163

Copyright: © 2016, Al-Shamaa et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any site, provided the original author

and source are credited.

Profile and Expression Virulence Genes of Pseudomonas

aeruginosa Isolated from Burns and Wounds

Noor F. K. Al-Shamaa1*, Mohammad A. Al-Faham2, Rasmia A. Abu- Risha3

INTRODUCTION

Burn injury is one of the significant public health problems worldwide. It is at high risk for nosocomial infections. Infection of burns is common because the skin, a physical barrier against microbes, has been compromised. Further-more, in moderate and severe burns the underlying vasculature of the skin has been damaged or destroyed and so immunity agents, such as T cells, cannot reach sites of infection, accordingly, the risk of infection increases proportionately with the size of the burn [1]. Wound infection is one of health problems that are caused by the

invasion of pathogenic organisms in different part of body and it threat life of large number of people in many countries [2]. Wound sometimes get infection by either single or multiple organisms, and are mostly due to nosocomial pathogens [3]. P. aeruginosa is one of the most common causes of burn wound infections [4]. P. aeruginosa is found as major colonizer of the burn wound because it live on moist burn wound surface and usually gains access to burn patients through cross contamination. It persists as a major nosocomial infection threat to burn patients arising

ABSTRACT

In this study 111 swabs were collected and culured, the isolated bacteria were identified by biochemical tests, API 20 E and Vitak 2. Drug susceptibility tests for the 31 isolates of P. aeruginosa were studied against 7 antibiotics and the percentages of sensitivity to antibiotic were shown as the following; Gentamicin 74%, Tobramycin 100%, Amikacin 64%, Ciprofloxacin 39%, Levofloxacin 48%, Imipenem 42% and Meropenem 45%. The DNA was isolated from 31 isolates of P. aeruginosa were extracted by DNA extraction kit, the concentration for all 31 DNA samples were between 60 - 110 ng/µl and the purity were between 1.8-2 . Polymerase Chain Reaction was used for screening the virulence genes, resistant genes (opr I, opr L) and (the macrophage apoptosis genes (exo S, exo T). The result showed that 29 (94%) isolates were positive for opr I and exo S genes and 2 (6%) were PCR-negative for opr L gene 27 (87%) isolates were PCR-positive, while 4 (13%) were PCR- negative, for exoT gene 26 (84%) were PCR- positive, while 5 (16%) were PCR - negative, For study the gene expression of the resistant genes (opr I, opr L), the technique of (RT-qPCR ) was used for the transcription of the RNA to cDNA, followed by their amplification. The result showed that the difference in gene expression of the virulence factor genes between the eight isolates, for the opr I ranged from (1.1 -561918) and the opr L ranged from (5.3 - 80684.3). The rate of gene expression of two virulence factors genes between the eight samples for opr I was 75% (6/8) and for opr L was 87.5% (7/8).

Keywords: Burn wound infection, gene expression, exo S, exo T, opr I, oprL, P. aeruginosa, RT-qPCR.

Citation: Al-Shamaa NFK, Al-Faham MA, Abu- Risha RA. (2016) Profile and expression virulence genes

of Pseudomonas aeruginosa isolated from burns and wounds. World J Exp Biosci 4: 163 – 170.

Received September 21, 2016; Accepted October 8, 2016; Published October 31, 2016.

Received September 06, 2016; Accepted September 30, 2016; Published October 7, 2016.

UnicornUnicorn

Research article

Volume 4, Number 2: 163-170

ISSN: 2313-3937

2016

*Correspondence: Al-Shamaa NFK.noorfuad80@yahoo.com.

Department of Biotechnology, college of Science, University of Baghdad, Baghdad, Iraq.

Full list of author information is available at the end of the article.

164

of resistance against multiple antimicrobial drugs frequently complicates the treatment of P. aeruginosa infection. This may lead to serious infection and thus mortality rate in these patients become high [5]. Infections of P. aeruginosa are difficult to eradicate because of their elevated intrinsic resistance as well as their capacity to acquire resistance to different antibiotics [6]. opr I, opr L genes is encoded to L and I lipoproteins are two outer membrane proteins of P. aeruginosa responsible for inherent resistance of P. aeruginosa to antibiotics and antiseptics [7] exo S gene is encoded exoenzyme (s) is bifunctional enzyme, induces apoptosis of epithelial cells and macrophages [8]. exo T gene is encoded for targets host kinases involved in focal adhesion and phagocytosis [9]. P. aeruginosa possesses a variety of virulence factors that may contribute to its pathogenicity. the evaluate of oprI, oprL genes by PCR identification of clinical P. aeruginosa. In order to find any relation between special virulence factors and special manifestation of P. aeruginosa infections, so detected virulence factors among these isolates by PCR [10]. RT-PCR is used to qualitatively detect gene expression through creation of complementary DNA (cDNA) transcripts from RNA [11]. In RT-PCR, the RNA template is first converted into a complementary DNA (cDNA) using a reverse transcriptase. The cDNA is then used as a template for exponential amplification using PCR. QT-NASBA (real-time quantitative nucleic acid -based amplification) is currently the most sensitive method of RNA detection available [12]. RT-PCR with rapid thermal cycling (LightCycler™ technology), based on the amplification of the outer membrane lipoprotein gene opr L . compared the efficacy of these methods to bacterial culture by quanti-tatively measuring levels of P aeruginosa in serial dilutions, in burn wound biopsy samples [13]. The present study aims to Isolate P. aeruginosa from burn and wound infection and diagnosis by chemical tests and confirm by API 20 E and Vitak apparatus. Detection the resistant isolates of P. aeruginosa for different antibiotics. Extraction the DNA from the P. aeruginosa isolates. Detection of virulence genes (opr I, opr L, exoS, exoT) in P. aeruginosa isolates by PCR

technique. Moreover the gene expression of the resistant

gens was detected using RT-qPCR technique.

