[CANCER RESEARCH 53. 5523-5527. November 15, ITO]

Production of Transgenic Mice Expressing the Kì-rasOncogene under the Controlof a Thyroglobulin Promoter1

Giovanni Santi-Ili, Vittorio de Franciscis, Giuseppe Portella, Gennaro Chiappetta, Amelia D'Alessio, Daniela Califano,Rita Rosati, Alba Mineo, Carmen Monaco, Giovanni Manzo, Laura Pozzi, and Giancarlo Vecchio2

Servizio di Oncologia Sperimentale E, Istituto per lo Studio e la Cura dei dei Tumori Fondazione "C. Pascale, " via M. Semmola ¡C.S., G. P., G. C., D. C., A. M., C. M., G. M.],

and Centro di Endocrinologia ed Oncologia Sperimentale del C.N.R., ciò Dipartimento di Biologia e PatologìaCellulare e Molecolare, Università di Napoli Federica II,via S. Pansini, 5, HOI31 Napoli. Italy ¡V.d. F., A. D., R. fi., G. V.]; and Istituto Regina Elena, viale Regina Margherita, Rome, Italy /I.. I'./

ABSTRACT

TVansgenic mice have been generated bearing three fusion genes consisting of: (a) a 900-base pair rat thyroglobulin promoter followed by a

gene coding for a chloroamphenicol acetyl transferase activity; (In thesame promoter followed by the complementary DNA of the human activated Ki-ras oncogene; (ci a 2000-base pair rat thyroglobulin promoterfollowed by the complementary DNA of the human activated Ki-ra\. Wehave shown that the 900-base pair rat thyroglobulin promoter is able to

direct the expression of the reporter gene specifically in the thyroid glandof transgenic mice. The mice bearing the two Ki-/-«.\constructs, which

express the transgene in thyroid glands, show thyroid abnormalities, although at very low incidence. These lesions appear after a long latency andwith a benign aspect, thus suggesting that, in agreement with literaturedata on naturally occurring human thyroid tumors, the action of anactivated rax gene is not sufficient to attain a complete malignant conversion of thyroid glands in vivo. However, ras expression in thyroid follicularcells represents a favorable ground for tumor development, as shown bythe fact that goitrogen stimulation experiments increase the occurrence oftumors.

INTRODUCTION

Point mutation of ras genes is the most common dominant oncogene activation found in human tumors (1). However, the relativefrequencies of this event are variable, with the highest incidence so farfound in tumors from the exocrine pancreas where it reaches 80% ofthe cases (2). Three oncogenes have been found frequently activatedin human thyroid carcinomas: ras (Ki-, Ha-, and N-ros); trk; andKET/PTC (3-6). Activated ras genes are present in various types of

human thyroid tumors, both benign and malignant, consistent with thehypothesis that ras genes mutations are an early step in thyroid tumor-

igenesis (3). Some studies have also observed a possible correlationbetween the presence or absence of ras mutations and the histológica!type (7, 8), but other studies have not confirmed these observations(3). However, trk and RET/PTC, both endowed with a tyrosine proteinkinase activity, have been exclusively detected in the papillary type ofthyroid cancer. At present, there is a lack of an adequate experimentalmodel of human thyroid tumors to allow the study of the interplay ofendogenous and exogenous factors from the onset through the development of this neoplasm. The model of transgenic mice obtained byintroducing foreign DNA into fertilized eggs can provide a powerfulexperimental approach to the open questions of the role of oncogenesin the transforming process in vivo. Recently, (9) targeting SV40 largeT antigen by use of a thyroid specific promoter has produced lines oftransgenic mice that develop polyclonal thyroid tumors within a fewweeks after birth showing phenotypic similarities with the anaplastic

Received ft/4/93; accepted 9/14/93.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

' Supported by the Associazione Italiana per la Ricerca sul Cancro, by the CNR Project"Biotechnology and Bioinstrumentation", and CNR Project "Applica/ioni Cliniche dellaRicerca Oncologica." A.D'A. is a recipient of a fellowship from the CNR Project "Biotechnology and Bioinstrumentation."

