Brandon L. Taylor, Jacqueline Benthuysen, and Maike Sander

Postnatal b-Cell Proliferationand Mass Expansion IsDependent on the TranscriptionFactor Nkx6.1Diabetes 2015;64:897–903 | DOI: 10.2337/db14-0684

All forms of diabetes are characterized by a loss offunctional b-cell mass, and strategies for expandingb-cell mass could have significant therapeutic benefit.We have recently identified the transcription factorNkx6.1 as an essential maintenance factor of the func-tional b-cell state. In addition, Nkx6.1 has been pro-posed to control b-cell proliferation, but a role forNkx6.1 in regulating b-cell mass has not been demon-strated. Here, we show that Nkx6.1 is required for post-natal b-cell mass expansion. Genetic inactivation ofNkx6.1 in newly formed b-cells caused a drastic de-crease in early postnatal b-cell proliferation, leading toreduced b-cell mass and glucose intolerance. Interest-ingly, Nkx6.1 was dispensable for prenatal b-cell prolifer-ation. We found that Nkx6.1 regulates the expression ofseveral b-cell maturation markers as well as expressionof the nutrient sensors Glut2 and Glp1r. Manifestation ofthe b-cell mass defect at the transition to postnatal feed-ing suggests that Nkx6.1 could regulate b-cell growth byenabling b-cells to respond to nutrient-dependent prolif-eration signals, such as glucose and Glp1. Identificationof b-cell-intrinsic regulators that connect nutrient-sensingand proliferation suggests new therapeutic targets forexpanding functional b-cell mass.

The establishment of sufficient b-cell mass depends onthe rapid expansion of b-cell numbers during early post-natal life (1–5). The extent of this early postnatal b-cellgrowth is postulated to influence later susceptibility totype 2 diabetes (6). Postnatal b-cell mass expansion isdriven by b-cell proliferation (7), which is controlled by

the cell cycle regulators Cyclin D1 or Cyclin D2 (encodedby Ccnd1 and Ccnd2, respectively) (2,3). It has beenshown that b-cells are highly proliferative in the perina-tal period and that this early proliferation is necessary toestablish sufficient b-cell mass for maintaining glucosehomeostasis (1–5). However, the cell extrinsic and in-trinsic factors that drive b-cell proliferation and massexpansion during the perinatal period are still poorlydefined.

Glucose has been identified as a systemic factor thatstimulates b-cell proliferation (8,9), and recent studiessuggest that glucose is a significant driver of early post-natal b-cell proliferation (10). Furthermore, it has beenshown that glucose metabolism in b-cells produces signalsthat increase Cyclin D2 expression and b-cell proliferation(11–13). Independent of glucose, b-cell proliferation isalso stimulated by gut-derived hormone GLP-1 (Glp1),which is secreted by intestinal enteroendocrine cells inresponse to food intake (14,15). Thus there is an estab-lished link between feeding, increases in blood glucoselevels, and b-cell proliferation. However, b-cells also ex-hibit significant proliferation during fetal life, when bloodglucose concentrations are low and glucose has little effecton b-cell proliferation (16). The distinct mechanisms usedin prenatal and postnatal b-cells to regulate proliferationremain unclear.

The b-cell-restricted transcription factor Nkx6.1 is es-sential for maintaining the functional state of b-cells dur-ing adulthood (17). Both in vitro and in vivo experimentshave suggested a role for Nkx6.1 in b-cell proliferation(17–19), but whether it is required for b-cell growth in

Departments of Pediatrics and Cellular and Molecular Medicine, Pediatric Di-abetes Research Center, University of California, San Diego, La Jolla, CA

Corresponding author: Maike Sander, masander@ucsd.edu.

Received 30 April 2014 and accepted 23 September 2014.

B.L.T. and J.B. contributed equally to this work.

© 2015 by the American Diabetes Association. Readers may use this article aslong as the work is properly cited, the use is educational and not for profit, andthe work is not altered.

Diabetes Volume 64, March 2015 897

ISLETSTUDIES

vivo is unknown. To reveal a possible role for Nkx6.1 inb-cell mass expansion, we inactivated Nkx6.1 in newlyformed b-cells of the embryo and examined the effectson b-cell proliferation and mass during the prenatal andpostnatal period.