MATERIALS and METHODS

Identification and susceptibility test of P. aeruginosa

In this study 111 swab were collected from 50 patients,

aged from 9 months to 69 years, (18 patient suffered from

burn, and 32 patient suffered from wound). All samples were cultured on MacConkey agar, Blood agar, Cetrimide agar, King A and king B medium. The biochemical tests were performed for confirmed the identification the P. aeruginosa isolates by oxidase, catalase, motility, IMVIC tests [14]. The biochemical tests result of final identification of p.aeruginosa was dependent on Api 20 E, and Vitak 2 systems. Drug susceptibility tests were performed for 31 isolates of P. aeruginosa from burn and wound using commercially prepared antibiotic disks on Mueller Hinton agar plates by the disk diffusion method against seven different antibiotics (Gentamicin, Tobramycin, Amikacin, Ciprofloxacin, Levofloxacin, Imipenem and Meropenem ).

DNA Extraction

The DNA of thirty one P. aeruginosa isolates were extracted according to the instruction of the Promega kit Nano Drop 2000 C Spectrophotometer was used for measured the DNA concentration and purity. The extracted DNA was electrophoresed by gel electrophoresis system for proofing that the genomic DNA was intact and not sheared.

Preparation the primers

Primers were prepared according to the instructions of manufactured company (Alpha DNA, Canada). The primers choose (Table 1)

Table 1. Sequence of primers of virulence genes

Genes Primer sequence (5-3) product Reference

opr I F- GCT CTG GCT CTG GCT GCT

R- AGG GCA CGC TCG TTA GCC 200

bp

[15]

opr L F-ATGGAAATGCTGAAATTCGGC

R- CTTCTTCAGCTCGACGCGACG 500b

p

[15]

exo S F-ATCGCTTCAGCAGAGTCCGTC

R-CAGGCCAGATCAAGGCCGCGC 150

bp

[16]

exo T FAATCGCCGTCCAACTGCATGCG

R- TGTTCGCCGAGGTACTGCTC 150

bp

[17]

Detection of the virulence factors genes

For optimization the primer was applied into eppendorf tube, 10 μl master mix, 0.7 μl forward primer, 0.7 μl reverse primer, 7.6 μl free nuclease water and 1ul DNA, the correct PCR products could be obtained for the template DNA with the temperature gradient PCR method [18] to identify the different annealing temperature (53, 55, 60.3, 62.6, 65 ºC). Detection of virulence genes resistant genes (opr I, opr L) and the macrophage apoptosis genes (exo S, exo T) was performed by amplifying the genes by monoplex PCR, the PCR thermocycler program (Table 2).

Table 2. PCR thermocycler program for DNA amplification of P.

aeruginosa genes. X, degree of primer for every virulence gene as

fellow; (opr L, exo S): 55 ºC; (opr I , exo T ), 60 ºC.

Gene expression

Preparation of control broth

Selected single colony of P. aeruginosa from certrimide agar and cultured on Luria Bertani (LB) broth and incubated at 37 ºC for 24 h.

Preparation antibiotic broth

Single colony of P. aeruginosa was selected from cetrimide agar and cultured on L.B broth. The powder antibiotic was dissolved in1 ml normal saline. 0.1 ml of the dilution

Steps Temperature Time Cycles

Initial

Denaturation

95 ºC 4min

1 cycle

Denaturation

Annealing

Extension

95 ºC

XºC

72 ºC

30 sec

30 sec

30 sec

35 cycles

Final

Extension

72 ºC 7 min 1 cycle

Hold 4 ºC

Shamaa et al. (2016).

World J Exp Biosci. Vol. 4, No. 2: 163-170.

165

antibiotic was added to the cultured colony in the LB broth, for transformation the concentration of the antibiotic to microgram, as fellow: 1gm = 1000 mg = 10^6 ug , at final concentration of antibiotic (Table 3) and incubated at 37 ºC for 24 h [19].

Table 3. The antibiotic powder and solutions were used in the

experimental study.

No. of the

isolate

The antibiotic Concentration ug/ ml

1 Ciprofloxacin 2000

2 Tobramycin 5000

3 Pipracillin 10000

4 Amikacin 5000

6 Ceftizidine 10000

7 Meropenem 5000

RNA extraction

RNA of 8 P. aeruginosa isolates were extracted according the instruction of the Promega kit.