2 To whom requests for reprints should be addressed.

type of human thyroid tumors. In order to investigate the role playedby activation of naturally occurring cellular oncogenes, we have introduced into mouse zygotes the human activated Ki-ra.s oncogene

fused to the rat thyroglobulin promoter. Here we show that the activated Ki-ra.s oncogene, when expressed in the mouse thyroid, is able

to induce, at low frequencies, benign tumor growth, thus suggestingthat more than one genetic event is necessary to confer a completelymalignant thyroid phcnotype in vivo. However, treatment of the Ki-

ras transgenic mice with antithyroid drugs for 6 months, a treatmentknown to induce thyroid cells proliferation, via TSH3 stimulation,

highly increases the frequency, and shortens the latency, of appearanceof benign lesions favoring also the induction of malignant cell growth.

MATERIALS AND METHODS

Construction of Plasmids. The pTg-CAT construct contains a rat Tg promoter fragment of 827 hase pairs (-827 to +39 relative to transcription startsite) (10, 11). The TG900-ra.v was constructed as follows. The Tg promoterfragment Psll/Hinàlll from pTg-CAT was cloned into the poly linker of pUC 19vector. The activated c-Ki-ra.s-2 was obtained from American Type Culture

Collection (12). The fragment Sma\/Hind\ll of 1.1 kilohascs corresponding tothe coding part of the activated oncogene was isolated and subsequently theSma\ site was converted to a ///«dill site by addition of ///»dill linkers. ThisHind\\l/Hind\\\ fragment was cloned downstream the Tg promoter into theHindl\l site of the pUC 19ATg promoter. The TG3500-ra.s. containing 3500

base pairs of the rat thyroglobulin promoter, was obtained from the plasmidTG90()-ra.v by insertion of a fragment EcoR\-Bstcll derived from pTg-NEO(11) into Smal-BstcM of the TG9(X)-ras, after conversion of the EcoRl to a

blunt end by filling with Klenow DNA polymerase.Production of Transgenic Mice. Transgenic mice were generated as de

scribed by Hogan et al. (13). Briefly, linearized DNA was dissolved in 10 ITIMTris pH 7.4-0.1 HIMEDTA at a concentration of 1-2 fig/ml and microinjected

into (C57 BL/6J x DBA/2)F2 1 cell embryos. Surviving embryos were transferred to the oviducts of pseudo-pregnant females for development.

CAT Assay. The cloramphenicol acetyl transferase activity was assayed ontissue homogenates, essentially as described by Gorman et al. (14).

DNA Isolation and Southern Blot Analysis. Genomie DNA was extractedfrom tail biopsies (13) and digested with restriction enzymes. DNA fragmentswere then separated by clcctrophorcsis in 0.8% agarose and transferred tonylon membranes by the method of Southern (15). DNA probes were labeledby the random primer method of Feinberg and Vogelstein (Ift).

Molecular Probes. The CAT "Genblock" obtained from Pharmacia

(Uppsala, Sweden) was used to screen TG900-CAT mice and the entire Ki-ro.vcDNA was used to screen TG900-ra.s and TG2000-ra.v mice. For the in situhybridization experiments, the human Ki-ra.v cDNA was reeloned in the RNAexpression plasmid pGEM-3Z (Promcga Corporation, Madison, WI) in both5'—>3' and 3'-»5' orientations to provide antiscnse and sense RNA probes,

respectively. Template DNAs for in vitro transcription were prepared by linearizing the ras antisensc and ra.v sense plasmids with /:V»RI.RadioactiveRNA probes were synthesized in vitro with [15S]UTP and SP6 phage RNA

polymerase.Histológica! Procedures and in Situ Hybridization. Fresh tissues, imme

diately after excision, were sectioned at 5 /xm thickness in a freezing micro-

1The abbreviations used are: TSH. thyroid stimulating hormone; Tg, thyroglobulin:

CAT, chloroamphenicol acetyl transferase; RT-PCR, reverse transcriptase-polymcra.sechain reaction; cDNA, complementary DNA.

