11

Press report may2016 - normalesup.orgvorgogoz/press-reports/Press_report_… · *Corresponding author: [email protected] 5kU 4 . Gene Promoter H3K4me1 H 3K27ac H3K4me3 H3K27me3

Download PDF Report

Upload
others
View
2
Download
0

Embed Size (px)

Citation preview

Press report 2.VI.16Alex Peluffo - Orgogozo Lab

€¦ · Web viewThe positive expression of H3K4me3, which was immunohistochemically stained yellow or brown in the nucleus, was based on the combination of both intensity scores

€¦ · Web viewThe positive expression of H3K4me3, which was immunohistochemically stained yellow or brown in the nucleus, was based on the combination of both intensity scores

Documents

Advances in epigenetics link genetics to the environment ... · REVIEWRESEARCH by the ability of maternally deposited H3K27me3 to control DNA methylation-independent imprinting 42,43.An

Advances in epigenetics link genetics to the environment ... · REVIEWRESEARCH by the ability of maternally deposited H3K27me3 to control DNA methylation-independent imprinting 42,43.An

Documents

Oct4-Mediated Inhibition of Lsd1 Activity Promotes the ... · H3K4me1 at PpGe in F9 ECCs. We tested this prediction in P19 ECCs, in which Oct4 expression is strongly reduced post-differentiation

Oct4-Mediated Inhibition of Lsd1 Activity Promotes the ... · H3K4me1 at PpGe in F9 ECCs. We tested this prediction in P19 ECCs, in which Oct4 expression is strongly reduced post-differentiation

Documents

1 Regions of very low H3K27me3 partition the Drosophila genome

1 Regions of very low H3K27me3 partition the Drosophila genome

Documents

WDR5-H3K4me3 epigenetic axis regulates OPN expression to … · lentiCRISPRv2 (Genscript, Piscataway, NJ) plasmids containing scramble (GGAAGACTTAGTCGAATGAT) or Spp1- specific ( GCAAATCACTGCCAATCTCA)

WDR5-H3K4me3 epigenetic axis regulates OPN expression to … · lentiCRISPRv2 (Genscript, Piscataway, NJ) plasmids containing scramble (GGAAGACTTAGTCGAATGAT) or Spp1- specific ( GCAAATCACTGCCAATCTCA)

Documents

Supplemental Figure 7(1) p u t SUPPLEMENTAL FIGURE 2 A B H3K4me3 loci Title Supplemental Figure 7(1).ai Created Date 20161030123200Z

Supplemental Figure 7(1) p u t SUPPLEMENTAL FIGURE 2 A B H3K4me3 loci Title Supplemental Figure 7(1).ai Created Date 20161030123200Z

Documents

H3K4me3 is neither instructive for, nor informed by ... · H3K4me3 is neither instructive for, nor informed by, transcription. Struan C Murray1, Philipp Lorenz1, Françoise S Howe1,

H3K4me3 is neither instructive for, nor informed by ... · H3K4me3 is neither instructive for, nor informed by, transcription. Struan C Murray1, Philipp Lorenz1, Françoise S Howe1,

Documents

Cooperation between the H3K27me3 Chromatin Mark and Non … · Cooperation between the H3K27me3 Chromatin Mark and Non-CG Methylation in Epigenetic Regulation1 Shaoli Zhou2, Xiaoyun

Cooperation between the H3K27me3 Chromatin Mark and Non … · Cooperation between the H3K27me3 Chromatin Mark and Non-CG Methylation in Epigenetic Regulation1 Shaoli Zhou2, Xiaoyun

Documents

SU PPLEMENTAR Y INFORMATION10.1038... · Supplementary Figure 2. Genome browser representation of hESC ChIP-seq profiles at selected loci. Binding profiles for p300, H3K4me1, H3K27ac,

SU PPLEMENTAR Y INFORMATION10.1038... · Supplementary Figure 2. Genome browser representation of hESC ChIP-seq profiles at selected loci. Binding profiles for p300, H3K4me1, H3K27ac,

Documents

Home | Development - Cdk8 is required for establishment of H3K27me3 and gene ... · chromatin (Chaumeil et al., 2008). Initially, this repressive compartment is spatially separated

Home | Development - Cdk8 is required for establishment of H3K27me3 and gene ... · chromatin (Chaumeil et al., 2008). Initially, this repressive compartment is spatially separated