Gene expression analysis

According to previous study [20] each virulence gene(opr I, opr L) was tested for its ability to expressed using RT-qPCR technique. The expression values were calibrated with rpoD gene which consisted of housekeeping gene. In this work, one step RT-qPCR had been used, RNA was transcript directly to cDNA before PCR beginning, material that had been used and their volumes and the Amplification steps of the gene expression were described in the Tables 4

Table 4. Materials and volumes of RT-qPCR technique.

No. Material The volume

1 Master mix 12.5ul

2 RT mix 0.5 ul

3 RNA 5ul

4 forward primer 2.5ul

5 reverse primer 2.5ul

6 H2O 2ul

and 5 Folding values were determined using ΔΔCt model, which known also as Livak equilibrium [21].

Table 5. Amplification steps of the gene expression of RT-qPCR

technique.

°C Min Cycles

cDNA making 37°C 15 min 1

Initial denaturation 95°C 5 min 1

Denaturation 95°C 30 sec 40

Annealing opr L : 55 ºC

opr I : 60 ºC

30 sec

Extension 72°C 30 sec

Melting curve 1

RESULT and DISCUSSION

In this study, from 111 specimens 31 isolates of P. aeruginosa (25 from burns and 6 from wounds) 33 isolates of E. coli, 10 isolates of Klebsiella spp (Table 6).

Table 6. Percentage of the isolated bacteria.

Type of bacteria No.

P.aeruginosa 31(25burn 6 wound)

E.coli 33

Klebsiella spp, 10

In previews study in Iraq, Alwan et al. [22] revealed that P. aeruginosa was most common isolate from burns and wounds another study of Ranjan et al. [23] founded that the most common isolated organism from postoperative wounds was P. aeruginosa. P. aeruginosa colonies, on blood agar produce a clear zone due to produce β-hemo-lysis [24], on MacCkonky agar medium the bacterial colon-ies appeared pale because it does not ferment lactose [25]. The identification of P. aeruginosa was confirmed on Cetrimide agar, King A and King B medium. In these media the bacteria produce pyocyanin and flourescen pigments. so it selective for P. aeruginosa. The positive isolates produce pyocyanin pigment (blue or green) on Cetrimide agar and king A and produce flourescen pigment (yellow) on King B [26]. The isolates of P. aeruginosa showed different percentage of resistance to each antibiotics of the aminoglycoside group: Gentamicin 74% (23/31), Tobramycin 100% (31/31), Amikacin 64% (20/31). The Quinolone group: Ciprofloxacin 39% (12/31), Levofloxacin 48% (15/31). The Carbapenem group: Imipenem 42% (13/31) and Meropenem 45% (14/31). According to the percentage of Gentamicin (74%) our results closed to results of Ra'oof [27], here the isolates were isolated from (burn, wound, otitis media, urinary tract infection), which rate was 75%, while another study by Yolbas et al [28], the isolates were isolated from burn wounds which rate was 45 %, the percentage of Tobramycin (100%), the study of Ekrami and Kalantar, [29] found that the same result, while another study by Ranjan et al, [23], the bacteria were isolated from Post-operative wound Infection, the rate was (69.5%), the percentage of Amikacin (64%) was closed with Naqvi et al (30), as rate was (70.5 %), while the study of Yolbaş et al, [28] the rate was 18 %. The percentage of sensitivity to ciprofloxacin (39%) was closed to results of Arabestani et al, [31] who isolated the bacteria from clinical samples and the rate was 38%, While another studies in Iraq by Al-Habib et al, [32] who isolated the bacteria from burn infection the rate was 80%. The percentage of Levofloxacin 48% previews study by Akingbade et al, [2] the isolates were isolated from wound infections the rate was 40 %, and Arabestani et al, [31] found the rate was 61.2 %. The percentage of Imepenem 42% in another studies revealed different percentages, Wang et al, [33] showed the rate was 30.4 %, Arabestani et al, [31], the rate was 9.6 %. Percentage of resistance of Meropenem was 45%, Salimi et al, [34] showed the rate was 37.2%, and Yolbaş et al, [28] the rate was 58%. The result revealed that the concentration for all DNA samples of the thirty one P. aeruginosa isolates were between 60 - 110 ng/ul and the purity was between 1.8 - 2. PCR was used for screening the resistant genes (opr I, opr L) and the macrophage apoptosis genes (exo S, exo T) of the thirty one P. aeruginosa isolates, and the result showed that 29 (94%) isolates were positive for opr I and 2 (6%) were PCR-negative, (Fig 1). From the 25 burn isolates, the positively rate was 25 (100%) and from 6 wound isolates

Shamaa et al. (2016).

World J Exp Biosci. Vol. 4, No. 2: 163-170.

166

the rate was 4 (66%), the percentage of opr I in burn was similar with study in Iraq by Khattab et al, [35] who isolated

the isolates from different origins revealed the burn isolates was 100 % harbored this gene.

Fig 1. Gel electrophoresis of amplified PCR products of opr I gene (200 bp) in monoplex PCR at (100 v for 90 min) in (1% agarose), TBE (1x),

stained with ethidium bromide. M, DNA ladder, all the lanes were positive for the opr I gene except the lanes (4,7) were

negative.

