54
Primate Comparative Genomics “…man’s position in the animate world is an indispensable preliminary to the proper understanding of his relations to the universe and this again resolves itself, in the long run, into an inquiry into the nature and the closeness of the ties which connect him with those singular creatures (the Great Apes) whose history has been sketched in the preceding pages.” -Thomas H. Huxley -Man’s Place in Nature, 1894

Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

  • Upload
    others

  • View
    4

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Primate Comparative Genomics

“…man’s position in the animate world is an indispensable

preliminary to the proper understanding of his relations to the

universe – and this again resolves itself, in the long run, into an

inquiry into the nature and the closeness of the ties which connect

him with those singular creatures (the Great Apes) whose history

has been sketched in the preceding pages.”

-Thomas H. Huxley

-Man’s Place in Nature, 1894

Page 2: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Humans and Chimps

Homo sapiens 99.9% identical

Homo sapiens and Pan troglodytes 99.0% identical

Page 3: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Why sequence chimps?

Two white papers.

http://www.genome.gov/11008056

Page 4: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Chimps Are Resistant To Many

Human Diseases

Comparison of disease susceptibility between chimps and humans

Condition Human Chimp

HIV progression to AIDS common very rare

Influenza A symptoms moderate/severe mild

Hepatitus B/C complications moderate/severe mild

Plasmodium falciparum malaria susceptible resistant

Menopause universal rare

E. Coli K99 gastroenteritis resistant sensitive

Alzheimer’s disease pathology complete incomplete

Epithelial cancers common rare

Source: Olson, M.V. et al. White paper advocating the complete sequencing of the common chimpanzee, Pan troglyodytes, (2002)

Page 5: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Chimp sequence can inform our

unique population history

Kasserman et al (2001) Nat. Genet. 27: 155-56

Page 6: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Chimps can inform our unique

population history

• Fixation of deleterious

alleles during bottlenecks

• Chimp genome might offer

a “fix” to common diseases

speech+speech--

hypertension+

hypertension--

obesity+obesity--

bipedal+

bipedal--

speech+

hypertension+

obesity+

bipedal+

Page 7: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Chimp sequence can help detect

selection• Important to know the ancestral allele

• Over-representation of the non-ancestral allele can suggest selection

A

AA

AB B

BB

BB

B

B

BB

B

B

B

A

B

B

BB

A allele fixed in

Chimps

A and B are

polymorphic in

Humans

Page 8: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Only species appropriate for

comparison of fast moving regions

• Pericentric duplications

• Subtelomeric repeats

• Y-chromosome

• 5-7% of the genome is in large segmental

duplications

Page 9: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

What does the genome tell us?

• (Roughly) same size genome (3.1 GB)

• (Roughly) same number of genes (~20,500)

• (Roughly) same genes

• Large number of papers reporting specific

differences between human and chimps

• Many papers also claim to detect positive selection

on specific human genes

Not too much yet…

Page 10: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Let’s do the math

How many differences do we need to look at?

(3 x 109 bp) (1% divergence) (50% in humans) = 15 million bp

In coding DNA?

(15 million bp) (1.5% coding) (75% non-synonomyous) =169,000 bp

or about 7 non-synonomyous changes per gene

Non-coding DNA?

(15 million bp) (3.5% under selection) = 525,000 bp

Page 11: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

What are the possibilities?

• Gene loss

• Gene gain

• Gene mutation (a few or many)

• Gene regulation

• Something else?

Page 12: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Inter- versus Intraspecific

Variation

He (man) resembles them (apes) as they

resemble one another – he differs from

them as they differ from one another.

-Thomas Huxley

-Man’s Place in Nature, 1894

Page 13: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Gene Loss

Hypothesis: Humans have lost (one or

more) genes compared to chimps, and

it is the loss of those functions that

accounts for our “humanness”

Page 14: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Sialic Acid Biologyan example of database mining

Chou et al. (1998) Proc. Natl. Acad. Sci. USA 95, 11751-11756

• Apes have lots of Neu5Gc, humans very little

• Neu5Gc is located on the surface of epithelial cells

• Neu5Gc is present in very low levels in the brain even

in animals that have lots of Neu5Gc

hydroxylase

humanchimpgorillamouse

A 92 bp deletion in the CMP-Neu5a

hydroxylase is specific to the

human lineage

ATG

ATG

ATG

ATG

Page 15: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Indels are ~50% of human-chimp differences

Frazer et al (2003) Genome. Res. 13: 341-346

Locke et al. (2003) Genome. Res. 13: 347-357

Page 16: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Gene Gain

Hypothesis: Humans have gained (one

or more) genes compared to chimps, and

it is the gain of these new functions that

accounts for our “humanness.”

Page 17: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Morpheus Gene Family

Johnson et al. (2001) Nature 413:514-519

Page 18: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Morpheus Gene family

Johnson et al. (2001) Nature 413:514-519

• 20 Kb duplicated segment on short arm of

chromosome 16

• 98% identity in introns/non-coding DNA,

81% identity in exonic DNA

• Ka/Ks tests indicate (possibility of) extreme

positive selection

• Gene family has no homology to known

genes

Page 19: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Morpheus Gene Family

Page 20: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Gene Mutation

Hypothesis: Humans acquired (one or

more) substitutions in the coding

regions of their genes that alter the

functions of those proteins so as to

account for our “humanness.”