Documents

Computational aspects of ChIP-seq - Bioconductor · Relationship to gene expression! Cain et al., 2011! • The results suggest that changes in H3K4me3 status could explain between

Computational aspects of ChIP-seq - Bioconductor · Relationship to gene expression! Cain et al., 2011! • The results suggest that changes in H3K4me3 status could explain between

Documents

Bone morphogenetic protein 4 reduces global H3K4me3 to inhibit … · 2020. 1. 22. · 1 TITLE: Bone morphogenetic protein 4 reduces global H3K4me3 to inhibit proliferation and promote

Bone morphogenetic protein 4 reduces global H3K4me3 to inhibit … · 2020. 1. 22. · 1 TITLE: Bone morphogenetic protein 4 reduces global H3K4me3 to inhibit proliferation and promote

Documents

The Arabidopsis GAGA-Binding Factor BASIC PENTACYSTEINE6 ... · GAGA motifs in vitro. Consistently, GAGA motifs in promoters coincide with in vivo LHP1 target genes and H3K27me3 decoration

The Arabidopsis GAGA-Binding Factor BASIC PENTACYSTEINE6 ... · GAGA motifs in vitro. Consistently, GAGA motifs in promoters coincide with in vivo LHP1 target genes and H3K27me3 decoration

Documents

Dynamics of H3K4me3 Chromatin Marks Take the Lead over ... · chromatin marks on genome expression. 2.2. Meristem and differentiated tissues share similar over-all distribution of

Dynamics of H3K4me3 Chromatin Marks Take the Lead over ... · chromatin marks on genome expression. 2.2. Meristem and differentiated tissues share similar over-all distribution of

Documents

SUPPLEMENTARY INFORMATION An allosteric PRC2 inhibitor ... · SUPPLEMENTARY INFORMATION An allosteric PRC2 inhibitor targeting the H3K27me3 binding pocket of EED Wei Qi1,3, Kehao

SUPPLEMENTARY INFORMATION An allosteric PRC2 inhibitor ... · SUPPLEMENTARY INFORMATION An allosteric PRC2 inhibitor targeting the H3K27me3 binding pocket of EED Wei Qi1,3, Kehao

Documents

BIOCHEMISTRY Copyright © 2020 Coordinated regulation of ...BIOCHEMISTRY Coordinated regulation of cellular identity–associated H3K4me3 breadth by the COMPASS family Christie C

BIOCHEMISTRY Copyright © 2020 Coordinated regulation of ...BIOCHEMISTRY Coordinated regulation of cellular identity–associated H3K4me3 breadth by the COMPASS family Christie C

Documents

Nature Genetics: doi:10.1038/ng...5 Supplementary Figure 4 Profiles of H3K27ac, H3K4me3 and H3K4me1 over methylation haplotype blocks for 12 human adult tissue types. X -axis denote

Nature Genetics: doi:10.1038/ng...5 Supplementary Figure 4 Profiles of H3K27ac, H3K4me3 and H3K4me1 over methylation haplotype blocks for 12 human adult tissue types. X -axis denote

Documents

Peran Pulasan Imunohistokimia H3K27me3 dalam Diagnosis

Peran Pulasan Imunohistokimia H3K27me3 dalam Diagnosis

Documents

Multi-dimensional histone methylations for coordinated regulation … · 2019-03-20 · NucleicAcidsResearch,2017 5 A H3K4me3-N H3K4me3-H H3K9me3-N H3K9me3-H H3K27me3-N H3K27me3-H

Multi-dimensional histone methylations for coordinated regulation … · 2019-03-20 · NucleicAcidsResearch,2017 5 A H3K4me3-N H3K4me3-H H3K9me3-N H3K9me3-H H3K27me3-N H3K27me3-H

Documents

Cancer Research Review W4...ESR1 1, and the epigenome of histone H3 lysine 4 monomethylation (H3K4me1). The majority of the risk The majority of the risk- associated SNPs modulate

Cancer Research Review W4...ESR1 1, and the epigenome of histone H3 lysine 4 monomethylation (H3K4me1). The majority of the risk The majority of the risk- associated SNPs modulate

