP) [21].

PDE, is the basic polypeptide consisting of 87 amino acid residues. 10 of the 13 basic amino acid residues are situated between positions 24 and 45 of

the structure. Earlier, using monoclonal antibodies, we demonstrated the importance of this region in the interaction between PDE, and transducin a subunits [10]. Furthermore, it was shown [4, 10] that the PDE, C-terminus takes part in PDE catalytic subunits inhi­bition.

To study the role of individual amino acid residues in the PDE, structure, we used oligonucleotide­directed mutagenesis and expression in vitro, which allowed us to obtain radioactively labelled function­ally active PDE, [12]. A number of PDE, point mutants were obtained (Fig. 1), as well as mutants with the deletions of seven C-terminal (~7C) and six N­terminal (~2-7N) amino acid residues and two double point mutants (P27,28L and M 17 ,57L). We determined the following properties of PDE, mutants: (1) incor­poration into rod outer segment (ROS) membranes; (2) inhibition of trypsin-activated PDE (tPDE); (3)

202

capability of the transducin a subunit charged with guanosine 5'-O-(3-thiotriphosphate) (GTP,S), a non­hydrolysable GTP analogue, to activate tPDE inhibited by PDE, mutants.

Materials and methods

Mutagenesis and expression

All experimental procedures (such as cloning, muta­genesis and expression in the cell-free system of wild-type PDE, (wtPDE,) and its mutant forms) were identical to those previously described [9].

Isolation 0f rod outer segment (ROS) membranes, purification of PDE and Ta*GTP,S, preparation of trypsin-activated PDE (tPDE). All were done as described previously [9].

PDE, incorporation into ROS membranes

4 pmol of the wtPDE, or its mutant [14C]protein were added to ROS membranes containing about 5 pg PDE. Unbound radioactivity was washed out three times at 10000 g for 10 min with 1 ml of buffer containing 10 mM Tris-HCI (pH 7.5), 100 mM NaCI, 2 mM MgCI2, 2 mM 2-mercaptoethanol. Pellets of ROS membranes containing bound wtPDE, or its mutant form were counted. Under these conditions, about 20% of wtPDE" making up approximately 2.5% of the endogenous, subunit, was bound to the ROS mem­branes. This binding of wtPDE, to ROS membranes was taken as 100%.

tPDE inhibition by wtPDE, or its mutant forms

Different amounts ofwtPDE, or its mutant were added to the ~xture (100 pI) containing SO mM Tris-HCI (pH 7.5),4 mM MgCI2, 0,01 % bovine serum albumin and about 0.2 nM tPDE [9]. An addition of cGMP up to 2 mM initiated the reaction. The mixture was incubated at 30 ° C for 10 min. The reaction was stopped by heat­ing (90 °C, 2 min), then 20 pI (0.1 unit) of bacterial alkaline phosphatase were added and the incubation continued at 30 °C for 15 min. The inorganic phos­phate content was determined using (NH4)6M07024 according to [6]. To determine the transducin influ­ence on tPDE inhibition by wtPDE, or its mutant forms, the assay was carried out in the presence of 2 Ji-M Ta*GTP,S. tPDE specific activity of 400 nmol of cGMP min- 1 pg-l of protein was taken as 100%.

The results were the means of three or more indepen­dent measurements with a standard deviation of less than 5%.

Results and discussion

The , subunit incorporation into ROS membranes is easy to measure as PDE, expressed in vitro is the only radioactively labelled protein. Incorporation of the PDE, mutants into ROS membranes charac­terizes their affinity for catalytic subunits. Earlier, we showed that after incorporation the radioactively labelled PDE, was cross-linked only with a or j3 subunits of PDE [12]. Moreover, washing of ROS membranes with a hypotonic buffer led to co-extraction of PDE and recombinant PDE,. PDE-depleted mem­branes are bound to the recombinant, subunit much more poorly.

The mutants under study could be divided into four groups. The first group includes 20 mutants: ~2-7N, M17L, P23L, R24H, R24G, R24L, R24K, K25H, K25I, K25R, K25S, K25T, P27L, P2SL, K45T, M57L, C6SS, E77G, P27,2SL and M17,57L. The point sub­stitutions in PDE, are named where, for example, the arginine at position 24 is substituted for glutamic acid hence R24E. At all concentrations, the mutants demonstrate inhibitory properties analogous to that of the recombinant, subunit. The second group includes two PDE, mutants, P69L and ~ 7C. The removal of 7 C-terminal amino acid residues from the PDE, polypeptide chain slightly lowers its affinity for the catalytic subunits (probably mainly due to the absence of the TyrS4 residue) and at the same time drastically decreases the inhibitory activity of this PDE, deletion mutant (Fig. 2). The mutant P69L demonstrated an affinity for the PDEaj3 identical to that of wtPDE" but its inhibitory activity was extremely low. In our opinion this is because the P69L mutant lacks the j3-tum of its polypeptide chain in the 6S-71 region. The data allow us to suggest that PDE, interaction with catalytic subunits consists of two steps; primary binding and sequential PDEaj3 inhibition and that the C-terminus plays a key role in PDEaj3 inhibition. An appropriate spatial orientation of the C-terminus is required for inhibition [9].

The third group of PDE, mutants consists of 6 mutants (K29T, K31 R, K31 T, R33G, P55L and YS4A [9]). Each mutant has a lower affinity to PDE catalytic subunits (Fig. 3). Their inhibitory properties are similar to that of the recombinant, subunit at low concentra-

Fig. 1. The primary structure of bovine rod PDE" and its mutants.

tPDE activity, % 188

88

68

48

28

Incorporation in to 188

ROS membranes, %

58 --e-- P69L -w t P D E Q' niiiiiiiiii ~ ~7C - 8

0 B ')(

x 0

)(

8 ~-----------'----'--------~I------------~Ir-----------~I 8 .5 1 1.5 2

inhibitor added, nM Fig. 2. Incorporation into ROS membranes and tPDE inhibition by wtPDE" and mutants P69L and t:. 7C.

203

tions but are seriously deteriorated at higher concen­trations [9]. This may occur because the mutants are bound to the first centre on PDEn:,Bwith normal affinity and to the second one with lower affinity.

The last two PDEy mutants, R24E and H79L from the fourth group, demonstrate some unusual features distinct from those of others studied by us. All other mutants which differed from the wild-type PDEy

204

tPDE activity, % ~

-+-IBB ~

-&-

8B """*----6-

48

28

Incorporation into ROS membranes, {o

wtPDE o c:::J 100

K29T IilllIiIiiiI K31R c:::::::J K31T I I so R33G "'"m;:;1

P55L IIIIIIIIIlD

Y84A -B ~ ____ ~ ______ -L ______ ~ ______ L-____ ~ ______ -L ______ ~ ____ --J

8 8.1 B.2 B.3 8.4 8.S 8.6 8.7 B.8

Inhibitor added, nM Fig. 3. Incorporation into ROS membranes and tPOE inhibition by wtPOE-y and mutants K29T, K31R, K31T, R33G, P55L and Y84A.

(wtPDE'Y) in affinity to the PDE catalytic subunits changed also their inhibitory activity. R24E, with a lower affinity for rod outer segments (ROS) mem­branes, (Le., to PDE catalytic subunits) and H79L with a higher affinity, are virtually indistinguishable from wtPDE'Y on the PDE inhibitory plot (Fig. 4).

Another feature of the R24E and H79L mutants is their ability, in a manner differing from that of wtPDE'Y, to affect tPDE activation with the transducin a subunit in a complex with the GTP non-hydrolyzable analogue (Ta*GTP'YS). Here, a reverse correlation is observed between the affinity of the mutants for the PDE catalytic subunits and the ability of Ta*GTP'YS to activate the tPDE preinhibited by mutant PDE'Y (Fig. 4). Surprisingly, none of the other PDE'Y mutants of the large number studied by us, differed from the wtPDE'Y in their effect on tPDE activation by trans­ducin.

None of the previously suggested mechanisms of PDE functioning explain these new findings. A new model of PDE functioning should answer the follow­ing questions: (i) Why two distinct groups of PDE'Y mutants differing from wtPDE'Y in their affinities to PDEa,8 affect PDE inhibition and activation in a different manner? (ii) Why R24E and H79L substi­tutions affecting the mutant PDE'Y interaction with PDEa,8 do not affect tPDE inhibition in the absence of

Ta*GTP'YS whereas substitutionsK29T, K31R, K31 T, R33G, P55L and Y84A demonstrate their effects on either tPDE inhibition or PDEa,8 binding? (iii) Why do R24E and H79L, at the same time, affect the PDE activation with Ta*GTP'YS and why are these effects in a reverse correlation with the R24E and H79L affinities to PDEa,8? (iv) Why the other studied PDE'Y mutations do not affect PDE activation with Ta*GTP'YS?

Figure 5 represents the proposed mechanisms of the inhibition by the PDE'Y and the activation by the Ta*GTP of mammalian ROS PDE. This essentially refined scheme fits well with all the properties of the PDE'Y mutants studied by us and other authors and in its general features is consistent with the scheme suggested by Whalen and Bitensky [22] and further modified by Takemoto and Cunnick [20].

According to Whalen and Bitensky, PDEa,8 from mammalian rods has two centres for PDE'Y binding, each with a different affinity to the inhibitor, although these authors were unable to calculate the binding con­stants [22]. It is likely that the difference between these constants is insignificant. We presume that the muta­tions R24E and H79L affect PDE'Y binding to one of these centres while the mutations K29T, K31 R, K31 T, R33G, P55L and Y84A affect the other centre. Let us name these centres the A-site and the B-site, respec­tively. Since the latter six mutations influence tPDE

205

Incorporation into .120 ..........................

ROS membranes, % .100

80

"""'*- R24E ~ 60 -+- wtPDE1) [IT;]

tPDE activity, % --lIE- H79L ~ 40

100 20

80

+ 2 pM 60 T<x*GTPoS

40

20 without

T<x*GTPoS

0 0.1 0.2 0 .3 0.4 0.5 0.6 0.7 0.8

inhibitor added, nM

Fig. 4. Incorporation into ROS membranes and tPDE inhibition by wtPDE,,/ and mutants R24E and H79L in the presence and in the absence of2ILMTa*GTP"/S.

inhibition only at high concentrations, it is tempting to speculate that these mutants have a lower affinity for the low affinity centre of PDEr binding on PDEa,8. However, at present we do not define each of these two centres as the "high" or "low" affinity ones and we do not identify which of the two PDE catalytic subunits (a or ,8) forms each of the centres. The removal of one PDEr from the virtually inactive PDEa,8·")'2 complex in bovine ROS membranes results in only 17% of maxi­mal PDE activation [22]. Thus, the contribution of each of the two PDE, molecules bound to different centres on PDEa,8 to the inhibition of the PDE catalytic activ­ity must be different. We assume that the PDE, bound to the B-site imparts the major contribution to the inhi­bition of PDE catalytic activity. Correspondingly, the PDE, mutants with altered parameters of interaction with the B-site noticeably differ from wtPDE, on the inhibitory plots. These mutants include K29T, K31R, K31 T, R33G, P55L and Y84A. At the same time, muta­tions affecting PDE, interaction with the other centre (A-site) may not demonstrate any substantial effect on the tPDE inhibitory plot, as observed with R24E and H79L.

Thus, site-directed mutagenesis data support the assumption that the sites on PDE, interacting with the A-site and the B-site differ structurally. Consequently,

the A-site and the B-site themselves must be differ­ent in structure. This is consistent with the results of Takemoto et at. [13, 14] on the binding of PDE, to synthetic peptides corresponding to different regions of the PDEa and PDE,8 polypeptide chains. The authors postulated that the PDE, binding centres on PDEa and PDE,8 (demonstrating a significant homology of their amino acid sequences, 72% in case of bovine rod PDE [11]) are situated in the non-homologous regions and are composed of PDEa fragments 16-30 and 78-90 [13] and of PDE,8 fragments 15-34, 91-110 and 211-230 [14].

It has been shown [1] thatPDE, has two Ta*GTP binding regions with coordinates 24-45 and 70--76 and that the centre of PDEa,8 binding is also located in the 24-45 region; this centre being able to overlap partly with the binding site for the Ta. Our results fromPDE, site-directed mutagenesis indicate that the PDE, site of binding to the B-site includes residues K29, K31 and R33 and, consequently, this site of the PDE, can partly overlap with the transducin binding one. If so, then the only PDE, bound to the A-site in the holoenzyme complex PDEa,8,2 is accessible for the transducin a subunit to interact.

PDE activation by transducin, according to the suggested PDE functioning scheme, is in this part

206

II.

117C

I. Catalytic Center

v.

B - site A -site

P69L --

K29T K31T ,-K31R / R33G P55L Y84A

III. ..

K41Q ~ K44Q

K4SQ W10F

..

Fig. 5. The proposed mechanism of PDE functioning: I. There are two sttucturally different sites on PDEa/3 for PDEI' binding. the A-site and the B-site. II. Sites on PDEI'. binding to the A- and the B-sites. are also sttucturally different. The site on PDEI' interacting with the B-site partly overlaps with the binding site for the Ta*GTP formed by two regions of the PDEI' molecule. The PDEI' bound to the B-site provides the main contribution to inhibition of the PDE catalytic activity. The PDEI' C-terminus plays the key role in inhibition. The spatial orientation of the PDEI' C-terminus is of great importance here. III. and IV. Ta*GTP first interacts with the PDEI' bound to the A-site on the PDE and removes it in a PDEI' * (Ta *GTP) complex. This results in a slight activation of the PDE catalytic activity. V. After removal of PDEI' from the A-site. another Ta*GTP molecule is enabled to interact both with PDEa/3 and with PDEI' bound to the B-site. This interaction results in the formation of a membrane-bound fully catalytically active triple complex. PDfu/3* PDEI' * (T a * GTP). PDEI' mutations K29T. K31 T. K31 R. R33G. P55L and Y84A affect PDEI' binding to PDEa/3 ihi the B-site. Substitutions in PDEI' R24E and H79L affect the PDEI' interaction with PDEa/3 in the A-site and the PDEI' dissociation from the A-site in the complex with transducin. PDEI' mutations D. 7C (the deletion of 7 C-terminal amino acid residues) and substitution P69L affect PDEa/3 inhibition. PDEI' mutations K4IQ. K44Q. K45Q [2) and W70F [15) prevent PDEI' binding to transducin.

analogous to those observations of Bitensky and Take­moto [20. 22, 23], beginning with the dissocia­tion of one PDEr molecule in the PDE,*(Tll'*GTP) complex from the holoenzyme PDEll',B(2) with the subsequent formation of a weak catalytically active complex PDEll',B,. We presume that here the PDE, molecule bound to A-site dissociates. It is likely that Tll'*GTP interaction with the PDE, molecule alloster­ically favours this dissociation. It seems apparent that mutations R24E and H79L, affecting the process of PDE, interaction with the A-site in a different manner,

should have a reverse effect on the PDE, dissociation from the holoenzyme complex. The analogous action of these mutations on the process of PDE activation by transducin can also be explained. We assume that the main role in this activation belongs to the second Tll'*GTP molecule. This Tll'*GTP binds to PDE, (in the PDEll',B, complex) at one of the two Tll'-binding sites (probably 70-76, since the other one, 24-45, is unavailable as a result of the interaction with the B-site) and interacts also with PDEll',B. This should hamper dissociation of the PDE, bound to the B-site.

As a result of su~h interaction the PDE" remaining in the B-site as part of the PDEa,8*PDE,*(Ta*GTP) complex, ceases the inhibition effect. It is likely that the second Ta*GTP molecule is able to bind to PDE only after PDE, dissociation from the A-site and that the Ta-binding site and A-site on PDEa,8 overlap. Accordingly, if the dissociation of the first PDE, is hampered, as in the case of H79L mutation, PDE acti­vation by transducin is hampered also. On the contrary, if the PDE, mutant affinity to the A-site is weakened, as in the case of R24E mutation, the PDE, dissocia­tion from the A-site is facilitated and, hence, transducin activ~tion is higher than in the case of wtPDE,.

We have shown earlier [10] that the PDE, sites of primary binding to PDEa,8 and of inhibitory action on PDEa,8 are spatially separated and the exact spa­tial location of the PDE, C-terminal region and the PDEa,8 catalytic (or allosteric) centre is of great impor­tance for the process of inhibition. The changes of the spatial arrangement of P69L mutant PDE, polypep­tide chain C-terminus hinder its interaction with the enzyme catalytic (or allosteric) centre. An analogous process apparently takes place in transducin activation ofPDE. The second Ta*GTP molecule bindingsimul­taneously with the PDE, (bound to the B-site) and with the PDEa,8 (probably to the A-site) and acting as a lever, shifts the location of the PDE, C-terminal region relative to the PDEa,8 catalytic (or allosteric) centre, thus terminating its inhibitory action.

Two PDE, mutants have been reported recently to hinder transducin activation of PDEa,8 after their binding with the PDE catalytic complex: these are the triple mutant K41 Q,K44Q,K45Q [2] and the point mutant W70F [15]. Both mutants bind to PDEa,8 and inhibit the tPDE catalytic activity in the same way as the recombinant wtPDE,. Consequently, we reason that both these mutations only affect the site of PDE, interaction with transducin and have no effect on their interaction with PDEa,8 in the A-site or in the B­site.

