Probing the Acute and Chronic Inflammation in Pcyt2 ETKO Mouse

Model of Metabolic Syndrome

by

Albert Yu-Yao Chang

A Thesis

presented to

The University of Guelph

In partial fulfillment of requirements

for the degree of

Master of Science

in

Human Health and Nutritional Sciences

Guelph, Ontario, Canada

© Albert Yu-Yao Chang, December, 2013

ABSTRACT

PROBING THE ACUTE AND CHRONIC INFLAMMATION IN PCYT2 ETKO

MOUSE MODEL OF METABOLIC SYNDROME

Albert Chang Advisor:

University of Guelph, 2013 Dr. Marica Bakovic

CTP: phosphoethanolamine cytidylyltransferase (Pcyt2) catalyzes the rate-limiting step

of the Kennedy pathway. Pcyt2 heterozygous knockouts (ETKO) suffer from adult onset

obesity, liver steatosis, hypertriglyceridemia, and insulin resistance. This thesis project

demonstrated that Pcyt2 ETKO obesity increases liver sensitivity to acute inflammation since

enhanced LPS induction of hepatic pro-inflammatory cytokine TNFα and suppressed

anti-inflammatory cytokine IL-10 genes expression was detected in ETKO mice than wildtype

(WT) mice leading to more TNFα damage and less IL-10 protection. ETKO had higher

hepatic NF-κBp65 protein level than WT indicating that Pcyt2 ETKO obesity results in

chronic hepatic inflammation. Sea buckthorn extract treatment reduced 4 symptoms of

metabolic syndrome in Pcyt2 ETKO mice specifically decreased body weight, lowered tissue

lipids (and consequently alleviated NAFL) and blood glucose levels.

iii

Acknowledgments

Firstly, I like to acknowledge my advisor Dr. Marica Bakovic for accepting me

as a MSc student and for her continuous support throughout the years. Next, I like to

thank Dr. Lindsay Robinson for serving on my advisory committee and for her

guidance throughout my time in the department. Thanks to Dr. William Bettger for

serving as my thesis defence chair. Also, I like to acknowledge members of the

Bakovic lab specifically Dr. Ratnesh Singh, Zvezdan Pavlovic, Poulami Basu, Laila

Schenkel, Mandy Stefanson, Jessica Phulchand, Rameez Imtiaz, Shafeeq Armstrong,

and Nicholas Mozas for their assistance. OMAFRA and HHNS deserve credits for

their support. Thanks to Dr. Gopinadhan Paliyath for providing the extract. On a more

personal note, thank you to my family (Mom, Dad, and Rose), relatives, and friends

for the tremendous support and motivation.

iv

Table of Contents

Abstract ii

Acknowledgments iii

Table of Contents iv

List of Tables vi

List of Figures vii

List of Abbreviations ix

Chapter 1: Literature Review 1

Chapter 2: Rationale, Hypotheses, and Objectives 16

Chapter 3: Pcyt2 ETKO Obesity Increases Liver Sensitivity to LPS-Induced

Acute Inflammation and Results in Chronic Hepatic Inflammation

Introduction 19

Experimental Procedures 21

Results 27

Discussion 35

Conclusion 40

Chapter 4: Sea Buckthorn Extract Diet Alleviates Metabolic Syndrome in Pcyt2

ETKO

Introduction 41

Experimental Procedures 43

Results 48

Discussion 63

Conclusion 67

v

Chapter 5: General Discussion and Concluding Remarks 68

Bibliography 71

Appendix A: specific cytokine primers used in Chapter 3 PCR analyses 83

Appendix B: specific cytokine primers used for Chapter 4 PCR analyses 84

vi

List of Tables

Chapter 3:

Table 3.1 LPS treatment induction of hepatic cytokine gene expression

compared to untreated 38

Appendices:

Appendix A: specific cytokine primers used in Chapter 3 PCR analyses 83

Appendix B: specific cytokine primers used for Chapter 4 PCR analyses 84

vii

List of Figures

Chapter 1:

Figure 1.1- CDP-Ethanolamine Pathway in Pcyt2 ETKO mice 11

Chapter 3:

Figure 3.1- Body weight of WT and ETKO mice 27

Figure 3.2- Hepatic interleukin 12 (IL-12) gene expression with and without

LPS treatment 28

Figure 3.3- Hepatic tumor necrosis factor alpha (TNFα) gene expression with

and without LPS treatment 29

Figure 3.4- Hepatic interferon gamma (IFNγ) gene expression with and

without LPS treatment 30

Figure 3.5- Hepatic interleukin 10 (IL-10) gene expression with and without

LPS treatment 31

Figure 3.6- Hepatic transforming growth factor beta 1 (TGF-β1) gene

expression with and without LPS treatment 32

Figure 3.7- Hepatic NF-κBp65 protein western blot 33

Figure 3.8- Liver Immunohistochemistry 34

Chapter 4:

Figure 4.1- Body weight change in sea buckthorn extract treated and control

mice 49

Figure 4.2- Retroperitoneal adipose tissue weight after sea buckthorn extract

Treatment 50

Figure 4.3- Liver weight after sea buckthorn extract treatment 51

viii

Figure 4.4- Pre-treatment (sea buckthorn extract, 30 days) IP glucose

tolerance test (IPGTT) 53

Figure 4.5- Pre-treatment (sea buckthorn extract, 30 days) IPGTT AUC 54

Figure 4.6- Post-treatment (sea buckthorn extract, 30 days) IPGTT 56

Figure 4.7- Post-treatment (sea buckthorn extract, 30 days) IPGTT AUC 57

Figure 4.8- Hepatic interleukin 12 (IL-12) gene expression with and without

sea buckthorn extract treatment 59

Figure 4.9- Hepatic transforming growth factor beta 1 (TGF-β1) gene

expression with and without sea buckthorn extract treatment 61

Figure 4.10- Liver histology after sea buckthorn extract treatment 62

ix

List of Abbreviations

ACC acetyl-CoA carboxylase

AUC area under curve

BCA bicinchoninic acid

BMI body mass index

cDNA complementary deoxyribonucleic acid

COX-2 cyclooxygenase-2

CPT-1 carnitine palmitoyltransferase-1

CRP C-reactive protein

DAG diacylglycerol

DEPC diethylpyrocarbonate

DGAT1/2 diacylglycerol acyltransferase 1/2

EK ethanolamine kinase

EPT CDP-ethanolamine 1,2-diacylglycerol ethanolaminephosphotransferase

ER endoplasmic reticulum

ES embryonic stem

Eth ethanolamine

ETKO heterozygous knockout

G3PDH glyceraldehyde 3-phosphate dehydrogenase

x

IFNγ interferon γ

IgG immunoglobulin G

IL-10 interleukin 10

IL-12 interleukin 12

iNOS inducible nitric oxide synthase

IPGTT intraperitoneal glucose tolerance test

IRAK interleukin–1 receptor-associated kinase

JAK-STAT Janus kinase–signal transducer and activator of transcription

LBP LPS-binding protein

LPS lipopolysaccharide

mRNA messenger ribonucleic acid

MyD88 myeloid differentiation factor 88

NADPH nicotinamide adenine dinucleotide phosphate

NAFLD nonalcoholic fatty liver disease

NASH non-alcoholic steatohepatitis

NF-κB nuclear factor kappa-light-chain-enhancer of activated B cells

PBS phosphate buffered saline

PC phosphatidylcholine

PCR polymerase chain reaction

xi

Pcyt1 CTP: choline cytidylyltransferase

Pcyt2 CTP: phosphoethanolamine cytidylyltransferase

PE phosphatidylethanolamine

P-Eth phosphoethanolamine

PPAR peroxisome proliferator-activated receptor

PS phosphatidylserine

PSD PS decarboxylase

PVDF polyvinylidene difluoride

RNA ribonucleic acid

rpm revolutions per minute

SB sea buckthorn

TAG triacylglycerol

TG triglyceride

TGF-β1 transforming growth factor beta 1

TLR4 Toll-like receptor 4

TNFα tumor necrosis factor alpha

TRAF tumor necrosis factor receptor–associated factor

UPR unfolded protein response

WB western blotting

xii

WHO World Health Organization

WT wildtype

1

Chapter 1: Literature Review

Obesity and General Health

The World Health Organization (WHO) defined obesity as having a Body Mass

Index (BMI; body weight in Kg divide by the square of height in m) of 30 Kg/m2 or

greater (WHO, 2000). Obesity is a medical condition characterized by excess body

fat accumulation and is becoming more prevalent especially in the Western world to

the point of being a serious public health issue (Haslam and James, 2005). In Canada,

approximately one quarter of adults are obese (The Public Health Agency of Canada

and The Canadian Institute for Health Information, 2011). Similar prevalence exists in

the WHO European Region in which 23% of women and 20% of men are estimated to

be obese (WHO Europe, 2008). Obesity is one of the leading preventable causes of

death worldwide (Lopez et al., 2006). Causes of obesity include overeating, inactive

lifestyle, and genetics among others. In terms of genetics, variations of certain

candidate genes including many genes that are highly expressed in the central nervous

system may predispose individuals to obesity (Lee, 2009, Willer et al., 2009).

Examples of candidate genes with protein name in brackets include PCSK1

(Proprotein convertase subtilisin/kexin type 1), POMC (Pro-opiomelanocortin), and

MC4R (Melanocortin receptor 4) (Renström et al., 2009, Farooqi and O’Rahilly,

2006).

2

This disease is a risk factor for a number of diverse diseases including type 2

diabetes, hyperlipidemia, cardiovascular disease, osteoarthritis, various infections,

cancer, pulmonary diseases, liver disorder as well as systematic chronic low-grade

inflammation (Yang et al., 1997, National Institutes of Health Consensus

Development Panel on the Health Implications of Obesity, 1985, de Luca and Olefsky,

2008, Lumeng and Saltiel, 2011). Some of these diverse diseases are closely related to

components of metabolic syndrome which the International Diabetes Foundation

defined as central adiposity with at least two of the following: high triglyceride (TG),

low high-density lipoprotein cholesterol (HDL-C), hypertension, obesity, and/or

insulin resistance (Cherniack, 2011). Inflammation refers to vascular tissue (e.g. liver,

adipose tissue, and muscle) response to harmful stimuli such as pathogens, damaged

cells, or irritants (Ferrero-Miliani et al., 2007). Obesity affects multiple tissues and

organs namely brain, adipose tissue, liver, muscle, and blood vessels (Lumeng and

Saltiel, 2011). This disease activates brain and adipose tissue inflammatory pathways

leading to insulin resistance with final outcomes of hypothalamic inflammation and

adipocyte enlargement (Lumeng and Saltiel, 2011). In liver, muscle, and blood vessels,

elevated cytokines lead to hepatic and muscular insulin resistance as well as

atherosclerosis (Lumeng and Saltiel, 2011). The common condition that detriments all

these five systems is inflammation enabling classification of obesity as an

3

inflammatory disease to be appropriate. Obesity stimulates inflammatory response

that is involved in many components of classical inflammatory response to pathogen

such as systemic increases in acute phase proteins (e.g., C-reactive protein) and

circulating inflammatory cytokines (Lumeng and Saltiel, 2011).

Obesity and Liver Disease

The proposed pathogenesis of obesity-associated liver disease originates with

hepatic steatosis (fat accumulation as TG but without inflammation leading first to

non-alcoholic steatohepatitis (NASH; fat accumulation with liver inflammation) then

progressing to cirrhosis (replacement of liver tissue by fibrosis, scar tissue, and

regenerative nodules) ultimately resulting in liver failure (Yang et al., 1997, Lee, 1989,

Powell et al., 1990, Bacon et al., 1994, Ludwig et al., 1980, Marchesini et al., 2008,

Tran and Gual, 2013). The most likely mechanism of obesity-induced hepatic

inflammation starts with hepatic steatosis which activates stress/inflammatory

pathways (de Luca and Olefsky, 2008). Activated stress/inflammatory pathways

increase hepatocyte free fatty acid release which stimulates liver resident

macrophages called Kupffer cells to increase expression of TNFα, MCP1, and other

pro-inflammatory cytokines ultimately making the liver to be pro-inflammatory (de

Luca and Olefsky, 2008). Endoplasmic reticulum (ER) stress is another possible cause

of obesity-induced liver inflammation (de Luca and Olefsky, 2008). It is believed that

4

nutrient abundance overworks ER by increasing lipid accumulation and protein

synthesis, causing abnormal energy metabolism as well as inducing mechanical stress

(de Luca and Olefsky, 2008). This heightened synthetic state activates unfolded

protein response (UPR) and interferes with normal protein folding in which the

response is known to induce stress response pathways (de Luca and Olefsky, 2008). In

addition, iron accumulation possibly links obesity to liver inflammation. Obesity can

lead to nonalcoholic fatty liver disease (NAFLD) in which hepatic iron accumulation

is present in NAFLD (Kohgo et al., 2007, Aigner et al., 2008). Hepatic iron

accumulation may activate Kupffer cells and other hepatic macrophages resulting in

cytokine release, inflammatory cell recruitment and inflammation (Tran and Gual,

2013, MacDonald et al., 2001).

Cytokines

Cytokines are small signaling proteins such as interleukins and interferons that

regulate host responses to infection, immune responses, inflammation, and

trauma (Dinarello, 2000). Some cytokines called pro-inflammatory cytokines promote

inflammation whereas other cytokines termed anti-inflammatory cytokines suppress

the activity of pro-inflammatory cytokines and promote healing (Dinarello, 2000).

Examples of pro-inflammatory cytokines include interferon γ (IFNγ), tumor necrosis

factor-alpha (TNFα), and interleukin 12 (IL-12) (Yang et al., 1997, Francoeur et al.,

5

2004, Trinchieri, 1995). For anti-inflammatory cytokines, two examples are

interleukin 10 (IL-10) and transforming growth factor beta 1 (TGF-β1) (Li et al.,

2012). IFNγ regulates transcription of many genes (e.g. iNOS, CASP1, and SLC11A1)

involved in various cellular processes including nitric oxide production, apoptosis,

and antimicrobial mechanisms (Schroder et al., 2004). Il-12 activates natural killer

cells and is involved in the differentiation of naive T cells into Th1 cells (Schroder et

al., 2004, Hsieh et al., 1993). Il-10 activates Janus kinase which is one of the main

components of Janus kinase–signal transducer and activator of transcription

(JAK-STAT) signaling pathway important in transcriptional regulation (Tanuma et al.,

2001, Aaronson and Horvath, 2002).