RESEARCH DESIGN AND METHODS

RIP-Cre (20), Nkx6.1flox (21), Nkx6.1 null (22), and R26-YFP mice (23) have been described. RIP-Cre;Nkx6.1flox/+;R26-YFP mice served as control mice in all experiments.All experiments were approved by the InstitutionalAnimal Care and Use Committee of the University ofCalifornia.

Methods for tissue preparation, immunofluorescencestaining, and terminal deoxynucleotidyl transferase dUTPnicked end labeling (TUNEL) have been previously de-scribed (21). The following primary antibodies wereused: guinea pig anti-insulin (Dako), 1:2,000; mouseanti-Nkx6.1 (BCBC #2023), 1:500; rabbit anti-Glut2(Millipore), 1:1,000; rabbit anti-Glp1r (S. Heller, NovoNordisk), 1:2,000; rat anti-GFP (C. Kioussi, Oregon StateUniversity), 1:1,000; rabbit anti-Ki67 (Laboratory Vi-sion), 1:500; rabbit anti-Ucn3 (M. Huising, University ofCalifornia, Davis), 1:500; rabbit anti-MafA (Bethyl),1:200; and rabbit anti-Pdx1 (Abcam), 1:500. Stainingwith antibodies raised in mice was performed using theM.O.M. Kit (Vector Laboratories). When necessary, nucleiwere counterstained with DAPI (Sigma) at 0.1 mg/mL.Primary antibodies were detected with donkey-raised sec-ondary antibodies conjugated to Cy3, Cy5, or Alexa 488(Jackson ImmunoResearch). b-Cell mass and marker+

area were determined as described (21). Images were cap-tured on a Zeiss Axio Observer Z1 microscope with anApoTome module and processed with Zeiss AxioVision4.8 software. All images were processed in accordancewith Diabetes journal guidelines.

The quantitative RT-PCR (qRT-PCR) analysis was per-formed as previously described (17) on total RNA isolatedfrom postnatal day 2 pancreata from individual mice. Prim-ers used are as follows: Nkx6.1 (f-CTTCTGGCCCGGAGTGATG; r-GGGTCTGGTGTGTTTTCTCTTC), Ucn3 (f-GCTGTGCCCCTCGACCT; r-TGGGCATCAGCATCGCT), Adh1 (f- GCAAAGCTGCGGTGCTATG; r-TCACACAAGTCACCCCTTCTC),Angptl7 (f- TGACTGTTCTTCCCTGTACCA; r-CAAGGCCACTCTTACGTCTCT), Dlk1 (f-CCCAGGTGAGCTTCGAGT; r-GGAGAGGGGTACTCTTGTTGAG), Gstm2 (f-ACACCCGCATACAGTTGGC; r-TGCTTGCCCAGAAACTCAGAG), Zyx (f-TCCCACCGCAGGTATCATC; r-GGAGCTAGAAGGGGTCTTCCA), andGapdh (f-CATGTTCCAGTATGACTCCACTC; r-GGCCTCACCCCATTTGATGT).

Glucose tolerance tests and blood glucose measurementswere performed as described (17). For glucose tolerancetests, a 1.5 g/kg body weight intraperitoneal injection ofglucose was administered after overnight fasting.

All values are shown as mean 6 SEM; P values werecalculated using a two-tailed Student t test in MicrosoftExcel. P , 0.05 was considered significant.

RESULTS

Nkx6.1 Inactivation in Embryonic b-Cells CausesHyperglycemia and Reduced b-Cell MassTo investigate the role of Nkx6.1 in perinatal b-cell de-velopment, we intercrossed mice to generate progeny car-rying a Nkx6.1 null allele (Nkx6.12), a Nkx6.1 conditionalloss of function allele (Nkx6.1flox), and the rat insulin2-Cretransgene (RIP-Cre). Additionally, the mice carried a con-ditional YFP reporter gene targeted to the Rosa-26 locus(R26-YFP), resulting in heritable YFP expression upon

Figure 1—Nkx6.1 deletion in newly formed b-cells leads to glucoseintolerance and reduced b-cell mass. A: Schematic of alleles andtransgenes used to inactivate Nkx6.1 in fetal b-cells. Rectanglesshow coding sequences; triangles show loxP sites; red rectangleshows DsRed coding sequence. B and C: Immunofluorescencestaining for Nkx6.1 and insulin reveals loss of Nkx6.1 in most b-cellsof Nkx6.1Δb mice at P0. D: Blood glucose levels in 6-week-oldNkx6.1Δb mice fed ad libitum compared with control mice (n = 6).E: Intraperitoneal glucose tolerance test shows glucose intolerancein 6-week-old Nkx6.1Δb mice as compared with control mice (n = 6).F: Quantification of b-cell mass reveals decreased b-cell mass inNkx6.1Δb mice at 6 weeks of age (n = 3). Data shown as mean 6SEM. Scale bars = 20 mm. Ins, insulin; YFP, yellow fluorescent pro-tein. *P < 0.05; **P < 0.01.