For the opr L gene 27 (87%) isolates were PCR- positive, while 4 (13%) were PCR-negative (Fig 2). From 25 burn isolates 23 (92%) were positive isolates and from 6 wound isolates 4 (66%) were positive isolates, whereas study by

Khattab et al, [35], exhibited that 100 % isolates from burn was harbored this gene. The study of Salman et al, [36] was 80% isolated from wound contain this gene.

Fig 2. Gel electrophoresis of amplified PCR product of opr L gene (500bp) in monoplex PCR at ( 100 v for 90 min ) in (1% agarose ) , TBE

(1x) , stained with ethidium bromide . M: DNA ladder, all the lanes were positive for the opr L gene except the lanes from (4-7) were negative

Khattab et al, [35] found that simultaneous use of oprI and oprL genes provides more confident detection of P. aeruginosa by PCR. The exo S gene dissemination in thirty

one isolates of P. aeruginosa showed that 29 (94 %) isolates were PCR- positive, and 2 (6%) isolates were PCR-negative (Fig 3)..

Fig 3. Gel electrophoresis of amplified PCR product of exo S gene (150bp) in monoplex PCR at (100 v for 90 min) in (1% agarose), TBE (1x),

stained with ethidium bromide. M, DNA ladder, all the lanes were positive for the exo S gene except the lanes (4,7) were negative.

Shamaa et al. (2016).

World J Exp Biosci. Vol. 4, No. 2: 163-170.

167

While, the study by Winstanley et al, [37] isolates from ulcerative keratitis samples showed that 38% were positive for this gene. The prevalence of exoS gene in 25 burn isolates, exhibited the positive rate was 25 (100% ) while in 6 wound was the rate 4 (66%). Another studies revealed different percentage from the percentage of exo S in burn, Khattab et al, [35] showed the isolates from burn was 70% contain this gene. Study by Gawish et al, [38] isolated from nosocomial and environmental samples found the burn isolates was 33.3 % harbored this gene. The percentage of exo S in wound different from other studies, study of Wolska and Szweda [39] showed that the isolates from wound was 77.8 % and the study of Holban et al, [40] showed the isolates from wound was 20%. Exoenzyme S is important for the pathogenic activity of P. aeruginosa [41]. The isolates harbor exoS are referred to as invasive strain, therefore the phenotype of P. aeruginosa is invasive [42].

exoT diminishes macrophage motility and phagocytosis, at least in part through disruption of the actin cytoskeleton of eukaryotic cells, and blocks wound healing [43]. The determined of exo T gene in thirty one isolates of P. aeruginosa revealed that PCR-positive for 26 (84 %) isolates and 5 (16%) isolates were PCR- negative (Fig 4). The positive percentage was different from the study of Georgescu et al, [44] revealed that all the isolated from chronic leg ulcers samples were 100% positive for this gene. The frequencies of exo T gene in 25 burn isolates was 23 (92%) positivity rate, while the isolates 6 wounds was 3 (50%) positivity rate. A study of Gawish et al, [38] revealed that all the isolates from burn were 100% harbored this gene. The percentage of (exo T) in isolates from wound not similar with the study of Holban et al, [40], showed that the isolates from wound was (95%) harbored this gene and the study of Gawish et al, [38] showed that the isolated from wound was 100% contain this gene.

Fig 4. Gel electrophoresis of amplified PCR product of exo T gene (150bp) in monoplex PCR at ( 100 v for 90 min ) in (1% agarose ) , TBE

(1x) , stained with ethidium bromide . M: DNA ladder (100bp) , all the lanes were positive for the exo T gene except the lanes (4,7, 26,30,31)

were negative.

Results of present study showed that the burns infection harbored high positively rate of the virulence genes than the isolates from wounds infection as fellow; 86% burn isolate,14% wound isolate for opr I gene and exo S genes, 85% burn isolate, 15% wound isolate for opr L gene and 88% burn isolate,12% wound isolate for exo T gene. The low prevalence of this virulence factor genes in the isolates from wound infections may show the role of this genes in the wound infections is less important than the burn infections. Nikbin et al, [10] reported in his study that the determination of different virulence genes of P. aeruginosa isolates are associated with different levels of intrinsic virulence and pathogenicity and the differences in the distributions of virulence factor genes in the populations strengthen the probability that some P. aeruginosa strains are better adapted to the specific conditions found in specific infectious sites. There were differences in the virulence genes profiles of strains isolated from different clinical origins, correlating between virulence patterns and infection clinical outcome could be useful for therapeutic procedures in hospitalized patients with positive P. aeruginosa cultures [40]. Significant correlations between some virulence genes and source of infections indicate implementation of infection control measures will help in controlling the dissemination

of virulence genes among P. aeruginosa isolates as reported by the study in Iraq of Khattab et al, [35].