Role of Kupffer Cells in Obesity

Kupffer cells are hepatic resident macrophages that clear portal blood endotoxin

(Yang et al., 1997). Endotoxin is also known as lipopolysaccharide (LPS) (Rietschel

et al., 1994). These cells also produce pro-inflammatory cytokines IFNγ, TNFα, and

IL-12 as well as anti-inflammatory cytokines IL-10 and TGF-β1 (Yang et al., 1997,

Decker, 1990, Grewe et al., 1994, Li et al., 2012, Clementi et al., 2009, Francoeur et

al., 2004, Trinchieri, 1995). LPS activates Kupffer cells triggering the production of

TNFα (Yang et al., 1997, Lanthier et al., 2011, Baffy, 2009, Abdel-Salam et al., 2012).

TNFα in turn promotes inflammation by stimulating pro-inflammatory lipid gene

6

expression specifically type II phospholipase A2 (PLA2), cyclooxygenase-2 (COX-2),

as well as inducible nitric oxide synthase (iNOS) (Dinarello, 2000). These genes

encode for enzymes that increase the synthesis of platelet-activating factor,

leukotrienes, prostanoids, and nitric oxide (Yang et al., 1997, Dinarello, 2000). In

addition, TNFα induces endothelial adhesion molecules leading to neutrophil

adhesion to endothelial surface with subsequent neutrophil emigration into tissues

(Dinarello, 2000). Furthermore, TNFα stimulates pro-inflammatory chemokine

synthesis (Dinarello, 2000). Neutrophil endothelial adhesion and neutrophil

emigration along with nitric oxide, platelet-activating factor, and leukotrienes lead to

inflammation, tissue damage, and loss of function (Dinarello, 2000). Work on ob/ob

mice and fa/fa rats demonstrated that obesity is associated with abnormal Kupffer cell

function specifically decreased phagocytic activity resulting in more endotoxin

staying in the systematic circulation (Yang et al., 1997). In addition, it seems that

there might be relative global dysfunction of Kupffer cell in obesity, indicated by

abnormal LPS induction of IL-10 and IL-12 (Yang et al., 1997).

Role of NF-κB

The transcription factor nuclear factor kappa-light-chain-enhancer of activated B

cells (NF-κB) is a protein complex involved in cellular responses to stimuli such as

cytokines, bacterial or viral antigens, free radicals, stress, oxidized low density

7

lipoprotein, and ultraviolet irradiation (Gilmore, 2006, Brasier, 2006, Perkins, 2007,

Gilmore, 1999, Tian and Brasier, 2003). NF-κB is composed of five distinct subunits:

p65 (RelA), p68 (RelB), p75 (c-Rel), p50 (NFkB1), and p52 (NFkB2), but only p65

can activate transcription (Zhu, Johnson, and Bakovic, 2008, Haffner, Berlato, and

Doppler, 2006). This transcription factor is inactive in cytoplasm when bound to

inhibitory IκB proteins (Wheeler, 2004, Reber et al., 2009). Upon stimuli (e.g. LPS),

IκB proteins are released from NF-κB and this transcription factor translocates to the

nucleus to become active (Wheeler, 2004, Reber et al., 2009). Once activated, NF-κB

controls transcription of multiple genes including cytokines (e.g. TNFα, IL-6, IL-1A),

cell adhesion molecules (e.g. CD44, CD209), acute phase genes (e.g. AGT, DEFB2),

and stress response genes (e.g. CYP2C11, CYP7B1) (Collart et al., 1990, Son et al.,

2008, Mori and Prager, 1996, Hinz et al., 2002, Liu et al., 2003, Brasier et al., 1990,

Kao et al., 2008, Morgan, Li-Masters, and Cheng, 2002, Dulos et al., 2005). NF-κB

activation also has several other outcomes such as superoxide generation through the

NADPH oxidase complex as well as pro-inflammatory cytokine production (TNFα,

IL-1, and IL-6) promoting inflammation (Kawai et al., 1999, Wheeler, 2004, Ulevitch

and Tobias, 1995). Since NF-κB controls transcription of cytokine genes and

expression of pro-inflammatory cytokines is elevated in obesity, NF-κB is also likely

to be elevated in this disease state.

8

ETKO as Mouse Model of Metabolic Syndrome

Two major types of mice obesity models have been established representing two

causes of obesity- diet and genetics. Typical example of a diet-induced obesity is the

C57BL/6J mouse strain fed with a high fat diet (60% of energy intake from fat) and

typical genetic models include the leptin-deficient ob/ob, the New Zealand Obese

(NZO/HlLt), the agouti mutated yellow obese, and the CTP: phosphoethanolamine

cytidylyltransferase (Pcyt2) heterozygous knockout (ETKO; Pcyt2 +/-) that our

laboratory created (Jackson Laboratory, 2002, Perfield II et al., 2012, Carrolla, Voisey,

and Van Daal, 2004).

The Pcyt2 ETKO mice are a valuable model for studying obesity since they

progressively gain weight and develop adult-onset obesity, liver steatosis, and

hyperlipidemia at 24-28 weeks old (Fullerton et al., 2009). Phosphatidylethanolamine

(PE), an important inner membrane phospholipid, is synthesized from

CDP-ethanolamine and diacylglycerol (DAG) by the Kennedy pathway (Figure 1.1).

The Kennedy pathway which consists of CDP-ethanolamine branch and CDP-choline

branch is the only route for de novo synthesis of PE (Bakovic et al., 2007, Pavlovic

and Bakovic, 2013, Figure 1.1). In the CDP-ethanolamine branch, ethanolamine

kinase converts ethanolamine to phosphoethanolamine which is subsequently

converted to the intermediate CDP-ethanolamine catalyzed by

9

CTP: phosphoethanolamine cytidylyltransferase (Pcyt2) (Bakovic et al., 2007,

Pavlovic and Bakovic, 2013, Figure 1.1). Pcyt2 catalyzes the rate-limiting step of the

Kennedy pathway (Gibellini and Smith, 2010). Finally,

CDP-ethanolamine:1,2-diacylglycerol ethanolaminephosphotransferase (EPT)

catalyzes PE formation from CDP-ethanolamine (Bakovic, Fullerton, and Michel,

2007, Pavlovic and Bakovic, 2013, Figure 1.1). In the CDP-choline branch,

phosphorylation of choline forming phosphocholine is executed by choline kinase

(Pavlovic and Bakovic, 2013). The analogous enzyme to Pcyt2 in the CDP-choline

branch is CTP: choline cytidylyltransferase (Pcyt1) which converts phosphocholine to

CDP-choline and CDP-choline is subsequently converted to phosphatidylcholine (PC)

(Bakovic, Fullerton, and Michel, 2007, Pavlovic and Bakovic, 2013). PE is formed

from PC via the intermediate conversion to phosphatidylserine (PS) (Bakovic,

Fullerton, and Michel, 2007, Pavlovic and Bakovic, 2013).

Pcyt2 +/- mice have lower CDP-ethanolamine as a result of partially knocking out

the Pcyt2 gene leading to lower rate of PE synthesis and higher availability of DAG

(another substrate in PE synthesis) (Figure 1.1). The excess DAG is then converted to

triacylglycerol (TAG) ultimately leading to Pcyt2 deficient disease phenotypes of

adult onset obesity, liver steatosis, hypertriglyceridemia, and insulin resistance

(Figure 1.1 and Fullerton et al., 2009). Metabolic adaptations to Pcyt2 deficiency lead

10

to the disease phenotype of hypertriglyceridemia. These adaptations include elevated

hepatic and intestinal lipoprotein secretion and stimulated expression and/or activity

of genes involved in lipid absorption, transport, and lipoprotein assembly (Singh et al.,

2012). In addition, lowered plasma TG clearance and utilization by peripheral tissues

work in concert leading to hypertriglyceridemia (Singh et al., 2012). Consistent with

another study, a conditional liver specific disruption of Pcyt2 results in liver steatosis

(Leonardi et al., 2009). We showed that complete Pcyt2 gene knockout is

embryonically lethal (Fullerton et al., 2007).

11

Figure 1.1- CDP-Ethanolamine Pathway in Pcyt2 ETKO mice

Pcyt2 gene disruption reduces CDP-ethanolamine and PE but increases DAG and TG.

Instead of being utilized to produce PE, DAG accumulates with excess DAG

subsequently being utilized to synthesize TG.

EPT: CDP-ethanolamine 1,2-diacylglycerol ethanolaminephosphotransferase

12

LPS: Damage, Obesity, and Liver Disease

Gram-negative bacteria in the small intestine, part of the gut flora, produce LPS

composed of an O-specific chain, a core oligosaccharide, and lipid A (Shea-Budgell et

al., 2006, Rietschel et al., 1994). LPS is also known as endotoxin serving as the major

component of the outer membrane of Gram-negative bacteria (Rietschel et al., 1994).

Together with soluble LPS-binding protein (LBP), LPS bind to the complex of

Toll-like receptor 4 (TLR4) and CD14 in macrophages (Kupffer cells) initiating a

variety of inflammatory signaling cascades (Wheeler, 2004, Rietschel et al., 1994). In

one of these cascades, LPS and LBP binding activates macrophages and downstream

molecules such as myeloid differentiation factor 88 (MyD88) and associated proteins

of interleukin–1 receptor-associated kinase (IRAK) and tumor necrosis factor

receptor–associated factor (TRAF) resulting in NF-κB activation (Hosoi et al., 2004,

Kawai et al., 1999, Zhang et al., 1999, Wheeler, 2004, Ulevitch and Tobias, 1995).

NF-κB activation has multiple outcomes such as superoxide generation through the

NADPH oxidase complex as well as pro-inflammatory cytokine production (TNFα,

IL-1, and IL-6) promoting inflammation (Kawai et al., 1999, Wheeler, 2004, Ulevitch

and Tobias, 1995). In terms of damage, LPS is a potent and even lethal toxin that

triggers a global activation of inflammatory responses that can lead to acute liver

failure and even death (Shea-Budgell et al., 2006, Baue, 1994, Livingston and Deitch,

13

1995, Wagner and Roth, 1999, Martin et al., 2003).

Obesity-related steatohepatitis shares histological resemblance with

alcohol-induced steatohepatitis (Yang et al., 1997, Ludwig et al., 1980, Diehl,

Goodman, and Ishak, 1988). In alcohol-related steatohepatitis, experimental data

suggested that LPS is involved in such pathogenesis (Yang et al., 1997, McClain et al.,

1993). Thus, it is tempting to speculate that LPS is also involved in the pathogenesis

of obesity-induced steatohepatitis. Therefore, obesity might prime individuals to liver

disease by increasing hepatic sensitivity to LPS (Yang et al., 1997).

Previous research found that obesity is associated with changes in LPS-induced

cytokine gene expression such that lower Il-12 and higher IFNγ expression was

detected in obese rats relative to normal control rats (Yang et al., 1997). Yang et al.

used leptin receptor-deficient fa/fa rats as obesity model and were uncertain if the

same result can be extrapolated to other models with different causes of obesity.

Sea Buckthorn

Sea buckthorn (Hippophae), a thorny deciduous shrub, is native to Asia and

Europe (Tirupathi Pichiah et al., 2012, Rousi, 1971). Sea buckthorn is a rich source of

vitamins A, C, E, and K as well as the two essential fatty acids specifically linoleic

acid (18:2n-6) and α-linolenic acid (18:3n-3) (Maheshwari et al., 2011, Pintea et al.,

2001, Kallio et al., 2002, Yang and Kallio, 2001, Franke and Muller, 1983, Quirin and

14

Gerard, 1993, Berezhnaya et al., 1993, Jabłczynska, Krawczyk, and Minkowski, 1994,

Moravcova et al., 1995, Zadernowski et al., 1997). Sea buckthorn is also rich in ω-9

oleic acid and ω-7 palmitoleic acid in which the latter is uncommon in plants (Yang

and Kallio, 2001, Franke and Muller, 1983, Quirin and Gerard, 1993, Jabłczynska,

Krawczyk, and Minkowski, 1994, Zadernowski et al., 1997, Ulchenko et al., 1995).

Furthermore, this plant is rich in phenolic compounds specifically flavonoids

including myricetin, quercetin, kaempferol, and isorhamnetin (Tirupathi Pichiah et al.,

2012, Maheshwari et al., 2011, Nijveldt et al., 2001).

Different parts of sea buckthorn have varying amounts of nutrients. For example,

sea buckthorn berries contain most of the ω-7 fatty acid whereas seeds contain high

levels of the two essential fatty acids (one ω-3 and one ω-6) (Suryakumar and Gupta,

2011). In addition to having high level of ω-7 fatty acid, berries are also rich in

various carotenoids namely zeaxanthin, α, β, δ-carotene, lycopene, β-cryptoxanthin,

and lutein (Kumar et al., 2011). Seeds, on the other hand, are a rich source of vitamin

E (Sne et al., 2013). Sea buckthorn is commercially available as tea, berry, oil, purée,

juice, skin cream, and gel.

In Tibetan and Mongolian traditional medicines, sea buckthorn was used to

improve digestive function and blood circulation as well as to treat cough and sputum

(Suryakumar and Gupta, 2011). Sea buckthorn exhibits many beneficial properties

15

including anti-inflammatory, immunomodulatory, hypoglycemic, hypolipidemic,

anti-atherogenic, antioxidant activity, and anticancer effects (Tirupathi Pichiah et al.,

2012, Geetha et al., 2003, Sharma et al., 2011, Geetha et al., 2005, Grey et al., 2010,

Ganju et al., 2005, Basu et al., 2007, Wang et al., 2011). However, this plant has not

been well studied in alleviating obesity and associated complications of steatosis,

hyperglycemia, and hepatic inflammation.