5523

on May 27, 2018. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

TRANSGENIC MICE EXPRESSING Vj-ras

tome and fixed in cold ethanol, 4% paraformaldehyde. phosphate-buffered

saline, and ethanol. Frozen sections were stained with hematoxylin and eosinwith standard methods or processed for in situ hybridization. To this purpose,sections were subjected to mild acid hydrolysis (5 min), digestion in protein-

ase K (5 min), and acetylation with acetic anhydride (10 min). The slideswere equilibrated for 2 h at 50°Cin hybridization solution, dehydrated by un

dergoing a graded ethanol series from 30 to 100%, and then air-dried. The

probe was mixed with the hybridization solution at a final concentration of0.3 fJ.g/ml and denatured by being heated at 7()°Cfor 10 min. Fifty fil of

probe solution were added to each slide and hybridization was carried on for18 h at 5()°Cin a humidified plastic box. Posthybridization washings, includ

ing a RNase digestion step, followed the hybridization. Finally, the slideswere dried, dipped in Kodak NTB-2 emulsion, and exposed for 3 weeks. All

slides were counterstained with hematoxylin and eosin.RT-PCR. Tissue samples were homogenized in guanidine isothiocyanate,

and total RNA was extracted with acid phenol, precipitated with isopropanol,and then subjected to RNase-free DNase digestion (Promega). Two /ng of RNAwere reverse transcribed for 60 min at 42°Cby 5 units of Moloney murine

leukemia virus reverse transcriptase and subsequently amplified by 30 cyclesof PCR with Taq DNA polymerase (1 min at 94°C,1 min at 55°C,and 1 minat 72°C).A PCR amplification of DNA was performed on the same RNA

samples, without the reverse transcription step, as control. The TG-exon 1specific 5' oligonucleotide was 5'TCCACCCCATCATTTGAGT3'; the humanKi-rai specific 3' oligonucleotide was 5'CACAAAGAAAGCCCTCCCCA3'.

The latter oligonucleotide was also used in the reverse transcriptase reaction.Goitrogen Treatment. Transgenic mice, aged 2-4 months, along with non-

transgenic littermates, belonging to the TG2000-ra.v 40 family, were ran

domly segregated into 4 groups. One group of 11 transgenic and one group of14 nontransgenic mice were given aminotriazole (1 g/liter) and sodiumperchlorate (10 g/liter) in the drinking water for a 6-month period and then

immediately sacrificed. Two additional groups, one of 12 transgenic and oneof 10 nontransgenic mice were administered the above described goitrogenregimen for 6 months. This treatment was interrupted for 2 months to allowthe return of thyroid hormones to normal levels, and the mice were thensacrificed.

200 bp

A) 900 bp RAT THYROGLOBULIN PROMOTER FUSED TOTHE CHLORAMPHENICOLACETYLTRANSFERASE GENE

SB Bt

Vs27TG1

CAT*•AUG—

*•mRNAP

B) 900 bp RAT THYROGLOBULIN PROMOTER FUSEDTO THE ACTIVATED HUMAN Ki-ras cDNA

TGKi-ras»AUG»•

mPMAB1

C) 2 Kbp RAT THYROGLOBULIN PROMOTER FUSEDTO THE ACTIVATED HUMAN Ki-ras cDNA

-3500 ^•1950Bt

TG

mRNA

Fig. 1. Schematic representation of the hybrid genes used. A, pTg-CAT, B, BamHl. P,Pvul, B, TGWU-ras, S, Sma\, Bt, BsteU; C, TG3500-ras. bp, base pairs.

RESULTS

In order to verify the tissue specificity in vivo of the rat thyroglobu-lin promoter, a 4000-base pair fragment (Bam\\\-Pvu\) from pTg-CAT

was microinjected into the pronuclei of fertilized mouse eggs to generate transgenic mice (TG900-CAT; Fig. L4). Five transgenic micewere identified by Southern blot hybridization using the C47*gene as

a probe. These mice were crossed to generate lines and it was observed that all founders transmitted the transgene in a Mendelianfashion. To study the expression of the transgene, a CAT activity assaywas carried out on homogenates from 6 organs, i.e., thyroid, brain,lung, liver, kidney, and spleen of founders and of the first generationderived from them. CAT activity, although at variable levels, wasobserved solely in the thyroid gland tissue in 4 lines out of 5 and wastransmitted along with the transgene (Fig. 2). The Ki-ras constructsdriven by the same promoter fragment used for the TG900-CAT(TG900-ra.y) and by a larger fragment spanning from -3500 to +39(TG3500-ras) are shown in Fig. 1, B and C, respectively. A BamH\-

