ORIGINAL PAPER

Morphological, biometrical, and molecular characterizationof Ctenocephalides felis and Ctenocephalides canis isolatedfrom dogs from different geographical regions

A. Marrugal & R. Callejn & M. de Rojas & A. Halajian &C. Cutillas

Received: 22 January 2013 /Accepted: 8 March 2013# Springer-Verlag Berlin Heidelberg 2013

Abstract In the present work, a comparative morphological,biometrical and molecular study of Ctenocephalides spp. iso-lated from dogs (Canis lupus familiaris) from different geo-graphical regions (Spain, Iran, and South Africa) has beencarried out. The internal transcribed spacer 1 (ITS1) sequencesof Ctenocephalides felis and Ctenocephalides canis collectedfrom dogs from different geographical regions have beendetermined to clarify the taxonomic status of these speciesand to assess intraspecific variation and interspecific sequencedifferences. In addition, a phylogenetic analysis based onITS1 sequences has been performed. Four different morpho-logical populations were observed in the individuals ofC. feliscollected from dogs from different geographical locations.Nevertheless, the comparative study of the ITS1 sequencesof the different morphological populations observed inC. felisdid not show molecular differences. The results showed clearmolecular differences between C. felis and C. canis and somespecific recognition sites for endonucleases were detectedbetween both species. Thus, BfrBI and DraI sites have diag-nostic value for specific determination in C. felis. The phylo-genetic tree based on the ITS1 sequences of C. felis and C.canis revealed that all the populations ofC. felis from differentgeographical regions clustered together and separated, withhigh bootstrap values, from C. canis. We conclude that ITS1region is a useful tool to approach different taxonomic andphylogenetic questions in Ctenocephalides species.

Introduction

Fleas are clinically important parasites for human health sincethey may play a role as parasites by themselves causingallergic dermatitis or other conditions as a result of theirfeeding activities, sometimes serve as intermediate hosts forparasitic worms, and transmitting important pathogens.Besides, domestic animals, as dogs, cats, or other pets, mayplay an important role as bridging hosts for fleas of differentwild animals, domestic animals, and humans, as they willcome into contact with different animals during their seekingbehavior and therefore acquire the fleas of different animals(Dobler and Pfeffer 2011).

The studies on fleas distribution have been reviewed byMedvedev (2002). For decades, some authors (Rothschild1975; Beaucournu and Launay 1990; Lewis 1993; Dunnetand Mardon 1999) have carried out morphological studies offleas from different hosts. There are approximately 2,500 spe-cies of fleas (Durden and Hinkle 2009) and within the familyPulicidae, the genus Ctenocephalides Stiles and Collins, 1930,includes 13 species and subspecies (Beaucournu and Mnier1998) according to different morphological criteria based onthe shape and structure of their genitalia and the presence anddistribution of setae, spines, and ctenidia on the body (Bitam etal. 2010). Dobler and Pfeffer (2011) reviewed the publishedliterature from 1980 to 2010 for occurrence and frequency offleas in the dog populations of different countries. They foundthat more than 15 different flea species have been described indomestic dogs, being the cat flea (Ctenocephalides felis) themost prevalent flea species found globally on dogs.

C. felis and Ctenocephalides canis have been studied bydifferent authors (Gil Collado 1949; Gil Collado 1960;Beaucournu and Launay 1990; Lewis 1993; Beaucournuand Mnier 1998; Mnier and Beaucournu 1998; Linardiand Guimares 2000 and Durden and Traub 2002); theybased their characterization on the shape of the head, the

A. Marrugal :R. Callejn :M. de Rojas : C. Cutillas (*)Department of Microbiology and Parasitology, Faculty ofPharmacy, University of Seville, Prof. Garca Gonzlez 2,41012 Seville, Spaine-mail: cutillas@us.es

A. HalajianDepartment of Biodiversity (Zoology), University of Limpopo,Turfloop Campus, Private Bag X1106,Sovenga 0727 Polokwane, South Africa