The proposed mechanism is also consistent with the data of Cherione et al. [8, 18] on the probabil­ity of direct interaction of the transducin a subunit with PDE catalytic ones during activation and with the results of Clerc and Bennett [3] who showed that transducin remains bound to the activated by it PDE catalytic complex in ROS membranes. It can be specu­lated that such a relatively complicated mechanism of PDE activation in mammalian rods facilitates the pro­cess of enzyme reinhibition after GTP hydrolysis by the transducin a subunit and subsequent dissociation

207

of the Ta*GDP from the catalytically active multisub­unit aggregate. In this case, 80-90% ofPDE inhibition could be achieved immediately after Ta*GDP dissoci­ation since the PDE, still bound to the B-site restores its inhibitory action.

Acknowledgements

The research described in this publication was made possible in part by Grant No. MU5000 from the Inter­national Science Foundation. This research has also been supported by the Russian Fundamental Research Fund (project code 93-04-7310).

Note

The abbreviations used are: PDE, cGMP phosphodiesterase; PDEa, PDE,6, and PDE,)" cGMP phosphodiesterase a, ,6, and -y subunits, respectively; PDEa,6, phosphodiesterase catalytic dimer consist­ing of the a and,6 subunits; Ta, transducin a subunit; Ta*GTP and Ta*GDP, transducin a subunit in a complex with GTP and GDP, respectively; R24E, point mutation in PDE-y with arginine at position 24 substituted by glutamic acid (the other point substi­tutions in PDE-y are named similarly); wtPDE-y, wild-type PDE-y; ROS, rod outer segments; Ta*GTP-yS, transducin a subunit in a complex with GTP non-hydrolyzable analog, guanosine-5'-O-(3-thiotriphosphate); tPDE, trypsin activated PDE.

References

I. Artemyev NO, Rarick HM, Mills JS, Skiba NP and Hamm HE (1992) Sites of interaction between rod G-protein a-subunit and cGMP-phosphodiesterase -y-subunit. J Bioi Chern 267: 25067-25072

2. Brown RL (1992) Functional regions of the inhibitory subunit of retinal rod cGMP phosphodiesterase identified by site-specific mutagenesis and fluorescent spectroscopy. Biochemistry 31: 5918-5925

3. Clerc A and Bennett N (1992) Activated cGMP phospho­diesterase of retinal rods. J Bioi Chern 267: 6620-6627

4. Cunnick JM, Hurt D, Oppert B, Sakamoto K and Takemoto DJ (1990) Binding of the -y-subunit of retinal rod-outer-segment phosphodiesterase with both transducin and the catalytic sub­units of phosphodiesterase. Biochem J 271: 721-727

5. Fung BK-K, Hurley 18 and Stryer L (1981) Flow of informa­tion in the light-triggered cyclic nucleotide cascade of vision. Proc Natl Acad Sci USA 78: 152-156

6. Eibl H and Lands WEM (1969) Sensitive determination of phosphate. Anal Biochem 30: 51-57

7. Hurley JB and Stryer L (1982) Purification and characteriza­tion of the -y regulatory subunit of the cyclic GMP phospho­diesterase from retinal rod outer segments. J Bioi Chern 257: 11094-11099

8. Kroll S, Phillips WJ and Cerione RA (1989) The regulation of the cyclic GMP phosphodiesterase by the GDP-bound form of the a subunit of transducin. J Bioi Chern 264: 4490-4497

208

9. Lipkin VM, Bondarenko VA, Zagranichny YE, Dobrynina LN, Muradov KhG "and Natochin MYu (1993) Site-directed muta­genesis of the cGMP phosphodiesterase,,( subunit from bovine rod outer segments: Role of separate amino acid residues in the interaction with catalytic subunits and transducin a subunit. Biochim Biophys Acta 1176: 250-256

10. Lipkin VM, Dumler IL, Muradov KG, Artemyev NO and Etingof RN (1988) Active sites of the cyclic GMP phospho­diesterase "( subunit of retinal rod outer segments. FEBS Lett 234:287-290

II. Lipkin VM, Khramtsov NV, Vasilevskaya lA, Atabekova NV, Muradov KG, Gubanov VV, Li T, Johnston JP, Volpp KJ and Applebury ML (1990) The .a-subunit of bovine rod photoreceptorcGMP phosphodiesterase: Comparison with the phosphodiesterase family. J Bioi Chern 265: 12955-12959

12. Muradov KhG, Natochin MYu, Bondarenko VA, Skiba NP and Lipkin VM (1990) Interactions between bovine retinal rod cGMP phosphodiesterase subunits. Bioi Membr 7: 565-572

13. OppertB,CunnickJM, Hurt D and Takemoto D (1991) Identifi­cation of the retinal cyclic GMP phosphodiesterase inhibitory ,,(-subunit interaction sites on the catalytic a-subunit. J Bioi Chern 266: 16607-16613

14. Oppert B and Takemoto D (1991) Identification of the "(­subunit interaction sites in the retinal cyclic-GMP phosphodi­esterase .a-subunit. Biochim Biophys Res Comm 178: 474-479

15. Otto-Bruc A, Antonny B, Vuong TM, Chardin P and Chabre M (1993) Interaction between the retinal cyclic GMP phospho­diesterase inhibitor and transducin. Kinetics and affinity studies. Biochemistry 32: 8636-8645

16. Ovchinnikov YuA, Gubanov VV, Khramtsov NV, Ischenko KA, Zagranichny VE, Muradov KG, Shuvaeva TM and Lipkin VM (1987) Cyclic GMP phosphodiesterase from bovine retina. Amino acid sequence of the a subunit and nucleotide sequence of the corresponding cDNA. FEBS Lett 223: 169-173

17. Ovchinnikov YuA, Lipkin VM, Kumarev VP, Gubanov VV, Khramtsov NV, Akhmedov NB, Zagranichny VE and Muradov KG (1986) Cyclic GMP phosphodiesterase from cattle retina. Amino acid sequence of the ,,(-subunit and nucleotide sequence of the correspondingcDNA. FEBS Lett 204: 288-292

18. Phillips WJ, Trukawinski S and Cerione RA (1989) An antibody-induced enhancement of the transducin-stimulated cyclic GMP phosphodiesterase activity. J Bioi Chern 264: 16679-16688

19. Stryer L (1986) Cyclic GMP cascade in vision. Ann Rev Neurosci 9: 87-119

20. Takemoto OJ and Cunnick JM (1990) Visual transduction in rod outer segments. Cellular Signalling 2: 99-104

21. Wensel TG and Stryer L (1986) Reciprocal control of retinal rod cyclic GMP phosphodiesterase by its "( subunit and trans­ducin. PROTEINS: Struct Funct Genet I: 90-99

22. Whalen MM and Bitensky MW (1989) Comparison of the phosphodiesterase inhibitory subunit interactions of frog and bovine rod outer segments. Biochem J 259: 13-19

23. Whalen MM, Bitensky MW and Takemoto DJ (1990) The effect of the ,,(-subunit of the cyclic GMP phosphodiesterase of bovine and frog (Rana catesbiana) retinal rod outer segments on the kinetic parameters of the enzyme. Biochem J 265: 655-658

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 209-215. © 1996 Kluwer Academic Publishers.

209

Studies on the possible role of protein phosphorylation in the transduction of the ethylene signal

A.W. Berry!, D.S.C. Cowan!, N.V.I. Harpham!, R.I. Hemsley!, G.Y. Novikova2 ,

A.R. Smith! & M.A. Hall! I Institute of Biological Sciences, University of Wales, Aberystwyth, Dyfed, Wales, SY23 3DA, UK; 2Timiriazev Institute of Plant Physiology, Acad. Sci. Russia, 35 Botanicheskaya Str., Moscow, 12726, FSU

Key words: Arabidopsis, EBP, ethylene, phosphorylation, receptors, signal transduction

Abstract

Previous work in our laboratory has demonstrated the existence of high affinity binding sites for the plant growth regulator ethylene. The ethylene binding protein (EBP), from Phaseolus cotyledons, shows many of the characteris­tics of a functional receptor for ethy lene, has been purified on SDS-PAGE and polyclonal antibodies raised in rabbits. Current work involves the investigation of the ethylene transduction signal in a number of ethylene-responsive tissues.

In peas, it has been shown that ethylene promotes the phosphorylation of specific proteins of similar molecular weight to the EBP from Phaseolus. Such ethylene-induced phosphorylation can be inhibited by the ethylene antagonist, 2,5-NBD. The antibodies raised to the EBP from Phaseolus have been shown to immunoprecipitate 32P-Iabelled proteins from membrane protein preparations obtained from pea tissue. Studies on ethylene binding in pea have also shown that the binding of ethylene may be regulated by phosphorylation. Thus, under conditions which promote phosphorylation, binding is inhibited, whereas the reverse is true under conditions which enhance dephosphorylation.

Further work is described which examines the effect of protein kinase, protein phosphatase and calcium channel inhibitors on ethylene-induced phosphorylation in peas, together with wild-type (WT) and ethylene insensitive (eti) mutants of Arabidopsis thaliana. The effects of these treatments can be monitored in vivo using the ethylene­induced triple response as a screen. Furthermore, the protein profiles of such treated seedlings can then be compared by labelling protein extracts with 32p and subjecting the samples to SDS-PAGE followed by autoradiography.

1. Introduction

Work in our laboratory over recent years has centred on the characterisation of ethylene binding sites in various species [2, 3]. The properties of the ethylene binding sites in pea seedlings are consistent with many of the criteria required of a functional receptor [12], being saturable, of high affinity and the affinity of the sites for physiological analogues such as propylene compares favourably with concentrations required to bring about physiological responses [11]. To date, ethylene binding sites have been detected in all species investigated, including Arabidopsis, Phaseolus, rice and tomato [4, 9, 10]. We have characterised the ethylene binding

protein (EBP) from Phaseolus and have obtained some information on its amino acid sequence.

Although it is well established that plants perceive an array of plant growth substances, it is only recently that possible signal transduction pathways have been studied. In animal systems, persistent study has iden­tified a plethora of complex pathways which include components such as the G-proteins and the inositol phosphate pathway, and which postulate a role for intracellular calcium in signal transduction mecha­nisms. Present work involves the study of the pathways involved in the transduction of the ethylene signal in higher plants. Much of this work has been done with etiolated pea seedlings, but where appropriate,

210

Table 1. Effect of NaF and phosphatase on ethylene binding to cell-free preparations from pea epitotyl tips

Control

+ Phosphatase

+NaF

+NaF+AlP

Specifically bound ethylene (pmol g-I (FW»

0.118 ± 0.012

0.239 ± 0.003

0.070 ± 0.011

0.067 ± 0.010

work on etiolated seedlings of Arabidopsis will be described.

2. Results

Initial studies [8] demonstrated that phosphorylation may be a regulator of ethylene binding (Table 1). Using cell-free extracts from pea, it was possible to show that ethylene binding could be increased in the presence of exogenous phosphatase, whereas it was decreased when the phosphatase inhibitor NaP was added. Phosphatase treatment led to a doubling of measur­able binding, with NaP treatment reducing binding by almost 60%. That ATP and kinase activity were not limiting factors in this assay was shown by the addition of additional ATP to one set of NaP-treated samples.

Further work using 32p_ATP showed that ethylene treatment of pea epicotyl extracts led to a marked increase in phosphorylation of proteins in both sol­uble and membrane fractions (Table 2). In all cases the average percentage increase in 32p incorporation in ethylene treated samples was approximately 30%. The increase was detected after an incubation of 1 h and was maintained up to 20 h.

After phosphorylation with 32P-Iabelled ATP, pro­tein extracts from pea were separated by SDS-PAGE electrophoresis and autoradiographed. Densitometer measurements showed that after a 20 h incubation with ethylene, there were ethylene-promoted regions of enhanced phosphorylation with molecular weights in the region of 14, 30 and 67 kDa (Fig. 1). In Phase­olus, proteins retaining 14C-ethylene have been shown to have molecular weights of 26 and 28 kDa under semi-denaturing conditions and approximately 14 kDa when fully denatured [2]. Other work has led us to postulate that it is the ethylene binding protein itself which becomes phosphorylated and that this phospho-

Table 2. Effects ofC2H4 on in vivo phosphorylationof96 kS (soluble) and 96 kP (membrane) fractions from pea epicotyl tips

Fraction C2H4 Incubation dpmmg- I

(100 ILL L -I) (h) Protein

96kS 4896

96kS + 1 9046

96kS 20 28342

96kS + 20 41920

96kP 509

96kP + 1419

96kP 20 5217

96kP + 20 8431

Table 3. Effects of ethylene (I ILL L -I) and 2,5-NBD (200 ILL L -I) on in vitro phosphorylation in a post-mitochondrial supernatant from pea epicotyl tips. Results are presented as a percentage of the untreated control

0.5 100 136 90 96

100 399 171 212

rylation may not only regulate ethylene binding, but may also be an integral part of the subsequent transduc­tion pathway. The specificity of the ethylene-induced phosphorylation has been studied using the ethylene antagonist 2,5, Norbomadiene (NBD) (Table 3).

In pea epicotyl tips, ethylene promotes phospho­rylation within 0.5 h by almost 40% and by 1 h there is a four-fold increase. In the presence of NBD, this ethylene-induced phosphorylation is markedly reduced. Further work has demonstrated that the ethylene-induced phosphorylation follows a typical ethylene dose-response curve, with an optimum of 0.1 pL L -I (data not shown). Antibodies raised to the EBP from Phaseolus have been used in immunopre­cipitation studies in pea (Table 4). A persistent prob­lem with these studies has been the high background readings that were obtained with control sera. Never­theless, antibodies raised to the 26 and 28 kDa protein do appear to immunoprecipitate 32P-Iabelled activity in both the soluble 96 kS and membrane-associated 96 kP fractions.

In our work investigating possible signal transduc­tion pathways triggered by ethylene, we have tried to combine in vitro 32P-Iabelling studies with in vivo

211

kDa

20.1 14.4 I I

A

94 6743 30 20.1 14 .4 I I I I I I

B

---- Mlgralion ) ---- Migration --~

Fig. 1. Densitometer scans of autoradiographs obtained after proteins from a membrane-enriched protein fraction from 32P-Iabelled pea epicotyl tips were separated on SDS-PAGE. The figure on the left (A) shows data for tips grown in the presence of absence of 100 ML L- 1

ethylene after a I h incubation. The figure on the right (B) shows the effect after a 20 h incubation. The position of the molecular weight markers is indicated on each graph.

Table 4. Immunoprecipitation of 32P-labelled proteins from pea epicoty I tips. Results are presented as dpm counted in each fixed volume fraction. Upper and Lower refer to the subunit proteins of the EBP to which antibodies were raised, upper referring to the 28 kDa protein, lower the 26 kDa protein

Antibody 96kS 96kP

Upper 120520 267640

Lower 141850 308680

Non-Immune (NI) 73346 241240

NI -upper 47174 26400

NI-Iower 68504 57440

physiological experiments. Interest in signal transduc­tion pathways in both animal and plant systems has led to the availability of a wide range of inhibitors to components of transduction pathways, for example kinase and phosphatase inhibitors. We are fortunate in working with ethylene that we have a well-established screen for ethylene-induced responses, namely the triple response of etiolated seedlings. Thus when exposed to ethylene, seedlings of many species show a reduction in elongation growth, increased isodia­metric cell expansion, and a tightening of the plumular hook. In most seedlings, the exception perhaps being the rather diminutive Arabidopsis, the triple response is relatively easily and rapidly measured, and so it is possible to monitor the effects of inhibitors on the various parameters of the triple response. Summary

data for our work in pea seedlings is shown below (Table 5).

One of the inhibitors which we have chosen in our studies is the phosphatase inhibitor Okadaic acid [1]. We have been able to show that when treated with 1 nM okadaic acid etiolated pea seedlings do not show a reduction in elongation growth when treated with ethy­lene, in fact there may be a promotion of growth under these conditions, although ethylene-induced radial cell expansion and increased hook curvature remain unaf­fected. Okadaic acid alone had no detectable effect on seedling morphology. In animal systems it has been shown that a concentration of 1 nM okadaic acid is specific for type 2A phosphatases, and so it is reason­able to suggest that a type 2A phosphatase may be important in at least part of the pathway that leads to the inhibition of the elongation response. It would seem reasonable to suggest that the inhibitors used do not interfere directly with ethylene perception. Further work will measure kinase and phosphatase activity in extracts from both pea and Arabidopsis. It is impor­tant, however, that the specificity of the inhibitors is checked in plant tissues as most of the information so far available is for animal systems.

Staurosporine [6], a kinase inhibitor, also has inter­esting effects on seedling morphology. In the absence of ethylene, staurosporine has been shown to have a promotory effect on seedling elongation, associated with a thinning of the epicotyl. Seedlings treated

212

Table 5 .. The effect of Okadaic acid, Staurosporine and Lanthanum chloride on the ethy lene-induced triple response in pea seedlings. Okadaic acid was used at a concentration of I nM, staurosporine at a concentration of 20 nM, and lanthanum chloride at 100 mM. Seedlings were 5 d old at the time of measurement. Values indicate the mean, ± standard error of 5 replicates

- Ethylene + Ethylene

Treatment Length (cm) Hook angle Width (mm) Length (cm) Hook Angle Width (mm)

Control 2.67 ± 0.2 68± 6

Okadaic acid 2.7 ± 0.2 90± 14

Staurosporine 4.82 ± 0.7 88± 9

Lanthanum chloride 0.97 ± 0.3 83± 12

with both ethylene and staurosporine show ethylene­induced thickening and increased hook curvature, but do not show a dramatic inhibition of elongation. Another chemical which we have studied is lanthanum chloride, a calcium channel blocker [7]. Treatment of seedlings with lanthanum causes a marked inhibi­tion of elongation growth, though both width and hook curvature remained unaffected. When treated with both lanthanum and ethylene, width and hook angle both increased compared to the controls although ethylene­induced shortening of the epicotyl was inhibited.