898 Nkx6.1 Regulates Postnatal b-Cell Growth Diabetes Volume 64, March 2015

RIP-Cre-mediated recombination of a translational stopsignal. Thus, in RIP-Cre;Nkx6.1flox/-;R26-YFP (hereafter re-ferred to as Nkx6.1Δb) mice, YFP labels all cells in whichNkx6.1 has been inactivated (Fig. 1A).

Nkx6.1Δb mice were born with the expected Mendelianfrequency (data not shown). Consistent with previousreports showing incomplete targeting of b-cells by the

RIP-Cre transgene (20), most but not all b-cells were devoidof Nkx6.1 at birth (Fig. 1B and C). At 6 weeks of age,Nkx6.1Δb mice exhibited significantly elevated blood glucoselevels (Fig. 1D) and impaired glucose tolerance after intraper-itoneal injection of a glucose bolus (Fig. 1E). To investigatewhether Nkx6.1 deficiency affects postnatal b-cell growth,we examined b-cell mass in Nkx6.1Δb mice. Compared with

Figure 2—Nkx6.1 is required for postnatal b-cell mass expansion. A: Quantification of the insulin immunofluorescent area relative to totalpancreatic area reveals no difference in b-cell mass between Nkx6.1Δb and control mice at P0 and a slight but not significant decrease atP4 (n = 3). B–G’’: Immunofluorescence staining for insulin, Nkx6.1, and YFP at P0 (B–C’’ ), P4 (D–E’’ ), and 6 weeks of age (F–G’’ ). H:Quantification of insulin+ cells expressing YFP at P0, P4, and 6 weeks shows a progressive decrease of YFP+ recombined b-cells inNkx6.1Δb mice postnatally (n = 3). I: Quantification of insulin+ cells expressing Nkx6.1 reveals a progressive increase of Nkx6.1-expressingunrecombined b-cells in Nkx6.1Δb mice between P0 and 6 weeks of age (n = 3). Data shown as mean 6 SEM. Scale bar = 20 mm. Ins,insulin; YFP, yellow fluorescent protein. *P < 0.05; **P < 0.01; ***P < 0.001.

diabetes.diabetesjournals.org Taylor, Benthuysen, and Sander 899

littermate controls, 6-week-oldNkx6.1Δb mice exhibited a 40%reduction in b-cell mass (1.26 6 0.05 mg in Nkx6.1Δb

mice vs. 2.13 6 0.29 mg in controls) (Fig. 1F). ThusNkx6.1 is necessary to establish appropriate b-cell mass.

Nkx6.1 Is Required for Postnatal, but Not Prenatal,b-Cell Mass ExpansionTo determine when b-cell mass is first affected inNkx6.1Δb mice, we measured the relative insulin+ areain Nkx6.1Δb mice immediately after birth. In contrast to6-week-old mice, b-cell mass in neonatal Nkx6.1Δb micewas indistinguishable from control mice (Fig. 2A), show-ing that Nkx6.1 is required for postnatal expansion butnot for establishing prenatal b-cell mass.