For study the gene expression of the resistant genes (opr I, opr L), the RNA of the eight of P. aeruginosa isolated from burn infection were extracted by RNA extraction kit. The RT-qPCR technique was used for the transcription of the RNA of each sample to cDNA, followed by their amplification and relative quantification expression ratios of the (oprI, oprL) genes were measured in comparison to the housekeeping gene (rpoD). The folding value (gene expression) for each of these virulence genes were determined as dependent on the mathematical models are very widely applied the (ΔΔCt model) (Livak equilibrium)

𝛥𝐶𝑡 (𝑐𝑜𝑛𝑡𝑟𝑜𝑙 𝑜𝑟 𝑢𝑛𝑡𝑟𝑒𝑎𝑡𝑒𝑑) = 𝐶𝑡 𝑣𝑖𝑟𝑢𝑙𝑒𝑛𝑐𝑒 𝑔𝑒𝑛𝑒 – 𝐶𝑡 ℎ𝑜𝑢𝑠𝑒𝑘𝑒𝑒𝑝𝑖𝑛𝑔 𝑔𝑒𝑛𝑒 𝛥𝐶𝑡 (𝑠𝑎𝑚𝑝𝑙𝑒, 𝑡𝑟𝑒𝑎𝑡𝑒𝑑) = 𝐶𝑡 𝑣𝑖𝑟𝑢𝑙𝑒𝑛𝑐𝑒 𝑔𝑒𝑛𝑒 – 𝐶𝑡 ℎ𝑜𝑢𝑠𝑒𝑘𝑒𝑒𝑝𝑖𝑛𝑔 𝑔𝑒𝑛𝑒

𝛥𝛥𝐶𝑡 = 𝛥𝐶𝑡 (𝑠𝑎𝑚𝑝𝑙𝑒, 𝑡𝑟𝑒𝑎𝑡𝑒𝑑) – 𝛥𝐶𝑡 (𝑐𝑜𝑛𝑡𝑟𝑜𝑙 𝑜𝑟 𝑢𝑛𝑡𝑟𝑒𝑎𝑡𝑒𝑑)

𝐸𝑥𝑝𝑟𝑒𝑠𝑠𝑖𝑜𝑛 (𝑓𝑜𝑙𝑑𝑖𝑛𝑔) = 2− 𝛥𝛥𝐶𝑡

Since relative quantification is the goal for most for real-time PCR experiments, several data analysis procedures have been developed. Mathematical models are very widely applied: the ΔΔCt model, Livak and Schmittgen (21). The threshold cycle values (Ct) were automatically determined for each reaction. These values were defined

Shamaa et al. (2016).

World J Exp Biosci. Vol. 4, No. 2: 163-170.

168

as the cycle number at which the fluorescence generated by the released reporter dye molecule exceeds a fixed threshold value above the baseline [45]. The following antibiotics were used in the gene expression (Table 7). The folding rate (the gene expression) of the resistant genes (opr I) were variant between the (eight) different isolates (Table 8, and Fig 5)

Table 7. Types of the antibiotic used in the gene expression.

No. of the isolate The antibiotic

1 Ciprofloxacin

2 Tobramycin

3 Pipracillin

4 Amikacin

5 Pipracillin

6 Ceftizidine

7 Meropenem

8 Meropenem

Fig 5. The amplified curve and Ct of the resistant gene (opr I).

The folding rate (the gene expression) of the resistant gene (opr L) were variant between the 8 different isolates (Table 9 and Fig 6).

Fig 6. The amplified curve and Ct of the resistant gene (opr L).

From 8 isolates, the high value of gene expression (opr L gene) was for the isolate 1 and this value was (80684.3), so it gene expression of the resistant to the ciprofloxacin antibiotic was very high of this isolate. The result of gene expression of the opr L gene for the isolates (1,6) was (80684.3), (16384.0) lower than the result of study Khodabakhshi et al, [46] who showed that the gene expression for opr L gene of P. aeruginosa isolated from cystic fibrosis patients was (112868). All the isolates exhibited resistant rate for all the used antibiotic and the value of the resistant genes (opr I, opr L genes) difference between these genes for the same antibiotic one of the resistant gene exhibit expression and the another resistant gene not exhibit expression. The rate of gene expression of the two virulence factors genes between the eight samples for oprI was 75% (6/8) and for opr L was 87.5% (7/8) and for compared between the expression rate of the resistant genes for the same isolates the result showed that 5/8, 62.5% expressed opr I and opr L genes (2/8) 25 % expressed only opr L gene and (1/8) 12.5% expressed only opr I gene (Table 10). The cause of high gene expression in this study and correlated with the type of samples of P. aeruginosa isolated from burn infection site, the reason of higher gene expression resistance rates may be associated with the type of clinical samples that as only burn samples have usually higher gene expression antibiotic resistance rates than other clinical samples [47]. The virulence genes expression differs according to site and severity of infection [10]. Increase in expression of virulence factors may be linked to reduced susceptibility to antimicrobial agents [48]. The low expression case of the resistant gene may be presence of another type of the resistant gene responsible for the resistant of the antibiotic. Vaisvila et al, [49] showed that the large size and the versatility of the genome of P. aeruginosa and its distribution in aquatic habitats, which could constitute a reservoir for bacteria carrying other resistance genes. Another mechanism that affecting the resistant, because the present study could not explain the resistant mechanisms exactly as mention El Amin et al, [50], the identification of resistance mechanisms based on gene expression analysis might be complicated when several mechanisms affecting the same class of antibiotics are at work. From current study it can conclude that The burns infection revealed high percentage of P. aeruginosa than wounds infection, the most active compound against P. aeruginosa was ciprofloxacin and the detected of four virulence factors genes (opr I, opr L, exo S, exo T) of P. aeruginosa showed high positively rate of virulence genes in isolates from burns infection than that of wounds infection. The folding rate (the gene expression) of the resistant genes (opr I, opr L) were variant between the eight different isolates and were graduate from high rate to no detect in gene expression and for compared between the expression rate of the resistant genes for the same isolates the result showed that (5/8) 62.5% expressed opr I and opr L genes (2/8) 25% expressed only opr L gene and (1/8) 12.5% expressed only opr I gene.