Thus we have shown that all three compounds already acknowledged to be potent inhibitors in animal systems also are active in plant tissues, indicating similar if not homologous signal transduction path­ways.

We have, in pea, obtained autoradiographs of protein extracts which have been treated with the various inhibitors outlined above (Plate 1). In controls, the dominant phosphorylated protein has a molecular weight in the region of 18 kDa. Ethylene treatment causes a decrease in the intensity of this band, with a concomitant increase in phosphorylation of bands of higher molecular weight. When treated with both ethylene and okadaic acid, there appears to be a reduc­tion in the density of the 18 kDa band, but no high molecular weight phosphorylation is detected. This pattern is also seen in ethylene and staurosporine­treated extracts. Lanthanum treatment alone leads to a phosphorylation of the 18 kDa band, however with extracts obtained from ethylene and lanthanum-treated seedlings it can be seen that the phosphorylation of the 18 kDa protein is dramatically enhanced. Similar pro­tein extracts have been Western blotted and the blots challenged with the P27 antibody raised to a Nucleo­side Diphosphate Kinase (NDK), (a generous gift from Dr Paul Millner, Biochemistry Dept, Leeds University,

1.63 ± 0.1 0.48 ± 0.12 174± 4 2.57 ± 0.12

1.69 ± 0.05 4.8 ± 1.0 166 ± 7.5 2.45 ± 0.1

1.48 ± 0.04 3.28 ± 0.8 192± 13 2.51 ± 0.1

1.51 ± 0.1 0.65 ± 0.06 173 ± 8 2.27 ± 0.07

UK). Results show that these P27 antibodies react with the phosphorylated band detected at 18 kDa (Plate 2). To date the significance of the 18 kDa band has to be elucidated, although our results do suggest that the phosphorylation of this protein may be regulated in part by ethylene.

In addition to the work described in pea seedlings, we have also been working on wild-type (WT) Arabidopsis thaliana, together with a range of ethylene-insensitive mutants, designated eti mutants [5]. We have experienced some technical difficul­ties when repeating the experiments described in peas using Arabidopsis. Although particularly well-suited to molecular genetics, Arabidopsis seedlings tend to be small, making biochemical and physiological experi­mentation difficult. We have shown that okadaic acid treatment of wild-type seedlings does lead to a reduc­tion in the capacity of ethylene to induce reduced elongation growth. In addition, we have observed very similar phosphorylation patterns in Arabidop­sis seedlings to those described in peas, and recent work has shown that the P27 antibody also reacts very strongly to the major phosphorylated protein we observe, at a molecular weight of 18 kDa.

A considerable concern in our studies has been the possible effect(s) that some of these chemical and inhibitor treatments might have on endogenous ethylene production rates. In Arabidopsis it has been demonstrated that ethylene pretreatment leads to the autoinhibitionof ethylene biosynthesis by almost 30%. We have shown that 1 nM okadaic acid in both Arabidopsis and Phaseolus leads to a marked decrease in ethylene evolution. These results are interesting as it is now well established that ethylene biosynthesis is receptor mediated. Previous work showed that the ethylene insensitive mutant of Arabidopsis thaliana, eti 5, shows a very much elevated rate of ethylene

kDa

94-67·

43·

30- '

20.1·

14.4·

94·. 67 ••

43- .

30-

10 Min incubahon

CON OK

+ + • • • •

30 Min incubation

• •

213

STA LAN

+ + • •

OIl •

Plate 1. Autoradiographs of phosphorylation using 32p·ATP labelled fractions from post·mitochondrial extracts of pea epicotyl tips grown in the presence (+) or absence (-) of 10 ILL L -1 ethylene (labelled CON). Phosphorylation reactions were carried out in the presence or absence of I nM okadaic acid (OK). 20 nM staurosporine (STA) or 100 mM lanthanum chloride (LAN). The position of molecular weight markers is indicated on the plate. Upper: 10 minute incubation reaction. Lower: 30 minute incubation reaction.

biosynthesis, and lacks demonstrable autoinhibition [3]. It has been recently demonstrated that while in wild-type Arabidopsis seedlings lanthanum treatment causes a twenty-fold increase in ethylene production, no such promotory effect is seen in eti 5. The absence of autoinhibitionin eti 5, coupled with its lack of response

to lanthanum and the effects of okadaic acid in the wild-type seedlings are all consistent with the idea of ethylene-biosynthesis being receptor-mediated.

Thus we have been able to show in the course of this work that some inhibitors of animal signal transduction pathways are indeed active in plants. By combining and

214

Western Blot using P27 antibody

96 kS 96 kP

kOa

- 67

-43

-30

- 20.1

-14.4

1:10K 1:20K 1:10K 1;20K

Plate 2. Western blots of soluble (96 kS) and membrane enriched (96 kP) preparations from 5 day old pea epicotyl tips. The blot was probed with the P27 antibody to the Nucleoside Diphosphate Kinase (NDK), (a generous gift from Dr Paul Millner, Leeds University, UK). Figures indicate the dilution of the antibodies used to probe the blot. Blotted and stained molecular weight markers are also indicated.

continuing physiological with in vitro investigations, we hope to gain a clearer picture of the initial stages of ethylene signal transduction.

Acknowledgements

This work was funded in part by the European 'Communities' BRIDGE Programme and the BIO­TECH Programme, as part of the project of Techno­logical Priority 1993-1996.

We would also like to acknowledge the support of the Royal Society under the Exchange Visitors Pro­gramme, International Association for the Promotion of Co-operation with Scientists from the Independent States of the FSU (INTAS) and the BBSRC.

References

I. Cohen P, Holmes CFB and Tsukitani Y (1990) Okadaic acid - A new probe for the study of cellular recognition. TIBS 5: 98-102

2. Hall MA, Aho HM, Berry AW, Cowan DSC, Harpham NVJ, Holland MG, Moshkov IE, Novikova GV and Smith AR (1993) Ethylene receptors. In: Peche, Latache and Balague (eds) Cellular and Molecular Aspects of the Plant Honnone Ethylene, pp 168-173. Dordrecht, Boston, London: Kluwer Academic Publishers

3. Hall MA, Berry AW, Cowan DSC, Evans JE, Harpham NVJ, Moshkov I, Novikova G, Raskin 10, Smith AR, Turner R and Zhang Xiuqing (1994) Ethylene receptors. In: Smith CJ, Gallon J, Chiatante D and Zocchi G (eds) Biochemical Mech­anisms Involved in Plant Growth Regulation. Proceedings of the Phytochemical Society of Europe. Oxford, UK: Clarendon Press

4. Hall MA, Connem CPK, Harpham NVJ, Isizawa K, Roveda­HoyosG, Raskin I, Sanders 10, Smith AR, TurnerR and Wood CK (1990) Ethylene receptors and action. In: Roberts JA, Kirk C and Venis MA (eds) Honnone Signal Perception and Signal Transduction in Animals and Plants, pp 87-110. SEB Sympo­sium number 44. Cambridge, UK: The Company of Biologists Ltd

5. HarphamNVJ,BerryAW,KneeEM,Roveda-HoyosG,Raskin I, Sanders 10, Smith AR, Wood CK and Hall MA (1991) The effect of ethylene on the growth and development of wild­type and mutant Arabidopsis thaliana (L.) Heynh. Ann Bot 68:56-61

6. Kiss Z and Deli E (1992) Regulation of phospholipase-D by sphingosine involves protein-kinase C-dependent and C­independent mechanisms in NIH 3T3 fibroblasts. Biochem J 288: (DEC) 853-858

7. Nelson MT (1984) Reduction of single calcium channel cur­rents by lanthanum and cadmium. Biophys J 45: (2) (meeting abstract)

8. Novikova GV, Moshkov IE, Smith AR and Hall MA (1993) Ethylene and phosphorylation of pea epicotyl proteins. In:

215

Peche, Latache and Balague (eds) Cellular and Molecular Aspects of the Plant Honnone Ethylene, pp 371-372. Dordrecht, Boston, London: Kluwer Academic Publishers

9. Sanders 10, Harpham NVJ, Raskin I, Smith AR and Hall MA (1991) Ethylene binding in wild-type and mutant Arabidopsis thaliana (L.) Heynh. Ann Bot 68: 97-103

10. Sanders 10, Ishizawa K, Smith AR and Hall MA (1990) Ethy­lene binding and action in rice seedlings. Plant Cell Physiol 31: 1091-1099

II. Sanders 10, Smith AR and Hall MA (199 I) Ethylene binding in epicotyls of Pisum sativum L. cv. Alaska. Planta 183: 209-217

12. Venis MA (1985) Honnone Binding Sites in Plants. New York, London: Longman

A. R. Smith et aI. (eds.), Plant Hormone Signal Perception and Transduction, 217-221. @ 1996 Kluwer Academic Publishers.

217

Synthetic peptides as probes of plant cell signalling G-proteins and the auxin signalling pathway

P.A. Millner!, D.A. Groarke & I.R. White2

1 Department of Biochemistry and Molecular Biology, University of Leeds, Leeds LS2 9JT, UK; 2 Analytical Sciences, SKB Pharmaceuticals, The Fry the, Welwyn Garden City, UK

Key words: syp.thetic peptides, G-proteins, auxin, cell-signalling

Abstract

Synthetic peptides have found increasing use in dissecting cell signalling pathways and have been employed as synthetic antigens, protein kinase and protease substrates. Recently, it has become evident that relatively short (10-30mer) peptides are able to mimic that part of the signalling protein to which their sequence corresponds. In particular, peptides corresponding to the C-terminus of Zea mays auxin binding protein, ZmABP1, were able to modulate ion channel function within Vicia guard cells. In this report, GTPiS binding to NaCl-washed Zea microsomal membranes is shown to be stimulated by peptide A6.2, corresponding to the C-terminal 16 residues of ZmABP1, only when the membranes are reconstituted with soluble Zea protein fractions containing GPal and Gao homologues.

Peptides as substrates

An important use of synthetic peptides has been to provide substrates for the characterisation of protein proteases and kinases. Within the latter context, the ability to prepare a range of related peptide struc­tures has facilitated greatly our ideas of protein kinase substrate specificity, in both animals [19] and plants [22].

Peptides as antigens

Another important use of synthetic oligopeptides, within many biochemical fields, has been as synthetic antigens. This has allowed development of antisera against proteins whose existence is only known via DNA sequence data. However, such antisera also represent antibodies directed against a particular linear epitope within a protein - a feature which has been highly useful in the field of cell signalling and in particular, in the study of G-proteins. For example

antisera raised against the so called Gacommon (ac)

sequence - LLGAGESGSK - [14] are pan-specific for most GO' subunits. The a c sequence forms part of the a-phosphate binding domain for GTP and as a conse­quence is very highly conserved [4]. Other domains within GO' subunits and sera raised against peptides corresponding to such domains can be used to specify GO' subtypes, e.g., Gai, [7] or even individual Ga­subunits. The way in which the degree of antibody specificity can be engineered is depicted in Fig. 1.

One important feature arising from the use of anti­sera against synthetic peptides is that non-specifically cross-reacting proteins will normally be encountered [23, 24]. The basis of this cross-reactivity is unclear and probably is due to antibodies directed against the carrier protein, crosslinking reagent used to attach the synthetic peptide, or part of the peptide. Accordingly, an important control is to abolish cross-reactivity by preabsorption of the antibody with the respective peptide. An example of this control is shown in Fig. 2B [25] where only the appropriate peptide (GARA2)

is able to block the cross-reactivity of anti-GPal ARA2

218

A B C o E

• I 1111111111111111111 '

1111111111111111111

T B - specific antibody

C ,D - specific antibody

! Panspecific (i.e ,A to E) antibody

Fig. 1. Hypothetical protein sequence alignment sharing domains that are pan-specific, partially specific, e.g., representing subfamilies within a superfamily of proteins, or completely specific, Le. representing a single member of the superfamily of proteins, e.g. G-proteins - An antibody raised against a synthetic peptide corresponding to domains A to E will have the specificity appropriate to that domain.

with a 43 kDa pea homologue of GPa L It should be noted that quite intensely cross-reacting components can be present, which are nonetheless artefactual. It is also important to realise that the use of preimmune serum does not represent an effective control with these immunochemicals. A second point arising in the use of antisera directed against synthetic peptides is a conceptual one that is well exemplified by antisera directed against the Gac sequence. Both in animal [10] and plant [24] systems, antisera against this epitope cross-reacts specifically with proteins outside of the usual molecular mass range for heterotrimeric Ga subunits. The assumption that these components, necessarily represent bona fide signalling G-protein should not be made, although it is likely that these pro­teins represent nucleotide binding proteins (and pos­sibly GTP-utilising proteins) since the epitope whose presence has been demonstrated is part of a highly conserved domain responsible for interacting with the a-phosphate of GTP [4].

Peptides as mimics of protein domains

When acting as synthetic antigens, the working assumption is that synthetic peptides mimic part of the protein which their sequence corresponds to. However, oligopeptides are capable of a more direct mimicry,

and in many cases can partake in interactions with proteins that the parent polypeptide would normally interact with. It is pertinent to the present commu­nication that good examples exist within the field of G-protein linked signalling and also signalling downstream of the auxin binding protein. A peptide corresponding to the receptor-interaction region of the Gas subunit was shown to be able to inhibit receptor mediated adenyl ate cyclase activity [17] pre­sumably by blocking ,B-adrenergic receptor: Gas inter­action. Conversely, a peptide corresponding to the effector-interaction region of transducin (Gat) was able to directly activate cGMP phosphodiesterase [20]. Similar observations have been made using peptides corresponding to cytoplasmic loops of G-protein coupled receptors [3, 12, 18] and these data are sum­marised in Table 1. It is true that the peptides used in these studies are likely to show little fixed confor­mation and most probably bring about their effects by induced-fit of peptide to target protein. The concen­tration (l0-6-10-4M) ofpeptide(s) to bring about the specific effects indicates a much higher apparent Kd for their targets than exhibited by the native molecule from whose sequence(s) they were derived and supports this contention.

219

Table 1. Peptides as mimics of protein-interaction domains in G-protein signalling systems. Synthetic peptides corresponding to domains of G-protein coupled receptors and the G-proteins (a-subunits) were shown to produce specific stimulatory (+) or inhibitory (-) effects on receptor: Ga coupling

System

,6 -adrenergic receptor

Catecholamine receptor

,6 -adrenergic receptor

Domain

3rd cytoplasmic loop

(C-terminal part)

3rd cytoplasmic loop

3rd cytoplasmic loop

(C-terminal part)

Effect

+

+

Reference

Cheung et al. 1991 [3]

Luttrell et al. 1993 [12]

Palm et al. 1989 [17]

Effector coupling domain

Receptor coupling domain

Receptor coupling domain

+ Rarick et al. 1992 [20]

Palmetal.1990[18]

Wise et al. 1994 [26]

1 Affinity isolation of a putative GPa I receptor.

Table 2. Peptides based around solvent exposed regions of maize auxin binding protein I (ZmABPI). (A), peptides corresponding to exposed regions excepting the C-terminus; (B), peptides based on the C-terminus of ZmABPI. The subscripted residues indicate the position of the peptides within the sequence of ZmABPI. Note that peptide A6.3 lacks the C-terminal KDEL motif whilst peptide A6.ln has the eight residues N-terminal to KDEL in an inverted configuration

Peptide Sequence

(A)

Al toRDLSQMPQSSYG21

A2 32GALNHGMKEVE42

A3 51 GQRTPIHRHSCE~3

A4 8oSLKYPGQPQEIPF92

AS to4DPHQVWNSDEHEDL117 (B)

A6.l 152DEDCFEAAKDEL163

A6.2 148 PFVWDEDCFEAAKDEL163

A6.3 148 PFVWDEDCFEAA 159

A6.ln 159 AAEFCDED152 KDEL 163

Peptides as probes of the auxin signalling pathway

It has been clear for some time, via the work of Venis and others [1, 15] that the initial point of percep­tion of auxins at the cell surface is mediated by the auxin binding protein (ABP). The major auxin bind­ing protein of maize, ZmABPI [8, 9] which is the most abundant source, is a small (22 kDa) glycopro­tein of which about 2 kDa is the glycan moiety. In addition, the key domain that bounds the binding site for auxin has been defined and it has been shown that binding of auxin brings about a conformational change

in the C-terminus of ZmABPI [16]. Binding of auxin to ZmABPl appeared to render the C-terminus cryptic to a monoclonal antibody directed against this region. (For further molecular details of the ZmABPI protein, see article by Venis & Napier, this volume). Secondary structural analysis ofZmABPI indicated thatthere is no hydrophobic region of sufficient length within it to span the membrane. This factor, plus considerable evidence that ZmABPI is present external to the cell has led to the suggestion [11] that some transmembrane dock­ing protein ("ABP-DP") must be present to convey the signal across the plasma membrane. In an effort to identify the surface feature of ZmABPl responsi­ble for binding to the ABP-DP, we prepared synthetic oligopeptides corresponding to all of the predicted solvent exposed regions of ZmABPI [13, 21]. The sequences of these peptides are summarised in Table 2A (plus A6.1 in 2B) whilst sequences of peptides based around the C-terminus of ZmABPI are shown in Table 2B.