Because RIP-Cre-mediated recombination of theNkx6.1flox allele is mosaic and did not delete Nkx6.1 inall b-cells (Fig. 1C), both unrecombined Nkx6.1+ andrecombined Nkx6.1-deficient b-cells can contribute tob-cell growth in Nkx6.1Δb mice. To investigate the con-tribution of recombined b-cells to postnatal b-cell massexpansion, we quantified the percentage of recombinedb-cells in Nkx6.1Δb and control mice. In line with ourobservation that Nkx6.1 is dispensable for prenatalb-cell growth (Fig. 2A), the percentage of recombinedYFP+ b-cells was similar in newborn Nkx6.1Δb and controlmice (73 6 1.4% in Nkx6.1Δb mice vs. 76 6 9.5% incontrol mice) (Fig. 2B–C’’ and H). Consistent with a slightdecrease in overall b-cell mass in Nkx6.1Δb mice at post-natal (P) day 4 (Fig. 2A), a reduction in the percentage ofrecombined b-cells was discernable in Nkx6.1Δb mice byP4 (Fig. 2D–E’’ and H). At 6 weeks of age, the reduction ofYFP+ b-cells was highly significant (15 6 2.02% of b-cellsin Nkx6.1Δb mice vs. 83 6 1.72% in control mice) (Fig.2F–H). The decrease of YFP+ b-cells in Nkx6.1Δb mice wasaccompanied by an age-dependent increase in the per-centage of b-cells expressing Nkx6.1 (Fig. 2B–G’’ and I).Closely mirroring the reported 82% recombination effi-ciency of the RIP-Cre transgene (20), 27 6 1.41% ofb-cells expressed Nkx6.1 in newborn Nkx6.1Δb mice(Fig. 2I). This percentage increased significantly to 40 63.75% at P4 (Fig. 2I). These findings indicate that a selec-tive disadvantage becomes apparent for Nkx6.1-deficientb-cells shortly after birth.

Postnatal, but Not Prenatal, b-Cell ProliferationDepends on Nkx6.1We next investigated whether the postnatal b-cell growthdefect in Nkx6.1Δb mice is caused by reduced b-cell pro-liferation and/or survival. First, we examined the possi-bility that Nkx6.1 deficiency causes increased b-cellapoptosis by performing TUNEL assays on pancreatic sec-tions. Virtually no TUNEL+ b-cells were detected in eitherNkx6.1Δb or control mice at P4 (Fig. 3A–C), indicatingthat apoptosis does not account for the negative selectionof Nkx6.1-deficient b-cells. By contrast, analysis of b-cellproliferation by immunofluorescence staining for Ki67, in-sulin, and YFP in Nkx6.1Δb mice at P4 revealed reducednumbers of Ki67+ b-cells (Fig. 3F–H). Quantification of

Figure 3—Nkx6.1 is required for postnatal b-cell proliferation. A–C:b-Cells are not apoptotic at P4 in Nkx6.1Δb or control mice basedon TUNEL combined with immunofluorescence staining for insulinand DAPI. TUNEL+ cells in the pancreas are shown as a positivecontrol (arrowheads) and TUNEL+insulin+ cells were quantified.D–G’’’: Immunofluorescence staining for insulin, Ki67, and YFP atP0 and P4. H: Quantification of the percentage of insulin+YFP+ cellsexpressing Ki67 shows decreased b-cell proliferation in Nkx6.1Δb

mice at P4, but not at P0 (n = 3). I: Quantification of Ki67-expressingYFP+insulin+ cells and YFP2insulin+ cells in Nkx6.1Δb mice at P4reveals a selective decrease in proliferation of recombined com-pared with unrecombined b-cells within the same animal (n = 3).Data shown as mean 6 SEM. Scale bar = 20 mm. Ins, insulin; YFP,yellow fluorescent protein. *P < 0.05; **P < 0.01.

900 Nkx6.1 Regulates Postnatal b-Cell Growth Diabetes Volume 64, March 2015

Ki67+YFP+ b-cells showed a threefold decrease in b-cellproliferation in 4-day-old Nkx6.1Δb compared with controlmice (4.48 6 1.01% in Nkx6.1Δb mice vs. 13.00 6 1.58%in control mice) (Fig. 3H). Consistent with our finding that

Nkx6.1 inactivation does not affect prenatal b-cell growth(Fig. 2A), the frequency of Ki67+ b-cells did not differbetween Nkx6.1Δb and control mice at P0 (2.67 6 1.14%in Nkx6.1Δb mice vs. 1.78 6 1.05% in control mice)