16

Chapter 2: Rationale, Hypotheses, and Objectives

The thesis is composed of two related projects using the same Pcyt2 ETKO

mouse model to study obesity and associated complications. The first project

investigates obesity pathology while the second project tests the medicinal properties

of sea buckthorn extract in obesity and associated complications. The specific

rationale, hypotheses, and objectives are described below:

For the first project:

Previous research found that obesity increases liver sensitivity to LPS using

leptin receptor-deficient fa/fa rats as obesity models, but authors were uncertain if the

same result can be extrapolated to other models with different causes of obesity (Yang

et al., 1997). Given LPS’s high potency and obesity’s high prevalence, it is imperative

to test if obesity increases liver sensitivity to endotoxin in other models such as Pcyt2

ETKO model in order to determine if obesity prime hepatic disease by increasing

liver sensitivity to LPS. The hypothesis is therefore: obesity increases liver

sensitivity to toxic effects of LPS. The corresponding research objective is to

determine if obesity increases liver sensitivity to toxic effects of LPS in Pcyt2 +/-

mice model.

17

For the second project:

Sea buckthorn exhibits many beneficial properties including anti-inflammatory,

immunomodulatory, hypoglycemic, hypolipidemic, anti-atherogenic, antioxidant

activity, and anticancer effects (Tirupathi Pichiah et al., 2012, Geetha et al., 2003,

Sharma et al., 2011, Geetha et al., 2005, Grey et al., 2010, Ganju et al., 2005, Basu et

al., 2007, Wang et al., 2011). However, this plant has not been well studied in

alleviating obesity and associated complications of steatosis, hyperglycemia, and

hepatic inflammation. Given obesity’s high prevalence and severe complications

including type 2 diabetes, hyperlipidemia, cardiovascular disease, various infections,

cancer, pulmonary diseases, liver disorder as well as systematic chronic low-grade

inflammation, it is imperative to find ways to prevent, manage, and treat this medical

condition. From sea buckthorn’s numerous beneficial effects such as

anti-inflammatory, immunomodulatory, hypoglycemic, hypolipidemic, and

anti-atherogenic properties, this plant presents a potential approach to prevent,

manage, and even treat this devastating health condition. The hypothesis is therefore: sea buckthorn extract diet will reduce body weight, tissue lipids, and blood

glucose and consequently alleviate the hepatic inflammation and NAFL in

ETKO mice. The corresponding research objective is to determine if orally

administered sea buckthorn extract reduce body weight, tissue lipids, and blood

18

glucose and consequently alleviate the hepatic inflammation and NAFL.

19

Chapter 3: Pcyt2 ETKO Obesity Increases Liver

Sensitivity to LPS-Induced Acute Inflammation and

Results in Chronic Hepatic Inflammation

Introduction

Together with soluble LBP, LPS bind to the complex of TLR4 and CD14 in

macrophages (Kupffer cells) initiating a variety of inflammatory signaling cascades

(Wheeler, 2004, Rietschel et al., 1994). In one of these cascades, LPS and LBP

binding activates macrophages and downstream molecules such as MyD88 and IRAK

and TRAF resulting in NF-κB activation (Hosoi et al., 2004, Kawai et al., 1999,

Zhang et al., 1999, Wheeler, 2004, Ulevitch and Tobias, 1995). NF-κB activation

results in pro-inflammatory cytokine production (Tnfα, Il-1, and Il-6) promoting

inflammation (Kawai et al., 1999, Wheeler, 2004, Ulevitch and Tobias, 1995). In

terms of damage, LPS is a potent and even lethal toxin that triggers a global activation

of inflammatory responses that can lead to acute liver failure and even death

(Shea-Budgell et al., 2006, Baue, 1994, Livingston and Deitch, 1995, Wagner and

Roth, 1999, Martin et al., 2003).

Obesity-related steatohepatitis shares histological resemblance with

alcohol-induced steatohepatitis (Yang et al., 1997, Ludwig et al., 1980, Diehl,

Goodman, and Ishak, 1988). In alcohol-related steatohepatitis, experimental data

20

suggested that LPS is involved in such pathogenesis (Yang et al., 1997, McClain et al.,

1993). Thus, it is tempting to speculate that LPS is also involved in the pathogenesis

of obesity-induced steatohepatitis. Therefore, obesity might prime individuals to liver

disease by increasing hepatic sensitivity to LPS (Yang et al., 1997).

Previous research found that obesity is associated with changes in LPS-induced

cytokine gene expression such that lower Il-12 and higher IFNγ expression was

detected in obese rats relative to normal control rats (Yang et al., 1997). Yang et al.

used leptin receptor-deficient fa/fa rats as obesity models and were uncertain if the

same result can be extrapolated to other models with different causes of obesity.

Given LPS’s high potency and obesity’s high prevalence, it is imperative to test if

obesity increases liver sensitivity to endotoxin in other models such as Pcyt2 ETKO

model in order to determine if obesity prime hepatic disease by increasing liver

sensitivity to LPS. The hypothesis is therefore: obesity increases liver sensitivity to

toxic effects of LPS. The corresponding research objective is to determine if obesity

increases liver sensitivity to toxic effects of LPS in Pcyt2 +/- mice model.

21

Experimental Procedures

Animals and Treatments

Pcyt2 +/- (ETKO) and Pcyt2 +/+ (wildtype (WT)) mice were generated as

previously described (Fullerton et al., 2007). In summary, a positively identified

bacterial artificial chromosome clone was used to subclone a 12.5-kb genomic region

used to construct the targeting vector. The targeting vector was created by

homologous recombination. 2.8 kb of the gene was replaced by neomycin cassette.

The targeting vector was transfected by electroporation of 129 SvEviTL embryonic

stem (ES) cells (InGenious Targeting, New York). After selection, surviving clones

were screened by polymerase chain reaction (PCR) to identify recombinant ES clones

with the neomycin cassette. Two positive ES clones were identified by selection

screening for homologous recombination. These clones were injected into mouse

blastocysts and implanted into pseudopregnant females. To achieve germ line

transmission, Agouti, chimeric male offspring were then crossed back to C57BL/6

mice. Genotype was determined by PCR using ear notch genomic DNA. All

procedures received University of Guelph Animal Care Committee’s approval and

were in accordance with the Canadian Council on Animal Care’s guidelines. Mice were

exposed to a 12-hour light/dark cycle with light starting at 7:00 A.M. Mice were fed ad

libitum a standard diet (Harlan Teklad S-2335) with unrestricted access to water.

22

LPS (E. coli, Sigma-Aldrich) was administered through intraperitoneal (IP)

injection shortly after noon to WT and ETKO mice (4/group) using the dosage as in a

previous study (500 ng/g body weight) (Yang et al., 1997). Mice were sacrificed 24

hours after LPS injection using CO2 and the tissues (liver, retroperitoneal adipose,

kidney, heart, lung, spleen, and muscle) were harvested. Mouse plasma from WT and

ETKO was obtained using cardiac puncture with subsequent centrifugation at 5000

rpm for 10 min at 4°C. Prior to storing at -80°C freezer for subsequent analyses,

harvested tissues were preserved in liquid nitrogen immediately following harvest

while plasma was preserved in ice. Basic mice data such as tissue weights and blood

glucose level were not measured in the WT and the ETKO to help characterize

differences in the two genotypes of mice because such measurements were conducted

previously in our lab.

Liver Immunohistochemistry

To compare approximate number of Kupffer cells in the WT and the ETKO,

histological staining for Kupffer cells was conducted from male 7-month old mice (2

WT and 2 ETKO). Following harvesting, a part of liver tissue was preserved in 10%

formalin in phosphate buffered saline (PBS) with subsequent paraffin embedding.

Section was dewaxed in xylene and rehydrated in a series of ethanol washes and

incubated with rabbit monoclonal anti-CD68 antibody (Kupffer cell marker, Abcam).

23

Leica DMR imaging microscope connected to a computer with Openlab software was

used to visualize the tissue stainings and perform image analysis. Tissue stainings

were visualized under 40x magnification and Kupffer cell numbers were quantified

and totaled from 5 areas using Openlab software.

Preparation of Liver mRNA and PCR Analyses

One year old male and female mice (4/group) were studied. Fifty mg of liver was

homogenized in 1 ml of TRIzol reagent (Invitrogen) followed by addition of 0.2 ml of

chloroform, vigorous vortexing for 15 sec, and room temperature incubation for 2 to 3

min. Next, the sample was centrifuged at 10000 rpm for 15 min at 4˚C resulting in a

multiple layer mixture. Top aqueous layer containing mRNA was then transferred to a

fresh tube with subsequent addition of 0.5 ml of isopropyl alcohol followed by 10 min

room temperature incubation. The sample was centrifuged at 10000 rpm for 25 min at

4˚C resulting in mRNA pellet and supernatant was removed. The pellet was washed

with 1 ml 75% ethanol, vortexed, and spun at 6000 rpm for 5 min at 40C. After

centrifugation, leftover ethanol was removed and the washing was repeated. mRNA

pellet was air dried for 5 min and dissolved in 90 µl diethylpyrocarbonate

(DEPC)-treated water. Spectrophotometric analysis was conducted to determine

mRNA purity (A260/A280 ratio between 1.8 to 2.0) and concentration. Concentration

was calculated using the equation: [mRNA] (µg/µl) = (40 x dilution factor x

24

absorbance at A260)/1000 where 40 refers to the convention that 1 OD (absorbance)

at A260 equals 40 µg/ml mRNA.

Complementary DNA (cDNA) was synthesized from 2 µg of liver total mRNA

using SuperScript II Reverse Transcriptase (Invitrogen). Following cDNA synthesis,

PCR was conducted for the following cytokines using cytokine-specific primers to

study hepatic mRNA level: IFNγ, TNFα, IL-12, IL-10, as well as TGF-β1. The PCR

conditions including the primers, temperatures, times, and cycle number are listed in

Appendix A. All primers were obtained from publications (IFNγ- Puddu et al., 1997;

TNFα- Peng et al., 2003; IL-12- Coutelier, Van Broeck, and Wolf, 1995; IL-10- Sohn

et al., 2001; TGF-β1- Oi, Yamamoto, and Nishioka, 2004) and purchased from

University of Guelph Laboratory Services. Finally, PCR amplified cDNA was

visualized using agarose gel electrophoresis with ethidium bromide staining.

Protein Preparation and Western Blotting (WB)

Male and female 8-month old mice (2 WT and 2 ETKO) were studied.

Bicinchoninic acid (BCA) protein assay (Thermo Scientific) was used to measure liver

total protein concentration. In brief, this assay combines protein reduction of Cu2+

to

Cu1+

(cuprous) in an alkaline environment with the highly sensitive and selective

colorimetric BCA detection of Cu1+

(Smith et al., 1985). The first step is the chelation

of copper with protein forming a light blue complex (Smith et al., 1985). In the

25

second step, BCA chelates with Cu1+

formed in step one forming intense purple

product (Smith et al., 1985). The final water-soluble product exhibits a strong linear

absorbance at 562 nm with increasing protein concentrations (Smith et al., 1985). To

prepare for protein immunoblotting, samples were diluted with 5X SDS (sodium

dodecyl sulphate) reducing buffer (0.5 M Tris-HCl pH 5.8, 25% glycerol, 2% SDS,

0.01% bromophenol blue, and 0.5% 2-mercaptoethanol) and boiled for 5 min.

To detect hepatic NF-κBp65 protein levels in Pcyt2 WT and ETKO mice, 20 µg

of proteins were loaded onto a 12% SDS-PAGE and separated by electrophoresis. The

proteins were transferred to polyvinylidene difluoride (PVDF) membranes for 30 min

and following the transfer, the membranes were stained with Ponceau S to ensure equal

loading and successful transfer of proteins. The membranes were then blocked with 5%

bovine serum albumin (BSA) in TBST (Tris buffered saline with 0.5% Tween 20) for 1

hr at room temperature. After blocking, the membranes were subjected to a 4˚C

overnight incubation with rabbit polyclonal anti-NF-κBp65 primary antibody from

Santa Cruz Biotechnology, Inc. diluted 1:2000 with 5% BSA. Next, the membranes

were washed 5x in TBST with change every 15 min followed by 1 hr room temperature

incubation with secondary antibody- goat-anti-rabbit immunoglobulin G (IgG) linked

to horse-radish peroxidase (HRP) diluted 1:20000. NF-κBp65 protein was viewed with

Sigma’s chemiluminescent peroxidase substrate assay following manufacturer’s

26

instructions including developing onto a X-ray film.

Graphs

PCR and WB band intensities were measured using Image J software. Bar graphs

with mean and SEM for body weight, PCR, and western blotting experiments were

generated using GraphPad Prism software.

Statistical Analyses

GraphPad Prism software was also used for statistical analyses. Unpaired t tests

were conducted to compare WT and ETKO body weight. For PCR experiments,

two-way ANOVA for the effect of LPS treatment, genotype, and interaction between

treatment and genotype was conducted. In addition, unpaired t tests were conducted to

compare the following: WT vs ETKO for LPS treated and not LPS treated as well as

LPS treated vs not LPS treated of the same genotype. P values < 0.05 were considered

statistically significant.

27

Results

WT and ETKO body weight

WT and ETKO mice (n = 8/group) body weight was measured to help

characterize differences in the two genotypes of mice. ETKO mice had higher body

weight than WT mice (Figure 3.1).

Figure 3.1- Body weight of WT and ETKO mice Bar graph showing mean and

SEM (n = 8/group). Each comparison line with * indicates the groups are statistically

different from each other (P < 0.05).

28

Hepatic IL-12 gene expression following LPS treatment

To determine if ETKO has increased liver sensitivity to inflammation, mRNA

level of the pro-inflammatory cytokine IL-12 was measured in four groups of mice (n

= 4/group). Only treatment had an effect and treatment did not interact with genotype

(Figure 3.2). For mice not treated with LPS, ETKO and WT mice had same IL-12

level (Figure 3.2). LPS treatment resulted in higher hepatic IL-12 level in ETKO and

WT mice compared to the untreated (Figure 3.2). IL-12 level was also same between

ETKO and WT mice treated with LPS (Figure 3.2).

Figure 3.2- Hepatic interleukin 12 (IL-12) gene expression with and without LPS

treatment- Effects of LPS on ETKO and WT mice. Liver mRNA level was measured

by PCR (n = 4/group). mRNA expression bar graph showing mean and SEM

Two-way ANOVA was conducted. Each comparison line with * indicates the groups

are statistically different from each other (P < 0.05).