Page 21: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

What about organism specific substitutions?

http://sayer.lab.nig.ac.jp/~silver/

C-C chemokine receptor (nucleotides 1 to 60)

Human_1 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC

Human_2 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC

Human_3 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC

Human_4 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC

Chimp_1 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCGATTATTATACATCGGAGCCCTGC

Chimp_2 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCGATTATTATACATCGGAGCCCTGC

Chimp_3 ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCGATTATTATACATCGGAGCCCTGC

Goril_1 ATGGATTATCAAGTGTCAAGTCCAACCTATGACATCGATTATTATACATCGGAGCCCTGC

Goril_2 ATGGATTATCAAGTGTCAAGTCCAACCTATGACATCGATTATTATACATCGGAGCCCTGC

Goril_3 ATGGATTATCAAGTGTCAAGTCCAACCTATGACATCGATTATTATACATCGGAGCCCTGC

************************* ********** ***********************

Problem: How can we make a conclusion based on one substitution?

Page 22: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Detecting Selective Sweeps

• Selective sweeps are (thought to be) accompanied

by a local reduction in diversity

• Test for overabundance of low frequency alleles

(Tajima’s D)

Apadted from Carroll, S. (2003) Nature 422:849-57

beneficial mutation arisesSelection drives

mutation to fixationmutation/recombination

Page 23: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

FOXP2, The Human Speech Gene?1) Mapped in families with inherited speech

defects (normal IQ)

2) Forkhead transcription factor

FOXP2 Nucleotide Substitutions

Enard et al. (2002) Nature 418, 869-72

Page 24: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

FOXP2, The Human Speech Gene?

Enard et al. (2002) Nature 418, 869-72

• Sequencing of adjacent non-coding DNA

revealed an excess in the number of low

frequency alleles relative to what would be

expected given neutral DNA in a randomly

mating population of constant size

• Tajima’s D = -2.20 (P<0.01)

Page 25: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Gene Expression

Hypothesis: It is not the structural

differences in proteins, but rather their

differences in expression between

humans and chimps that account for

our “humanness.”

Page 26: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Differences in Gene Expression in the Brain?Enard et al (2002) Science 296, 340-343.

microarrays

2D Gels

Page 27: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Neutral Theory of Gene

Expression?

• Consider how one might construct a neutral

theory of gene expression akin to the neutral

theory of gene mutation

Page 28: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

1) What is the sequence of the

normal Human Genome?

2) What accounts for the genetic

differences between individuals?

Page 29: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Finding Segmental Duplications in the

Human Genome

Bailey et al (2002) Science 297:1003-07

Page 30: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Segmental Duplications in the Human Genome

Bailey et al (2002) Science 297:1003-07

Page 31: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Polymorphism in Segmental Duplications

Iafrate et al (2004) Nat Genet 36:949-51

Page 32: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Polymorphism in Segmental

Duplications

• CGH studies find many copy number polymorphisms in segmental duplications (~12 per individual)

• Rare and common polymorphisms

• Many overlap coding regions

• Critical for the interpretation of amplifications in cancers

• Responsible for phenotypic differences between people?

Page 33: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

SNPs/Hap Map/1000 Genomes

The International HapMap Project is a multi-country effort to

identify and catalog genetic similarities and differences in human

beings. Using the information in the HapMap, researchers will be

able to find genes that affect health, disease, and individual

responses to medications and environmental factors. The Project is

a collaboration among scientists and funding agencies from Japan,

the United Kingdom, Canada, China, Nigeria, and the United

States. All of the information generated by the Project will be

released into the public domain

Page 34: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Questions

1. How many sub-populations best partition the

data?

2. How strong is the evidence for the clusters?

3. Do the inferred clusters correspond to our

notions of race, ethnicity, ancestry, or

geography?

4. Given the inferred clusters can we accurately

can we classify new individuals?

5. Can we identify population admixture or

migration events?

Page 35: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Attempts to group humans by genotype

Page 36: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

and Fst

1. , average nucleotide diversity

(~1 in 1000 bp)

2. Fst, proportion of genetic variation that can

be ascribed to differences between

populations (~10%)

Page 37: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Summary of Findings

• and Fst are small

• Diversity within “African” populations is

highest

• Unsupervised clustering tends to support

either 3 or 4 sub-populations depending on

number and type of markers and individuals

included in the study, but the composition

of the groups are often different in different

studies

Page 38: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

A contradiction?