Our initial studies with the ZmABPI peptides has shown that a peptide corresponding to the C-terminus of ZmABPl (peptide A6.I, PZl5l - 163) was able to bring about a rapid and reversible closure of the inward Ca2+ /pH dependent K+ channel in intact Vicia guard cells [21]. The same peptide led to a dramatic eleva­tion in cellular pH, and also Ca2+ [6]. In compari­son, peptides corresponding to N-terminal or internal regions of ZmABPI were ineffective in this system and all other assays so far. In subsequent studies we also found that peptide A6.1, and variant peptides based around the ZmABPI C-terminus, was able to stimulate GTP,S binding to Zea mesocotyl microsomal frac­tion membranes [13]. Interestingly, a peptide (A6.3)

220

Table3. Detection ofGa subunits and NDK within Zea microsomal membrane-associated proteins after size fractionation. Microsomal membranes were incubated at a concentration of 5 mg protein ml- I

in a medium containing 25 mM Tricine pH 7.6, 1 mM EDTA, 10 mM Mg(CH3COzh and 1 mM DTI (TEMD) plus 1 M NaCI, at 4°C for 45 min. After centrifugation at 200,000 x g for 30 min to sediment the membranes, the supernatant was concentrated by ultrafitration and 200 III samples chromatographedon a Superose 12 gel permeation column using TEMD as eluant. Proteins eluting in the size ranges> 70 kDa, 70-50 kDa and 50-30 kDa were collected separated by SDS-PAGE and transferred to PVDF membrane. The blots were probed with the antisera indicated. The intensity (+ to +++) and Mr of cross-reacting proteins are given

Antiserum Size fraction

specificity >70 kDa 70-50 kDa 50-30kDa

Gao

GPalARAz -

Gai

NDK

34+,35+,44+++ 34+++,35+++,44+

35+++ ,53+++ 35+ ,53+

28+

17++ 17++

which lacked the C-terminal KDEL sequence was effective in stimulatingGTP,S binding. Alternatively, peptide A6.ln, in which the KDEL motif is con­served but the preceding eight residues are inverted in sequence (Table 2B) was ineffective indicating that ABP:ABP-DP interaction is not solely dictated by the C-terminal -KDEL sequence.

More recent efforts have concentrated on identifi­cation .of the G-protein(s) responsible for transducing the events initiated by binding of A6-type peptides, and in vivo presumably by ZmABP1 itself. It is clear from earlier studies that microsomal fraction mem­branes and more highly resolved plasma membranes from plant cells can be shown to possess proteins that are at least immunologically related to heterotri­meric GO:' subunits. Some of these entities seem to be only loosely associated with the membrane and can be released by gentle treatments such as freeze thawing [2, 5] or washing with moderately high ionic strength media.

In our hands, we have found that treatment of Zea microsomal fraction membranes with 1.0 M NaCl, pH 7.5, released approximately 10% of the membrane associated protein. The solubilised proteins were sub­sequently concentrated and size fractionated via gel permeation chromatography. The fractions, which con­tained proteins of nominally 2: 70 kDa, 70 kDa to 50 kDa and 50 kDa to 30 kDa were assayed for GTP,S binding and the presence of GO:' subunit homologues (Table 3). The size-fractionated material was also

Table 4. Reconstitution of peptide A6.2 stimulated GTP,S binding by microsomal membrane-associated proteins. Size fractionated Zea microsomal proteins were prepared as described in legend to Table 3. GTP,S-binding was assayed as described in White et al. (1993b) using 5 Ilg washed micro­somal membranes (Wm), 30 IlM peptide A6.2 (P), 10 J.!g size fractionated proteins (Fr), 9.25 kBq [35 S)GTP,S and 10 nM unlabelled GTP,S. Data are the means ± standard error of trip­licate determinations and represent pmol GTP,S bound mg- I

protein

Size fraction

Conditions >70kDa 70-50kDa 50-30kDa

Wm 2.69 ± 0.08 2.69 ± 0.08 2.96 ± 0.08

Wm,P 3.79 ± 0.37 3.79 ± 0.37 3.79 ± 0.37

Wm,Fr 3.76± 0.37 7.31 ± 0.56 12.92 ± 0.67

Wm,P,Fr 4.83 ± 0.20 9.80± 0.21 17.63 ± 0.60

tested for its ability to reconstitute peptide-stimulated GTP,S binding to the washed membranes. It is clear from the data (Table 3) that the richest source of G sub­units, which were removed by NaCl-washing was the 50 kDa to 30 kDa size fraction [26]. In addition, this fraction gave the most profound stimulation of A6.2 peptide-mediated GTP,S binding. It should be noted that the soluble size-fractionated material alone bound GTP,S to a moderate extent in the absence of peptide. However, since the fractions contained both GO:' sub­units probably not involved in the auxin cascade and also NDK, this is hardly surprising.

Our data then, are consistent with the involvement of a G-protein in at least one auxin signalling pathway. We are unsure as to the exact GO:' subtype involved, but it is likely to be either GO:'o or a homologue of GPO:' 1 on the basis of immunological data. At present we are working to separate these sUbtypes and further confirm the G-protein involvement.

References

1. Barbier-Brygoo H, Ephritikine G, Kllimbt D, Maurel C, Palme K, Schell J and Guem J (1991) Perception of the auxin signal at the plasma membrane of tobacco mesophyll protoplasts. The Plant J 1: 83-93

2. Bilushi SV, Shebunin AG and Babakov AV (1991) Purification and subunit characterisation of a GTP binding protein from maize root plasma membranes. FEBS Lett. 291: 219-221

3. Cheung AH, Huang RRC, Graziano MP and Strader, CD (1991) Specific activation of Gs by synthetic pePtides corresponding to an intracellular loop of the beta-adrenergic­receptor. FEBS Lett 279: 277-280

4. Conklin BR and Bourne HR (1993) Structural elements of GO! subunits that interact with G{3-y, receptors and effectors. Cell 73:631-641

5. de Boer AH van Honnike E, Kortbout HAAJ, Sedd NJA and Wang M (1994) Affinity purification of GTPase proteins from oat root plasma membranes using biotiny lated GTP. FEBS Lett. 337:281-284

6. Fricker MD, White NS, Theil G, Millner P and Blatt MR (1994) Peptides derived from the auxin binding protein C-terminus elevate Ca2+ and pH in stomatal guard cells of Vicia faba: a confocal fluorescence ratio imaging study. SEB Symposium 48:215-228

7. Goldsmith P, Gierschik K, Milligan G, Unson CG, Vinitsky R, Malek HL and Speigel AM (1987) Antibodies directed towards synthetic peptides distinguish between GTP-binding proteins in neutrophil and brain. J Bioi Chern 262: 14683-14688

8. Hesse T, Feldwisch J, Balschuseman D, Bauw G, Puype M, Vandekerkhove J, LObler M, KHimbt D, Schell J and Palme K (1989) Molecular cloning and structural analysis of a gene from Zea mays(L.) coding for a putative receptor for the plant hormone auxin. EMBO J 8: 2453-2461

9. InoharaN, Shimomura S, Fukui T and Futai M (1989) Auxin binding protein located in the endoplasmic reticulum of maize shoots: Molecular cloning and complete primary sequence. Proc Nat! Acad Sci USA 86: 3564-3568

10. Jo H, Radding W, Anantharamaiah GM and McDonald JM (1993) An insulin receptor peptide (1135-1156) stimulates guanosine 5'-[-y-thio 1 triphosphate binding to the 67 kDa G­protein associated with the insulin receptor. Biochem J 294: 19-24

II. KHimbt D (1991) A view about the function of auxin binding proteins at plasma membranes. PI Mol Bioi 6: 1045-1053

12. Luttrell LM, Ostrowski J, Cotecchia S, Kendall H and Lefkowitz RJ (1993) Antagonism of catecholamine receptor signalling by expression of cytoplasmic domains of the recep­tors. Science 259: 1453-1457

13. Millner PA, White IR, Groarke DA, Theil G and Blatt MR (1994) Novel strategies towards an auxin evoked transport control. SEB Symposium 48: 203-213

14. Mumby SM, Kahn RA, Manning DR and Gilman AG (1986) Antisera of designed specificity for subunits of guanine nucleotide-binding regulatory proteins. Proc N atl Acad Sci USA 83: 265-269

221

15. Napier RM and Venis MA (1991 a). From auxin binding protein to plant hormone receptor. Trends in Biochem Sci 16: 72-75

16. Napier RM and Venis MA (199Ib). Monoclonal antibodies detect an auxin induced conformational change in the maize auxin binding protein. Planta 182: 313-318.

17. Palm D, Munch G, Dees, C and Hekman, M (1989) Mapping of {3-adrenoceptorcoupling domains to Gs-protein by site specific synthetic peptides. FEBS Lett 254: 89-93

18. Palm, D, Munch, G, Malek, D, Dees, C and Hekman, M (1990) Identification of a Gs-protein coupling domain to the {3 -adrenoceptor using site specific synthetic peptides. FEBS Lett 261: 294-298

19. Pinna LA, Meggio F, Marchiori F and Borin G (1984) Opposite and mutually incompatible structural requirements of type-2 casein kinase and cAMP-dependent protein kinase as visu­alised with synthetic peptide substrates. FEBS Lett 171: 211-214

20. Rarick, HM, Artemeyev, NO and Hamm, HE (1992) A site on rod G-protein O! subunit that mediates effector activation. Science 256: 1031-1033

21. Thiel G, Blatt MR, Fricker MD, White IR and Millner PA (1993) Modulation of K+ channels in Vicia stomatal guard­cells by peptide homologues to the auxin-binding protein-C terminus. Proc Nat Acad Sci USA 90: 11493-11497

22. White IR, O'Donnell PJ, Keen IN, Findlay JBC and Millner PA (1990) Investigation of the substrate specificity ofthylakoid protein kinase using synthetic peptides. FEBS Lett 269: 49-52

23. White IR, Wise A, Finan PM, Clarkson J and Millner PA (1992) GTP- Binding Proteins in Higher Plant Cells. In: Cooke DT and Clarkson DT (eds) Transport and Receptor Proteins of Plant Membranes, pp 185-192. New York: Plenum Press

24. White IR, Zamri I, Wise A and Millner PA (1993a) Use of synthetic peptides to study G-proteins and protein kinases in higher plant cells. SEB Seminar Series 53: 91-108

25. White IR, Finan, PM and Millner PA (1993b) Nucleoside diphosphate kinase associated with Pisum sativum microsomal membranes: apparent binding ofGTP-yS at nM concentrations. J Plant Physiol 142: 191-196

26. Wise A, Thomas po, White IR and Millner PA (1994) Isolation of a putative receptor from Zea mays microsomal membranes that interacts with the G-protein GPO! I. FEBS Lett 356: 233-237

A. R. Smith et al. (eds.). Plant Hormone SigTUll Perception and Transduction. 223-231. © 1996 Kluwer Academic Publishers.

223

Mechanism of auxin action: second messengers

V.V. Polevoi, N.P. Sinyutina, T.S. Salamatova, N.!. Inge-Vechtomova, O.v. Tankelyun, E.!. Sharova & M.P. Shishova Department of Plant Physiology and Biochemistry. Biology Faculty. St. Petersburg State University, St. Petersburg, 199034, Russia

Key words: bioelectric potential, Ca2+ , H+ , H+ -ATPase, indoleacetic acid, phosphoinositides, protein kinase, Zea mays

Abstract

The study was conducted on maize coleoptile segments from 4-d-old etiolated seedlings. Auxin action was observed by changes in the potential difference between the IAA-treated apical end and the basal end of20-mm coleoptile seg­ments. It was shown that the bioelectric potential (BEP) changes measured with extracellular electrodes completely coincided with membrane potential (MP) changes in epidermal cells (intracellular measurements). Treatment with IAA or its methyl ester (0.1-10 mg 1-1) resulted in the BEP becoming negative (depolarization of MP) and was replaced in 5-10 min by an electropositive wave of BEP (hyperpolarization of MP) with an amplitude of 15-20 m V and a duration of 40-50 min. Since IAA action on coleoptile cells in the first 2-5 min was accompanied by a decrease in Ca2+ in the incubation medium and the Ca2+ -channel blockers veraparnil (0.1 mM) and nifedipine (0.01 and 0.1 mM) decreased the primary negative amplitude, we concluded that the entrance of Ca2+ ions into the cell was one of the primary responses to auxin. It was supposed that the temporary electronegative BEP (MP depolarization) might be caused by a Ca2+ -induced decrease in plasma membrane H+ -ATPase activity. IAA could directly open Ca2+ -channels in the plasma membrane and/or act through the phosphoinositide cycle. In in vitro experiments with microsomal fractions, IAA was shown to decrease the [33p] radioactivity level in phosphatidyli­nositol 4,5-bisphosphate and phosphatidylinositoI4-phosphate, but to increase incorporation in a water-methanol fraction containing inositol polyphosphates. In experiments with microsomes, IAA also increased Ca2+ -dependent protein kinase activity. The auxin-dependent electropositive response of the BEP (hyperpolarization of MP) was related to plasma membrane H+ -pump activation and was eliminated by the protonophore 2,4-DNP. It was shown that the auxin-dependent H+ -pump was of ATPase nature because the IAA effect was abolished by the inhibitors of ATPases - vanadate and DES. We propose that the activity increased due to a rise in H+ ions concentration in the cytosol (specifically, in exchange of Ca2+ ions through the tonoplast) and IAA activation of protein synthesis. Changes in protein kinase activity, phosphorylation and dephosphorylation of cytoplasmic proteins were detected after a 10-min treatment of the coleoptile segments with IAA. Some protein fractions added to the incubation medium increased the effect of IAA on growth and BEP.

Introduction

Auxin perception by specific sites on the plasma mem­brane and in the cytoplasm induces a cascade response in which messengers such as Ca2+ and H+ ions, inositol phosphates, diacylglycerol, lisoforms of phos­pholipids and some other substances, capable of diffu­sion and short-term action may provide mechanisms

of hormone signal transduction [4]. In the 1960s, the possibility of such a role for Ca2+ and H+ ions in the mode of action ofIAA was indicated [6,8]. Atthe same time, an electrophysiological method was worked out which made it possible to follow the response of plant cells to exogenous auxin [10]. At present, in addition to studies on the role of H+ ions in the mechanisms of lAA action, special attention is devoted to the possi-

224

ble participation of Ca2+ ions in honnone regulation of plant cells [2, 'l]. In the work introduced here, the role of these agents in auxin-dependent electrogenesis in plant cells is investigated.

Materials and methods

Plant material

Experiments were carried out with 4-d-old etiolated maize seedlings (Zea mays L., cvs. Odesskaya 80 and Moldavskaya 215) grown at 26 °C. Coleoptile seg­ments 20 mm in length were cut 4 mm below the tip.

BEP and MP measurement

Segments to be used in electrophysiological experi­ments were preincubated in 1 mM CaCh for 2 h and then washed with distilled water. Silver chloride elec­trodes with glass pipettes (1 mm in diameter at the tip) filled with 2% agar and 0.1 M KCI and a direct-current amplifier with input resistance of 1011 Ohm were used for the measurement of BEP. Coleoptile segments were placed horizontally into the plexiglass chamber. Lanolin with a drop of vaseline oil was inserted inside the coleoptile segment and two bands of lanolin were put on the coleoptile 5 mm from the coleoptile segment ends.

The ends were placed in the chamber cells with 0.5 ml of incubation medium supplied with all the neces­sary components. Distilled water was used as a basal medium. The measuring electrode was in contact with the solution around the apical end of the segment and the reference electrode was put in the other chamber cell with the basal coleoptile end [7, 10]. When BEP stabilization was achieved, distilled water was added to the basal end and IAA or the methyl ester of IAA (MEIAA) at concentrations of 1-10 mg 1-1 was added to the apical end. BEP was usually measured on the second min and then every 5 or 10 min over 1 h at 23-25 °C without any change of medium. Four seg­ments were used in each treatment. All experiments were perfonned 3-5 times.

Membrane potential was registered using the stan­dard microelectrode technique.

'B ,,: ., ..

'B

~

5

0

-1

-1 5

-20

-25

o 10 20 50

-1 40

- 150

-150

-170 o 10 20 ;0 40 50 60

Time , min

Fig. 1. Simultaneous and continuous registration ofMEIAA (10 mg I-I) action on bioelectric potential (BEP, A) and membrane potential (MP, B). BEP of the maize coleoptile apical end was measured with extracellular electrodes. MP of epidermal cell in the apical coleoptile segment end was measured with standard microelectrode technique. Distilled water was the incubation medium.

I solation of microsomal fractions

Total microsomal fractions were isolated from 10-mm coleoptile segments. Plant material was homog­enized in a solution containing 50 mM Tris-HCI (pH 7.8), 0.5 M sucrose, 5 mM EDTA and 10 mM 2-mercaptoethanol. The homogenate was filtered through three layers of nylon cloth and the filtrate was centrifuged at 16 000 x g for 15 min. The total micro­somal fraction was precipitated from the supernatant at 92 000 x g for 1 h. The pellet was resuspended in a medium containing 10 mM Tris-HCl (pH 7.5) and 0.25 M sucrose [14].