29

Hepatic TNFα gene expression following LPS treatment

TNFα (pro-inflammatory cytokine) mRNA level was also measured (n = 4/group)

to determine if the ETKO has increased liver sensitivity to inflammation. Treatment,

genotype had no effect and treatment did not interact with genotype (Figure 3.3). In

mice without LPS treatment, TNFα level was same between ETKO and WT mice

(Figure 3.3). LPS treatment resulted in higher hepatic TNFα level in ETKO mice and

resulted in same level in WT mice relative to the respective untreated (Figure 3.3).

TNFα level was also same between LPS treated ETKO and WT mice (Figure 3.3).

Figure 3.3- Hepatic tumor necrosis factor alpha (TNFα) gene expression with

and without LPS treatment- Effects of LPS on ETKO and WT mice. Liver mRNA

level was measured by PCR (n = 4/group). mRNA expression bar graph showing

mean and SEM Two-way ANOVA was conducted. Each comparison line with *

indicates the groups are statistically different from each other (P < 0.05).

30

Hepatic IFNγ gene expression following LPS treatment

In addition to IL-12 and TNFα, the pro-inflammatory cytokine IFNγ mRNA level

was measured (n = 4/group) with the same goal as the previous two cytokines. Only

genotype had an effect and treatment did not interact with genotype (Figure 3.4). In

mice without LPS treatment, IFNγ mRNA was higher in WT mice (Figure 3.4). LPS

treatment had no effect on hepatic IFNγ level in both ETKO and WT mice relative to

the untreated so the level after treatment was also higher in the WT (Figure 3.4).

Figure 3.4- Hepatic interferon gamma (IFNγ) gene expression with and without

LPS treatment- Effects of LPS on ETKO and WT mice. Liver mRNA level was

measured by PCR (n = 4/group). mRNA expression bar graph showing mean and

SEM Two-way ANOVA was conducted. Each comparison line with * indicates the

groups are statistically different from each other (P < 0.05).

31

Hepatic IL-10 gene expression following LPS treatment

Another way to study inflammation is to investigate anti-inflammatory

cytokines. Thus, mRNA level of IL-10 was measured (n = 4/group). Only treatment

had an effect and treatment did not interact with genotype (Figure 3.5). In untreated

mice, IL-10 level was low and same between the two groups (Figure 3.5). LPS

treatment resulted in higher hepatic IL-10 level by 2.1 fold in the ETKO and by 6 fold

in WT mice compared to the respective untreated level demonstrating that LPS

induction of IL-10 is suppressed in the ETKO leading to less IL-10 protection (Figure

3.5).

Figure 3.5- Hepatic interleukin 10 (IL-10) gene expression with and without LPS

treatment- Effects of LPS on ETKO and WT mice. Liver mRNA level was measured

by PCR (n = 4/group). mRNA expression bar graph showing mean and SEM

Two-way ANOVA was conducted. Each comparison line with * indicates the groups

are statistically different from each other (P < 0.05).

32

Hepatic TGF-β1 gene expression following LPS treatment

The anti-inflammatory cytokine TGF-β1 was also studied and its mRNA level

was measured (n = 4/group). Only treatment had an effect and treatment did not

interact with genotype (Figure 3.6). In untreated mice, this cytokine’s level was same

between ETKO and WT mice (Figure 3.6). LPS treatment resulted in higher hepatic

TGF-β1 level only in ETKO mice by 1.4 fold relative to the untreated demonstrating

that LPS induction of TGF-β1 is enhanced in the ETKO so response to LPS was

different in WT vs ETKO (Figure 3.6). ETKO and WT mice had same post LPS

treatment TGF-β1 expression (Figure 3.6).

Figure 3.6- Hepatic transforming growth factor beta 1 (TGF-β1) gene expression

with and without LPS treatment- Effects of LPS on ETKO and WT mice. Liver

mRNA level was measured by PCR (n = 4/group). mRNA expression bar graph

showing mean and SEM Two-way ANOVA was conducted. Each comparison line

with * indicates the groups are statistically different from each other (P < 0.05).

33

Hepatic NF-κBp65 protein level

Hepatic NF-κB is linked to hepatic inflammation (Sajan et al., 2009). Since

obesity is also associated with hepatic inflammation, it is possible that obesity is

associated with hepatic NF-κB. To determine if such association exists in the ETKO,

NF-κBp65 protein was measured (n = 2/group) by western blotting. NF-κBp65

protein level was threefold higher in ETKO liver than WT liver (Figure 3.7).

WT ETKO

Figure 3.7- Hepatic NF-κBp65 protein western blot NF-κBp65 protein level in

ETKO and WT mice livers was measured (n = 2/group) by western blotting using

anti-NF-κBp65 antibody.

34

Liver Immunohistochemistry- Kupffer cells

Changes in liver Kupffer cell number have been linked to liver steatosis and

inflammation (Lin et al., 2007). Kupffer cells are elliptical and quantitative analyses

with Openlab software revealed that ETKO and WT mice had similar number (total

from 5 areas: ETKO 29 WT 31) of Kupffer cells (n = 2/group) (Figure 3.8).

WT ETKO

Figure 3.8- Liver Immunohistochemistry- Representative figures- Kupffer cells as

indicated by arrows were visualized with CD68 specific antibody under 40x

magnification (n = 2/group).

35

Discussion

ETKO mice had higher body weight than WT mice

ETKO mice had higher body weight than WT mice (Figure 3.1). ETKO mice

have lower CDP-ethanolamine as a result of partially knocking out the Pcyt2 gene

leading to lower rate of PE synthesis and higher availability of DAG (another

substrate in PE synthesis). The excess DAG is then converted to TAG ultimately

leading to Pcyt2 deficient disease phenotype of adult onset obesity (Fullerton et al.,

2009).

Mostly same basal hepatic pro-inflammatory and anti-inflammatory cytokine

gene expression between ETKO and WT mice

At the basal state (without LPS treatment), WT and ETKO mice had same liver

pro-inflammatory cytokine (IL-12 and TNFα) as well as anti-inflammatory cytokine

(IL-10 and TGF-β1) gene expression (Figures 3.2, 3.3, 3.5, 3.6). One leptin-deficient

ob/ob mice study found similar basal mRNA level of TNFα and TGF-β1 between the

obese and the regular weight (Yang et al., 1997). The only difference in cytokine gene

expression between the ETKO and the WT was IFNγ in which the expression was

lower in ETKO demonstrating that basal hepatic IFNγ gene expression was blunted

(Figure 3.4). One study found that WT mice had higher hepatic and visceral adipose

tissue pro-inflammatory cytokine (IL-6 and TNFα) gene expression compared to KO

mice (O'Rourke et al., 2012).

36

Pcyt2 ETKO obesity increases liver sensitivity to acute inflammation indicated

by higher LPS treatment induction of hepatic pro-inflammatory cytokine gene

expression and lower LPS treatment induction of hepatic anti-inflammatory

cytokine gene expression in ETKO than WT

LPS is also known as endotoxin which serves as the major component of the

outer membrane of Gram-negative bacteria (Rietschel et al., 1994). LPS is used to

study several processes including inflammation, cell proliferation and cancer,

migration, cell survival, as well as septic shock (Sharif et al., 2007). In terms of

damage, LPS is a potent and even lethal toxin that triggers a global activation of

inflammatory responses that can lead to acute liver failure and even death

(Shea-Budgell et al., 2006, Baue, 1994, Livingston and Deitch, 1995, Wagner and

Roth, 1999, Martin et al., 2003). The dosage we used was probably not high enough

to induce acute liver failure and death.

LPS treatment (500 ng/g body weight) induction of hepatic pro-inflammatory

cytokine TNFα gene expression was higher in ETKO than WT and LPS treatment

induction of hepatic anti-inflammatory cytokine IL-10 gene expression was lower in

ETKO than WT leading to more TNFα damage and less IL-10 protection in ETKO

than WT (Figures 3.3, 3.5). LPS treatment of WT and ETKO similarly induced

pro-inflammatory cytokine gene expression (IL-12) and resulted in higher TNFα in

ETKO relative to the untreated (Figures 3.2-3.3). For IFNγ, LPS treatment had no

effect relative to the untreated (Figure 3.4). One reason that LPS treatment did not

37

affect IFNγ gene expression could be cytokine specific alleviating mechanism in

response to LPS involving downregulation of IFNγ gene expression that occurs few

hours after LPS treatment. The goal of this mechanism is to restore pro-inflammatory

cytokine IFNγ gene expression back to pre-treatment level thus dampening LPS’s

damaging effect of increasing pro-inflammatory cytokine genes expression leading to

inflammation. The findings that LPS treatment resulted in higher IL-12 and TNFα

gene expression relative to the untreated are supported by Yang et al., 1997.

Endotoxin also resulted in higher anti-inflammatory cytokine (IL-10 and TGF-β1)

mRNA levels in the ETKO and resulted in higher IL-10 in the WT all compared to the

untreated (Figures 3.5-3.6). Yang et al., 1997 also found higher IL-10 in the LPS

treated.

LPS induced increase in pro-inflammatory cytokine (TNFα, IL-1, and IL-6) gene

expression is a multi-step process that begins when LPS in combination with soluble

LPS-binding protein bind to their receptor complex- Toll-like receptor 4 and CD14 in

macrophages such as Kupffer cells initiating a variety of inflammatory signaling

cascades (Wheeler, 2004, Rietschel et al., 1994). In one of these cascades, LPS and

LBP binding activates macrophages and downstream molecules such as myeloid

differentiation factor 88 and associated proteins of interleukin–1 receptor-associated

kinase and tumor necrosis factor receptor–associated factor resulting in NF-κB (a

38

transcription factor) activation (Hosoi et al., 2004, Kawai et al., 1999, Zhang et al.,

1999, Wheeler, 2004, Ulevitch and Tobias, 1995). NF-κB activation has multiple

outcomes including pro-inflammatory cytokine (TNFα, IL-1, and IL-6) production,

gene expression, and release (Kawai et al., 1999, Wheeler, 2004, Ulevitch and Tobias,

1995, Sharif et al., 2007).

LPS induced higher anti-inflammatory cytokine (TGF-β1 and especially IL-10)

gene expression relative to the untreated can be an amelioration mechanism of the

immune system in an attempt to alleviate LPS toxic effects. IL-10, for example,

inhibits TNFα toxic effects of inflammation, tissue damage, as well as loss of function

(Yang et al., 1997, Dinarello, 2000).

pro-inflammatory cytokine anti-inflammatory cytokine

IL-12 TNFα IFNγ IL-10 TGF-β1

ETKO ↑

↑

__

↑

↑

WT

↑

__

__

↑

__

Table 3.1 LPS treatment induction of hepatic cytokine gene expression compared

to untreated ↑ means LPS treatment resulted in higher cytokine gene expression

compared to untreated and means LPS treatment resulted in same cytokine gene

expression compared to untreated

Mostly same hepatic pro-inflammatory and anti-inflammatory cytokine gene

expression between WT and ETKO mice after LPS treatment

WT and ETKO mice had same liver pro-inflammatory cytokine (IL-12 and TNFα)

as well as anti-inflammatory cytokine (IL-10 and TGF-β1) gene expression following

39

500 ng LPS/g body weight treatment (comparing LPS (+) WT to LPS (+) ETKO bar

of Figures 3.2, 3.3, 3.5, 3.6). Yang et al., 1997 supported our findings for TNFα and

TGF-β1. The only difference in cytokine gene expression between the ETKO and the

WT is IFNγ in which the expression is higher in WT (comparing LPS (+) WT to LPS

(+) ETKO bar of Figure 3.4). Lower IFNγ in ETKO can be an obesity-induced

adaptive mechanism in an attempt to alleviate obesity-related metabolic dysfunction

since IFNγ deficiency lowers adipose tissue inflammatory genes gene expression and

ameliorates metabolic parameters in obese animals (Rocha and Folco, 2011, Rocha et

al., 2008).

Pcyt2 ETKO obesity results in chronic hepatic inflammation indicated by higher

hepatic NF-κBp65 protein level in ETKO than WT mice

ETKO obese mice had threefold higher hepatic NF-κBp65 protein level than WT

mice indicating that obesity (Pcyt2 ETKO) results in chronic hepatic inflammation

(Figure 3.7). Since the transcription factor NF-κB controls transcription of cytokine

genes such as IL-6 and IL-1A and expression of pro-inflammatory cytokines such as

MCP-1 is elevated in obesity, it is reasonable that NF-κB is elevated in this disease

state (Kanda et al., 2006, Conti et al., 1997). Elevated NF-κBp65 protein level in the

ETKO explains higher LPS treatment induction of hepatic pro-inflammatory cytokine

TNFα gene expression in ETKO since NF-κBp65 activates transcription of

pro-inflammatory cytokine genes such as TNFα.

40

Conclusion

Since LPS treatment induction of hepatic pro-inflammatory cytokine TNFα gene

expression was higher in ETKO than WT and LPS treatment induction of hepatic

anti-inflammatory cytokine IL-10 gene expression was lower in ETKO than WT

leading to more TNFα damage and less IL-10 protection in ETKO than WT, obesity

(Pcyt2 ETKO) increases liver sensitivity to acute inflammation. ETKO mice had

higher hepatic NF-κBp65 protein level than WT mice indicating that obesity (Pcyt2

ETKO) results in chronic hepatic inflammation. Elevated NF-κBp65 protein level in

the ETKO explains higher LPS treatment induction of hepatic pro-inflammatory

cytokine TNFα gene expression in ETKO since NF-κBp65 activates transcription of

pro-inflammatory cytokine genes such as TNFα.

41

Chapter 4: Sea Buckthorn Extract Diet Alleviates

Metabolic Syndrome in Pcyt2 ETKO

Introduction

Sea buckthorn (Hippophae), a thorny deciduous shrub, is native to Asia and

Europe (Tirupathi Pichiah et al., 2012, Rousi, 1971). Sea buckthorn is a rich source of

vitamins A, C, E, K, fatty acids linoleic acid (ω-6), α-linolenic acid (ω-3), oleic acid

(ω-9), palmitoleic acid (ω-7) and phenolic compounds specifically flavonoids

myricetin, quercetin, kaempferol, isorhamnetin (Maheshwari et al., 2011, Pintea et al.,

2001, Kallio et al., 2002, Yang and Kallio, 2001, Franke and Muller, 1983, Quirin and

Gerard, 1993, Berezhnaya et al., 1993, Jabłczynska, Krawczyk, and Minkowski, 1994,

Moravcova et al., 1995, Zadernowski et al., 1997, Ulchenko et al., 1995, Tirupathi

Pichiah et al., 2012, Nijveldt et al., 2001).