BamHl fragment of about 2000 base pairs was microinjected to generate transgenic mice for TG9()()-ro.s-while a Bamtìì-BamHlfragment

of about 3000 base pairs containing 2000 base pairs of the thyro-globulin promoter (TG200()-ras) was microinjected to generate transgenic mice for TG2000-ras. Five lines were produced for the TG900-ras construct and 17 lines were produced for the TG2000-ras. All

founder mice transmitted the transgene to the progeny in a Mendelianfashion. These founders and lines derived from them were followedfor p to 20 months. All mice so far examined were apparently healthywitli a normal growth rate and serum levels of thyroid hormones, T3and T4, in the normal ranges (results not shown). At defined timeintervals, from 10 months of age onwards, groups of transgenic mice

o5oc

í

io

olUIII

ILU)

cem

ocLU

Fig. 2. Analysis of CAT activities in homogenates of various organs from a foundermouse transgenic for the TG900-CAT construct.

were sacrificed, together with the same number of control nontransgenic animals, and the gross appearance and histology of thyroid,brain, lung, liver, kidney, and spleen were examined. At least 3 members of each transgenic line have been examined thus far. There wereclearly abnormalities in the histology of the stained thyroid sectionsfrom three mice: (a) TG9QQ-ras 61.3, of F, generation, displayed

5524

on May 27, 2018. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

TRANSCI-NIC MICE EXPRESSING Ki-ra*

, *%%%•¿�fr.'*•

W«B£I5Õ>ÄfSStt

Fig. 3. ^ and B, photomicrographs of hcmatoxylin and cosin-staincd fro/en thyroid sections of mouseTG2000-rf/.v 40.4 thyroid (x UK)).A. adenoma with a papillary architecture;ß,nodule. C, photomicrograph of hematoxylin and eosin stained, formalin fixed, paraffin embedded thyroid section (X 250) from goitrogcn-trcalcd, and then suspendedfor 2 months,nontransgenic mouse. Note the almost complete reversal toward a normal morphology. 1), photomicrograph of hematoxylin and eosin stained fro/en thyroid section of a goitrogen-treated, and then suspended for 2 months. TG2000-r«.vtransgenic mouse (X 1000). Note the presenceof a carcinoma without any reversal of goitrogcn-induced lesions.

rather disorganized follicles, lined by epithelial cells showing an increased cell height and nuclear pleomorphism with no observabletumors; (b) TG2()()()-ra.v 40.0 presented a marked vasculitis in thethyroid tissue; and (c) TG2000-r«.v40.4, of F, generation, sacrificed

at 12 months of age, showed a histologically abnormal thyroid gland(Fig. 3, A and B; Table 1). In detail, towards a center of one lobe asmall lesion was visible with a papillary architecture and several otherfollicles were surrounded by abnormal, irregularly arranged, follicularcells. All together these lesions can be classified as both adenomas andnodules in an abnormal gland. No other abnormality and no otherspontaneous tumor was observed in any other sacrificed mice atautopsy, including the TG900-CAT transgenic mice (Table 1). To

Table 1 Tlivroitl /c.v/Vj/j.sin trtinwnic timi nonininwnii' micf with itr without

goitrogen treatment

ConstructusedNone

TCTCXI-CATTCWW-ra.vTO2(KK)-ra.vNoneTG2()00-â„¢.sNone

TCi2(HK)-ra.vNo.

ofanimals50

10155114111012TreatmentNone

NoneNoneNoneGoilrogen"

for hmonthsGoitrogcn"

for f>monthsGoitrogcn"

for fi months

+ 2 months suspensionGoitrogen" for d months

+ 2 months suspensionNo.

and type oflesionsobserved00

1 Follicular disorganization1Vasculitis1Adenoma14

Hyperplasias1Adenoma11 Hyperplasias

3Adenomas1Hypcrplasia5

Adenomas1 Follicular carcinoma

' Aminotriazole (I g/liter) and sodium-perehlorate (10 g/liter) in the drinking water.

study the expression of the transgene, in situ RNA hybridizationexperiments were carried out in 8 mice belonging to 5 independentfounder families, 1 of the TG9()()-ra.v lineage and 4 of the TG2000-rax

lineage. An unequivocally positive hybridization for the presence ofmessenger RNA, expressed by the transgene in the thyroid gland, wasobserved in founder mice TG2(HK)-ra.v 1.0 and TG2000-r<w 21.0,