Phosphoinositide metabolites

Microsomes (120 mg protein in a volume of 100 ml) were incubated in vitro for 10 min with auxin (20 mM) in medium consisting of 100 mM N a2ATP, 10 mM GTP, 10 mMMgS04 , 25 mMLiCl inHEPES-KOH (pH 7.5) and 0.25 M sucrose. [,_33p]ATP was introduced into

225

B

-15

o 20 40 60 o 20 40 60

Time, min

Fig. 2. Effect of CaH -channel blockers on the lAA-induced bioelectric response of maize coleoptile segments. Apical end of coleoptile segment was pre incubated for I hour in a solution of: A - verapamil (0.1 mM) and B - nifedipine (0.0 I and 0.1 mM). The arrow indicates the beginning of IAA (2 mg 1-1) treatment. IAA was dissolved in distilled water. (. ) - verapamil (0.1 mM). (0) - nifedipine (0.0 I mM). (_) -nifedipine (0.01 mM). (0) - control. Bars indicate standard errors.

the medium for the last 30 s of incubation [16]. The reaction was stopped by the addition of a cold solu­tion of chloroform: methanol: 10 N HCl (300:200: 1.5 v/v/v) [5]. Acidic lipids were extracted twice with the acidic chloroform:methanol solution and separated into phases by centrifugation after an addition of 0.5 ml chloroform and 0.5 ml water. The chloroform phase containing lipids was evaporated under vacuum and redissolved in a small volume of chloroform: methanol (2: 1). The lipids were separated by lLC on silica gel plates impregnated with potassium oxalate. The solvent system was chloroform: acetone: methanol: acetic acid:water (40:15:13:12:8). 1LC plates were

autoradiographied on X-ray film. We also defined the radioactivity of phosphoinositide fractions and the water-methanol phase in a Beckman LS-100C scintil­lation counter.

Protein kinase assay

Membrane preparations (total microsomal fraction from maize coleoptile cells) were preincubated with 1 mM IAA or 1 mM 2,4,5-trichlorophenoxy isobu­tyric acid (CPIBA) for 10 min. The protein kinase activity was then assayed in the reaction mixture con­taining 25 mM Tris-HCI (pH 8.0), 10 mM MgCh, 10

226

150.---------------------------_

100-------.:=...-- ~---c! r-~ .p g () r-

Fig. 3. Effect of auxin (% of control) on 33p incorporation into phosphoinositides and their metabolites in maize coleop­tile microsomal fractions. Microsomes were incubated with lAA (20 mM) for 10 min and b-33Pl ATP for the last 30 s of the incubation I - phosphatidylinositol 4.S-diphosphate (PIP2). 2 -phosphatidylinositol4 - monophosphate (PIP). 3 - phosphatidyli­nositol (PI). 4 - water-methanol fraction (inositol tris-phosphate. inositol bis-phosphate. etc.)

roM NaF, 0.2 roM EGTA, 0.5 roM calcium acetate, [,_33p]ATP (4.5 mCi ml- I, 1.6-3.0 x 106 Ci mol-I) and the microsomal fraction (l00 mg ml- I protein) at 30 ° C. At defined time periods, a portion of the mixture (50 J.tl) was sampled, fixed in 10% trichloroacetic acid with 2% K4P207 on Whatman squares, washed and counted in a Beckman scintillation counter. We also carried out analysis of protein kinase activity in gels after electrophoresis of soluble proteins under nonde­naturing conditions (7.5% alkaline PAGE). The gels were washed twice with ice-cold 50 roM Tris-HCI (pH 7.5) and preincubated with histone (total fraction, 300 J.tg ml- I) for 30 min. After removing the histone, the gels were placed in solution containing 50 roM Tris­HCI (pH7.5), 10 roM MgS04, 0.2 roM EGTA, 0.5 roM calcium acetate and [,_33p]ATP (1.5 mCi ml- I, 1.6-3.0 x 106 Ci mol-I) and incubated for 30 min at 30 0c. After washing, gels were cut into sections and proteins were eluted with a solution of 0.1 N NaOH with 1 % SDS and radioactivity counted.

Phosphorylation of soluble proteins

Coleoptile segments were homogenized in 20 roM Tri s­glycine buffer, pH 8.3 (1 gml- I). The homogenate was centrifuged at 6000 x g for 20 min. The reaction mix­ture, in a total volume of 60 J.tl, consisted of 10 roM

'i ~

.: .... II .., 0 I-< Po

lI' '-' a

Po

" .; 0 .... ., '" I-< 0 ll-l-< 0

" .: ....

'" t<\

'"

>C1 0-3

400

300

200

...... / ...

I~ • •

I V'

,.-

........ ,.­

.......-.......­

.......-.......­

........

0L-~~--~-±2--~-=3--~~4~~~5~~~

TilDe . min

Fig. 4. Effect of IAA and 2.4.S-trichlorophenoxy isobutyric acid (TCPIBA) on the time course of protein kinase reactions of micro­somal fractions from maize coleoptile cells. Microsomal fraction was preincubated with I mM IAA (_). or I rnM TCPIBA (e) or without them (+) for 10 min and protein kinase reaction was conducted in the presence of calcium without exogenous substrate at 30 0c.

NaF, 10 roM MgCh, 10% sucrose, 16 mCi £T-33p]ATP (1.6-3.0 x 106 Ci mol-I) and 100-120 J.tg of soluble protein. After 10-min incubation at 30 ° C, the reaction was stopped by addition of 20 J.tl of cold buffer with 40% sucrose (-5 °C) and proteins were immediately submitted to electrophoretic fractionation in 7.5% PAGE, pH 8.9. Protein fractions from Coomassie­stained gels were eluted with a solution containing 1 % SDS and 0.1 N NaOH. Radioactivity was measured in a Beckman LS-100 C scintillation counter [13].

Results and discussion

IAA and its methyl ester (0.1-10 mg I-I) in the first 1-10 min induced an electronegative response in the apical end of auxin-treated coleoptile segments, after which an electropositive wave with a maximum at 25-35 min and an amplitude of 15-20 mV occurred (Fig. 1). Using extra- and intracellular electrodes on the same coleoptile segments, we observed that the electronegative phase completely coincided with mem­brane potential (MP) depolarization of auxin-treated cells and the electropositive phase coincided with MP hyperpolarization [7]. The investigation of the

227

20 A

10

0

-10

-20

I> 20 B a

~ 10 Il)

0 •.. ., ......... . .' ...... ..•. -.... .. ' -10

- 20

-?o

0 40 60 80 140 160 180 200 Time, min

Fig. 5. Effect of 0.05 mM diethylstilbestrol (A) and I mM orthovanadate (B) on the auxin-dependent bioelectric potential of maize coleoptile segments. IAA (I mg I-I) was added 40 min later than DES and 2 h later than salt. DES was desolved in IN NaOH and then diluted to pH 9.0. control for DES action - diluted solution of NaOH. pH 9.0. In experiments with orthovanadate: the initial pH of all solutions was adjusted to pH 6.5 with HC!. IAA-dependent biopotential is presented as the difference between IAA-induced and control values. Bars indicate standard errors. (.) - with DES (A) or orthovanadate (B). (0 ) - control (A) or I mM Na3P04 (B). 0) - with 3 mM NaCI (B). (- - -) - water. DES. orthovanadate. Na3P04 or NaCI were added at the time indicated by the first arrow; IAA was added at the time pointed with the second arrow.

primary BEP electronegative phase (MP depolariza­tion) by extracellular electrodes showed that in the first 3 mip Ca2+ entered the cells from the incubation medium (1 mMCaCh 0.1 mMKC1) in the IAA-treated segment end and K+ ions were excreted out of the cells. Short-term peaks of CaH influx and K+ excretion reached a maximum on the 5th min and then dimin­ished rapidly. The flux of Cl- ions did not change for 2 min and then increased Cl- excretion out of the cells was observed for 60 min (data are not presented).

One-hour preincubation of the apical end of the coleoptile segments with the CaH -channel blockers, nifedipine and verapamil, led to decreases in the auxin­induced negative amplitude (Fig. 2). Verapamil (0.1 mM) decreased the primary negative response by 30%

in comparison with controls and nifedipine (0.1 mM) inhibited by 50%. It should be pointed out that these blockers of CaH -channels also affected the IAA­induced electropositive wave. The decrease in ampli­tude was about 40-43% for verapamil (0.1 rnM) and nifedipine (0.01 mM) while nifedipine at a concentra­tion of 0.1 mM resulted in a decrease of 64%.

We concluded that the primary electronegative response of tissues (MP depolarisation) was closely related to CaH influx but not to fluxes in Cl- ions. Therefore we can propose that the auxin-induced pri­mary depolarization occurred due to other processes. The entering CaH ions probably activated a CaH -

dependent protein kinase which upon phosphorylat­ing a plasma membrane H+ -ATPase decreased its

228

1 0~------------------~------------'

>s 0

Po."

"" '" ~----10

~0~---L--0~~--2~0---L--4~0--~~~-0~~-8~0

Time , min

Fig. 6. Effect of cycloheximide (CHI, IO mg 1-1) on the auxin­dependent bioelectric potential of the maize coleoptile segment apical end (MEIAA, 10 mg 1-1). The arrow (0 min) indicates the time of MEIAA (0) or MEIAA + cycloheximide (.) application to the apical end of the coleoptile segment. At 0 min the distilled water or cycloheximide, respectively, was added to basal segment end. BEP was measured at 20-mm coleoptile segments with extracellular electrodes. The measuring electrode was at the segment apical end and the reference electrode was at the basal end. Bars indicate stan­dard errors.

activity and, therefore, influenced the MP. Zocchi also pointed out this possibility [17]. It is possible that Ca2+ entering the cell contributes to the opening of Ca2+ -dependent K+ -channels, temporally stopping cytoplasm streaming and vesicle secretion activities and perhaps inducing other cellular changes.

Thus, data obtained indicate that IAA causes Ca2+ -channel opening in plasma membranes. There are two alternatives: (i) an auxin receptor directly binds to Ca2+ -channel proteins and (ii) IAA affects Ca2+­channels due to other reactions.

In in vitro experiments with microsomal frac­tions isolated from maize coleoptile segments, the auxin effect on b_33p]ATP incorporation into phos­phoiondsitides and their metabolites was studied. It was shown that during incubation with IAA at a con­centration of 20 roM for 30 s of phosphorylation, the radioactivity in phosphatidylinositol-bisphosphate halved. The effect of auxin on labelled phosphate incorporation was less than in other phosphoinosi­tide fractions, identified as phosphoinositolphosphate and the radioactivity was 65% in comparison with the control. In contrast, radioactivity increased by 37% in the water-methanol fraction which contained free inositolphosphates (Fig. 3). These results agree well with that ofZbell [16] who showed using carrot tissue culture the possibility of the participation of phos-

phoinositides and inositol phosphates in IAA signal transduction [13]. It is well-known that inositol triphosphate (IP3) releases Ca2+ ions out of intra­cellular compartments. Ca2+ also activates C-type protein kinases in plasma membranes which can phos­phorylate ion channels.

In our in vitro experiments with microsomal frac­tions, we showed that IAA in the first minute activated protein kinase activity by 10-25% in the presence of Ca2+ (Fig. 4). The inactive IAA analogue 2,4,5-triclorophenoxy isobutyric acid did not have such an effect. The cascade increase in the Ca2+ concentra­tion in the cytoplasm might be the result of all these processes.

Electropositive phase of BEP

The electronegative phase affected the IAA was followed by a BEP electropositive response (hyper­polarization of MP) as was mentioned above. The electropositive phase occurred due to changes in H+ -pump activity in the plasma membrane. The activa­tion of H+ extrusion under auxin treatment and the elimination of the BEP electropositive wave in the presence of 2,4-DNP stressed this fact [9]. According to inhibitor analysis, a proposal was put forward that auxin activates H+ -pump functions on the basis of a redox-system of the plasma membrane as in mitochon­dria [8]. However, it has been shown that IAA did not significantly increase ferricyanide reductase activity in coleoptile segments during an 80-min incubation [11]. However, activation was observed later [11]. Never­theless, coleoptile segment treatment with inhibitors of transport ATPases (orthovanadate, diethylstilbestrol) had a strong effect of the BEP induced by IAA [9]. The amplitude of the IAA-dependent electropositive response was decreased by 60% in coleoptile seg­ments preincubated for 2 h in 1 roM orthovanadate as compared to the orthophosphate control. Diethylstilbe­strol added 40 min prior to IAA application decreased BEP positivation by 55-60% (Fig. 5). Therefore it may be considered that the IAA-dependent BEP posi­tive response was induced by an enhanced activity of the outward-directed ATPase H+ -pump in the plasma membrane.

In our experiments with plasma membrane frac­tions, IAAdidnotdirectly affect the H+ -ATPase activ­ity which agrees with the findings of other researchers [15]. In addition, the IAA effect on acidification of the incubation medium for coleoptile segments and on the BEP electropositive response (Fig. 6) was rapidly

229

I II

4-00 1

e 2 P. C) 3 1'1 ~oo 0

.r< 4-b ~

~ I-< 0

200 e' 0 C)

1'1 .r<

Il. 100 1<'\ 1<'\

Fraction Number Fig. 7. Alteration of protein kinase activity associated with electrophoretic fractions of soluble proteins after IAA (5 mg I-I) treatment of maize coleoptile segments (I). Polyacrylamide gels after electrophoresis of soluble proteins were incubated with histone and b-33 P1ATP in the presence of calcium at 30°C for 30 min. The protein fractions were eluted from the sections and gels and 33p incorporation was counted: a­without IAA; b and c - incubation with IAA for 10 and 40 min, respectively. Coomassie-stained soluble proteins of maize coleoptiles in 7.5% nondenaturing PAGE. Bars indicate standard errors.

600r--------------------------------------------,

480

s P-C)

360 1'1 0 ..... +' ell r.. 240 0 p. I-< 0 C)

1:1 .r<

Il. 1 20

'" I<'

o

1 2

Fracti on Number

Fig. 8. Phosphorylation of the soluble proteins in the crude extract after IAA (5 mg I-I) treatment of maize coleoptile segments. Segments were homogenized in 20 roM Tris-glycine buffer, pH 8.3. The homogenate was centrifuged at 6000 x g for 20 min. The reaction mixture, in a total volume of 60 ml, consisted of 10 roM NaF, 10 roM MgCIz, 10% sucrose, 16 mCi b-33P1ATP (1.6-3.0 x 106 Ci mol-I) and 100-120 J.Lg of soluble protein. Samples were electrophoresed in 7.5% PAGE, pH 8.9. Radioactivity of protein fractions eluted from gels was counted in a liquid scintillation counter: a - without IAA; b and c - incubation with IAA for 10 and 40 min, respectively. 1-7 - numbers of fractions (as shown in Fig. 7). Bars indicate standard errors.

230

PM R 1---==::::---_ ~

RNA

Fig. 9. Hypothetical scheme for the mechanism of auxin action. DG - diacylglycerol, G - G-proteins, IP3 - inositol I ,4,5-trisphosphate, P1P2 - phosphatidylinositol, 4,5-bisphosphate, PK - protein kinase, PLC - phospholipase C, PM - plasma membrane, R - receptor, AG - Golgi body, ER - endoplasmic reticulum.

and stropgly inhibited by cycloheximide, an inhibitor of protein synthesis [1, 7]. Taking into account previ­ous data, we propose that enhancing the H+ -ATPase system in plasma membranes is brought about by the following mechanism: In the cytoplasm, Ca2+ levels decrease by exchange ofH+ ions through the tonoplast. The decrease in Ca2+ and the pH shift in the cytosol in the acid direction activate the H+ -ATPase. This activation is as a result of Ca2+ -dependent secretion activation arid continues due to the auxin-dependent activation of protein synthesis and short-lived proteins [12]. According to the literature, H+ -ATPase can be ranked among the short-lived proteins with a half-life

of about 12 min [3]. The intensity of protein synthesis is perhaps regulated by protein kinases. We showed that during the first 10 min after IAA addition to the coleoptile segments, the activity of a number of Ca2+ -dependent protein kinases increased as presented in Fig. 7, especially in protein sample 5. Phosphory­lation of proteins with Rm of 0.25-0.42 (fraction 4) halved (Fig. 8) and phosphorylation of proteins with Rm 0.42-0.55 (fraction 5) increased 1.5 fold after 15 min of coleoptile incubation with IAA. After 50 min of incubation, the inhibitory effect ofIAA was reduced to 36% and the stimulatory effect disappeared [13].

According to, all the above-presented data, we can propose two versions of the mechanism of action of IAA with participation of Ca2+ and H+ ions as second messengers (Fig. 9): (i) IAA directly activates Ca2+ -channels in the

plasma membrane. Increases in Ca2+ levels in the cytoplasm activate vesicle secretion but inhibit, for a short period of time, H+ -ATPase activity. Decreases in H+ -ATPase activity and Ca2+ exchange with vacuolar H+ ions through the tono­plast lead to the acidification of the intracellular medium which causes H+ -ATPase activation. Increases in protein synthesis and short-lived H+­ATPase in particular are necessary conditions for IAA action on the BEP and cell growth.

(ii) IAA activates phospholipase C and the phospho­inositide cycle. Inositolphosphate induces Ca2+ release out of the vacuole. Diacylglycerol and Ca2+ activate C-type protein kinase which proba­bly causes the Ca2+ -channel opening in the plasma membrane. The increase in Ca2+ concentration in the cytoplasm takes place. Ca2+ and H+ ions act later according to the previous scheme.