Parasitol ResDOI 10.1007/s00436-013-3391-6

length of the first spine of the genal comb, number of spinesin the metepisternite, the distribution of spines in the hindtibia, and male and female genitalia. However, the variationsof chaetotaxy, especially those on the dorsal margin of thehind tibia and metepisternite found in some individuals, havesometimes been erroneously treated as hybrids (Holland1949; Fox 1952; Amin et al. 1974; Amin 1976). Recently,Linardi and Santos (2012) concluded that the chaetotaxies ofthe hind tibia and metepisternite (cited by these authors aslateral metatonal area) showed significant intraspecific varia-tions and, therefore these two characteristics would be cau-tiously used for interspecific diagnosis and the separation ofthe two species of Ctenocephalides must be done while con-sidering all characteristics.

Furthermore, four subspecies have been recognized: C.felis felis, C. felis damarensis, C. felis orientis, and C. felisstrongylus (Lewis 1972; Mnier and Beaucournu 1998; Kaalet al. 2006). However, overall findings do not support theexistence of subspecies of C. felis (Vobis et al. 2004).

In the present work, we carried out a comparative morpho-logical, biometrical and molecular study of Ctenocephalidesspp. isolated from Canis lupus familiaris from different geo-graphical regions (Spain, Iran, and South Africa). The internaltranscribed spacer 1 (ITS1) sequences of C. felis and C. caniscollected from dogs from different geographical regions havebeen determined to clarify the taxonomic status of thesespecies and to assess intraspecific variation and interspecificsequence differences. In addition, a phylogenetic analysisbased on ITS1 sequences has been performed.

Materials and methods

Collection of samples

Fleas were collected from dogs (C. lupus familiaris) fromdifferent geographical localities (Table 1). Dogs were ex-haustively examined for fleas through an inspection of head,neck, body, sides, tail, and ventral regions of each animal,kept in an Eppendorf tubes with 70 % ethanol until requiredfor subsequent identification and sequencing.

Morphological study

At the laboratory, fleas were examined under stereomicroscopeand cleared with 10 % KOH (Lewis 1993) for morphologicalstudies. Morphological differentiation was carried outaccording to the original descriptions (Gil Collado 1949,1960; Beaucournu and Launay 1990; Lewis 1993;Beaucournu and Mnier 1998; Mnier and Beaucournu 1998).

Different criteria (cited by different authors) have beenused to characterize the fleas. Thus, all the morphologicalcharacteristics cited by different authors have been consideredfor the specific determination of the genus Ctenocephalides,including:

Hind tibia with a number of seta-bearing notches alongdorsal margin (Lewis 1993; Beaucournu and Launay1990; Beaucournu and Mnier 1998; Durden andTraub 2002; Linardi and Santos 2012).

Genal ctenidium formed of eight or nine spines orientedhorizontally (Lewis 1993) and relative size of the first andsecond genal spines (Gil Collado 1949; Beaucournu andMnier 1998; Durden and Traub 2002).

Presence of two to three spines in the metepisternite (GilCollado 1949; Beaucournu and Launay 1990; Beaucournuand Mnier 1998; Linardi and Santos 2012).

Shape of the front of head (Gil Collado 1949; Lewis1993; Beaucournu and Launay 1990; Linardi andSantos 2012). Length/wide ratio of the head (Durdenand Traub 2002).

Male genitalia: manubrium and apex (degree of dila-tion) (Gil Collado 1949; Lewis 1993; Mnier andBeaucournu 1998) and aedeagus (Mnier and Beaucournu1998).

Female genitalia: Spermatheca and hilla (degree ofelongation of the apical part of the spermatheca) (GilCollado 1949; Lewis 1993).

Biometrical study

For biometrical study, different parameters were considered(Tables 2 and 3).

