Plasmid Construction and Purification of Arabidopsis Plantacyanin and Lily

Chemocyanin in a Prokaryotic System

Suhyen Lee and Brooke Vuong (Aram Nersissian)

Outline

•Purpose•Arabidopsis Plantacyanin•Lily Chemocyanin•Chemotropism Assay•pET-3a vector•Mechanism-Plasmid Construction

-PCR Condition -DNA purification after PCR -DNA digestion and ligation -Transformation -Protein Purification

Purpose

collaborate with UCR to purify protein so that UCR can use purified protein to do further research on Arabidopsis Plantacyanin and Lily Chemocyanin

• A basic, 10kD, copper binding …..protein with pI ~10• Characterized by turning blue upon …..binding copper in its +2 oxidation …..state • Its function remains unknown• Has a single copper binding site …..formed by four ligands: two …..histidines and a cystein …..coordinate equatorially, while the …..fourth, axial ligand, is a …..methionine or a glutamine.• The redox potential of plantacyanin …..bound copper varies with the …..hydrophobicity of the axial ligand: …..it increases along with the …..hydrophobicity of the ligand

Arabidopsis Plantacyanin

http://aggie-horticulture.tamu.edu/faculty/davies/students/ngo/research.html

http://www.pnas.org/misc/3800.jpg

• A member of the plantacyanin family ….copper binding proteins • Implicated in Chemotropism in lily ….stigma• Essential in pollination: pollen tube ….chemotropism induction• Shows 67% sequence similarity to ….plantacyanin• Copper binding site: two histidines and ….a cysteine. In place of the axial ligand ….has a non-coordinating, hydrophobic ….leucine residue. • Copper binding and other biochemical ….and biophysical properties have not ….been characterized.

Lily Chemocyanin

Copyright ©2003 by the National Academy of Sciences

Kim, Sunran et al. (2003) Proc. Natl. Acad. Sci. USA 100, 16125-16130

Fig. 3. Chemotropism assay showing pollen tube reorientation over time (A and B) and quantification method (C)

pET-3a Vector

*Designed for cloning and recombinant protein expressions in prokaryotic system, E. Coli.*Utilizes T7 RNA polymerase in the host cell to transcribe and translate. *Has NdeI and BamHI restriction sites which make directional cloning possible*Presence of selective marker, Ampicillin resistant gene

Plasmid Construction of Arabidopsis Plantacyanin

Primers 1&3

Primer 1: AtPNCNdeMet1 gatcgacatatggccaagggaagaggcagtgc

Primer 3: AtPNCNdeMet32 tacgttcatatggcaacgtacacggtcggtgactctgg

Reverse Primer: AtPNCBamStop tagaggatccatcaaaccgcggtgactgcgattttc

P32

P1

Plasmid Construction of Lily Chemocyanin

Primer 2: lilChemNdeMet1 atctatcatatggctcagggaagtggcagtgcag

Primer 4: lilChemNdeMet30 gtggcccatatggtcgtctataccgtcggcgatggc

Reverse Primer: lilChemBamStop gagaggatccttaagctgctgtgactgctatcttcaaacc

L30

L1

PCR Condition

JRAY

94°C 2min94°C 1min50°C 1min72°C 2min

72°C 10min4°C 99hr

N2

94°C 2min94°C 1min50°C 1min72°C 4min

72°C 10min4°C 99hr

30X

*Reaction program Jray was the first program that I used. Using Jray program yielded product, yet the size of the DNA was incorrect. *Reaction program N2 is 60min longer than Jray and using this program yielded right size DNA

DNA Purification after PCR

Agarose Gel Electrophoresis

Low Melting Agarose GelElectrophoresis

Phenol-Chlorform Extraction Cold Ethanol

Precipitation

•DNA is in aqueous phase in phenol-chloroform extraction•After ethanol precipitation, DNA is in the pallet

DNA Digestion & Ligation

Digest DNA with restriction enzyme, NdeI & BamHI with NEB buffer #2

Purify DNA After Restriction Digestion

DNA Ligation with pET-3a vector

Transformation into Competent Cells

Conclusion

*P1 expression produced large quantities of recombinant protein*No presence of protein for L1*Protein in P1 can be purified via glucose shock then ultrafiltration*Protein in L30 should be purified via sonication, 8M urea treatment, and ultrafiltration

Protein Purification: Ultrafiltration of P1

Protein Purification: L30 purification

Further Research

Purified proteins will be sent to University of California, Riverside for further study of Lily Chemocyanin

Acknowledgement

First of all I want to thank God, Dr. Nersissian, Brooke Vuong, and Nicole. And I also want to thank Sam Phang, Penny Saephan, Phuong Minh and Nersissian Lab folks.