References

L Bumagina KN and Polevoi VV (1984) Comparative investi­gation of auxin and fusicoccin effects on H+ ions secretion, biopotential and growth of maize coleoptile sections, Vestnik of Leningrad Univ, Ser Biology 3: 73-80

2, Felle HH, Ruck A and Peters WS (1992) The role of cytosolic calcium, pH and auxin-induced electrical responses for elon­gation growth of maize, In: Karssen CM, van Loon LC and Vreugdenhil D, (eds) Progress in Plant Growth Regulation, pp 663-667, Kluwer Academic Publishers, The Hague

3, Hager A, DebusG, Edel H-G, Stransky H and Serrano R (1991) Auxin induces exocytosis and the rapid synthesis of a high­turnover pool of plasma-membrane H+ -ATPase, Planta 185: 527-537

4, Robelts J, Kirk C and Venis M, eds (1990) Hormone Perception and Signal Transduction in Animals and Plants, Cambridge Comp Bioi Ltd, Cambridge

231

5, Litosch J, Calista C, Wallis C and Faine JW (1986) 5-Methyltryptamine decrease net accumulation of 33p into the polyphosphoinositides from b-33 P1ATP in cell-free system from blowfly salivary glands, J Bioi Chern 261: 638-649

6, Polevoi VV (1967) The Physiology and Biochemistry of Auxin and Gibberellin Action. Bioi Sci Doc Thesis, Leningrad State University, Leningrad

7, Polevoi VV (1986) The Role of Auxin in Plant Regulation Systems, Nauka, Leningrad

8, Polevoi VV and Salamatova TS (1977) Auxin, proton pump and cell trophics, In: Marre E and Ciferri 0 (eds) Regulation of Cell Membrane Activities in Plants, pp 209-216, Elsevier, Amsterdam

9, Polevoi VV, SharovaEI and Tankelyun OV (1989) On the role of H+ -pump in indoleacetic acid action on biopotential and growth of maize coleoptile sections, Soviet Plant Physiol 36: 998-1002

10, Polevoi VV, Osharova LM, Leonova LA, Maksimov GB and Poberezhny BA (1969) Bioelectric response of maize coleop­tile segments to unilateral auxin treatment, Soviet Plant Physiol 16:854-860

1 L Salamatova TS, Storozhenko NYu and Polevoi VV (1988) Potassium ferricyanide reduction and H+ ion excretion in maize coleoptile segments, In: Anisimov AA (ed) Regula­tion of Plant Enzyme Activities, pp 65-70, Gorkii Univ Press, Gorkii

12. Sharova EI and Polevoi VV (1990) Auxin-dependentsynthesis of short-living proteins in sections of maize coleoptiles, Fiziologia i Biokhimya Kul'turnykh Rastenii 22: 234-239

13, Sharova EI and Polevoi VV (1993) Auxin-dependent changes in protein phosphorylation in maize coleoptile segments, Vestnik of St. Petersburg Univ, Ser Biology 2: 82-85

14, Tankelyun OV (1987) Properties of membrane ATPases of the maize coleoptile cells, Vestnik of Leningrad Univ, Ser Biology I: 68-76

15, Tankelyun OV and Polevoi VV (1989) Fusicoccin action on ATPase activity of plasma membrane fraction isolated from maize coleoptiles, Vestnik of Leningrad Univ, Ser Biology 4: 67-71

16, Zbell B and Walter-Back C (1988) Signal transduction of auxin on isolated plant cell membranes: indication for a rapid polyphosphoinositide response stimulated by indole acetic acid, J Plant Physiol133: 353-360

17, Zocchi G (1985) Phosphorylation-dephosphorylation of mem­brane proteins controls the microsomal H+ -ATPase activity of corn roots, Plant Sci 40: 154-159

A. R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 233-238. © 1996 Kluwer Academic Publishers.

233

A single cell model system to study hormone signal transduction

D. Stickens, W. Tao & J.-P. Verbelen University of Antwerp VIA, Department of Biology, Universiteitsplein 1, B2610, Wilrijk, Belgium

Key words: cell culture, auxins, cytokinins, confocal laser scanning microscope, protoplasts

Abstract

The model system presented here is based on immobilised single cells, derived directly from tobacco mesophyll protoplasts. It allows the adequate steering of cell populations towards expansion, cell cycling or cell resting. Using this approach cells always have the same predictable response to auxins and cytokinins whatever their actual physiological status. This model system opens new ways to study cellular parameters governing these hormone responses, some of which have been explored so far; a) the cytokinin response can equally well be induced by endogenous as by exogenous cytokinins; b) at least two intracellular components, microtubuli and the ER, adapt their architecture to the hormone-induced status of the cell; c) additionofNAA to the cells does not induce a change in the cytoplasmic pH.

Introduction

Plant hormones are mediators of crucial importance during the whole developmental history of plants [1]. Unravelling the basic mechanisms of hormone action is however a difficult task since no single and unique function is known for any given hormone system. [8]. Simple model systems have helped to increase our knowledge about the role of plant hormones in growth and development. Experiments with excised stem or coleoptile segments showed very elegantly that auxins mediate cell expansion [6]. But even models of this kind contain many cell types which make it difficult to relate hormone treatments unambiguously to a single well-defined cell response.

For many years scientists have recognised the enor­mous potentials of individual cells in culture for cyto­logical studies of growth and differentiation [5], and the advantages offered by mesophyll protoplasts of tobacco as starting material for cultures [7].

In everyday practice, cells are cultured either suspended in a liquid medium or immobilised in a solidified medium. The latter method has two main advantages; regeneration is enhanced in the semi-solid environment [10] and secondly individual cells can be identified and followed during experiments. The

main disadvantage of the method is that the semi-solid medium hampers synchronous and homogeneous treat­ment of the cell with hormones. However this can be circumvented by immobilising the cells on the surface of a carrier. Experiments with protoplasts immobilised in a thin layer of agarose on a glass surface have proven the usefulness of this approach [12].

The model system presented here is based on the immobilisation of individual cells on the surface of a normal cell culture medium which offers optimal accessibility for treatment and observation of the cells. Cultures can be sustained for many weeks and cell development can be induced and controlled by means of simple and very well defined hormone treatments. The first quantitative results on cell morphogenesis have been published in preliminary report [14]. Here we want to stress the potential of the system for further basic research of hormone responses at the level of the individual cell.

Materials and methods

Plants of Nicotiana tabacum L. cv. Petite Havana were grown in sterile culture on a Murashige and Skoog medium without hormones (4.7 gil, Flow Laborato-

234

ries), supplemented with 10 gil sucrose and solidified with 8 gil agar, pH 5.7. Only healthy leaves were used in the experiments.

Protoplasts were isolated from the leaves essen­tially following the method of Potrykus and Shillito [9], using 2% cellulase Onozuka RIO and 0.2% macerozyme RIO (Yakult Honsha Co, Ltd.) After a 1.5 min vacuum infiltration, leaves were incubated for 90 min at 26°C. Living protoplasts were isolated from cell debris by filtration and centrifugation (60 x g). The purified protoplasts were immobilised at the surface of an agarose layer (K3A culture medium [9] solidified with 1.2% agarose Sea Plaque FMC) in disposable Petri dishes, and covered with liquid K3A medium. Four different culture conditions were used: the com­plete K3A rr,edium [9] with 1 mg/1 NAA (Naphtale­neacetic acid) + 1 mgll BAP (6-Benzaminopurine), a medium with only NAA, a medium with only BAP and a medium without hormones. They were kept in cul­ture at 22°C in a 16 h photoperiod at a light intensity of 2000 lux (Philips tlm 65W/33).

Cell development was followed using a Nikon TMD inverted microscope equipped for epifluores­cence. All observations were done on cultures with a density of about 100 cells per mm2 •

Acridine orange (BDH Chemicals Ltd), (C) FDA (Carboxy) fluoresceine diacetate (Serva), and calco­fluor white (Fluorescent brightner 28, Sigma) were used as standard fluorochromic stains for nuclei, cell viability and cell wall cellulose, respectively. For detailed study of the shape of the cells and the struc­ture of the cytoskeleton and the ER and for measuring the cytoplasmic pH, a CLSM Confocal Laser Scanning Microscope-BioRad-MRC 600 was used.

ER (endoplasmic reticulum) staining was achieved using the probe DiOC6(3) as described in [11]. For microtubule immunolocalization cells were fixed in 4% paraformaldehyde in Microtubule Stabilizing Buffer (50 mM Pipes, 5 mM EGTA, 5 mM MgS04)

and treated with a detergent (1 % Triton - X100). The indirect immunostaining used monoclonal anti-tubulin antibodies (MAS078c, Sera Lab) and FITC-goat anti­rat IgGs (Sigma). Cytoplasmic pH was measured using the dual emission probe SNARF-l supplied to the cells in the membrane permeable AM-ester form for 5 min­utes. Cells were then rinsed and imaged on a CLSM equipped with the BioRad ratio-imaging software.

Results

The single cell culture system was used to study the effect of specific hormone treatments on different parameters of the cell's biology.

Cell division-expansion

Protoplasts were cultured in four different conditions: in the presence ofNAA, BAP, NAA + BAP, and in the absence of hormones.

Wall regeneration during the first days of culture was not affected by the presence or absence of hor­mones, however differences in cell behaviour soon became clear. Cells in NAA + BAP start dividing from day 4 of culture onwards and ultimately form micro­calli (Fig. lA).

Cells kept in NAA started elongating on day 6 and carried on elongating for 30 days, ultimately forming long (up to 800 Jim) tubular cells (Fig. IB). Cells kept in BAP behave like cells in the absence of hormones in that they are not able to expand or to divide and they generally increase in volume by repetitive budding, leading ultimately to long pearl-necklace shaped cell constructs (Fig. lC).

This growth response to exogenous hormone signals is a clear and unambigous response of the whole cell population as at least 80% of the cells show the same reaction. If, during prolonged culture, the hor­mone content of the medium is changed the cells con­sequently react to the new hormonal signal given. Cells having expanded in a NAA medium and budded cells start dividing or enter a period of elongation in NAA + BAP or NAA medium respectively.

All these hormone-driven morphogenic responses of the cells are summarized in Fig. 3. It is clear that independent of their physiological state, cells always react in a predictable way to the hormonal conditions of the culture medium. Also whatever their previous physiological status, actively dividing cells can be cul­tured to produce calli on which shoots can be induced from which plants can be regenerated.

Comparing exogenous and endogenous hormone signals

Protoplasts isolated from normal SRI tobacco tissue and from a transgenic SRI carrying a heat inducible ipt gene were compared in their growth response to hormones (Table 1). The transgenic cells are similar to

235

Fig. 1. Extended focus pictures of cultured cells made with the CLSM. A: cells grown for 15 days in a medium containing only NAA+BAP stained with FDA. B: cell grown for 15 days in a medium containing only NAA stained with FDA. C: cell kept for 9 days in a medium containing only BAP stained with FDA. D: immunostained microtubules in a cell cultured for 3 days in a medium containing only NAA. E: parallel hoops of microtubules in a cell cultured during 15 days in a medium containing only NAA. F: ER structure in a cell after two days of culture in a medium containing only NAA.

236

Fig. 2. Extended focus pictures of cultured cells made with the CLSM. A:ER structure in a cell after 10 days of culture in a medium containing only NAA. B:ER structure in a cell after 10 days of culture in a medium containing NAA+BAP.

Summary of cell responses to the supplied hormones*

• NAA / BA~or /' NO-hor; ne

NAA ~ NAA+BAP

NAA

NAA+BAP

No·hormono NAA+BAP (1 :5)

on solid MS cunure medium on solid MS cunure medium

• supplied hormones is 1 mgll unless specially metioned

~ NAA+BAP

on solid MS cunure medium

Fig. 3. Diagram summarizing the different responses of cells to specific hormone treatments.

the wild-type in their growth reaction; they expand in NAA and divide in NAA+BAP.

When they are heat treated (60 min at 40°C every day) the cells from the transgenic plant however divide in a medium containing only NAA. The wild-type cells are not affected by the heat treatment, they expand

as can be expected. In the presence of NAA the cell division response can thus be triggered equally well by increasing the internal pool of cytokinins as by addition of exogenous BAP.

237

Table 1. Cell response to exo- and endogenous cytokinins

SRI

HSwr

Cytoskeleton and endomembranes

NAA (1 mg/I)

No-heat

Elongation

Elongation

Heat

Elongation

Division

Parietal microtubules have typically random distribu­tionin the protoplasts during the first 3 days of culture (Fig. ID). This type of architecture is also present in cells cultured further in BAP or in NAA+BAP, although microtubules might be more numerous in the latter. In NAA however, cells reorientate their parietal microtubules into hoops parallel to each other and per­pendicular to the long axis of the cell when the cells start to elongate and retain this pattern during further growth (Fig. IE).

Also endomembranes seem to adapt their structure to the physiological status of the cell. In cells which have just regenerated a wall, ER is mainly present as long tubular structures spread throughout the peri­pheral cytoplasm (Fig. IF). Cells cultured in BAP keep this pattern in the parent cell and in the cytoplasm of the buds. NAA-grown elongating cells have qualita­tively the same structures but the individual tubules are shorter (Fig. 2A). Cells grown in NAA+BAP however change their ER architecture completely. Concommit­tant with the first divisions, the tubular ER is replaced by a numerous population of discrete vesicles (Fig. 2B); this type of structure is typical for cycling cells as it was found in long cells as they were dividing.

Auxins and intracellular pH

Cells grown for 5-days in NAA+BAP were kept in a hormone free medium for 6 h and were then used to monitor the cytoplasmic pH. Butyric acid (5 roM) added to the medium is taken up by cells and induces acidification of the cytoplasm. With the use of a pH probe we detected changes in pH within the first minute after addition of butryric acid and an acidification of 0.2 pH units was reached in 3 min. This confirmed the reliability of the experimental set-up. Addition ofNAA never induced a detectable change in cytoplasmic pH during the first 15 min; the threshold for detection of changes being 0.05 pH units.

NAA(lmg/l) + BAP (1 mg/I)

No-heat

Division

Division

Discussion

Heat

Division

Division

Single cells have been used as model systems to study cell growth and development. Very interesting results were obtained in the Zinnia system where differen­tiation of mesophyll cells to tracheary elements was a clear response of the cells to a defined hormone message [2]. Single cells could also be induced to elongate with adequate hormone treatments [4]. Most experiments were however done on cells in liquid cul­ture which makes it impossible to follow individual cells over longer periods of time. Also the induced differentiations were always considered or at least studied as irreversible.

The model system presented here offers the pos­sibility to induce cell division or expansion in a fully reversible way. A very important observation is that whatever the physiological state of the cells, they always react in a predictable way to an external hormone signal; the presence of NAA+BAP is trans­lated in cell division. This makes it possible to produce different cell types at will.

Another advantage of this system is the accessibil­ity of the cells for microscopic inspection in situ in the medium they are growing in - allowing the study of many aspects of the cell's biology during hormone treatment. The examples shown here demonstrate the potential of such an experimental approach.

The experiments on protoplasts displayed heat­inducible cytokinin production, and so add new data to the definition of this transgenic plant strain [13]. They also give information on the cytokinin induction of cell division, unattainable in experiments with whole plants or tissues. Also the fact that the structure of the ER is related to the hormone induced state of the cell - dividing, resting or expanding - has hitherto not been reported. The observation that the cytoplasmic pH does not change upon addition of auxins to the growth medium adds arguments in the debate on the role of auxin induced H+ extrusion [3].

238

We expect that the applicaton of other research techniques on the cell culture system will allow us to address at the molecular level further questions on the translation of a hormone signal to cell activity.

Acknowledgements

This research was supported by the grants 3.0028.90 and 2.0049.93 from the National Fund for Scientific Research of Belgium. D. Stickens was recipient of a grant from the Flemish Community (VLAB­ETC) and W.Tao received a grant from the Belgian State Research Programme (87/92-119). The authors acknowledge the invaluable help of S. Foubert.

References

I. Davies PJ (1987) Plant Honnones and Their Role in Plant Growth and Development. Dordrecht: Kluwer Academic

2. Fukuda H and Komamine A (1980) Direct evidence for cytodifferentiation to tracheary elements without intervening mitosis in a culture of single cells isolated from the mesophyll of Zinnia elegans. Plant Physiol 65: 61-64

3. Gehring CA, Irving HR and Parish RW (1990) Effects of auxin and abscisic acid on cytosolic calcium and pH in plant cells. Proc Natl Acad Sci USA 87: 9645-9649

4. Hasezawa S and Syono K (1983) Honnonal control of elon­gation of tobacco cells derived from protoplasts. Plant Cell Physiol24: 127-132

5. Jones LE, Hildebrandt AC, Riker AJ and Wu JH (1960) Growth of somatic tobacco cells in microculture. Amer J Bot 47: 468-475

6. Kutchera U, Bergfeld, R and Schopfer P (1987) Cooperation of epidennis and inner tissues in auxin mediated growth of maize coleoptiles. Planta 170: 168-180

7. Nagata T and Takebe I (1971) Plating of isolated tobacco mesophyll protoplasts on agar medium. Planta 99: 12-20

8. Palme K, Hesse T, Moore I, Campos N, Feldwisch J, Garbers C, Hesse F and Schell J (1991) Honnonal modulation of plant growth. Mech Dev 33: 97-106

9. Potrykus I and Shillito RD (1986) Protoplasts: isolation, culture, plant regeneration. Meth Enzymol 118: 549-578

10. Shillito RD, Paskowski J and Potrykus I (1983) Agarose plat­ing and a bead type culture technique enable and stimulate development of protoplast-derived colonies in a number of plant species. Plant Cell Rep 2: 244-247

II. Stickens D and Verbelen J-P (1993) Visualizing endo­membranes with confocal microscopy in protoplasts and cells oftobacco. Micron 24: 637-642

12. Van der Valk HCPM, Blaas J, van Eck JW and Verhoeven HA (1988) Vital DNA staining of agarose-embedded protoplasts and cell suspensions of Nicotiana plumbaginifolia. Plant Cell Rep 7: 489-492

13. Van Loven K, Beinsberger SE, Valcke RLM, Van Onckelen HA and Clijsters HMM (1993) Morphometric analysis of growth of Phsp 70-ipt transgenic tobacco plants. J Exp Bot 44: 1671-1678

14. Verbelen J-P, Lambrechts D, Stickens D and Tao W (1992) Controlling cellular development in a single cell system of Nicotiana. Int J Dev BioI 36: 67-72

A.R. Smith et al. (eds.), Plant Hormone Signal Perception and Transduction, 239-246. © 1996 KluwerAcademic Publishers.