Shamaa et al. (2016).

World J Exp Biosci. Vol. 4, No. 2: 163-170.

169

Table 8. The folding rate of the resistant gene (opr I) for 8 isolates.

Isolates Calibrator OprI ∆∆Ct Fold

oprI rpoD ∆Ct oprI rpoD ∆Ct

1 37.6 19.4 18.2 21.7 22.6 -0.9 -19.1 561918.0

2 36.2 16.8 19.4 13.7 12.2 1.5 -17.9 244589.0

3 16.8 12.5 4.3 23.3 20.6 2.7 -1.6 3.0

4 17.4 14.6 2.8 25 16.2 8.8 6 0.0

5 17.4 14.6 2.8 18 15.3 2.7 -0.1 1.1

6 17.4 14.6 2.8 19.7 12.4 7.3 4.5 0.0

7 21.9 14 7.9 23 21.4 1.6 -6.3 78.8

8 23.8 21.5 2.3 26 28.6 -2.6 -4.9 29.9

Table 9. The folding rate of the resistant gene (opr L) for (8) isolates.

Isolates Calibrator oprL ∆∆Ct Fold

oprL rpoD ∆Ct OprL rpoD ∆Ct

1 37.6 19.4 18.2 24.5 22.6 1.9 -16.3 80684.3

2 38 16.8 21.2 29.5 12.2 17.3 -3.9 14.9

3 20.6 12.5 8.1 24.5 20.6 3.9 -4.2 18.4

4 33.7 14.6 19.1 22.8 16.2 6.6 -12.5 5792.6

5 33.7 14.6 19.1 32 15.3 16.7 -2.4 5.3

6 33.7 14.6 19.1 17.5 12.4 5.1 -14 16384.0

7 19.6 14 5.6 22.9 21.4 1.5 -4.1 17.1

8 22.3 21.5 0.8 33.6 28.6 5 4.2 0.1

Table 10. The difference of the gene expression value

between the opr I , opr L genes for every antibiotic.

No. of

isolate

The antibiotic Gene expression

folding of opr I

Gene

expression of

opr L

1 Ciprofloxacin 561918.0 80684.3

2 Tobramycin 244589.0 14.9

3 Pipracillin 3.0 18.4

4 Amikacin Undetectable 5792.6

5 Pipracillin 1.1 5.3

6 Ceftizidine Undetectable 16384.0

7 Meropenem 78.8 17.1

8 Meropenem 29.9 Undetectable

Conflict of interest The authors declare that they have no conflict of interests.

REFERENCES

1. Church DS, Elsayed O, Reid B ,Winston RL. (2006) Burn wound

infections. Clin Microbiol Rev 19: 403-434.

2. Akingbade OA, Balohun SA, Ojo DA, Afolabi RO, Motayo BO,

Okerentugba PO, Okonko IO. (2012) Plasmid profile analysis of

multidrug resistant Pseudomonas aeruginosa isolated from wound

infections in South West Nigeria. World Applied Sci J 20:766-775.

3. Mulu AF, Moges BT, Kassu A. (2006) Patterns and multiple drug

resistance of bacterial pathogens at university of Gondar teaching

hospital Northwest Ethiopia. Ethiopian Med J 44: 125-131.

4. Bojary NMR, Hajia M. (2012) Multidrug resistant Pseudomonas

aeruginosa strains in Tehran Reference Burn Hospital. Tehran Iran. Afr J

Microbiol Res 6: 1393-1396.

5. Estahbanati HK, Kashani PP, Ghanaatpisheh F. (2002) Frequency of P.

aeruginosa serotypes in burn wound infections and their resistance

antibiotics. Burns 28: 340-348.

6. Breidenstein EBM, De la Fuente-Nuñez C, Hancock REW. (2011) P.

aeruginosa all roads lead to resistance. Trends Microbiol 19:419-426.

7. De Vos D, Lim A, Pirnay JP, Struelens M, Vandenveld C, Duinslaeger

L. et al. (1997) Direct detection and identification of Pseudomonas

aeruginosa in clinical samples such as skin biopsy specimens and

expectorations by multiplex PCR based on two outer membrane genes,

oprI and oprL . J Clin Microbiol 35: 1295-1299.

8. Henriksson ML, Sundin C, Jansson AL, Forsberg A, Palmer RH,

Hallberg B. (2002) Exoenzyme S shows selective ADP-ribosylation and

GTPase-activating protein (GAP) activities towards small GTPases in vivo.

Biochem 367: 617– 628.

9. Vance RE , Rietsch A , Mekalanos JJ. (2005) Role of the type III secret-

ed exoenzymes S, T and Y in systemic spread of Pseudomonas

aeruginosa Pa01 in vivo. Infect Immun 73:1706- 1713.