(see Fig. 4). To confirm the results obtained by the in situ hybridization experiments, an RNA amplification strategy was used to detectby an independent method the transgene expression in the TG2000-

ras 40 family, which is the family in which the adenomatous proliferation was observed and which is the family of transgcnic miceused for the goitrogen treatment experiments (see below). We used a3' Ki-ra.v specific primer (bases 222-241) to synthesize the firstcDNA strand; the 5' primer was derived by the Tg exon 1 (bases 10-

28). The results of these RT-PCR assays indicate that the RNAs de

rived from the thyroid glands of the transgenic mice, but not that derived from normal thyroid glands, were amplified by the specificoligomers (Fig. 5, compare Lanes 3 and 5). In addition, the amplification was strictly dependent on the Moloney murine leukemia virusreverse transcriptase activity (compare Lanes 4 and 6), thus excluding that trace amounts of the integrated transgene DNA would beutilized in the amplification reaction. The RT-PCR experiment

showed the positive expression of the transgene both in thyroidglands from untreated animals as well as in thyroid glands frommice treated for 6 months with the goitrogcns (data not shown).

The 2 groups of mice that were treated for 6 months with thegoitrogenic regimen (see "Materials and Methods") and sacrificed

5525

on May 27, 2018. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

TRANSOENIC MICE EXPRESSING Ki-ras

•¿�Õ,.« ;

..;B

Fig. 4. Photomicrographs with darklield Nomarski optics of frozen sections of athyroid gland from mouse T(i2(HM)-ra.v l.d, following RNA/n.v/m hybridization (X 4(XI).,4, Sense RNA prohe; /f, Antisensc RNA probe (see "Materials and Methods").

immediately thereafter showed, as expected, diffuse hyperplasias ofthe thyroid glands. However, three mice in the transgenic groupshowed also lesions classifiable as follicular adenomas, compared toonly one mouse showing a similar type of lesions in the nontransgenicgroup. Finally, nontransgenic mice treated with the goitrogens for 6months and sacrificed after a 2-month suspension period, showed, as

expected, a clear reversion of the lesions induced by the treatment(Fig. 3C; Table 1). On the other hand, while 6 out of 12 transgenicmice showed a similar reversion, 6 showed clear abnormalities of thethyroid gland sections: 5 adenomas surrounded by unusual foci ofproliferation; and 1 carcinoma (Fig. 3D; Table 1). Taken together,these results clearly support the hypothesis that the ras transgenicbackground strongly favors the occurrence of thyroid proliferation.

DISCUSSION

We have shown that a 900-base pair fragment of the rat thyroglobu-

lin promoter is able to direct the expression of the CAT reporter genefused to it in the thyroid gland of transgenic mice. This promotercontains, therefore, all the informations necessary for a restrictedtissue-specific pattern of expression and can be used to construct other

hybrid genes intended to be expressed specifically in the thyroidgland. CAT activity was not detected in one line and this suggests thatthe random integration site of the transgene may play a relevant roleinfluencing its expression; such variability of expression of a reportergene has also been noted by others (17). Studies of the expression ofthe TG20()()-ra.v transgene have been carried out in several families of

transgenic mice by two independent methods, i.e., in situ hybridization and RT-PCR. The experiments of in situ hybridization haveshown the presence of the ras transcript in TG2(XX)-ra.s families 1 and

21. The results of the expression found in TG2(MM)-rasfamily 21 bythis method are shown in Fig. 4. The results of the RT-PCR experiments have clearly confirmed the expression of the TG2000-ra.v trans-

gene also in family 40.The TG2000-ras was able to induce the onset of thyroid gland

abnormalities and, at least in one case out of 51 transgenic miceanalyzed (which would correspond to an approximate frequency of2%), multiple nodular structures were observed within the same thyroid gland. Since the occurrence of "spontaneous" thyroid tumors in

mice is a very rare event, estimated to be less than 0.03% (19 lesionsin 61.700 mouse necropsies) (18), it is very unlikely that the multi-focal lesions found in mouse 40.4 represent a "spontaneous" growth.