In Tibetan and Mongolian traditional medicines, sea buckthorn was used to

improve digestive function and blood circulation as well as to treat cough and sputum

(Suryakumar and Gupta, 2011). Sea buckthorn exhibits many beneficial properties

including anti-inflammatory, immunomodulatory, hypoglycemic, hypolipidemic,

anti-atherogenic, antioxidant activity, and anticancer effects (Tirupathi Pichiah et al.,

2012, Geetha et al., 2003, Sharma et al., 2011, Geetha et al., 2005, Grey et al., 2010,

Ganju et al., 2005, Basu et al., 2007, Wang et al., 2011). However, this plant has not

42

been well studied in alleviating obesity and associated complications of steatosis,

hyperglycemia, and hepatic inflammation. Given obesity’s high prevalence and

obesity’s severe complications including type 2 diabetes, hyperlipidemia,

cardiovascular disease, various infections, cancer, pulmonary diseases, liver disorder

as well as systematic chronic low-grade inflammation, it is imperative to find ways to

prevent, manage, and treat this medical condition. From sea buckthorn’s numerous

beneficial effects such as anti-inflammatory, immunomodulatory, hypoglycemic,

hypolipidemic, and anti-atherogenic properties, sea buckthorn presents a potential

approach to prevent, manage, and even treat this devastating health condition. The

hypothesis is therefore: sea buckthorn extract diet will reduce body weight, tissue

lipids, and blood glucose and consequently alleviate the hepatic inflammation and

NAFL in ETKO mice. The corresponding research objective is to determine if orally

administered sea buckthorn extract reduce body weight, tissue lipids, and blood

glucose and consequently alleviate the hepatic inflammation and NAFL.

43

Experimental Procedures

Animals and Treatments

ETKO (Pcyt2 +/-) and WT (Pcyt2 +/+) mice were described in Chapter 3. Sea

buckthorn extract was obtained from Dr. Gopinadhan Paliyath (Department of Plant

Agriculture, Ontario Agricultural College, University of Guelph). The slurry extract

was administered at about 1 pm through daily oral gavage once suspend in 0.85%

saline for 30 days to WT and ETKO mice (5/group) using the dosage of 200 μg/g

body weight. One study used 260 μg/g body weight which is somewhat similar to our

dosage (Hsu et al., 2009). Control mice were gavaged with saline. Mice were weighed

daily and sacrifice was carried out at the end of the 30-day trial using CO2. The

various tissues (liver, retroperitoneal adipose, kidney, heart, lung, spleen, and muscle)

were harvested and liver and retroperitoneal adipose tissues were weighed. Blood was

collected by cardiac puncture and plasma obtained by centrifugation at 5000 rpm for

10 min at 4°C. Prior to storing at -80°C freezer for subsequent analyses, harvested

tissues were preserved in liquid nitrogen immediately following harvest while plasma

was preserved in ice.

IP Glucose Tolerance Test

To determine if sea buckthorn extract lowers blood glucose level, IP glucose

tolerance tests were conducted prior to as well as after the 30-day trial. Male and

44

female mice 7-month of age (n = 5/group) were used. After a 16-hour fast, a baseline

saphenous vein blood sample was taken followed by glucose (2 g/Kg body weight; in

0.85% saline) IP injection. Blood glucose level was measured at the following time

points post injection using OneTouch UltraMini glucose metre: 15, 30, 60, 90,120,

and 180 min.

Liver Histology

To determine if sea buckthorn extract treatment results in lower hepatic lipid

accumulation compared to control, histological work was conducted. Male and female

mice 7-month of age (n = 5/group) were used. Following harvesting and weighing, a

part of liver tissue was preserved in 10% formalin in phosphate buffered saline (PBS)

with subsequent paraffin embedding. Section was dewaxed in xylene and rehydrated

in a series of ethanol washes and stained with hematoxylin and eosin. Leica DMR

imaging microscope set at 10x magnification connected to a computer with Openlab

software was used to visualize the tissue and perform image analysis.

Preparation of Liver mRNA and PCR Analyses

Male and female mice 7-month of age (n = 5/group) were used. Fifty mg of liver

was homogenized in 1 ml of TRIzol reagent (Invitrogen) followed by addition of 0.2

ml of chloroform, vigorous vortexing for 15 sec, and room temperature incubation for

2 to 3 min. Next, the sample was centrifuged at 10000 rpm for 15 min at 4˚C resulting

45

in a multiple layer mixture. Top aqueous layer containing mRNA was then transferred

to a fresh tube with subsequent addition of 0.5 ml of isopropyl alcohol followed by 10

min room temperature incubation. The sample was centrifuged at 10000 rpm for 25

min at 4˚C resulting in mRNA pellet and supernatant was removed. The pellet was

washed with 1 ml 75% ethanol, vortexed, and spun at 6000 rpm for 5 min at 40C.

After centrifugation, leftover ethanol was removed and the washing was repeated.

mRNA pellet was air dried for 5 min and dissolved in 90 µl DEPC-treated water.

Spectrophotometric analysis was conducted to determine mRNA purity (A260/A280

ratio between 1.8 to 2.0) and concentration. Concentration was calculated using the

equation: [mRNA] (µg/µl) = (40 x dilution factor x absorbance at A260)/1000 where

40 refers to the convention that 1 OD (absorbance) at A260 equals 40 µg/ml mRNA.

cDNA was synthesized from 2 µg of liver total mRNA using SuperScript II

Reverse Transcriptase (Invitrogen). Following cDNA synthesis, touchdown PCR was

conducted for the following cytokines using cytokine-specific primers to study

hepatic mRNA level: IL-12 and TGF-β1. In touchdown PCR, an initial annealing

temperature of several °C greater than estimated melting temperature is used (Korbie

and Mattick, 2008). Annealing temperature than gradually decreases (1-2 °C per every

second cycle) until reach estimated annealing temperature or some °C below (Korbie

and Mattick, 2008). Reaction continues using this annealing temperature. Touchdown

46

PCR increases specificity of product (Korbie and Mattick, 2008). G3PDH was used as

a control and amplified using traditional PCR. The PCR conditions including the

primers, temperatures, times, and cycle number are listed in Appendix B. Primers

were obtained from PubMed Primer-BLAST search and purchased from University of

Guelph Laboratory Services. Finally, PCR amplified cDNA was visualized using

agarose gel electrophoresis with ethidium bromide staining.

Graphs

PCR band intensities were measured using Image J software. Bar graphs with

mean and SEM for PCR experiments, body weight, post-treatment retroperitoneal

adipose tissue weight, post-treatment liver weight, and glucose tolerance test area

under the curve (AUC; trapezoidal calculation method) as well as curves for glucose

tolerance test were generated using GraphPad Prism software.

Statistical Analyses

GraphPad Prism software was also used for statistical analyses conducted using

n of 3/group to exclude outliers from analyses. For PCR experiments, post-treatment

body weight, post-treatment retroperitoneal adipose tissue and liver weight

measurements, as well as post-treatment glucose tolerance test AUC, two-way

ANOVA for the effect of treatment, genotype, and interaction between treatment and

genotype was conducted. Two-way repeated measures ANOVA was not conducted

47

for post-treatment body weight and post-treatment glucose tolerance test AUC

because data were not matched. One-way ANOVA was conducted for pre-treatment

body weight and pre-treatment glucose tolerance test AUC. In addition, unpaired t

tests were used for the following body weight comparisons: pre-treatment WT vs

ETKO, post-treatment body weight of the same genotype, and pre-treatment vs

post-treatment of the same treatment and genotype. For post-treatment retroperitoneal

adipose tissue and liver weight measurements, unpaired t tests were additionally used

for the following comparisons: WT vs ETKO and weights of the same genotype. For

pre-treatment glucose tolerance test AUC, unpaired t tests were additionally

conducted to compare WT vs ETKO. For post-treatment glucose tolerance test AUC,

unpaired t tests were additionally conducted to compare WT vs ETKO and different

treatments of the same genotype. Additionally, for PCR data, unpaired t tests were

used to compare different genotype levels of the same treatment and levels of the

same genotype with different treatments. P values < 0.05 were considered statistically

significant.

48

Results

Sea buckthorn extract induced body weight loss in ETKO

It is possible that sea buckthorn extract induces weight loss in mice. To

determine (n = 3/group) if sea buckthorn extract induce weight loss in ETKO mice,

mice were oral gavaged daily for 30 days with 200 μg/g body weight. Control mice

were gavaged with saline. For post-treatment weight, only genotype had an effect and

treatment did not interact with genotype (Figure 4.1). As shown in Figure 4.1, prior to

the 30-day treatment, ETKO mice weighed heavier than WT mice. Prior to treatment,

groups of the same genotype had the same weight (Figure 4.1). Sea buckthorn treated

ETKO mice lost weight while WT, ETKO saline control and WT sea buckthorn

treated mice did not lose weight (Figure 4.1).

49

Figure 4.1- Body weight change in sea buckthorn extract treated and control

mice WT and ETKO mice (n = 3/group) were fed a standard chow diet with

unrestricted access to water. Sea buckthorn extract was administered through daily oral

gavage for 30 days using the dosage of 200 μg/g body weight. Data are represented

using bar graphs (first six graphs = pre-treatment) showing means and SEMs.

One-way ANOVA and two-way ANOVA was conducted for pre-treatment and

post-treatment data respectively. Each comparison line with * indicates the groups are

statistically different from each other (P < 0.05).

50

Sea buckthorn extract induced retroperitoneal adipose tissue weight loss in

ETKO and WT

Genotype, treatment each had an effect and treatment interacted with genotype

(Figure 4.2). At the end of the 30-day trial, WT mice had lower retroperitoneal

adipose tissue weight compared to ETKO mice (Figure 4.2). Treated retroperitoneal

adipose tissues weighed lighter than control tissues for both the WT and the ETKO

(76.67% and 56.77% for the WT and the ETKO respectively relative to the controls)

indicating that sea buckthorn extract treatment induced retroperitoneal adipose tissue

weight loss in mice (Figure 4.2).

Figure 4.2- Retroperitoneal adipose tissue weight after sea buckthorn extract

treatment Retroperitoneal adipose tissues were harvested and weighed at the end of

the 30-day trial (n = 3/group). Data are represented using bar graphs showing means

and SEMs. Two-way ANOVA was conducted. Each comparison line with * indicates

the groups are statistically different from each other (P < 0.05).

51

Sea buckthorn extract induced liver weight loss in ETKO

To study if sea buckthorn extract reduces hepatic lipid accumulation in mice

leading to lower liver weight, harvested livers were weighed (n = 3/group) following

30 days of daily treatment. Genotype, treatment each had an effect and treatment

interacted with genotype (Figure 4.3). In addition to having lower post-treatment

retroperitoneal adipose tissue weight, WT mice had lower post-treatment liver weight

than ETKO mice (Figure 4.3). ETKO treated liver weighed lighter (59.79% of control

weight) indicating that sea buckthorn extract lowered liver weight by reducing hepatic

lipid accumulation (Figure 4.3). WT treated and control livers had same weights.

Figure 4.3- Liver weight after sea buckthorn extract treatment Livers were

harvested and weighed at the end of the 30-day trial (n = 3/group). Data are

represented using bar graphs showing means and SEMs. Two-way ANOVA was

conducted. Each comparison line with * indicates the groups are statistically different

from each other (P < 0.05).

52

Pre-treatment intraperitoneal glucose tolerance test

To ensure that changes in blood glucose levels result from sea buckthorn extract

treatment and not from pre-treatment differences between two groups of the same

genotype, pre-treatment blood glucose levels were measured to confirm that two

groups of the same genotype do not differ. WT mice had lower pre-treatment fasting

as well as post glucose administration blood glucose levels compared to ETKO mice

corresponding to smaller area under the curve of IP glucose tolerance test (Figures 4.4

and 4.5; n = 3/group).

53

Figure 4.4- Pre-treatment (sea buckthorn extract, 30 days) IP glucose tolerance

test (IPGTT) After a 16-hour fast, glucose was administered by IP injection to WT

and ETKO mice (n = 3/group). Blood glucose level was measured at baseline as well

as 15, 30, 60, 90, 120, and 180 min post injection. Statistical analyses are conducted

using IPGTT AUC data.

54

Figure 4.5- Pre-treatment (sea buckthorn extract, 30 days) IPGTT AUC Data are

represented using bar graphs showing means and SEMs (n = 3/group). One-way

ANOVA was conducted.

55

Sea buckthorn extract lowered blood glucose levels in WT and ETKO

We were interested in determining (n = 3/group) if sea buckthorn extract lower

blood glucose concentration in mice. Genotype, treatment each had an effect and

treatment did not interact with genotype (Figure 4.7). After 30 days of daily treatment

with 200 μg/g body weight, WT mice had lower concentration compared to ETKO

mice corresponding to smaller glucose area under the curve after an IP glucose

tolerance test (Figures 4.6 and 4.7). Treated ETKO and WT mice had lower blood

glucose level than control mice corresponding to smaller IPGTT AUC indicating that

sea buckthorn extract treatment lowered blood glucose concentration (Figures 4.6 and

4.7).

56

Figure 4.6- Post-treatment (sea buckthorn extract, 30 days) IPGTT After a

16-hour fast, glucose was administered by IP injection to WT and ETKO mice (n =

3/group). Blood glucose level was measured at baseline as well as 15, 30, 60, 90, 120,

and 180 min post injection. Statistical analyses are conducted using IPGTT AUC data.

57

Figure 4.7- Post-treatment (sea buckthorn extract, 30 days) IPGTT AUC Data are

represented using bar graphs showing means and SEMs (n = 3/group). Two-way

ANOVA was conducted. Each comparison line with * indicates the groups are

statistically different from each other (P < 0.05).