Figure 4—Nkx6.1 inactivation leads to a cell autonomous loss of b-cell maturation and nutrient sensing markers. Immunofluorescencestaining for insulin, Pdx1, and YFP (A–C’’’ ) or insulin, MafA, and YFP (D–F’’’ ) shows Pdx1 but not MafA expression in recombinedYFP+insulin+ cells of Nkx6.1Δb mice at P4. Unrecombined YFP2insulin+ cells express Pdx1 and MafA in Nkx6.1Δb mice. G: qRT-PCRanalysis of pancreata from Nkx6.1Δb and control mice at P2 for genes associated with b-cell maturation (n = 3). Immunofluorescencestaining for insulin, Ucn3, and YFP (H–J’’’ ); insulin, Glut2, and YFP (K–M’’’ ); or insulin, Glp1r, and YFP (N–P’’’) shows loss of Ucn3, Glut2,and Glp1r expression in recombined YFP+insulin+ cells but not in unrecombined YFP2insulin+ cells of Nkx6.1Δb mice at P4. For eachmarker, representative areas are shown in lower panels for Nkx6.1Δb mice, as indicated by a dashed box in the merged middle panel. Whitearrowheads point to recombined YFP+insulin+ cells and blue arrowheads to unrecombined YFP2insulin+ cells. Data shown as mean 6SEM. Scale bar = 20 mm. Ins, insulin; YFP, yellow fluorescent protein. *P < 0.05; **P < 0.01.

diabetes.diabetesjournals.org Taylor, Benthuysen, and Sander 901

(Fig. 3D–E’’’ and H). Thus Nkx6.1 is required for b-cellproliferation and expansion during early postnatal lifebut is dispensable prenatally. Furthermore, the effect ofNkx6.1 deletion on b-cell proliferation is cell autonomous,as revealed by comparing proliferation rates betweenrecombined and unrecombined b-cells in Nkx6.1Δb miceat P4 (4.48 6 1.01% YFP+insulin+ cells vs. 11.0 6 0.93%YFP-insulin+ cells expressed Ki67) (Fig. 3I).

Nkx6.1 Deletion Causes a Cell Autonomous Loss ofMarkers for b-Cell Maturation and Nutrient SensingTo determine whether loss of Nkx6.1 affects other b-cellmarkers, we performed immunofluorescence staining forPdx1 and MafA. While Pdx1 was unaffected, MafA waslost in recombined Nkx6.1-deficient b-cells (Fig. 4A–F’’’ ).We further assessed whether Nkx6.1 regulates b-cell mat-uration markers. To this end, we selected genes found tobe significantly changed between immature and maturepostnatal b-cells (24) and performed qRT-PCR analysis onpancreata from control and Nkx6.1Δb mice at P2, whenb-cell mass is similar between Nkx6.1Δb and control mice(Fig. 2A). Of these genes, Ucn3, Adh1, Gstm2, and Zyxwere expressed at significantly lower levels in Nkx6.1Δb

mice, while Angptl7 and Dlk1 were unchanged (Fig. 4G–J’’’).These results suggest that Nkx6.1 regulates a subset ofgenes associated with b-cell maturation. Given the post-natal onset of the b-cell proliferation defect in Nkx6.1Δb

mice, we next investigated whether Nkx6.1-deficient b-cellsare able to receive feeding-induced signals that stimulateb-cell proliferation. We analyzed the expression of Glut2and the Glp1 receptor (Glp1r), which are known to havea role in the regulation of postnatal b-cell growth (14,16).In accordance with Glut2 being a direct Nkx6.1 target gene(17), Nkx6.1Δb mice exhibited a selective loss of Glut2 ex-pression only in recombined b-cells (Fig. 4K–M’’’). Similarly,recombined b-cells displayed a cell autonomous reductionin Glp1r expression (Fig. 4N–P’’’ ). The cell autonomousrole of Nkx6.1 in regulating b-cell proliferation, Glut2, andGlp1r expression argues against an Nkx6.1-dependentparacrine or systemic factor affecting b-cell proliferationin Nkx6.1Δb mice. These findings demonstrate thatNkx6.1-deficient b-cells lack key sensors for extrinsicstimuli of postnatal b-cell growth.

DISCUSSION

The role of Nkx6.1 in b-cell proliferation has been con-troversial. While in vitro studies have suggested a directrole of Nkx6.1 in stimulating b-cell proliferation throughthe regulation of Cyclin gene expression (18), in vivo over-expression of Nkx6.1 in b-cells showed no effect on b-cellproliferation or mass (19). Moreover, we have recentlyreported that b-cell-specific inactivation of Nkx6.1 inadult mice has no overt effect on b-cell mass (17). How-ever, due to the extremely low proliferation rate of b-cellsin adult animals (1), the role of Nkx6.1 in b-cell massexpansion could not be rigorously tested in this model.By ablating Nkx6.1 in newly formed b-cells of the embryo,