239

Receptor-like proteins of higher plants

Klaus Palme Max Delbriick Laboratorium, Carl von Linne Weg 10, D-50B29 K61n, Germany

Key words: auxin receptor, G-protein coupled receptors, GTPase, protein kinase, two-component signalling system

Abstract

Structurally and biochemically diverse receptors that initiate signalling events in response to various signals have been been found in all organisms. Many of these proteins span the cellular membranes, with an extracellular signal binding domain facing the outside of the cell, and an intracellular domain for interaction with the cells biochemical machinery. In the last few years significant progress has been made in cloning various plant genes coding for receptor-like proteins. Recent insights in their predicted structure and function will be summarized. Genetic advances allowed the identification and detailed characterization of several phytohormone perception mutants. By T-DNA tagging and chromosome walking genes from Arabidosis thaliana encoding the ethylene receptor as well as putative G-protein coupled receptors were isolated. These receptors are contrasted by another group of receptor proteins that bind auxins and which show a markedly different structural organization.

Introduction

The coordinated control of growth and differentia­tion in eukaryotes is achieved, in part, through the activation of intracellular biochemical networks in response to external stimuli. Elucidation of the prin­cipal architecture of the major signalling pathways of prokaryotic and eukaryotic organisms has revealed that receptor proteins are involved in monitoring the cells environment by binding a large variety of ligands. Numerous signal substances are transduced through t)1ese receptors to a few cellular signalling pathways leading to modulation of physiological processes. These processes include the regulation of cell-to-cell communication, secretion, adhesion, pro­liferation, differentiation as well as the regulation of many metabolic responses. While phosphorylation plays an important role in prokaryotic signal transduc­tion, signalling pathways of eukaryotes show an even more complex design and contain various additional elements like guanine nucleotide-binding proteins (GTPases), second-messenger generating enzymes, protein kinases, and various regulatory target proteins. The advanced knowledge in this area is reflected in

numerous reviews including a special issue of Plant Molecular Biology and will therefore not be repeated here [52].

In order to· narrow the scope of molecular com­ponents to be considered in this review, we will limit ourselves to plant receptor proteins. Receptors commonly are considered to represent either membrane-asscociated or intracellular soluble pro­teins. Cell surface receptors possess besides of at least one transmembrane spanning domain an additional domain for ligand binding. Through ligand binding these receptors transmit signals into the cells interior by interaction of their intracellular domains with cel­lular enyzmes and proteins. What are the ligands to be sensed by plant receptor proteins? Phytohormones, for example, which influence a remarkable variety of developmental and physiological processes, might be candidate ligands for such receptor proteins. For a long time it was not clear whether such phytohormone receptor proteins will be structurally related to receptor proteins already known from yeast and mammals or whether they would have structures of their own. Now we know that both views are true, we find some plant receptor proteins that have a topological organization

240

highly related to known prokaryotic and eukaryotic receptor proteins; however, novel structural and func­tional themes are emerging at the same time as well. This review will describe recent breakthroughs in our understanding on plant receptor proteins; but first we will briefly summarize relevant general knowledge on membrane-associated receptor proteins.

Receptors - a current view

Application of biochemical and molecular techniques has resulted in isolation of numerous receptors. Predic­tion of primary structures from their genes confirmed the view that many of these proteins consist of distinct domains or ID,odules, with each module often encoded by a separate exon (for discussion see [50]). Due to this modular design of signal recognition proteins many of these domains are found reiterated in several distinct receptor proteins. We will highlight some examples that seem to be important modules in many organisms including plants. Bacterial signalling receptors often contain two-components, a membrane-located sensor and a cytoplasmically located response regulator [4]. When a signal has been sensed by the sensor com­ponent an autocatalytic phosphorylation of a histidine residue follows on the consumption of ATP. Histidine bound phosphate can then be transferred to an aspar­tate residue on the appropriate receiver domain of the response regulator, thus activating a response cascade [56]. This regulatory framework has been modulated in numerous ways in many bacteria and, as recent evi­dence indicates, such ancient regulatory devices have been further adopted to the sensing of environmental signals in eukaryotes [22].

In eukaryotes, there are three major classes of cell surface bound receptors which can bind various ligands. Receptors can act as ion channels, they can activate heterotrimeric GTPases thereby initiating the production of intracellular signalling molecules, and they can perform directly as enzymes [46]. Remark­ably, these different classes correspond to distinct time­scales for physiological responses, from seconds, to minutes and hours, respectively [67,69]. Distribution of ions across the relevant membrane is rapid and typic­ally results in short time-scale responses like release of cell secretory vesicle contents and propagation of membrane electrical potential waves. These class I receptor proteins (mainly neurotransmitter receptors), which rapidly regulate physiological responses, are contrasted by the so called class II receptors. Through

the interaction with other proteins, G-protein coupled receptors for example, they in turn activate other enzymes which induce the production or release of second messengers (e.g. cAMP, cGMP, Ca2+, phos­pholipid metabolites). The third class encompasses enzymes (e.g. receptor kinases), which, after binding of the ligand, often aggregate within the membrane and then modulate the activity of other intracellular enzymes for more long-term responses. In particular, growth factor receptors are known to use this latter mode of action and regulate cellular events over a time scale of hours or days.

Receptors belonging to class II have already been isolated from higher plants by polymerase chain reac­tions, however, despite the more traditional strategies towards isolation of receptor proteins it is expected that genetic analysis will result in identification of novel receptors and dissection of their respective signalling chains. Mutants to be isolated in hormone signalling chains are generally thought to fall in two classes: those that influence hormone levels by altering the synthesis or the degradation of hormones and those that influence the response to hormones [60]. These mutants could modulate (i) the level of receptors, (ii) the affinity of the receptor protein to the hormone or (iii) the size of the response. Of particular interesting will be the analysis of mutants that result in insensitiv­ity to a particular hormone. Such hormone insensitive mutants may either turn out to be receptors which are uncoupled from the activating ligand or effect genes that encode biosynthetic enzymes which alter intracel­lular hormone levels or effect other genes whose action results in an unexpected activation of the hormone signal transduction chain. Recent examples of studies on mutations in the ethylene pathway and in the response of plants to auxins have highlighted the power of such genetic approaches [8, 30, 35].

Receptor-like protein kinases

Phosphorylation (or dephosphorylation) of serine and threonine and sometimes tyrosine residues trigger changes in protein conformation resulting in activation or deactivation of target proteins. Receptor mediated alteration of protein phosphorylation may either result in amplification of perceived signals or to diversifica­tion of a signal when different branching intracellular pathways are activated. Membrane-spanning protein kinases and protein phosphatases are known to repre­sent integral components of many signal transduction

pathways. Not only do they serve to phosphorylate their normal physiological substrates, their enzymatic activity is, in tum, regulated again through interaction with other kinases and phosphatases.

'Several genes were isolated from higher plants encoding receptor-like kinases (for overview see [77]). The deduced sequences of these receptor-like kinases all show an overall structure very similar to that of receptor-type kinases from mammals [73], i.e. large extracellular domains containing possible glyco­sylation sites together with blocks of leucine-rich repeat motifs, linked via a single transmembrane spanning domain to an intracellularly located protein kinase domain. According to structural similarities in their extracellular domains type I membrane pro­teins have been grouped into 0) a leucine rich repeat class, a repeated motif found in many other eukary­otic proteins, (ii) a class containing epidermal growth factor-like repeats, and (iii) the S-domain class, highly related to the self-incomatibility locus encoded glyco­proteins of Brassica [45]. The TMKI protein of Arabidopsis, for example, belongs to the latter class and contains within its extracellular S-domain a motif which was first found in members of the self incompatibility-locus glycoproteins (SLG) from var­ious Brassicaceae, proteins which as part of the sporophytic self-incompatibility response inhibit self­pollination [45]. Related kinases have been cloned not only from Brassicaceae, but also from Arabidopsis thaliana, and maize. PCR technology allowed cloning of the ZmPKl gene which shares 27% identity with­in its S-domain with the Brassicacea oleracea SLG13 allele [78]. Other distantly related members of this group are the SRK protein from Brassica oleracea [65], or the ARK protein from Arabidopsis [72]. Members of the leucine rich repeat class with an aj3-fold tertiary structure [31] are the Arabidopsis TMK 1, RLK5 and TMKII proteins which have between seven and twenty-one leucine rich repeats organized in a contiguous block. The only member of the epidermal growth factor-like repeat containing class is the pro25 gene product, a protein which apparently interacts with the N-terminal region of the light-harvesting chloro­phyll alb binding protein [32]. All these proteins are predicted to be serine/threonine kinases as they share conserved subdomains of amino acid residues within their catalytic domain [23, 24, 16] and indeed ser­ine/threonine autophosphorylating activity was found when, for example, the TMK protein was expressed as a fusion protein in E. coli [9]. Similar biochemical specificity towards serine/threonine residue phospho-

241

rylation was found for the SRK6, SRK -910 and PR025 proteins, no tyrosine phosphorylation was however found [77].

The isolation of a large number of protein kinases from a range of plants showing structurally motifs well known from other eukaryotic species including mammals, budding and fission yeast, and Drosophia, strongly suggests that at least some of the processes that govern cell growth and differentiation in this diverse range of organisms are achieved by similar princi­ples.

Two-component signalling systems

As already discussed, one way to get at the mecha­nism by which a signal is transduced into a response is to identify mutants that are unable to respond or that respond abnormally to a particular signal. Such mutants may define components of the process that transduce that signal into a particular response. Although neither the abscisic acid nor the gibberellic acid receptors have been found yet, progress was made when an ethylene insensitive mutant from Arabidopsis thaliana was analyzed [3]. This dominant mutant was not defective in ethylene production, but was affected in several well characterized ethylene responses including ethylene induced inhibition of cell elongtion, promotion of seed germination, accelera­tion of leaf senescence and feedback suppression of ethylene synthesis [3,70]. This mutant was mapped to the etr locus on chromosome 1 and the ETRI gene was isolated by chromosome walking [8]. An 82.5 kDa protein was predicted from the nucleotide sequence that showed in its first 313 amino acid residues no homology to any other protein present in the data bases; however, in its remaining C-terminal part it showed similarity over 241 residues to all essential sequence motifs of the histidine kinase domain of the sensor domain of the bacterial two-component signal trans­ducing proteins [56]. Next to this putative histidine kinase sensor domain another domain present in bac­terial response regulator proteins was found. Although not yet experimentally confirmed, these sequence homologies suggest that the ethylene receptor might have a histidine kinase activity [22]. Interestingly and at the same time, it was also found that not only plants seem to make use of the two-component design ofbac­terial signalling elements with N-terminal sensor and C-terminal histidine kinase domains. When compared to the ETRI protein, similar structural topology was

242

found for the Sin gene from Saccharomyces cerevisiae which plays an essential role in the regulation of pro­tein degradation [49], as well as for other genes from Dictyostelium discoideum and Neurospora crassa that act in apparently unrelated functional pathways [68]. More of such unexpected conserved sequence motifs with similarity to bacterial proteins have been estab­lished by analysis of large genome fragments such as the yeast chromosome III [33]. Indeed, that the ethy­lene signal is transduced through phosphorylation was already indicated by several reports showing biochem­ical evidence that calcium and protein phosphorylation are required for ethylene signal transduction [58, 59, 48]. Although the direct target protein(s) for E1Rl are not yet known, it is now clear that at least one other serine/threonine protein kinase with homology to the mammalian Raf kinase family plays an important role in further downstream transduction of the ethylene signal [30]. Raf kinases belong to a larger family of MAP kinase kinase activators which act in MAP­kinase like pathways. It will be interesting to see whether, similar to the yeast two-component-like osmosensing system, the plant two-component ethy­lene perception system will be mediated through MAP kinase-like signalling cascade.

G-protein coupled receptor proteins

Besides receptor-like protein kinases another group of membrane-bound receptors, the G-protein coupled receptors, have found wide interest as cellular sensors. These proteins, to date encompassing far more than 300 sequences in the databases, interact with GTPases. GTPases are very important cellular switches found in all eukaryotic systems analyzed up to date, includ­ing higher plants where some of them play a role in light signal transduction [47, 5]. Through switching between ,an active and an inactive state they ensure vectorial flow of information on the expense of GTP [66]. As G-proteins from higher plants have been extensively reviewed [37a, 41,53] we will only briefly refer to recent advances not mentioned in these arti­cles. Several genes encoding proteins homologous to Ga proteins have been cloned from Arabidopsis, tomato and maize [36,37,79, Brzobohaty and Palme, unpublished] and shown to share around 75% iden­tity and 84% similarity with the Arabidopsis GPa 1 and 50,6% (rat stimulatory G protein) to 58% (bovine transducin) with other Ga proteins. Plant Ga subunit proteins contain all the regions well known from other

yeast and mammalian Ga proteins. The conserved nature of these proteins makes it likely that recep­tors with seven-membrane spanning domain topology will be present in plants. This was in fact found recently, when Bennett and coworkers succeeded in isolating several Arabidopsis cDNAs from aT-DNA tagged auxl mutant with open reading frames pre­dicting a hydrophobic protein with seven hydrophobic membrane spanning domains characteristic for this in mammals wide spread receptor family (Bennett and coworkers, pers. communication). It is of interest to note that the auxl mutant was isolated by screening for increased growth of seedling roots in the presence of inhibitory auxin concentrations. Although the exact role of this protein is not yet clear, it seems likely that these putative receptors may playa role in auxin signalling. The cloning of the AUXI gene as well as several related members of this gene family is true to have important implications for understanding receptor mediated signalling chains in higher plants.

Auxin receptors

Auxins influence cell enlargement and stem growth, cell division, root initiation and lateral branching, vascular tissue differentiation, apical dominance, tropisms, flowering and fertility (for overview see [11]. While the question how this hormone can activate such a bewildering array of responses has been asked many times and though resulted in a massive and com­plex literature, convincing answers on the molecular mechanisms of auxin action are still not available. The molecule is quite small and therefore can not transfer much information to the cell. Therefore, the percep­tion machinery of the various plant target cells will be of great importance to convey specificity to the response. The particular auxin receptors, their cellu­lar localization and mode of interaction with auxin are thus expected to determine how this signal will be transmitted into the numerous distinct and branching responses. Looki~g to the vast number of receptor pro­teins that are involved in transduction of hormonal signals in mammals, we will not be surprised to find a similar complex array of phytohormone receptors. But do we have the auxin receptors yet? While genetic analysis has recently greatly contributed to the dissec­tion and elucidation of auxin transduction chains [17, 35], the analysis of proteins that bind auxins, i.e. auxin binding proteins, has revealed exciting insights into

auxin action too, (forreview see [43,44,27,26,15,51, 62,74].

The specific structure/function requirements of auxins suggest that the first step of the response must be an interaction of the auxin with a protein [28, 29]. From the many auxin binding proteins that were characterized over the past decades, one has attracted considerable interest. This protein, termed ERabp for endoplasmic reticulum located auxin binding protein or simply abpl, was initially identified by classical hor­mone binding studies using binding of radiolabelled auxins to plant membrane fractions as an assay. ER associated auxin binding proteins were most abundant in maize coleoptiles, but much less abundant in other maize tissues; related binding sites were also found in many other mono- and dicotyledonous plant species and several respective genes were cloned [20, 25, 34, 50,63,64,80]. The proteins predicted from their open reading frames are highly related. Common structural features are: an N-terminal signal peptide responsi­ble for uptake into the lumen of the ER, a C-terminal located ER retention signal composed of the amino acids Lys-Asp-Glu-Leu [KDEL], an Asn-Xxx-Thr glycosylation signal, three cysteine residues at con­served positions, and a sequence composed of residues His-Arg-His-Ser-Cys-Glu which might be involved in auxin binding or transduction [7, 57, 75]. Biochem­ical experiments confirmed that ERabps are luminal component of the ER [20, 7].

It is a widely held view that ERabp I is an auxin receptor [43, 44, 74], although this has been ques­tioned recently [19]. As an auxin receptor ERabpl should bind auxin reversibly and at high affinity. Bind­ing of auxins to ERabps should be saturable, binding specificity of different auxin analogs should correlate with their biological affinity and finally an auxin specific response should be elicited by ERabps. Most of these criteria are met by this protein (for extensive discussion of data see reviews of [44, 2a]. Indeed, ERabpl isolated from maize coleoptiles or when expressed in vitro in insect cells using recombinant baculoviruses binds auxin under equilibrium binding conditions with a Ko for I-naphthylacetic acid in the range of 1.4 to 7.0 x 10-7 M [38,54]. Both the maize and the Arabidopsis ERabpl can be photoaffinity labeled using 5-N3-(7-3H)-indole-3-acetic acid [6, 40]. The relatively higher affinity for I-napththylacetic acid of the ER- and the tonoplast-associated bind­ing sites when compared with the plasma membrane­associated binding sites has been a matter of dispute. These binding sites differ not only in their affinity

243

towards 2-naphthylacetic acid, phenylacetic acid and benzooxazolinone [76, 13], but also in their affinity to 4-chloroindole-3-acetic acid, a physiologically very active auxin [39, 21, Hertel et ai., 1993]. 4-chloro­indole-3-acetic acid apparently does not very effec­tively compete for 1-[3H]naphthylacetic acid binding to ZmERabpl when maize coleoptile microsomes containing this protein were assayed. Does this mean that these sites are not involved in growth promo­tion and control of elongation [14, 19, 29] and does it indicate that additional auxin binding factors will be necessary to promote growth? While radiolabeled 4-chloroindoleacetic acid is not yet available to deter­mine its Ko in equilibrium binding studies, sandwich ELISA assays recently revealed similar binding char­acteristics for I-naphthylacetic acid and 4-chloroacetic acid [42, Napier, pers. communication]. Thus the dispute on ligand specificity of ERabp 1 seems to be settled. It is likey that purified ERabp I when compared to ERabpl containing crude extracts or membrane fractions will allow at higher resolution the analysis of small differences in ligand binding properties and that the use of crude membrane fractions in the earlier studies caused these discrepancies.