58

Hepatic IL-12 gene expression following sea buckthorn extract treatment

It is possible that sea buckthorn exerts its anti-inflammatory property by

reducing pro-inflammatory cytokine gene expression. To test this possibility, hepatic

mRNA level of pro-inflammatory cytokine IL-12 was measured (n = 3/group)

following 30 days of daily treatment. Only genotype had an effect and treatment

interacted with genotype (Figure 4.8). For control mice, the level was same between

WT and ETKO while WT treated mice had higher IL-12 mRNA than the ETKO

treated (Figure 4.8). Sea buckthorn extract treatment resulted in higher IL-12 mRNA

in the WT and had no effect in the ETKO compared to the control (Figure 4.8).

59

Figure 4.8- Hepatic interleukin 12 (IL-12) gene expression with and without sea

buckthorn extract treatment- Effects of sea buckthorn extract on WT and ETKO

mice. Liver mRNA level was measured by PCR (n = 3/group). Gene expression was

assessed relative to glycerol-3-phosphate dehydrogenase (G3PDH) as an endogenous

control. mRNA expression bar graph showing mean and SEM Two-way ANOVA was

conducted. Each comparison line with * indicates the groups are statistically different

from each other (P < 0.05).

60

Hepatic TGF-β1 gene expression following sea buckthorn extract treatment

Sea buckthorn possibly exerts its anti-inflammatory property by increasing

anti-inflammatory cytokine mRNA level. To test this possibility, hepatic mRNA level

of anti-inflammatory cytokine TGF-β1 was measured (n = 3/group) by PCR after 30

days of daily oral gavage. Genotype, treatment had no effect and treatment did not

interact with genotype (Figure 4.9). For control mice, the ETKO had higher level

which is beneficial for ETKO obese in alleviating hepatic inflammation although the

effect probably does not exist since ETKO level was just slightly higher (Figure 4.9).

In LPS study, we found same TGF-β1 basal level between WT and ETKO. In sea

buckthorn extract treated mice, TGF-β1 expression was same between the WT and the

ETKO (Figure 4.9). Sea buckthorn extract treatment did not have effect on TGF-β1

mRNA level in both ETKO and WT mice compared to the control (Figure 4.9).

61

Figure 4.9- Hepatic transforming growth factor beta 1 (TGF-β1) gene expression

with and without sea buckthorn extract treatment- Effects of sea buckthorn extract

on WT and ETKO mice. Liver mRNA level was measured by PCR (n = 3/group).

Gene expression was assessed relative to glycerol-3-phosphate dehydrogenase

(G3PDH) as an endogenous control. mRNA expression bar graph showing mean and

SEM Two-way ANOVA was conducted. Each comparison line with * indicates the

groups are statistically different from each other (P < 0.05).

62

Sea buckthorn extract reduced liver lipid accumulation in ETKO

Sea buckthorn extract may have potential in alleviating hepatic steatosis. We

tested such potential and determined (n = 3/group) if sea buckthorn extract reduce

obesity-induced hepatic lipid accumulation in ETKO mice by conducting a 30-day

trial with daily sea buckthorn extract administration. WT hepatic lipid accumulation

was insignificant whereas ETKO control mice had significant fat buildup (Figure

4.10). Sea buckthorn extract reduced ETKO liver fat accumulation considerably

which explains lower post-treatment liver weight in the treated ETKO relative to the

control ETKO (Figure 4.3).

WT sea buckthorn ETKO control ETKO sea buckthorn

Figure 4.10- Liver histology after sea buckthorn extract treatment (30 days, 200

μg/g body weight daily)- Representative figures- Arrows point to areas of lipid

accumulation. Livers were harvested, weighed, cut, and preserved in 10% formalin in

PBS with subsequent paraffin embedding (n = 3/group). Hematoxylin and eosin stain

was used and viewed under 40x magnification.

63

Discussion

Sea buckthorn extract decreased ETKO mice body and retroperitoneal adipose

tissue weights

Our laboratory previously developed a mouse model of Pcyt2 deficiency and

further characterized effects of partially knocking out the Pcyt2 gene. We showed that

the ETKO had higher body weight and higher adipose tissue weight relative to the

WT (Fullerton et al., 2009). Prior to sea buckthorn extract treatment, 7-month old

ETKO mice weighed heavier than WT mice (Figure 4.1). By partially knocking out

the Pcyt2 gene, Pcyt2 +/- mice have lower CDP-ethanolamine leading to lower rate of

phosphatidylethanolamine (PE) synthesis and higher availability of DAG (another

substrate in PE synthesis). The excess DAG is then converted to TAG ultimately

leading to Pcyt2 deficient disease phenotype of obesity (Fullerton et al., 2009).

One previous study showed that sea buckthorn extract prevents obesity

development in mice fed a high fat diet (60% of energy from fat) (Tirupathi Pichiah et

al., 2012). We were interested in determining if sea buckthorn induces weight loss.

We found that sea buckthorn extract treatment induced body and retroperitoneal

adipose tissue weights losses in ETKO mice (Figures 4.1-4.2). Since body weight

alone does not provide an accurate and complete characterization of obesity as body

weight is composed of lean and adipose tissue weights, retroperitoneal adipose tissue

weight was also measured. One previous study showed that sea buckthorn extract

64

attenuates epididymal fat weight gain in the high fat fed mice (Tirupathi Pichiah et al.,

2012). Body weight loss is least partly attributed to liver and retroperitoneal adipose

tissue weights losses. Other organ weights reductions may also contribute to body

weight loss. One previously conducted investigation found lower hepatic mRNA

expression of acetyl-CoA carboxylase (ACC; rate limiting enzyme in fatty acid

synthesis) and higher carnitine palmitoyltransferase-1 (CPT-1; mitochondrial fatty

acid β-oxidation enzyme) and peroxisome proliferator-activated receptor-alpha

(PPAR-α; mitochondrial fatty acid β-oxidation protein) gene expression in mice

receiving sea buckthorn extract (Tirupathi Pichiah et al., 2012, Wakil, Stoops, and

Joshi, 1983). The combination of lower hepatic ACC, higher CPT-1 and PPAR-α

gene expression may result in decreased fatty acid synthesis and increased fatty acid

oxidation possibly responsible for sea buckthorn extract-mediated body,

retroperitoneal adipose tissue, and liver weights losses.

Sea buckthorn extract reduced blood glucose level in ETKO mice

Previously, we showed that the ETKO had higher post glucose administration

blood glucose level compared to the WT determined by intraperitoneal glucose

tolerance test (Fullerton et al., 2009). One previous study showed that sea buckthorn

extract attenuates obesity-induced elevation in blood glucose level (Tirupathi Pichiah

et al., 2012). WT mice had lower pre-treatment fasting as well as post glucose

65

administration blood glucose level compared to ETKO mice (Figures 4.4-4.5). In

addition to being obese, Pcyt2 +/- mice also suffer from hepatic steatosis and reduced

fatty acid oxidation which all have been frequently associated with hyperglycemia

(Fullerton et al., 2009, Jiang and Torol, 2008, Petersen and Shulman, 2006). Sea

buckthorn extract treatment lowered ETKO blood glucose concentration (Figures

4.6-4.7). Enhanced expression of both PPAR-α and PPAR-γ may contribute to blood

glucose lowering effect of sea buckthorn as both nuclear receptors play a major role in

not only glucose but also lipid metabolism (Tirupathi Pichiah et al., 2012). PPAR-γ

increases glucose metabolism in the muscle by increasing glucose uptake leading to

lower blood glucose level (Patel et al., 2013).

Sea buckthorn extract reduced ETKO hepatic lipid accumulation (liver weight

and histological analysis)

One of the effects of partially knocking out the Pcyt2 gene is hepatic lipid

accumulation leading to higher liver weight (Fullerton et al., 2009). One previous

study showed that sea buckthorn extract prevents obesity-induced hepatic lipid

accumulation in mice fed a high fat diet (60% of energy from fat) (Tirupathi Pichiah

et al., 2012). After 30 days of daily sea buckthorn extract oral gavage (200 μg/g body

weight), liver fat accumulation as TAG was lower in ETKO mice relative to the

control ETKO resulting in lower (59.79% of control) post-treatment liver weight

(Figure 4.3). Increased expression of PPAR-α and CPT-1 coupled with decreased

66

expression of ACC produce outcomes of decreased fatty acid synthesis as well as

increased fatty acid oxidation possibly contribute to sea buckthorn extract-mediated

liver weight loss resulted from lowered hepatic lipid accumulation (Tirupathi Pichiah

et al., 2012, Xu et al., 2009).

Effects of sea buckthorn extract on hepatic pro-inflammatory and

anti-inflammatory cytokine gene expression

Although there is literature stating that sea buckthorn extract exhibits

anti-inflammatory property, no publication about sea buckthorn extract’s mechanism

of action is available (Tirupathi Pichiah et al., 2012, Ganju et al., 2005). Sea

buckthorn extract treatment did not have effect on liver pro-inflammatory cytokine

IL-12 mRNA level in the ETKO relative to control (Figure 4.8). Similar to no effect

on IL-12, treatment did not have effect on hepatic anti-inflammatory cytokine TGF-β1

gene expression among ETKO rodents (Figure 4.9). It would be interesting to study

IL-12 and TGF-β1 gene expression in adipose tissue. One human double-blind,

randomized, placebo-controlled trial found sea buckthorn extract reduced blood

C-reactive protein (CRP; inflammation marker) concentration thus confirming sea

buckthorn’s anti-inflammatory property (Larmo et al., 2008). It may be worthwhile to

measure blood CRP concentration in Pcyt2 mice prior to and after sea buckthorn

treatment.

67

Conclusion

Work conducted in this thesis project demonstrated that Pcyt2 ETKO mice

benefitted from sea buckthorn extract treatment indicated by decreased body weight,

lowered tissue lipids (and consequently alleviated NAFL) and blood glucose. Results

of this study suggest that sea buckthorn extract can be a dietary approach to

ameliorate obesity and associated complications of hyperglycemia and hepatic

steatosis. More studies are needed to determine if sea buckthorn has a role in

obesity-related inflammation.

68

Chapter 5: General Discussion and Concluding Remarks

Summary of Results

For LPS project that investigated obesity pathology, LPS treatment induction of

hepatic pro-inflammatory cytokine TNFα gene expression was higher in ETKO than

WT and LPS treatment induction of hepatic anti-inflammatory cytokine IL-10 gene

expression was lower in ETKO than WT. In addition, WT and ETKO mice had mostly

same basal as well as post LPS treatment hepatic pro-inflammatory and

anti-inflammatory cytokine gene expression (TNFα, IL-12, IL-10, as well as TGF-β1).

LPS treatment resulted in higher hepatic pro-inflammatory and anti-inflammatory

cytokine gene expression specifically IL-12, IL-10 for WT and ETKO as well as

TNFα, TGF-β1 for ETKO. Furthermore, ETKO mice had higher hepatic NF-κBp65

protein level than WT mice. For sea buckthorn project that investigated a possible

remedy for metabolic syndrome, sea buckthorn extract decreased ETKO mice body

and retroperitoneal adipose tissue weights, blood glucose level, and hepatic lipid

accumulation (liver weight and histological analysis).

Strengths and Limitations

Using a mouse model to study metabolic syndrome offers the advantage of

studying the whole body physiology and biochemistry. Since metabolic syndrome

affects multiple tissues and organs, a more complete approach that involves the

69

capability to investigate the entire body is more ideal as each affected tissue and organ

interact to contribute to the complex disease pathology. Also, these studies about

metabolic syndrome have clinical applications with the potential to benefit a

significant portion of population in developed nations. Limitations include the

relatively small sample size and the use of animal model. Results from animal model

cannot be extrapolated to humans with very high accuracy.

Future Directions

It is possible that sea buckthorn extract treatment results in same TNFα

(pro-inflammatory cytokine) gene expression following LPS treatment compared to

LPS untreated in ETKO mice based on the plant’s anti-inflammatory property.

Testing such possibility is an avenue of future research. Although we determined

beneficial effects of sea buckthorn extract in ETKO mice, mechanisms of these

effects are still uncertain and require future research. For example, as mentioned

earlier, lower hepatic mRNA expression of ACC (fatty acid synthesis enzyme) as well

as higher liver gene expression of CPT-1 (fatty acid β-oxidation enzyme) and PPAR-α

(fatty acid β-oxidation protein) may result in decreased fatty acid synthesis and

increased fatty acid oxidation possibly responsible for sea buckthorn extract-mediated

body, retroperitoneal adipose tissue, and liver weights losses. Determining if

70

enhanced expression of both PPAR-α and PPAR-γ contribute to blood glucose

lowering effect of sea buckthorn extract is also necessary.

Concluding Remarks

Work conducted in this thesis project demonstrated that obesity as induced by

partially knocking out Pcyt2 gene increases liver sensitivity to acute inflammation.

Also, sea buckthorn extract treatment reduced 4 of 5 symptoms of metabolic

syndrome in Pcyt2 ETKO mice.

71

Bibliography

Aaronson, D. S., & Horvath, C. M. (2002). A road map for those who don't

know JAK-STAT. Science, 296(5573), 1653-1655.

Abdel-Salam, B. K., & Sayed, A. A. A. (2012). Beneficial effect of garlic on

d-galactosamine and lipopolysaccharide-induced acute hepatic failure in

male albino rats. Allergologia et Immunopathologia, 40(4), 238-243.

Aigner, E., Theurl, I., Theurl, M., Lederer, D., Haufe, H., Dietze, O., ... &

Weiss, G. (2008). Pathways underlying iron accumulation in human

nonalcoholic fatty liver disease. Am J Clin Nutr, 87(5), 1374-1383.

Bacon, B. R., Farahvash, M. J., Janney, C. G., & Neuschwander-Tetri, B. A.

(1994). Nonalcoholic steatohepatitis: an expanded clinical entity.

Gastroenterology-Orlando, 107(4), 1103-1109.

Baffy, G. (2009). Kupffer cells in non-alcoholic fatty liver disease: the

emerging view. Journal of hepatology, 51(1), 212-223.

Bakovic, M., Fullerton, M. D., & Michel, V. (2007). Metabolic and

molecular aspects of ethanolamine phospholipid biosynthesis: the role of

CTP: phosphoethanolamine cytidylyltransferase (Pcyt2). Biochem and Cell

Biol, 85(3), 283-300.