we here show that postnatal b-cell proliferation and massexpansion depends on Nkx6.1 activity. We found thatNkx6.1-deficient b-cells begin to exhibit reduced prolifer-ation between P0 and P4, which manifests in a measurabledecrease in the contribution of Nkx6.1-deficient b-cells tob-cell mass as early as P4. We have previously reportedthat Nkx6.1 deficiency leads to a loss of b-cell identityand, ultimately, their conversion into delta cells (21). It isimportant to note that this fate conversion occurs laterand is not yet observed at P4 (see Fig. 2E–E’’; all YFP+ cellsexpress insulin). Thus the reduced contribution ofNkx6.1-deficient b-cells to b-cell mass is caused by theproliferation defect and cannot be attributed to a b-to-delta–cell fate conversion.

Using chromatin immunoprecipitation sequencinganalysis, we have recently shown that Nkx6.1 does notbind to Cyclin gene regulatory regions (17). Therefore,Nkx6.1 is likely an indirect regulator of b-cell prolif-eration. Consistent with this idea, our current workshows that prenatal b-cell proliferation is unaffected inNkx6.1Δb mice. Interestingly, we found that the onset ofreduced b-cell proliferation in Nkx6.1Δb mice coincideswith birth and thus the beginning of food intake, suggest-ing that Nkx6.1 could enable b-cells to respond to nutrient-dependent inducers of b-cell proliferation. Supportingthis notion, Nkx6.1-deleted b-cells fail to express two im-portant nutrient sensors, Glut2 and Glp1r. At the transi-tion from prenatal to postnatal life, glucose becomes animportant stimulus of b-cell proliferation (16) and similarto Nkx6.1Δb mice, Glut2-deficient mice exhibit reducedb-cell proliferation during the early postnatal period (25).Since Glp1 regulates b-cell proliferation independent ofglucose (15), loss of Glut2 and Glp1r in Nkx6.1Δb micelikely have additive effects on b-cell proliferation. Inaddition to regulating nutrient sensors, we found thatNkx6.1 also regulates several markers associated with post-natal b-cell maturation (24). It is still largely unclearwhether and how these genes affect b-cell maturation,but the regulation of several of these genes by Nkx6.1suggests a role for Nkx6.1 in b-cell maturation. Collectively,our results demonstrate that Nkx6.1 controls multiple rel-evant pathways for postnatal b-cell development.

Acknowledgments. The authors thank S. Heller (Novo Nordisk) for anti-Glp1r, C. Kioussi (Oregon State University) for anti-GFP, and Mark Huising (Univer-sity of California, Davis) for anti-Ucn3 antibody. They are grateful to N. Rosenblattand FenFen Liu for technical assistance.Funding. This work was supported by the National Institutes of Health/NationalInstitute of Diabetes and Digestive and Kidney Diseases grant R01-DK-068471 toM.S. and the National Institutes of Health training grant T32-GM-008666-15 to J.B.Duality of Interest. No potential conflicts of interest relevant to this articlewere reported.Author Contributions. B.L.T. and J.B. designed and performed experi-ments, analyzed data, prepared figures, and wrote the manuscript. M.S. wrotethe manuscript. M.S. is the guarantor of this work and, as such, had full accessto all the data in the study and takes responsibility for the integrity of the data andthe accuracy of the data analysis.