10. Nikbin VS, Aslani MM, Sharafi Z, Hashemipour M, Shahcheraghi F,

Ebrahimipour GH. (2012) Molecular identification and detection of

virulence genes among Pseudomonas aeruginosa isolated from

different infectious. Iran J Microbiol 4: 118-123.

11. Mackay I. (2007) Real-time PCR in Microbiology From Diagnosis to

Characterization. Norfolk England Caister Acad Press: 440.

12. Schmittgen TD, Zakrajsek BA., Mills AG, Gorn V, Singer MJ, Reed

MW. (2000) Quantitative reverse transcription-polymerase chain

reaction to study mRNA decay: comparison of endpoint and real-time

methods. Anal Biochem 285: 194–204.

13. Pirnay JP, Vos DD, Duinslaeger L, Reper P, Vandenveld C, Cornelis P,

Vander KA. (2000) Quantitation of pseudomonas aeruginosa in wound

biopsy samples From bacterial culture to rapid real-time polymerase

chain reaction. Crit Care 4:255-61.

14. Giraldi GL. (1990) Pseudomonas and related genera. Manual of clinical

microbiology 5th ed. American Society for Microbiology, Washington

D.C: 429-441.

15. De Vos D, Bouton C, Sarniguet A, De Vos P, Vauterin M, Cornelis P.

(1998) Sequence diversity of the oprI gene, coding for major outer

membrane lipoprotein I among rRNA group I pseudomonads. J Bacteriol

180:6551-6556.

16. Lomholt JA, Poulsen K, Kilian M. (2001) Epidemic population structure

of Pseudomonas aeruginosa evidence for a clone that is pathogenic to

the eye and that has a distinct combination of virulence factors. Infect

Immun 69: 6284 6295.

17. Panagea S, Winstanley C, Parsons YN, Walshaw MJ, Ledson MJ,

Hart CA. (2003) PCR-based detection of a cystic fibrosis epidemic strain

of Pseudomonas aeruginosa .Mol Diagn 7: 195- 200.

18. Rose TM et al. (2003) Analysis of 4.3 kilobases of divergent locus B of

macaque retroperitoneal fibromatosis-associated herpesvirus reveals a

close similarity in gene sequence and genome organization to Kaposi's

sarcoma-associated herpesvirus. .J virol 77: 5084-97.

Shamaa et al. (2016).

World J Exp Biosci. Vol. 4, No. 2: 163-170.

170

19. Cruickshank R, Duguid JP, Masion BP, Swain RH. (1979) Medical

Microbiology. 12th Churchill Livingstone Edinbourgh London and New

York.

20. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De

Paepe A Speleman F. (2002) Accurate normalization of realtime

quantitative RT-PCR data by geometric averaging of multiple internal

control genes. Genome Biol 3: 0034.1-0034.11.

21. Livak KJ, Schmittgen TD. (2001) Analysis of relative gene expression

data using real-time quantitative PCR and the 2-ΔΔCT method. Methods

25:402-408.

22. Alwan MJ, Lafta IJ, Hamzah AM. (2011) Bacterial isolation from burn

wound infections and studying their antimicrobial susceptibility. Kufa J

Vet Med Sci 2:1-11.

23. Ranjan KP, Ranjan N, Bansal SK, Arora DR. (2010) Prevalence of

Pseudomonas aeruginosa in Post-operative Wound Infection in a

Referral Hospital in Haryana India. J Lab Physicians 2: 74-77.

24. MacFadden JF. (2000) Biochemical tests for Identification of Medical

Bacteria 3rd Ed. The Williams& Wilkins Co. USA: 689 – 691.

25. Brook FG, Beutel SJ, Carroll CK , Mores AS. (2007) Jawetz, Melinick

and Adelberg’s Medical microbiology. Twenty–fourth edition: 224, 226,

233, 236,249.

26. Atlas RM, Snyder JW. (2006) Handbook of Media for Clinical

Microbiology. 2 ed. Taylor and Francis group. CRC press. USA.

27. Ra'oof WM. (2011) Distribution of algD, lasB, pilB and nan1 genes

among MDR clinical isolates of Pseudomonas aeruginosa in respect to

site of infection. Tikrit Med J 17: 148- 160.

28. Yolbaş İ, Tekin R, Kelekçi S, Selçuk CT, Okur MH, Tan I, Uluca

Ü. (2013) Common pathogens isolated from burn wounds and their

antibiotic resistance patterns. Dicle Med J 40: 364-368.

29. Ekrami A , Kalantar E. (2007) Analysis of the bacterial infections in

burn patients at Taleghani Burn Hospital in Ahvaz, Khuzestan province.

Iran J Clin Infect Dis 2:9-12.

30. Naqvi ZA, Hashmi K, Rizwan QM, Kharal SA. (2005) Multidrug

resistant pseudomonas aeruginosa: anosocomial infection threat in

burn patients. Pak J Pharmacol 22: 9-15.

31. Arabestani MR, Rajabpour M, Mashouf RY, Alikhani MY, Mousavi SM.

(2015) Expression of Efflux pump MexAB-OprM and OprD of

Pseudomonas aeruginosa Strains Isolated from ClinicalSamples using

qRT-PCR . Arch IranMed 18. 102-108.