On the other hand, the low incidence of abnormalities found in thethyroid gland of the K\-ras transgenic mice is in good agreement

with several other studies. Ras oncogenes are able to partially transform primary human thyroid epithelial cells (19) and fully transformprimary rodent cells in vitro only with the additional cooperation ofother oncogenes, such as adenovirus EIA or myc, or of other unknown events taking place in the process of immortalization(20-22). A similar pattern was observed in the PC CI3 rat thyroidcell line, in which cooperation with the c-myc oncogene is requiredfor transformation by the activated K.\-ras or Ha-ra.s oncogenes (23,24). When a retrovirus carrying the v-Ki-ras oncogene was injected

directly into the thyroid gland of adult Fischer rats 3 rats of 30 developed thyroid tumors after a latency period of 7-8 months (25). A

much higher incidence and a shorter latency period were observedonly when rats were treated with a goitrogen that stimulates TSH secretion (25), thereby increasing the mitotic rate of thyroid cells (26).It is possible that differences in promoter strength may explain thelower tumor incidence obtained in the present study compared toprevious experiments (25). In fact, a much higher expression of theKi-ra.v oncogene is expected to take place when driven by a retrovi-

ral promoter than by the rat thyroglobulin promoter. Alternatively,low levels of the Ki-ras expression could be due to the existence ofa negative feedback loop which takes place between ras and Tg pro-

1 23456

Fig. 5. Analysis of TGZOOO-ra.s transgcne expression by RT-PCR. Lane /, X174DNA///fl£*IIImarkers; Lane 2, primers control; Lane 3, RT-PCR amplification of lotalRNA extracted from a pool of thyroid glands from 3 TG2(KM)-ri/.v40 mice and treated withreverse iranscriptase; Lane 4, same as in Lane 3 without reverse transcriptase treatement;Lane 5 and Lane 6, same analysis as in Lanes 3 and 4 on RNA from 3 nontransgenic micethyroid glands. Electrophorcsis of samples in 1.5% agarose gel ethidium-bromide stained.

Arrow, expected molecular weight of the specific amplified DNA fragment (31S basepairs).

5526

on May 27, 2018. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

TRANSOENIC MICE EXPRESSING Ki-ras

moter activity, an event demonstrated in previous work done by ourgroup (23). Ha-ras oncogenes fused to a tissue-specific promoter to

generate transgenic mice have caused the appearance of tumors ofpancreatic (27), mammary (28), epidermal (29), and liver cells (30)with a variable latency period and a variable incidence. Results similar to ours, in terms of long latency and low incidence, were obtained by directing Ha-ras oncogene expression by the murine whey

acidic protein promoter into mammary epithelial cells in transgenicmice (28). Furthermore, in this case, the transformation process inthe mammary gland of a founder mouse took place after 5 pregnancies and therefore after 5 rounds of tissue hormonal stimulations. Onthe other hand, thyroid follicular cells exhibit a very low mitotic ratein the absence of external stimuli and, therefore, if the action of rasoncogenes is mediated by a proliferative state, we must expect a lowincidence and a long latency period of transformation events in thistissue. It is also possible that in our model activated Ki-ras alone is

capable of transforming thyroid epithelial cells completely, but onlyafter reaching a threshold level. The occurrence of isolated tumorsreported in the present study could be explained by this hypothesis,although it seems improbable that largely different levels of Ki-ras

expression take place in different thyroid cells.The animal model that we have described here, in which an early

step of thyroid tumorigenesis has been induced by the action of acellular oncogene, may offer valuable opportunities to study the influence of environmental and other oncogenes action on the multi-

step process of thyroid tumorigenesis. The results reported here concerning the treatment of transgenic and nontransgenic mice withgoitrogens support this assertion. The treatment with the goitrogenfor 6 months has led to the appearance of 3 adenomatous lesions inthe transgenic group against 1 such lesion in the nontransgenicgroup. TSH stimulation (31, 32) has been previously described, infact, to induce, by itself, adenomatous growth. However, since thediffuse hyperplastic background observed in both transgenic andnontransgenic groups of animals, which have undergone TSH stimulation following the goitrogen treatment, could influence the accuratereading of the histopathological findings, we performed the additional experiment of the goitrogen withdrawal for 2 months. In thislatter experiment there was a significant number of lesions which developed in the transgenic group in contrast to the nontransgenicgroup where no lesions developed. These results, which are similarto those already reported in a different experimental model (25),strongly suggest that the action of activated Ki-ras alone is not, by

itself, capable of transforming completely thyroid cells in vivo, but,nevertheless, its expression represents an early event of thyroidtumorigenesis, which then proceeds through following steps, someof which may be brought about by TSH stimulation.

ACKNOWLEDGMENTS

We thank Professor E. D. Williams, Drs. A. Picone, R. Mariani-Costantini,

and A. Simeone for discussions and helpful suggestions during the course ofthe work. We thank G. Sequino for excellent technical assistance.