902 Nkx6.1 Regulates Postnatal b-Cell Growth Diabetes Volume 64, March 2015

References1. Teta M, Long SY, Wartschow LM, Rankin MM, Kushner JA. Very slowturnover of beta-cells in aged adult mice. Diabetes 2005;54:2557–25672. Georgia S, Bhushan A. Beta cell replication is the primary mechanism formaintaining postnatal beta cell mass. J Clin Invest 2004;114:963–9683. Kushner JA, Ciemerych MA, Sicinska E, et al. Cyclins D2 and D1 are es-sential for postnatal pancreatic beta-cell growth. Mol Cell Biol 2005;25:3752–37624. Meier JJ, Butler AE, Saisho Y, et al. Beta-cell replication is the primarymechanism subserving the postnatal expansion of beta-cell mass in humans.Diabetes 2008;57:1584–15945. Finegood DT, Scaglia L, Bonner-Weir S. Dynamics of beta-cell mass in thegrowing rat pancreas. Estimation with a simple mathematical model. Diabetes1995;44:249–2566. Butler PC, Meier JJ, Butler AE, Bhushan A. The replication of beta cells innormal physiology, in disease and for therapy. Nat Clin Pract Endocrinol Metab2007;3:758–7687. Dor Y, Brown J, Martinez OI, Melton DA. Adult pancreatic beta-cells areformed by self-duplication rather than stem-cell differentiation. Nature 2004;429:41–468. Alonso LC, Yokoe T, Zhang P, et al. Glucose infusion in mice: a new modelto induce beta-cell replication. Diabetes 2007;56:1792–18019. Bonner-Weir S, Deery D, Leahy JL, Weir GC. Compensatory growth ofpancreatic beta-cells in adult rats after short-term glucose infusion. Diabetes1989;38:49–5310. Tarussio D, Metref S, Seyer P, et al. Nervous glucose sensing regulatespostnatal b cell proliferation and glucose homeostasis. J Clin Invest 2014;124:413–42411. Salpeter SJ, Klein AM, Huangfu D, Grimsby J, Dor Y. Glucose and agingcontrol the quiescence period that follows pancreatic beta cell replication. De-velopment 2010;137:3205–321312. Porat S, Weinberg-Corem N, Tornovsky-Babaey S, et al. Control ofpancreatic b cell regeneration by glucose metabolism. Cell Metab 2011;13:440–44913. Salpeter SJ, Klochendler A, Weinberg-Corem N, et al. Glucose regulatescyclin D2 expression in quiescent and replicating pancreatic b-cells throughglycolysis and calcium channels. Endocrinology 2011;152:2589–2598

14. Xu G, Stoffers DA, Habener JF, Bonner-Weir S. Exendin-4 stimulatesboth beta-cell replication and neogenesis, resulting in increased beta-cellmass and improved glucose tolerance in diabetic rats. Diabetes 1999;48:2270–227615. Buteau J, Foisy S, Rhodes CJ, Carpenter L, Biden TJ, Prentki M. Proteinkinase Czeta activation mediates glucagon-like peptide-1-induced pancreaticbeta-cell proliferation. Diabetes 2001;50:2237–224316. Swenne I. Glucose-stimulated DNA replication of the pancreatic islets duringthe development of the rat fetus. Effects of nutrients, growth hormone, andtriiodothyronine. Diabetes 1985;34:803–80717. Taylor BL, Liu FF, Sander M. Nkx6.1 is essential for maintaining thefunctional state of pancreatic beta cells. Cell Rep 2013;4:1262–127518. Schisler JC, Fueger PT, Babu DA, et al. Stimulation of human and rat isletbeta-cell proliferation with retention of function by the homeodomain transcrip-tion factor Nkx6.1. Mol Cell Biol 2008;28:3465–347619. Schaffer AE, Yang AJ, Thorel F, Herrera PL, Sander M. Transgenic over-expression of the transcription factor Nkx6.1 in b-cells of mice does not increaseb-cell proliferation, b-cell mass, or improve glucose clearance. Mol Endocrinol2011;25:1904–191420. Postic C, Shiota M, Niswender KD, et al. Dual roles for glucokinase inglucose homeostasis as determined by liver and pancreatic beta cell-specificgene knock-outs using Cre recombinase. J Biol Chem 1999;274:305–31521. Schaffer AE, Taylor BL, Benthuysen JR, et al. Nkx6.1 controls a generegulatory network required for establishing and maintaining pancreatic Beta cellidentity. PLoS Genet 2013;9:e100327422. Nelson SB, Schaffer AE, Sander M. The transcription factors Nkx6.1 andNkx6.2 possess equivalent activities in promoting beta-cell fate specification inPdx1+ pancreatic progenitor cells. Development 2007;134:2491–250023. Srinivas S, Watanabe T, Lin CS, et al. Cre reporter strains producedby targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol2001;1:424. Blum B, Hrvatin SS, Schuetz C, Bonal C, Rezania A, Melton DA. Functionalbeta-cell maturation is marked by an increased glucose threshold and by ex-pression of urocortin 3. Nat Biotechnol 2012;30:261–26425. Guillam MT, Hümmler E, Schaerer E, et al. Early diabetes and abnormalpostnatal pancreatic islet development in mice lacking Glut-2 [published cor-rection appears in Nat Genet 1997;17:503]. Nat Genet 1997;17:327–330

diabetes.diabetesjournals.org Taylor, Benthuysen, and Sander 903