32. Al-Habib MH, Al-Gerir A, Hamdoon MA. (2011) Profile of Pseudomonas

aeruginosa in burn infection and their antibiogram study. Ann Coll Med

Mosul 37: 57 – 65.

33. Wang LF, Li JL., Ma WH, Li JY. (2014) Drug resistance analysis of

bacterial strains isolated from burn patients. Gen Mol Res 13: 9727-

9734.

34. Salimi H, Owlia P, Yakhchali B, Lari AR. (2009) Drug Susceptibility and

Molecular Epidemiology of Pseudomonas aeruginosa Isolated in a Burn

Unit. Am J Infect Dis 5: 301-306.

35. Khattab MA, Nour MS, ElSheshtawy NM (2015) Genetic Identification of

Pseudomonas aeruginosa Virulence Genes among Different Isolates. J

Microb Biochem Technol 7:274-277.

36. Salman M, Ali A, Abdul Haque. (2013) A novel multiplex PCR for

detection of Pseudomonas aeruginosa A major cause of wound

infections. Pak J Med Sci 29: 957-961.

37. Winstanley C, Kaye SB Neal TJ, Chilton HJ, Miksch S. (2005) Hart C A

and the Microbiology Ophthalmic Group , Genotypic and phenotypic

characteristics of Pseudomonas aeruginosa isolates associated with

ulcerative keratitis. J Med Microbiol 54: 519–526.

38. Gawish AA, Mohammed NA, El-Shennawy GA, Mohammed HA. (2013) An

investigation of type 3 secretion toxins encoding-genes of Pseudomonas

aeruginosa isolates in a University Hospital in Egypt. J Microbiol infect

Dis 3:116-122.

39. Wolska K, Szweda P. (2009) Genetic features of clinical Pseudomonas

aeruginosa strains. Pol J Microbiol 78: 255–260.

40. Holban A, Chifiriuc MC, Cotar A, Bleotu C, Grumezescu AM, Banu O,

Lazar V. (2013) Virulence markers in Pseudomonas aeruginosa isolates

from hospital acquired infections occurred in patients with underlying

cardiovascular disease. Romanian Biotechnological Lett 18 (6).

41. Hossein HM, Mehdi RM, Masoumeh A, Gholamreza A, Masoud DM.

(2015) Molecular evaluation of pseudomonas aeruginosa isolated from

patients in burn ward, ICU, and ITU in a number of hospital in Kerman

province 5 (S2): 1428-1431

42. Choy MH, Stapleton F, Willcox MD, Zhu H. (2008) Compaction of

virulence factors in Pseudomonas aeruginosa strains isolated from

contact lens-and non contact lens related keratitis. J Med Microbial 57:

1539 -1546.

43. Geiser TK, Kazmierczak BI, Garrity-Ryan LK, Matthay MA, Engel JN.

(2001) Pseudomonas aeruginosa ExoT inhibits in vitro lung epithelial

wound repair. Cell Microbiol 3:223–236.

44. Georgescu M, Gheorghe I, Curutiu C, Lazar V, Bleotu C, Chifiriuc M.

(2016) Virulence and resistance features of Pseudomonas aeruginosa

strains isolated from chronic leg ulcers Georgescu et al. BMC Infect Dis

16:92

45. Michael WP, Graham WH, Leo D. (2002) Relative expression software

tool for group-wise comparison and statistical analysis of relative

expression result in real-time PCR. Nucleic Acids Res 30: e 36.

46. Khodabakhshi M, Arjunan S, Imran K, Senthilkumar R. (2014)

comparative analysis of real time pcr and elisa for the detection of

Pseudomonas aeruginosa in not chronically infected cystic fibrosis

patients. Int J Pharm Bio Sci 5: 36 – 40.

47. Chaudhari V, Sandeep G, Mehta M. (2013) Antibiotic resistance patterns

of Pseudomonas aeruginosa in a tertiary care hospital in Central India.

Int J Med Sci Public Health 2: 386 – 389.

48. Bratu S, Gupta J, Quale J. (2006) Expression of the las and rhl quorum-

sensing systems in clinical isolates of Pseudomonas aeruginosa does

not correlate with efflux pump expression or antimicrobial resistance. J

Antimicrob Chemother 58: 1250–1253.

49. Vaisvila R, Morgan RD, Posfai J, Raleigh EA. (2001) Discovery and

distribution of super-integrons among pseudomonads. Mol Microbiol 42:

587–601.

50. El Amin N, Giske CG, Jalal S, Keijser B, Kronvall G, Wretlind B. (2005)

Carbapenem resistance mechanisms in Pseudomonas aeruginosa

alterations of porin OprD and efflux proteins do not fully explain

resistance patterns observed in clinical isolates. APMIS 113: 187–196.

UnicornUnicorn

Author affiliation 1. Department of Biotechnology, college of Science,

University of Baghdad, Baghdad, Iraq. 2. Department of Microbiology, College of Medicine,

University of Baghdad, Baghdad, Iraq. 3. Department of Biology, College Science, University

of Baghdad, Baghdad, Iraq.

World J Exp Biosci. Vol. 4, No. 2: 163-170.

Shamaa et al. (2016).