Documents

4 male, 4 female LCLs HumanChimpanzeeRhesus Macaque Expression: RNAseq Active Gene Marks: Pol II (ChIPseq) H3K4me3 (ChIPseq) Repressed Region Mark: H3K27me3

4 male, 4 female LCLs HumanChimpanzeeRhesus Macaque Expression: RNAseq Active Gene Marks: Pol II (ChIPseq) H3K4me3 (ChIPseq) Repressed Region Mark: H3K27me3

Documents

Discovery and validation of sub-threshold genome-wide ...compbio.mit.edu/publications/148_Wang_eLife_16.pdf · Enhancer enrichment in QT/QRS loci (z-score) 127 human tissues b H3K4me1-defined

Discovery and validation of sub-threshold genome-wide ...compbio.mit.edu/publications/148_Wang_eLife_16.pdf · Enhancer enrichment in QT/QRS loci (z-score) 127 human tissues b H3K4me1-defined

Documents

Gene Expression Differences Among Primates Are Associated ...Comparing expression proﬁles and H3K4me3-associated regions: Of the 14,526 genes with expression data and the 25,160

Gene Expression Differences Among Primates Are Associated ...Comparing expression proﬁles and H3K4me3-associated regions: Of the 14,526 genes with expression data and the 25,160

Documents

Computational aspects of ChIP-seq - Bioconductor · 2011-06-28 · Relationship to gene expression! Cain et al., 2011! • The results suggest that changes in H3K4me3 status could

Computational aspects of ChIP-seq - Bioconductor · 2011-06-28 · Relationship to gene expression! Cain et al., 2011! • The results suggest that changes in H3K4me3 status could

Documents

Low‑omatin prArabidopsis endosperm using CUT&RUNEndosperm H3K27me3 Peaks A B C 2-2 SE 2 -2 S2 E -2 S2 E Distance (kb) Normalized Reads H3 H3K27me3 IgG CUT&RUN with Endosperm Nuclei

Low‑omatin prArabidopsis endosperm using CUT&RUNEndosperm H3K27me3 Peaks A B C 2-2 SE 2 -2 S2 E -2 S2 E Distance (kb) Normalized Reads H3 H3K27me3 IgG CUT&RUN with Endosperm Nuclei

Documents

The effects of Alicine on ZNF703 Gene Expression in Gastric … · promoters with H3Kme1 or H3K4me3 labels suggesting Abstract—Cancer is the genetic disease of the somatic cells,

The effects of Alicine on ZNF703 Gene Expression in Gastric … · promoters with H3Kme1 or H3K4me3 labels suggesting Abstract—Cancer is the genetic disease of the somatic cells,

Documents

Single-molecule and in silico dissection of the interaction between … · nism: The EED subunit recognizes an existing H3K27me3 mark, which allosterically activates the methyltransferase

Single-molecule and in silico dissection of the interaction between … · nism: The EED subunit recognizes an existing H3K27me3 mark, which allosterically activates the methyltransferase

Documents

Elevated H3K27me3 levels sensitize osteosarcoma to cisplatin... · 2019. 1. 16. · RESEARCH Open Access Elevated H3K27me3 levels sensitize osteosarcoma to cisplatin Chao He1†,

Elevated H3K27me3 levels sensitize osteosarcoma to cisplatin... · 2019. 1. 16. · RESEARCH Open Access Elevated H3K27me3 levels sensitize osteosarcoma to cisplatin Chao He1†,

Documents

Avaliação da marca epigenética H3K4me3 como biomarcador ... · Objetivo: Avaliação da expressão da modificação epigenética pós-traducional das histonas H3K4me3 (trimetilação

Avaliação da marca epigenética H3K4me3 como biomarcador ... · Objetivo: Avaliação da expressão da modificação epigenética pós-traducional das histonas H3K4me3 (trimetilação

Documents

€¦ · XLS file · Web view · 2012-10-07H4K20me3 H3K36me3 H3K27me3 H3K9me3 H3K4me3 Protein.Names Gene.Names Protein.Descriptions Uniprot Peptides..seq. Unique.Sequence.Coverage

€¦ · XLS file · Web view · 2012-10-07H4K20me3 H3K36me3 H3K27me3 H3K9me3 H3K4me3 Protein.Names Gene.Names Protein.Descriptions Uniprot Peptides..seq. Unique.Sequence.Coverage

Documents