Basu, M., Prasad, R., Jayamurthy, P., Pal, K., Arumughan, C., & Sawhney,

R. C. (2007). Anti-atherogenic effects of seabuckthorn (Hippophaea

rhamnoides) seed oil. Phytomedicine, 14(11), 770-777.

Baue, A. E. (1994). Multiple organ failure, multiple organ dysfunction

syndrome, and the systemic inflammatory response syndrome-where do we

stand? Shock, 2(6), 385-397.

72

Berezhnaya, G. A., Ozerinina, O. V., Yeliseev, I. P., Tsydendambaev, V. D.,

Vereshchagin, A. G. (1993). Developmental changes in the absolute content and

fatty acid composition of acyl lipids of sea buckthorn fruits. Plant Physiol and

Biochem, 31(3), 323-332.

Brasier, A. R. (2006). The NF-κB regulatory network. Cardiovas Toxi, 6(2), 111-130.

Brasier, A. R., Ron, D., Tate, J. E., & Habener, J. F. (1990). A family of constitutive

C/EBP-like DNA binding proteins attenuate the IL-1 alpha induced, NF kappa B

mediated trans-activation of the angiotensinogen gene acute-phase response

element. The EMBO Journal, 9(12), 3933.

Carroll, L., Voisey, J., & Van Daal, A. (2004). Mouse models of obesity. Clinics in

Derma, 22(4), 345-349.

Casafont, F., Crespo, J., Mayorga, M., Fernadez-Escalante, J. C., & Pons-Romero, F.

(2007). Lipopolysaccharide-binding protein plasma levels and liver TNF-alpha gene

expression in obese patients: evidence for the potential role of endotoxin in the

pathogenesis of non-alcoholic steatohepatitis. Obesity surgery,17(10), 1374-1380.

Cherniack, E. P. (2011). Polyphenols: planting the seeds of treatment for the

metabolic syndrome. Nutrition, 27(6), 617-623.

Clementi, A. H., Gaudy, A. M., van Rooijen, N., Pierce, R. H., & Mooney, R. A.

(2009). Loss of Kupffer cells in diet-induced obesity is associated with increased

hepatic steatosis, STAT3 signaling, and further decreases in insulin

signaling. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease,1792(11),

1062-1072.

Collart, M. A., Baeuerle, P., & Vassalli, P. (1990). Regulation of tumor necrosis factor

alpha transcription in macrophages: involvement of four kappa B-like motifs and of

constitutive and inducible forms of NF-kappa B. Molecular and Cellular

Biology, 10(4), 1498-1506.

Conti, P., Pang, X., Boucher, W., Letourneau, R., Reale, M., Barbacane, R. C., ... &

Theoharides, T. C. (1997). Monocyte chemotactic protein-1 is a proinflammatory

chemokine in rat skin injection sites and chemoattracts basophilic granular

cells. International Immunology, 9(10), 1563-1570.

73

Coutelier, J. P., Van Broeck, J. O. H. A. N., & Wolf, S. F. (1995). Interleukin-12 gene

expression after viral infection in the mouse. Journal of Virology, 69(3), 1955-1958.

Decker, K. (1990). Biologically active products of stimulated liver macrophages

(Kupffer cells). European Journal of Biochemistry, 192(2), 245-261.

de Luca, C., & Olefsky, J. M. (2008). Inflammation and insulin resistance. FEBS

Letters, 582(1), 97-105.

Diehl, A. M., Goodman, Z., & Ishak, K. G. (1988). Alcohollike liver disease in

nonalcoholics. A clinical and histologic comparison with alcohol-induced liver

injury. Gastroenterology, 95(4), 1056-1062.

Dinarello, C. A. (2000). Proinflammatory cytokines. CHEST Journal, 118(2),

503-508.

Dulos, J., Kaptein, A., Kavelaars, A., Heijnen, C., & Boots, A. (2005). Tumour

necrosis factor-alpha stimulates dehydroepiandrosterone metabolism in human

fibroblast-like synoviocytes: a role for nuclear factor-kappaB and activator protein-1

in the regulation of expression of cytochrome p450 enzyme 7b. Arthritis Res Ther, 7,

R1271-R1280.

Farooqi, I. S., & O’Rahilly, S. (2006). Genetics of obesity in humans. Endocrine

reviews, 27(7), 710-718.

Ferrero‐Miliani, L., Nielsen, O. H., Andersen, P. S., & Girardin, S. E. (2007). Chronic

inflammation: importance of NOD2 and NALP3 in interleukin‐1β generation. Clinical

& Experimental Immunology, 147(2), 227-235.

Francoeur, C., Escaffit, F., Vachon, P. H., Beaulieu, J. F. (2004). Proinflammatory

cytokines TNF-alpha and IFN-gamma alter laminin expression under an

apoptosis-independent mechanism in human intestinal epithelial cells.

American Journal of Physiology Gastrointestinal Liver Physiology, 287(3),

G592-598.

Franke, W., & Muller, H. (1983). A contribution to the biology of useful plants. 2.

Quantity and composition of fatty acid in the fat of the fruit flesh and seed of sea

buckthorn. Angew. Bot, 57, 77-83.

74

Fullerton, M. D., Hakimuddin, F., & Bakovic, M. (2007). Developmental and

metabolic effects of disruption of the mouse CTP: phosphoethanolamine

cytidylyltransferase gene (Pcyt2). Molecular and cellular biology, 27(9), 3327-3336.

Fullerton, M. D., Hakimuddin, F., Bonen, A., & Bakovic, M. (2009). The

development of a metabolic disease phenotype in CTP: phosphoethanolamine

cytidylyltransferase-deficient mice. Journal of Biological Chemistry, 284(38),

25704-25713.

Ganju, L., Padwad, Y., Singh, R., Karan, D., Chanda, S., Chopra, M. K., ... &

Sawhney, R. C. (2005). Anti-inflammatory activity of Seabuckthorn (Hippophae

rhamnoides) leaves. International Immunopharmacology, 5(12), 1675-1684.

Geetha, S., Sai Ram, M., Mongia, S. S., Singh, V., Ilavazhagan, G., & Sawhney, R. C.

(2003). Evaluation of antioxidant activity of leaf extract of Seabuckthorn (Hippophae

rhamnoides L.) on chromium (VI) induced oxidative stress in albino rats. Journal of

Ethnopharmacology, 87(2), 247-251.

Geetha, S., Singh, V., Ram, M. S., Ilavazhagan, G., Banerjee, P. K., & Sawhney, R. C.

(2005). Immunomodulatory effects of seabuckthorn (Hippophae rhamnoides L.)

against chromium (VI) induced immunosuppression. Molecular and cellular

biochemistry, 278(1-2), 101-109.

Gibellini, F., & Smith, T. K. (2010). The Kennedy pathway—De novo synthesis of

phosphatidylethanolamine and phosphatidylcholine. IUBMB life, 62(6), 414-428.

Gilmore, T. D. (2006). Introduction to NF-κB: players, pathways,

perspectives.Oncogene, 25(51), 6680-6684.

Grewe, M., Gausling, R., Gyufko, K., Hoffmann, R., & Decker, K. (1994). Regulation

of the mRNA expression for tumor necrosis factor-α in rat liver macrophages. Journal

of hepatology, 20(6), 811-818.

Grey, C., Widén, C., Adlercreutz, P., Rumpunen, K., & Duan, R. D. (2010).

Antiproliferative effects of sea buckthorn (Hippophae rhamnoides L.) extracts on

human colon and liver cancer cell lines. Food Chemistry, 120(4), 1004-1010.

75

Haffner, M. C., Berlato, C., & Doppler, W. (2006). Exploiting our knowledge of

NF-κB signaling for the treatment of mammary cancer. Journal of mammary gland

biology and neoplasia, 11(1), 63-73.

Hosoi, T., Wada, S., Suzuki, S., Okuma, Y., Akira, S., Matsuda, T., & Nomura, Y.

(2004). Bacterial endotoxin induces IL-20 expression in the glial cells.Molecular

brain research, 130(1), 23-29.

Hsieh, C. S., Macatonia, S. E., Tripp, C. S., Wolf, S. F., O'Garra, A., & Murphy, K. M.

(1993). Development of TH1 CD4+ T cells through IL-12 produced by

Listeria-induced macrophages. Science, 260(5107), 547-549.

Hsu, Y. W., Tsai, C. F., Chen, W. K., & Lu, F. J. (2009). Protective effects of

seabuckthorn (Hippophae rhamnoide s L.) seed oil against carbon

tetrachloride-induced hepatotoxicity in mice. Food and Chemical Toxicology,47(9),

2281-2288.

Kallio, H., Yang, B., & Peippo, P. (2002). Effects of different origins and harvesting

time on vitamin C, tocopherols, and tocotrienols in sea buckthorn (Hippophae

rhamnoides) berries. Journal of Agricultural and Food Chemistry,50(21), 6136-6142.

Kanda, H., Tateya, S., Tamori, Y., Kotani, K., Hiasa, K. I., Kitazawa, R., ... & Kasuga,

M. (2006). MCP-1 contributes to macrophage infiltration into adipose tissue, insulin

resistance, and hepatic steatosis in obesity. Journal of Clinical Investigation, 116(6),

1494-1505.

Kawai, T., Adachi, O., Ogawa, T., Takeda, K., & Akira, S. (1999). Unresponsiveness

of MyD88-deficient mice to endotoxin. Immunity, 11(1), 115-122.

Kohgo, Y., Ikuta, K., Ohtake, T., Torimoto, Y., & Kato, J. (2007). Iron overload and

cofactors with special reference to alcohol, hepatitis C virus infection and

steatosis/insulin resistance. World Journal of Gastroenterology, 13(35), 4699.

Korbie, D. J., & Mattick, J. S. (2008). Touchdown PCR for increased specificity and

sensitivity in PCR amplification. Nature Protocols, 3(9), 1452-1456.

76

Kumar, M. S., Dutta, R., Prasad, D., & Misra, K. (2011). Subcritical water extraction

of antioxidant compounds from Seabuckthorn (Hippophae rhamnoides) leaves for the

comparative evaluation of antioxidant activity.Food Chemistry, 127(3), 1309-1316.

Lanthier, N., Molendi-Coste, O., Cani, P. D., van Rooijen, N., Horsmans, Y., &

Leclercq, I. A. (2011). Kupffer cell depletion prevents but has no therapeutic effect on

metabolic and inflammatory changes induced by a high-fat diet. The FASEB

Journal, 25(12), 4301-4311.

Larmo, P., Alin, J., Salminen, E., Kallio, H., & Tahvonen, R. (2007). Effects of sea

buckthorn berries on infections and inflammation: a double-blind, randomized,

placebo-controlled trial. European journal of clinical nutrition, 62(9), 1123-1130.

Lee, Y. S. (2009). The role of leptin-melanocortin system and human weight

regulation: lessons from experiments of nature. Annals Academy of Medicine

Singapore, 38(1), 34.

Leonardi, R., Frank, M. W., Jackson, P. D., Rock, C. O., & Jackowski, S. (2009).

Elimination of the CDP-ethanolamine pathway disrupts hepatic lipid

homeostasis. Journal of Biological Chemistry, 284(40), 27077-27089.

Lepper, P. M., Schumann, C., Triantafilou, K., Rasche, F. M., Schuster, T., Frank,

H., ... & von Eynatten, M. (2007). Association of lipopolysaccharide-binding protein

and coronary artery disease in men. Journal of the American College of

Cardiology, 50(1), 25-31.

Li, H., Zheng, H. W., Chen, H., Xing, Z. Z., You, H., Cong, M., & Jia, J. D. (2012).

Hepatitis B virus particles preferably induce Kupffer cells to produce TGF-β1 over

pro-inflammatory cytokines. Digestive and Liver Disease, 44(4), 328-333.

Lin, H. V., Kim, J. Y., Pocai, A., Rossetti, L., Shapiro, L., Scherer, P. E., & Accili, D.

(2007). Adiponectin resistance exacerbates insulin resistance in insulin receptor

transgenic/knockout mice. Diabetes, 56(8), 1969-1976.

Liu, H., Yu, W., Liou, L. Y., & Rice, A. P. (2003). Isolation and characterization of

the human DC-SIGN and DC-SIGNR promoters. Gene, 313, 149-159.

77

Livingston, D. H., & Deitch, E. A. (1995). Multiple organ failure: a common problem

in surgical intensive care unit patients. Annals of medicine, 27(1), 13-20.

Lopez, A. D., Mathers, C. D., Ezzati, M., Jamison, D. T., & Murray, C. J. (2006).

Global and regional burden of disease and risk factors, 2001: systematic analysis of

population health data. The Lancet, 367(9524), 1747-1757.

Ludwig, J., Viggiano, T. R., McGill, D. B., & Oh, B. J. (1980). Nonalcoholic

steatohepatitis: Mayo Clinic experiences with a hitherto unnamed disease. InMayo

Clinic proceedings. Mayo Clinic (Vol. 55, No. 7, pp. 434-438).

Lumeng, C. N., & Saltiel, A. R. (2011). Inflammatory links between obesity and

metabolic disease. The Journal of clinical investigation, 121(6), 2111.

Maheshwari, D. T., Kumar, Y., Verma, S. K., Singh, V. K., & Singh, S. N. (2011).

Antioxidant and hepatoprotective activities of phenolic rich fraction of Seabuckthorn

(Hippophae rhamnoides L.) leaves. Food and Chemical Toxicology, 49(9),

2422-2428.

Marchesini, G., Moscatiello, S., Di Domizio, S., & Forlani, G. (2008).

Obesity-associated liver disease. Journal of Clinical Endocrinology &

Metabolism, 93(11 Supplement 1), s74-s80.

Martin, G. S., Mannino, D. M., Eaton, S., & Moss, M. (2003). The epidemiology of

sepsis in the United States from 1979 through 2000. New England Journal of

Medicine, 348(16), 1546-1554.

McClain, C., Hill, D., Schmidt, J., & Diehl, A. M. (1993, May). Cytokines and

alcoholic liver disease. In Seminars in Liver Diseases (Vol. 13, pp. 170-170). GEORG

THIEME VERLAG.