REFERENCES

1. Barbacid, M. ras genes. Ann. Rev. Biochem., 56: 779-827, 1987.2. Bos, J. L. ras oncogenes in human cancer: a review. Cancer Res., 49: 4682-4689,

1989.3. Suarez, H. G., du Villard, J. A.. Severino. M., Caillou, B., Schlumherger, M.. Tuhiana.

M., Parnienlier, C., and Monier. R. Presence of mutations in all three ras genes inhuman thyroid tumors. Oncogene. 5: 565-570. 1990.

4. Bongarzonc, I.. Pierotti, M. A., Monzini, N., Mondcllini, P., Manenti. G., Donghi, R..Pilotti. S., Grieco, M., Sanloro, M.. Fusco, A., Vecchio. G., and Della Porta, G. Highfrequency of activation of tyrosine kinase oncogenes in human papillary thyroid

carcinoma. Oncogene, 4: 1457-1462, 1989.

5. Fusco, A., Grieco, M., Santoro, M., Berlingieri, M. T., Pilotti, S., Pierotti, M. A., DellaPorta, G., and Vecchio, G. A new oncogene in human thyroid papillary carcinomasand their lymphonodal métastases.Nature (Lond.), 328: 170-172, 1987.

6. Jhiang, S. M., Caruso, D. R., Gilmore, E, Ishizaka, Y., Tahira, T., Nagao, M.. Chiù,I., and Mazzaferri. E. L. Detection of the PTC/retTPC oncogene in human thyroidcancer. Oncogene, 7: 1331-1337, 1992.

7. Lemoine, N. R., Mayall, E. S., Wyllie, F. S, Williams, E. D., Goyns, M.. Stringer. B.,and Wynford-Thomas. D. High frequency of ras oncogene activation in all stages ofhuman thyroid tumorigenesis. Oncogene, 4: 159-164, 1989.

8. Wright, P. A., Lemoine, N. R., Mayall, E. S., Wyllie, F. S., Hughes, D., Williams. E.D., and Wynford-Thomas, D. Papillary and follicular thyroid carcinomas show adifferent pattern of ras oncogene mutations. Br. J. Cancer, 60: 576-577, 1989.

9. Ledent, C., Dumont, J., Vassart, G., and Parmentier. M. Thyroid adenocarcinomassecondary to tissue-specific expression of simian virus-40 large-T antigen in transgenic mice. Endocrinology, 729.- 1391-1401, 1991.

10. Musti, A. M.. Ursini. V. M.. Avvedimento, E. V, Zimarino, V., and Di Lauro. R. A celltype specific factor recognizes the rat thyroglohulin promoter. Nucleic Acids Res., 15:8149-8166, 1987.

11. Avvedimento, E. A., Obici, S.. Sanchez, M., Gallo, A., Musti, A., and Gottcsman, M.E. Reactivation of thyroglobulin gene expression in transformed thyroid cells by5-Azacytidine. Cell, 58: 1135-1142, 1989.

12. McCoy, M., Bargmann, C. L., and Weinberg, R. A. Human colon carcinoma Ki-nj.v2 oncogene and its corresponding proto-oncogene. Mol. Cell Biol.. 4: 1577-1582,

1984.13. Hogan, B.. Costantini. F.. and Lacy. E. Manipulating (he Mouse Embryo: A Labora

tory Manual. Cold Spring Marbor.NY: Cold Spring Harbor Laboratory, 1986.14. Gorman, C. M., Moffat, L. F.. and Howard, B. H. Rccombinant genomes which

express chloramphenicol acetyl transferase in mammalian cells. Mol. Cell Biol., 2:1044-1051, 1982.

15. Southern, E. M. Detection of specific sequences among DNA fragments separated bygel electrophoresis. J. Mol. Biol., 98: 503-517,1975.

16. Feinberg, A. B., and Vogelstein, B. A technique for radiolabeling DNA restrictionendonuclease fragments to high specific activity. Anal. Biochem.. 132: 613-619,

1983.17. Ledent, C., Parmenlier, M., and Vassart, G. Tissue-specific expression and methyl-

ation of a thyroglobulin-chloramphenicol acetyllransferasc fusion gene in transgenicmice. Proc. Nati. Acad. Sci. USA, 87: 6176-6180, 1990.

