Protein Synthesis

An intro tothis section!

Transcription

Making RNA from DNA296-297; 300-303

Click forAnimation

Let’s Draw it Out

Translation

Forming polypeptides297-300; 304-309

Interested inplaying a game?

From your reading…

• How many total amino acids are there?• How many bases (nucleotides) code for each amino

acid?• A triplet code known as a codon is found on what

strand, DNA or RNA?• What is a polypeptide chain made up of?• Is the genetic code universal? (Do all organisms use

the same codon/amino acid genetic code?)• How does the above question relate to the linked

history of the life on Earth?

From your reading…

• What type of RNA transfers amino acids from the cytoplasm to the ribosome?

• Where is tRNA made?• Is tRNA reuseable?• tRNA is a strand of RNA nucleotides, what is found at

each of its ends?• Wobble position=Not Needed• Joining of amino acid to the tRNA is performed by

what type of molecule? (Specific name is not needed)

From your reading…

• Where are the rRNA subunits made?• The order of sites in the ribosome are E, P, A. • P holds:• A holds:• E does what?:• The movement of mRNA and tRNA through the

sites requires energy from whom?• What type of molecule is the release factor?• Why are polyribosomes used?

Translation

• Converts/transfers information from mRNA into amino acids

• Amino acids are the monomers of proteins• String amino acids together and a protein is made• 3 RNAs needed– mRNA (messenger—from nucleus to ribosome)– rRNA (ribosomal—used in the ribosome)– tRNA (transfer—transfers the codons into amino acids

using anticodons)

Translation3 Main Steps

1. Initiation• mRNA attaches to the ribosome (with the use

of rRNA)• rRNA reads the mRNA in groups of 3

nucleotides called codons• Translation starts with a special codon – AUG—start codon—initiator

Translation3 Main Steps

2. Elongation• tRNA carries specific amino acid to the ribosome• The specific amino acid is determined by the

anticodon of tRNA• The anticodon pairs with complementary codon on

mRNA (Example: codon AUG; anticodon UAC)• Peptide bonds form between amino acids, linking

them into proteins• tRNAs get recycled back to go pick up more amino

acids

Translation amino acid

tRNA**Draw this!

anticodon codon

protein (linked amino acids)

ribosome

Translation3 Main Steps

3. Termination• Protein is released from ribosome when “stop

codon” is reached– 3 stop codons:• UAA• UAG• UGA

mRNA codon chartLet’s Try!!

1. If mRNA codon is CCG, what is the amino acid?

2. If tRNA anticodon is AAC, what is the mRNA codon?

What is the amino acid?

3. If the DNA template strand is ATA, what is the mRNA codon? What is the amino acid?

1. 2.

3.

Translation Answers

1. Proline

2. UUG ; leucine

3. UAU ; tyrosine

Now….4. Use codon chart to complete practice

worksheet5. Draw/analyze/explain Figures:

17.9 17.12 17.15 17.16 17.23

Click for Animation

Protein Synthesis

• DNA: TACACCTTCGCGCAATACTGC

• mRNA: AUGUGGAAGCGCGUUAUGACG

• AA: START-TRY-LYS-ARG-VAL-MET-THR• START=METHIONINE