Moreno-Navarrete, J. M., Ortega, F., Serino, M., Luche, E., Waget, A., Pardo, G., ...

& Fernández-Real, J. M. (2011). Circulating lipopolysaccharide-binding protein (LBP)

as a marker of obesity-related insulin resistance. International Journal of

Obesity, 36(11), 1442-1449.

Morgan, E. T., Li-Masters, T., & Cheng, P. Y. (2002). Mechanisms of cytochrome

P450 regulation by inflammatory mediators. Toxicology, 181, 207-210.

78

Mori, N., & Prager, D. (1996). Transactivation of the interleukin-1alpha promoter by

human T-cell leukemia virus type I and type II Tax proteins. Blood, 87(8), 3410-3417.

Nijveldt, R. J., van Nood, E., van Hoorn, D. E., Boelens, P. G., van Norren, K., & van

Leeuwen, P. A. (2001). Flavonoids: a review of probable mechanisms of action and

potential applications. The American journal of clinical nutrition,74(4), 418-425.

O'Rourke, R. W., White, A. E., Metcalf, M. D., Winters, B. R., Diggs, B. S., Zhu, X.,

& Marks, D. L. (2012). Systemic inflammation and insulin sensitivity in obese IFN-γ

knockout mice. Metabolism, 61(8), 1152-1161.

Patel, T. P., Soni, S., Parikh, P., Gosai, J., Chruvattil, R., & Gupta, S. (2013).

Swertiamarin: An Active Lead from Enicostemma littorale Regulates Hepatic and

Adipose Tissue Gene Expression by Targeting PPAR-γ and Improves Insulin

Sensitivity in Experimental NIDDM Rat Model. Evidence-Based Complementary and

Alternative Medicine, 2013.

Pavlovic, Z., & Bakovic, M. (2013). Regulation of Phosphatidylethanolamine

Homeostasis—The Critical Role of CTP: Phosphoethanolamine Cytidylyltransferase

(Pcyt2). International journal of molecular sciences, 14(2), 2529-2550.

Peng, T., Lu, X., Lei, M., & Feng, Q. (2003). Endothelial nitric-oxide synthase

enhances lipopolysaccharide-stimulated tumor necrosis factor-α expression via

cAMP-mediated p38 MAPK pathway in cardiomyocytes. Journal of Biological

Chemistry, 278(10), 8099-8105.

Perfield, J. W., Ortinau, L. C., Pickering, R. T., Ruebel, M. L., Meers, G. M., &

Rector, R. S. (2013). Altered hepatic lipid metabolism contributes to nonalcoholic

Fatty liver disease in leptin-deficient ob/ob mice. Journal of obesity, 2013.

Perkins, N. D. (2007). Integrating cell-signalling pathways with NF-κB and IKK

function. Nature Reviews Molecular Cell Biology, 8(1), 49-62.

Pichiah, P. B., Moon, H. J., Park, J. E., Moon, Y. J., & Cha, Y. S. (2012). Ethanolic

extract of seabuckthorn (Hippophae rhamnoides L) prevents high-fat diet–induced

obesity in mice through down-regulation of adipogenic and lipogenic gene

expression. Nutrition Research, 32(11), 856-864.

79

Pintea, A., Marpeau, A., Faye, M., Socaciu, C., & Gleizes, M. (2001). Polar lipid and

fatty acid distribution in carotenolipoprotein complexes extracted from sea buckthorn

fruits. Phytochemical Analysis, 12(5), 293-298.

Puddu, P., Fantuzzi, L., Borghi, P., Varano, B., Rainaldi, G., Guillemard, E., ... &

Gessani, S. (1997). IL-12 induces IFN-gamma expression and secretion in mouse

peritoneal macrophages. The journal of Immunology, 159(7), 3490-3497.

Reber, L., Vermeulen, L., Haegeman, G., & Frossard, N. (2009). Ser276

phosphorylation of NF-kB p65 by MSK1 controls SCF expression in

inflammation. PLoS One, 4(2), e4393.

Renström, F., Payne, F., Nordström, A., Brito, E. C., Rolandsson, O., Hallmans, G., ...

& Franks, P. W. (2009). Replication and extension of genome-wide association study

results for obesity in 4923 adults from northern Sweden.Human molecular

genetics, 18(8), 1489-1496.

Rietschel, E. T., Kirikae, T., Schade, F. U., Mamat, U., Schmidt, G., Loppnow, H., ...

& Di Padova, F. (1994). Bacterial endotoxin: molecular relationships of structure to

activity and function. The FASEB Journal, 8(2), 217-225.

Rocha, V. Z., & Folco, E. J. (2011). Inflammatory concepts of obesity.International

journal of inflammation, 2011.

Rocha, V. Z., Folco, E. J., Sukhova, G., Shimizu, K., Gotsman, I., Vernon, A. H., &

Libby, P. (2008). Interferon-γ, a Th1 Cytokine, Regulates Fat Inflammation A Role

for Adaptive Immunity in Obesity. Circulation research, 103(5), 467-476.

Rousi, A. (1971). The genus Hippophae L.: A taxonomic study. Ann. Bot. Fenn,8(3),

177-227.

Sajan, M. P., Standaert, M. L., Nimal, S., Varanasi, U., Pastoor, T., Mastorides, S., ...

& Farese, R. V. (2009). The critical role of atypical protein kinase C in activating

hepatic SREBP-1c and NFκB in obesity. Journal of lipid research, 50(6), 1133-1145.

Schroder, K., Hertzog, P. J., Ravasi, T., & Hume, D. A. (2004). Interferon-γ: an

overview of signals, mechanisms and functions. Journal of leukocyte biology,75(2),

163-189.

80

Sharif, O., Bolshakov, V. N., Raines, S., Newham, P., & Perkins, N. D. (2007).

Transcriptional profiling of the LPS induced NF-κB response in macrophages.BMC

immunology, 8(1), 1.

Sharma, M., Siddique, M. W., Shamim, A. M., Shukla, G., & Pillai, K. K. (2011).

Evaluation of antidiabetic and antioxidant effects of seabuckthorn (Hippophae

rhamnoides l.) in streptozotocin-nicotinamide induced diabetic rats. In The Open

Conference Proceedings Journal (Vol. 2, pp. 53-58).

Shea-Budgell, M., Dojka, M., Nimmo, M., Lee, D., & Xu, Z. (2006). A BRIEF

COMMUNICATION Marginal Zinc Deficiency Increased the Susceptibility to Acute

Lipopolysaccharide-Induced Liver Injury in Rats. Experimental Biology and

Medicine, 231(5), 553-558.

Singh, R. K., Fullerton, M. D., Vine, D., & Bakovic, M. (2012). Mechanism of

hypertriglyceridemia in CTP: phosphoethanolamine cytidylyltransferase-deficient

mice. Journal of Lipid Research, 53(9), 1811-1822.

Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H.,

Provenzano, M., ... & Klenk, D. C. (1985). Measurement of protein using

bicinchoninic acid. Analytical biochemistry, 150(1), 76-85.

Šnē, E., Segliņa, D., Galoburda, R., & Krasnova, I. (2013). Content of Phenolic

Compounds in Various Sea Buckthorn Parts. In Proceedings of the Latvian Academy

of Sciences. Section B. Natural, Exact, and Applied Sciences (pp. 27-31).

Sohn, B., Moon, H., Kim, T., Kang, H., Bae, Y., Lee, K., & Kim, S. (2001).

Interleukin-10 up-regulates tumour-necrosis-factor-α-related apoptosis-inducing

ligand (TRAIL) gene expression in mammary epithelial cells at the involution

stage. Biochem. J, 360, 31-38.

Son, Y. H., Jeong, Y. T., Lee, K. A., Choi, K. H., Kim, S. M., Rhim, B. Y., & Kim, K.

(2008). Roles of MAPK and NF-[kappa] B in Interleukin-6 Induction by

Lipopolysaccharide in Vascular Smooth Muscle Cells. Journal of cardiovascular

pharmacology, 51(1), 71-77.

81

Suryakumar, G., & Gupta, A. (2011). Medicinal and therapeutic potential of Sea

buckthorn (Hippophae rhamnoides L.). Journal of ethnopharmacology,138(2),

268-278.

Tanuma, N., Shima, H., Nakamura, K., & Kikuchi, K. (2001). Protein tyrosine

phosphatase εC selectively inhibits interleukin-6–and interleukin-10–induced

JAK-STAT signaling. Blood, 98(10), 3030-3034.

Tran, A., & Gual, P. (2013). Non-alcoholic steatohepatitis in morbidly obese

patients. Clinics and research in hepatology and gastroenterology, 37(1), 17-29.

Trinchieri, G. (1995). Interleukin-12: a proinflammatory cytokine with

immunoregulatory functions that bridge innate resistance and antigen-specific

adaptive immunity. Annual review of immunology, 13(1), 251-276.

Ulevitch, R. J., & Tobias, P. S. (1995). Receptor-dependent mechanisms of cell

stimulation by bacterial endotoxin. Annual review of immunology, 13(1), 437-457.

Wagner, J. G., & Roth, R. A. (1999). Neutrophil migration during

endotoxemia.Journal of leukocyte biology, 66(1), 10-24.

Wakil, S. J., Stoops, J. K., & Joshi, V. C. (1983). Fatty acid synthesis and its

regulation. Annual review of biochemistry, 52(1), 537-579.

Wang, J., Zhang, W., Zhu, D., Zhu, X., Pang, X., & Qu, W. (2011). Hypolipidaemic

and hypoglycaemic effects of total flavonoids from seed residues of Hippophae

rhamnoides L. in mice fed a high‐fat diet. Journal of the Science of Food and

Agriculture, 91(8), 1446-1451.

Wheeler, M. D. (2003). Endotoxin and Kupffer cell activation in alcoholic liver

disease. Alcohol research and Health, 27, 300-306.

Willer, C. J., Speliotes, E. K., Loos, R. J., Li, S., Lindgren, C. M., Heid, I. M., ... &

Gillson, C. J. (2008). Six new loci associated with body mass index highlight a

neuronal influence on body weight regulation. Nature genetics, 41(1), 25-34.

82

Yang, B., & Kallio, H. P. (2001). Fatty acid composition of lipids in sea buckthorn

(Hippophae rhamnoides L.) berries of different origins. Journal of Agricultural and

Food Chemistry, 49(4), 1939-1947.

Yang, S. Q., Lin, H. Z., Land, M. D., Clemens, M., & Diehl, A. M. (1997). Obesity

increases sensitivity to endotoxin liver injury: Implications for the pathogenesis of

steatohepatitis. Proceedings of the National Academy of Sciences, 94, 2557–2562.

Zhang, F. X., Kirschning, C. J., Mancinelli, R., Xu, X. P., Jin, Y., Faure, E., ... &

Arditi, M. (1999). Bacterial lipopolysaccharide activates nuclear factor-κB through

interleukin-1 signaling mediators in cultured human dermal endothelial cells and

mononuclear phagocytes. Journal of Biological Chemistry, 274(12), 7611-7614.

Zhu, L., Johnson, C., & Bakovic, M. (2008). Stimulation of the human CTP:

phosphoethanolamine cytidylyltransferase gene by early growth response protein

1. Journal of lipid research, 49(10), 2197-2211.

83

Appendix A

Gene Primers Temperatures, Time, and

Cycle Numbers

IFNγ

Puddu et al., 1997

F: 5' AACGCTACACACTGCATCTTG

G 3'

R: 5' GACTTCAAAGAGTCTGAGG 3'

95°C 5 min

(90°C 40 sec 62°C 40

sec 72°C 1 min)- 30

cycles

72°C 10 min

TNFα

Peng et al., 2003

F: 5' CCGATGGGTTGTACCTTGTC 3'

R: 5' GGGCTGGGTAGAGAATGGAT

3'

95°C 5 min

(95°C 1.5 min 62°C 1

min 72°C 45 sec)- 40

cycles

72°C 10 min

IL-12

Coutelier, Van

Broeck, and Wolf,

1995

F: 5' TTGCCCTCCTAAAC

CACCTCA 3’

R: 5' CTTGCTCTTCTGCT

AACACAT 3’

95°C 5 min

(95°C 2 min 55°C 2 min

72°C 1 min)- 35 cycles

72°C 10 min

IL-10

Sohn et al., 2001

F: 5' GCTGAGGCGCTGTCATCGAT 3'

R: 5' GAGCTGCTGCAGGAATGATC 3'

95°C 5 min

(94°C 45 sec 62°C 1 min

72°C 40 sec)- 25 cycles

72°C 10 min

TGF-β1

Oi, Yamamoto,

and Nishioka,

2004

F: 5' AAGTGGATCCACGAGCCCAA 3'

R: 5' CTGCACTTGCAGGAGCGCAC 3'

95°C 5 min

(95°C 2 min 60°C 2 min

72°C 1 min)- 40 cycles

72°C 10 min

specific cytokine primers used in Chapter 3 PCR analyses

84

Appendix B

Gene Primers Temperatures, Time, and

Cycle Numbers

IL-12

F: 5' ACCCTTGCATCTGGC

GTCTA 3’

R: 5' TGGTCTTCAGCAGGT

TTCGG 3’

95°C 7 min

(95°C 2 min 64°C

(annealing

temperature-Ta) 1 min

72°C 40 sec)- 18 cycles

(every cycle, Ta goes

down 0.5°C)

(95°C 2 min 55°C 1 min

72°C 40 sec)- 17 cycles

72°C 10 min

TGF-β1

F: 5' GCTGAACCAAGGAGACGGAA

3'

R: 5' AGAAGTTGGCATGGTAGCCC 3'

95°C 7 min

(95°C 2 min 64°C (Ta) 1

min 72°C 45 sec)- 18

cycles (every cycle,

Ta goes down 0.5°C)

(95°C 2 min 55°C 1 min

72°C 45 sec)- 17 cycles

72°C 10 min

G3PDH

F: 5' ACCACAGTCCATGCCATCAC 3'

R: 5' TCCACCACCCTGTTGCTGTA 3'

95°C 3 min

(95°C 40 sec 55°C 40

sec 72°C 1 min)- 32

cycles

72°C 10 min

specific cytokine primers used for Chapter 4 PCR analyses