18. Biancifiori, C. Pathology of tumors in laboratory animals. In: V. S. Turonsov (ed.),Tumors of the Mouse (IARC Scientific Pub. No. 23), Vol. II, pp. 451^163. Lyon,France: International Agency for Research on Cancer, 1979.

19. Lemoine, N. R., Staddon. S., Bond, J.. Wyllie, F. S., Shaw. J. J., and Wynford-Thomas, D. Partial transformation of human thyroid epithelial cells by mutant Ha-ro.voncogene. Oncogene, 5: 1833-1837, 1990.

20. Land. H., Parada, L. F., and Weinberg, R. A. Tumorigenic conversion of primaryembryo fibroblasts requires at least two cooperating oncogenes. Nature (Lond.), 304:596-602, 1983.

21. Ruley. H. E. Adenovirus early region 1A enables viral and cellular tranforming genesto transform primary cells in culture. Nature (Lond.), 304: 602-606, 1983.

22. Dotto, G. P., Weinberg, R. A., and Ariza. A. Malignant transformation of mouseprimary keratinocitcs by HaSV and its modulation by surrounding normal cells. Proc.Nati. Acad. Sci. USA, 85: 6389-6393, 1988.

23. Vecchio, G., Di Fiore, P. P., Fusco. A.. Colletta. G., Weissman, B. E., and AaronsonS. A. In vitro tranformaron of epithelial cell by acute retroviruses. In: F. Blasi (ed.).Human Genes and Diseases, pp. 415^170. New York: John Wiley & Sons, Ltd.. 1986.

24. Fusco, A., Berlingieri. M. T, Di Fiore, P. P.. Portella, G., Grieco, M., and Vecchio, G.One- and two-step transformation of rat thyroid epithelial cells by retroviral oncogenes. Mol. Cell. Biol., 7: 3365-3370, 1987.

25. Portella, G, Ferulano. G.. Santoro. M., Grieco, M., Fusco, A., and Vecchio, G. TheKirsten murine sarcoma virus induces rat thyroid carcinomas in vim. Oncogene, 4:181-188, 1989.

26. Wynford-Thomas, D., Stringer, B. M. J., and Williams, E. D. Dissociation of growth

and function in the rat thyroid during prolonged goitrogen administration. ActaEndocrinol., 101: 210-216,1982.

27. Quaife, C. J., Pinkert, C. A., Ornitz, D. M., Palmiter, R. D., and Brinster, R. L.Pancreatic neoplasia induced by rax expression in acinar cells of transgenic mice.Cell, 48: 1023-1034, 1987.

28. Andres, A. C., Schonenberger, C. A., Groner, B., Henninghausen. L.. LcMeur. M., andGerlinger P. Ha-r«.voncogene expression directed by a milk proteingene promoter:tissue specificity, hormonal regulation, and tumor induction in transgenic mice. Proc.Nati. Acad. Sci. USA, 84: 1299-1303, 1987.

29. Baillcul, B., Surani, M. A., White, S., Barton, S. C., Brown, K.. Blessing, M., Jorcano,J.. and Balmain, A. Skin hyperkeratosis and papilloma formation in transgenic miceexpressing a ras oncogene from a suprabasal keratin promoter. Cell, 62: 697-708,1990.

30. Sandgren, E. P., Ouaife, C. J., Pinkert, C. A., Palmiter, R. D., and Brinster. R. L.Oncogene-induced liver neoplasia in transgenic mice. Oncogene, 4: 715-724,1989.

31. Wollman, S. H. Production and properties of transplantable tumors of the thyroidgland in the Fischer rat. Ree. Progr. Horm. Res., 19: 579-618, 1963.

32. Ohshima, M., and Ward, J. M. Dietary iodine deficiency as a tumor promoter andcarcinogen in male F344/NCr rats. Cancer Res., 46: 877-883, 1986.

5527

on May 27, 2018. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1993;53:5523-5527. Cancer Res   Giovanni Santelli, Vittorio de Franciscis, Giuseppe Portella, et al.   under the Control of a Thyroglobulin Promoter

OncogenerasProduction of Transgenic Mice Expressing the Ki-

  Updated version

  http://cancerres.aacrjournals.org/content/53/22/5523

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/53/22/5523To request permission to re-use all or part of this article, use this link

on May 27, 2018. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from