As an auxin receptor ERabp should act at the plasmamembrane. However, most of this protein seems to be located within the endoplasmic reticulum. But that a small fraction of this protein is located at the plasmamembrae could directly be demonstrated using a novel technique of silver enhanced immuno­gold viewed by epipolarization microscopy [12]. Most excitingly, application of auxin resulted in a redistri­bution of ERabp 1 on the surface of maize protoplasts. There is no doubt any more that ERabp 1 is modulating auxin-dependent plasmamembrane responses leading to changes in the plasmamembrane potential through activation of the H+ -A1Pase and probably ion chan­nels (for detailed review see 2a). The C-terminal part of ERabp 1 including the terminal KDEL residues seems to be crucial for this response. Using several ERabpl peptides it was demonstrated that the thirteen C-terminal aminoacid residues containing peptide was able to inactivate the inward rectifying K+ channel of Vicia faba guard cells [71]. This peptide also caused a rapid and reversible intracellular alkalinization of approximately 0.4 pH units of cytoplasmic pH. Is ERabp an auxin receptor as argued since 1977? It seems that all the requirements requested for a genuine receptor are fulfilled for ERabp I. A number of ques­tions still remain to be answered. What is the primary ERabp 1 target at the plasma membrane and what are

244

the elements of ~e auxin perception chain linking the receptor to the cellular effector proteins? Will it be possible to generate mutants that will allow dissection of the various steps in this chain? Intense efforts in several laboratories are likely to provide answers to these questions in near future.

Conclusion

For a long time the "site I" specific auxin binding site was the only one amenable to biochemical and physiological analysis. Now, a number of other pro­teins with topologies related to eukaryotic receptor proteins have been isolated from plants. Their archi­tecture suggests that some of them function at the cell membrane where they respond to diverse extracellular signals and modulate various physio­logical responses. The structural diversity and the diverse expression patterns suggest that many more signalling molecules and signalling pathways than presently known will have to be discovered in plants. Moreover, the finding that the fusicoccin receptor, a protein that activates the H+ -ATPase, belongs to the highly conserved and widespread family of eukaryotic 14-3-3 proteins, might indicate that different hormone signal transduction chains share common elements (see articles of Adducci and De Boer in this issue).

Acknowledgement

The work performed in the authors laboratory was supported by the European Community.

References

1. Barbier-Brygoo H, Ephritikhine G, KJambt D, Ghislain M and Guem J (1989) Functional evidence for an auxin receptor at the plasmalemma of tobacco mesophyll protoplasts. Proc Natl Acad Sci USA 86: 891-895

2. Barbier-Brygoo H, Ephritikhine G, Kliimbt D, Maurel C, Palme K, Schell J, and Guern J (1991) Perception of the auxin signal at the plasma membrane of tobacco mesophyll protoplasts. Plant Journal I: 83-93

2a. Barbier-Brygoo H (1995) Tracking auxin receptors using functional approaches. Crit. Rev. Plant Sci 14: 1-25

3. Bleecker AB, Estelle MA, Somerville C and Kende H (1988) Insensitivity to ethylene conferred by a dominant mutant in Arabidopsis thaliana. Science 241: 1086-1089.

4. Bourret RB, Borkovich KA and Simon MI (1991) Signal transduction pathways involving protein phosphorylation in prokaryotes. Annu Rev Biochem 60: 401-441

5. Bowler C, Neuhaus G, Yamagata H and Chua N-H (1994) Cyclic GMP and calcium mediate phytochrome phototransd­cution. Cell 77: 73-81

6. Campos N, Feldwisch J, Zettl R, Boland W, Schell J and Palme K (1991) Identification of auxin-binding proteins using an improved assay for photoaffinity labeling with 5-N3-(7-3H)-indole-3-acetic acid. Technique 3: 69-75

7. Campos N, Schell J and Palme K (1994) In vitro uptake and processing of maize auxin-binding proteins by ER-derived membranes. Plant Cell Physiol35: 153-161

8. Chang C, Kwok SF, Bleeker AB and Meyerowitz EM (1993) Arabidopsis ethy lene-response gene ETR I: Similarity of product to two-component regulators. Science 266: 539-544

9. Chang C, Schaller GE, Patterson SE, Kwok SF, Meyerowitz EM and Bleeker AB (1993) The TMKI gene from Arabidopsis codes for a protein with structural and biochem­ical characteristics of a receptor protein kinase. Plant Cell 4: 1263-1271 .

10. Cross JW (1991) Cycling of auxin-binding protein through the plant cell: Pathways in auxin signal transduction. The New Biologist 3: 813-819

11. Davies PJ (1995) Plant hormones. Physiology, Biochem­istry and Molecular Biology. 2nd Edition. The Netherlands, Dordrecht: Kluwer Academic Publishers

12. Diekmann W, Venis MA and Robinson DG (1994) Auxins induce clustering of the auxin-binding protein at the surface of maize coleoptile protoplasts. Proc Natl Acad Sci USA 92: 3425-3429

13. Dohrmann U, Hertel R and Kowalik W (1978) Properties of auxin binding sites in different subcellular fractions from maize coleoptiles. Planta 140: 97-106

14. Fischer C, Liithen H, Bottger M and Hertel R (1992) Initial transient growth inhibition of maize coleoptiles following auxin application. J Plant Physiol 141: 88-92

15. Goldsmith MHM (1993) Cellular signalling: New insights into the action of the plant growth hormone auxin. Proc Nat! Acad Sci USA 90: 11442-11445

16. Hanks SK and Quinn AM (1992) Protein kinase catalytic domain sequence data base: identification of conserved fea­tures of primary structure and classification of family mem­bers. Methods Enzymol 200: 38-61

17. Hayashi H, Czaja I, Lubenow H, Schell J and Walden R (1992) Activation tagging ofa plant gene by T-DNA tagging: auxin-independent growth in vitro. Science 258: 1350-1353

18. Hertel R (1994) A critical view on proposed hormone action: the example of auxin. In: Smith JC (ed) Biochemical Mech­anisms in Growth Regulation, pp 103-110. Oxford: Oxford University Press

19. Hertel R (1995) Auxin binding protein is a red herring. J Exp Botany 46: 461-462

20. Hesse T, Feldwisch J, Balshiisemann D, Bauw G, Puype M, Vandekerckhove J, Ubler M, Kliimbt D, Schell J and Palme K (1989) Molecular cloning and structural analysis of a gene from Zea mays (L.) coding for a putative receptor for the plant hornione auxin. EMBO J 8: 2453-2461

21. Hofinger M and Bottger M (1979) Identification by GC-MS of 4-choloro-indolylacetic acid and its methyl esters in immature Vicia faba seeds. Phytochemistry 18: 653-654

22. Hughes DA (1994) Histidine kinases hog the lime light. Nature 369: 187-188

23. Hunter T (1992) Protein kinase classification. Meth Enzymol 200:3-37

24. Hunter T (1994) 1001 protein kinases redux-towards 2000. Sem Cell Bioi 5: 367-376

245

25. Inohara N, Shirnomura S, Fukui T and Futai M (1989) Auxin- 43. Napier RM and Venis M (1991) From auxin-binding protein binding protein located in the endoplasmic reticulum of maize to plant hormone receptor? Trends Biochem Sci 16: 72-75 shoots: Molecular cloning and complete structure. Proc Natl 44. Napier R and Venis MA (1995) Auxin action and auxin-Acad Sci USA 86: 3564-3568 binding proteins. New Phytol 129: 167-201

26. Jones AM (1994) Auxin-binding proteins. Annu Rev Plant 45. Nasrallah JB and Nasrallah ME (1993) Pollen-stigma signal-Physiol Plant Mol Bioi 45: 393-420 ling in the sporophytic self-incompatibility response. Plant

27. Jones AM and Prasad PV (1992) Auxin-binding proteins Cell 5: 1325-1335 and their possible roles in auxin-mediated plant cell growth. 46. Neubig RR and Thomsen WJ (1989) How does a key fit a BioEssays 14: 43-48 flexible lock? Structure and dynamics in receptor function.

28. KaethnerTM (1977) Conformational change theory for auxin BioEssay II: 136--141 structure-activity relationships. Nature 267: 19-23 47. Neuhaus G, Bowler C, Kern R and Chua N-H (1993) Calcium!

29. Katekar GF and Geissler AE (1983) Structure-activity differ- calmodulin-dependent and -independent phytochrome signal ences between indoleacetic acid auxins on pea and wheat. transduction pathways. Cell 73: 937-952 Phytochemistry 22: 27-31 48. Novikova GV, Moshkov IE, Smith AR and Hall MA (1993)

30. Kieber 11, Rothenberg M, Roman G, Feldmann KA and Ecker Ethylene and phosphorylation of pea epicotyl proteins. In: JR (1993) CTRI, a negtive regulator of the ethylene response Pech JC, Latche A, Balague C et a/. (eds) Cellular and Moel-pathway in Arabidopsis, encodes a member of the Raf family cular Aspects of the Plant Hormone Ethylene, pp 371-372. of protein kinases. Cell 72: 427-441 Dordrecht: Kluwer

31. Kobe B and Deisenhofer J (1993) Crystal structure of porcine 49. Ota 1M and Varshavsky A (1993) A yeast protein similar to ribonuclease inhibitor, a protein with leucine repeats. Nature bacterial two-component regulators. Science 262: 566--569 366:751-756 50. Palme K (1992) Molecular analysis of plant signalling ele-

32. Kohom BD, Lane S and Smith TA (1992) An Arabidopsis ments: Relevance of eucaryotic signal transduction models. serine/threonine kinase homologue with an epidermal growth Intern Rev Cytol 132: 223-283 factor repeat selected in yeast for its specificity for a thylakoid 51. Palme K (1993) From binding proteins to receptors? J Plant membrane protein. Proc Natl Acad Sci USA 89: 10989- Growth Regul12: l71-178 10992 52. Palme K (ed) (1994) Signals and Signal Transduction Path-

33. Koonin EV, Bork P and Sander C (1994) Yeast chromosome ways in Plants. Special Issue. Plant Mol Bioi 26: 1237 III: new gene functions. EMBO J 13: 493-503 53. Palme K (1996) A role for the heterotrimeric G-protein switch

34. Lazarus C, Napier RM, Yu L-X, Lynas C and Venis MA in higher plants. Bios Scientific Pub., UK. In press (1991) Auxin-binding proteins: Genes and the protein. In: 54. Palme K, Feldwisch J, Hesse T, Bauw G, Puype M, Vandek-Jenkins CI and Schuch W (eds) Molecular Biology of Plant erckhove 1 and Schell J (1990) Auxin binding proteins from Development, The SEB Symposium Vol. 45, pp 129-148. maize coleoptiles: Purification and molecular properties. The Cambridge, UK: The Company of Biologists Limited Company of Biologists Limited. In: Roberts lA, Kirk C and

35. Leyser OHM, Lincoln CA, Timpte C, Lammer D, Thrner 1, Venis M (eds) Hormone Perception and Signal Transduction Estelle M (1993) Arabidopsis auxin-resistance gene AXRI in Animals and Plants, pp 299-313. Symposia of the Society encodes a protein related to ubiquitin-activating enzyme EI. for Experimental Biology, XLIV Nature 364: 161-164 55. Palme K, Hesse T, Campos N, Garbers C, Yanofsky MF and

36. Ma H, Yanofsky MF and Meyerowitz EM (1990) Molecular Schell 1 (1992) Molecular analysis of an auxin binding protein cloning and characterization of GPA I, a G protein alpha sub- gene located on chromosome 4 of Arabidopsis thaliana. Plant unit gene from Arabidopisis thaliana. Proc Natl Sci USA 87: Cell 4: 193-201 3821-3825 56. Parkinson IS and Kofoid EC (1992) Communication modules

37. Ma H, Yanofsky M and Huang H (1991) Isolation and in bacterial signalling proteins. Annu Rev Genet 26: 71-112 sequence analysis of TGAI cDNAs encoding a tomato G 57. Pelham HRB (1990) The retention signal for the soluble pro-protein subunit. Gene 107: 189-195 teins of the endoplasmic reticulum. Trends Biochem Sci 15:

37a. Ma, H (1994) GTP-binding proteins in plant: new member of 483-486 an old family. Plant Mol. BioI. 26: 1611-1636 58. Raz V and Fluhr R (1992) Calcium requirement for ethylene-

38. Macdonald H, Henderson J, Napier RM, Venis MA, Hawes dependent responses. Plant Cell 4: 1123-1130 C anI! Lazarus CM (1994) Authentic processing and target- 59. Raz V and Fluhr R (1993) Ethylene signal is transduced via ing of active maize auxin-binding protein in the baculovirus protein phosphorylation events in plants. Plant Cell 5: 523-expression system. Plant Physiol 105: 1049-1057 530

39. Marumo S, Abe H, Hattori H and Muncacata K (1968) Isola- 60. Reid JB (1993) Plant hormone mutants. J Plant Growth Regul tion of 4-chloroindolyl-3-acetic acid from immature seeds of 12:207-226 Pisum sativum. Nature 219: 959-960 61. Ruck A, Palme K, Venis MA, Napier Rand Felle H (1993)

40. Massotte D, Fleig U and Palme K (1995) Purification and Patch-clamp analysis establishes a role for an auxin binding characterization of an auxin-binding protein from Arabi- protein in the auxin stimulation of plasma membrane current dopsis thaliana expressed in baculovirus-infectedinsect cells. in Zea mays protoplasts. Plant J 4: 41-46 Protein Purific Engineering 6: 220--227 62. Schell 1, Palme K and Walden R (1995) Molecular appraoches

41. Millner PJ (1994) Molecular characteristics and cellular roles to the study of the mechanism of action of auxins. In: Plant of guanine nucleotide binding proteins in plant cells. In: Hall hormones. Physiology, Biochemistry and Molecular Biolo-MA and Libbenga KR (eds) in press gy. 2nd Edition, pp 354-371. Dordrecht, The Netherlands:

42. Napier Rand Venis M (1990) Monoclonal antibodies detect Kluwer Academic Publishers an auxin-induced conformational change in the maize auxin- 63. Schwob E, Choi S-Y, Simmons C, Migliaccio F, Hag L, Hesse binding protein. Planta 182: 313-318 T, Palme K and Soll D (1993) Molecular analysis of three

246

maize 22 kDa auxin binding protein genes - transient pro­moter expression and regulatory regions. Plant J 4: 423-432

64. Shimomura S, Liu W, Inohara N, Watanabe S and Futai M (1993) Structure of the gene for an auxin-binding protein and a gene for 7SL RNA from Arabidopsis thaliana. Plant Cell Physiol 34: 633-638

65. Stein JC, Howlett B, Boyes DC, Nasrallah ME and Nasrallah JB (1991) Molecular cloning of a putative receptor protein kinase gene encoded at the self-incompatibility locus of Bras­sica oleracea. Proc Nat! Acad Sci USA 88: 8816-8820

66. Stouten PFW, Sander C, Wittinghofer A and Valencia A (1993) How does the switch II region of G-domains work? FEBS Lett 320: 1-6

67. Strange PG (1988) The structure and mechanism of neuro­transmitter receptors. J Biochem 249: 309-318

68. Swanson RV and Simon MI (1994) Bringing the eukaryotes up to speed. Curr Bioi 4: 234-237

69. Taylor CW (1990) The role ofG proteins in transmembrane signalling. Biochem J 272: 1-13

70. Theologis A (1993) Plant hormones - What a gas! Curr Bioi 3:369-371

71. Thiel G, Blatt MR, Fricker MD, White IR and Millner PA (1993) Modulation of K+ channels in Vicia stomatal guard cells by peptide homologs to the auxin-binding C terminus. Proc Nat! Acad Sci USA 90: 11493-11497

72. Tobias CM, Howlett B and Nasrallah JB (1992) An Arabidopsis thaliana gene with sequence similarity to the

S-locus receptor kinase of Brassica oleracea. Plant Physiol 9999:284-290

73. Ullrich A and Schlessinger J (1990) Signal transduction by receptors with tyrosine kinase activity. Cell 61: 203-212

74. Venis MA (1995) Auxin binding protein I is a red herring? Oh no it isnt! J Exp Botany 46: 463-465

75. Venis AM, Napier RM, Barbier-Brygoo H, Maurel C, Perrot­Rechenmann C and Guem J (1992) Antibodies to a peptide from the auxin-binding protein have auxin agonist activity. Proc Natl Acad Sci USA 89: 7208-7212

76. Venis M, Watson TJ (1978) Naturally occurring modifiers of auxin-receptor interaction in com: identification as benzoxa­zolinones. Planta 142: 103-107

77. Walker JC (1994) Structure and function of the receptor-like protein kinases of higher plants. Plant Mol Bioi 26: 1599-1609

78. Walker JC and Zhang R (1990) Relationsrip of a putative receptor protein kinase from maize to the S-Iocus glyco­proteins of Brassica. Nature 345: 743-746

79. Weiss CA, Huang H and Ma H (1993) Immunolocalization of the G protein c< subunit encoded by the GPAI gene in Arabidopsis. Plant Cell 5: 1513-1528

80. Yu L-X and Lazarus CM (1991) Structue and sequence of an auxin-binding protein gene from maize (Zea mays L.). Plant Mol Bioi 16: 925-930