• Although they differed on the extent and

composition of sub-populations, so far all

studies have found evidence of significant

sub-structure in human populations

• And yet, all studies agree that Fst is small

(between 3-15%)

See review by Jorde and Wooding (2004) Nature Genet. 36: S28-S33

Page 39: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Small Fst does not imply lack of structure

A1

D2

B2

A1

B2

A1

A1

A1

A2A2

D2A1C1

C2

A1

B1

B1

B1

A1

C1A2

D1

A2

A1C2

A1

D2

C2

D1D1

A1

C1

D1

B2E2

E2

E1E1E1

E1

E2

E2

E2

C2

Page 40: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Clustering human populations by

genotype

K-means clustering of gene expression data

• Pick a number (k) of cluster centers

• Assign every gene to its nearest cluster center

• Move each cluster center to the mean of its assigned genes

• Repeat 2-3 until convergence

EM-based clustering of genotype data

• Pick a number (k) of sub-populations

• Assign every individual to a sub-population based on the allele frequencies in the sub-population

• Recalculate the allele frequencies in each sub population

• Repeat 2-3 until convergence

Page 41: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

An ExampleI1= (A1,B1,C2)

I2= (A1,B1,C2)

I3= (A1,B2,C2)

I4= (A2,B2,C1)

I5= (A1,B1,C1)

I6= (A1,B1,C2)

I7= (A1,B1,C2)

I8= (A2,B2,C2)

I9= (A1,B2,C1)

I10= (A2,B1,C2)

I11= (A2,B2,C2)

I12= (A2,B2,C2)

12 individuals genotyped at three

different independent biallelic loci

Page 42: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

k1 k3k2

I1= (A1,B1,C2)

I2= (A1,B1,C2)

I3= (A1,B2,C2)

I4= (A2,B2,C1)

I5= (A1,B1,C1)

I6= (A1,B1,C2)

I7= (A1,B1,C2)

I8= (A2,B2,C2)

I9= (A1,B2,C1)

I10= (A2,B1,C2)

I11= (A2,B2,C2)

I12= (A2,B2,C2)

F(A1)k1=0.75

F(B1)k1=0.5

F(C1)k1=0.25

F(A1)k2=0.75

F(B1)k2=0.75

F(C1)k2=0.25

F(A1)k3=0.25

F(B1)k3=0.25

F(C1)k3=0.25

Consider individual I1= (A1,B1,C2)

P(I1 in k1) = (.75)(.5)(.75) = 0.28

P(I1 in k2) = (.75)(.75)(.75) = 0.42

P(I1 in k3) = (.25)(.25)(.75) = 0.046

Therefore reassign I1 to k2

Page 43: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

An exampleBamshad et al (2003) Am. J. Hum. Genet. 72:578-89

Page 44: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

But…Bamshad et al (2003) Am. J. Hum. Genet. 72:578-89

Page 45: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Genes mirror geography in EuropeNovembre et al. Nature 456, 98-101

Page 46: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Pharmacogenomics

• Many drugs never reach the market because

of side effects in a small minority of

patients

• Many drugs on the market are efficacious in

only a small fraction of the population

• This variation is (in part) due to genetic

determinants

– OrissaEGF mutations

– Codeinecytochrome P450 alleles

Page 47: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Question: Is race, ancestry, ethnicity,

geography or genetic substructure a

reasonable proxy for genotype at

alleles relevant for drug metabolism?

Answer: So far…No. Still looks as if we will have to genotype

the relevant loci before making any guesses

Page 48: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Population genetic structure of

variable drug response.Wilson et al (2001) Nat Genet. 29: 265-269

A = African

B = European

C = Asian

A B C

CYP1A2

GSTM1

CYP2C19

DIA4

NAT2

CYP2D6

Page 49: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Evidence for Archaic Asian Ancestry on

the Human X ChromosomeGarrigan et al. (2005) Mol. Biol. And Evol. 22:189-192

1) Pseudogene on the X-chromosome

2) 18 substitutions between human-chimp

3) 15 substitutions between two human alleles

4) Assuming a molecular clock the split between

the two human alleles is about 2 million years

5) Both alleles found in southern Asia, only one

allele found in Africa

6) Only human gene tree to “root” in Asia

Page 50: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Garrigan et al. (2005) Mol. Biol. And Evol. 22:189-192

Page 51: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Garrigan et al. (2005) Mol. Biol. And Evol. 22:189-192

Page 52: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Human evolution in a nutshell

chimpsH. sapien

H. ergaster

H. erectus

H. neanderthalis

5-6 mya

1 mya

0.5 mya

0.2 mya

Page 53: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

Human evolution in a nutshell

chimpsH. sapien

H. ergaster

H. erectus

H. neanderthalis

5-6 mya

1 mya

0.5 mya

0.2 mya?

Page 54: Primate Comparative Genomicsgenetics.wustl.edu/bio5488/files/2018/04/... · Human Diseases Comparison of disease susceptibility between chimps and humans ... Epithelial cancers common

So what happened?

1. Strong selection for the Asian allele in southern Asia

-not likely since this is a pseudogene locus

-fails Tajima’s D test

2. Gene flow between H. sapien and H.erectus in

southern Asia

-branch lengths are about right for 2 million years of divergence

-H. erectus was in southern Asia until 18,000 years ago

(Morwood et al. and Brown et al. in Nature (2004) vol

431.)

-supporting evidence from genetic analysis of lice and other

human parasites (Reed et al (2004) PLoS 2:1972-83)