Table 1 Distribution of fleas collected from dogs from different geographical origins

Geographical origin Dogs tested Ctenocephalides felis(number of fleas)

Ctenocephalides canis(number of fleas)

Sanlcar de Barrameda (Cadiz, Spain) 3 403

Mairena del Aljarafe (Seville, Spain) 23 110

Nashtarood (Mazandaran province, Iran) 10 11 96

Polokwane (Limpopo province, South Africa) 23 121

Santanyi (Mallorca, Spain) 3 166

Total 62 811 96

Parasitol Res

Table 2 Biometrical data of males (M) and females (F) of different populations of Ctenocephalides felis isolated from Canis lupus familiaris

TL (mm) TW (mm) HL (m) HW (m) GSD (m) ASL (m) ASD (m) HL (m) AW (m)

Population A

H 40

MIN 1.7 0.7 364.3 193.9 28.2 0 0 25.9

MAX 2.9 1.2 464.1 235.0 58.8 28.2 23.5 37.7

X 2.4 1.0 418.9 214.4 42.1 22.4 14.6 30.8

SD 0.3 0.1 28.3 13.1 8.7 6.7 7.2 3.6

VC (%) 13.8 13.4 6.8 6.1 20.7 29.9 49.2 11.6

M 37

MIN 1.5 0.6 246.8 158.6 23.5 0 0 4.7

MAX 2.3 1.0 393.6 240.9 47.1 30.6 16.5 32.9

X 1.8 0.7 364.8 188.6 37.6 23.2 5.8 21.3

SD 0.2 0.1 32.9 16.5 5.5 5.3 5.6 6.7

VC (%) 10.5 9.4 9.0 8.8 14.5 22.9 97.7 31.7

Population B

H 27

MIN 1.9 0.8 381.9 188.0 23.5 23.5 0 16.5

MAX 2.9 1.2 440.6 235.0 51.8 40.0 40.0 35.3

X 2.4 1.1 416.2 212.7 38.7 27.6 21.7 28.4

SD 0.3 0.1 18.0 14.5 7.1 5.0 8.9 5.7

VC (%) 11.6 10.4 4.3 6.8 18.2 18.2 41.2 20.0

M 25

MIN 1.4 0.5 317.3 158.6 28.2 16.5 16.5 11.8

MAX 2.0 0.8 411.3 229.1 47.1 40.0 70.6 35.3

X 1.8 0.7 371.7 191.1 38.2 26.3 28.0 24.3

SD 0.2 0.1 23.9 18.5 4.7 4.6 12.8 7.0

VC (%) 11.5 10.0 6.4 9.7 12.3 17.5 45.6 28.9

Population C

H 6

MIN 2.9 1.2 411.3 188.0 30.6 23.5 0 40.0

MAX 3.0 1.3 464.1 229.1 47.1 44.7 0 42.4

X 3.0 1.2 437.7 208.6 38.8 34.1 0 41.2

SD 0.1 0.1 37.4 29.1 11.7 15.0 0 1.7

VC (%) 1.8 6.9 8.5 13.9 30.0 43.9 0 4.0

M 1

MIN 2.0 0.9 381.9 205.6 51.8 40.0 0

MAX 2.0 0.9 381.9 205.6 51.8 40.0 0

X 2.0 0.9 381.9 205.6 51.8 40.0 0

SD

VC (%)

Population D

H 3

MIN 2.0 1.0 417.1 199.8 35.3 75.3 11.8 35.3

MAX 2.5 1.1 440.6 235.0 40.0 80.0 30.6 35.3

X 2.2 1.0 428.9 221.3 37.7 77.7 21.2 35.3

SD 0.3 0.1 11.8 18.9 3.3 3.3 13.3 0

VC (%) 11.9 4.7 2.7 8.5 8.8 4.3 62.9 0

M 3

MIN 1.8 0.7 381.9 223.3 40.0 25.9 32.9 25.9

MAX 2.0 0.8 423.0 229.1 44.7 28.2 47.1 37.7

Parasitol Res

Molecular study

For molecular purposes, single fleas were frozen in liquidnitrogen and pulverized in a mortar. Genomic DNA wasisolated using the DNeasy Blood and Tissue Kit (Qiagen)according to the manufacturers protocol. Genomic DNAwas detected after 0.8 % agarose gel electrophoresis usingethidium bromide. The ribosomal DNA (rDNA) region wasamplified by PCR using a thermocycler (Perkin Elmer) andthe following PCR mix: 10-l 10 PCR buffer, 2-l 10 mMdNTP mixture (0.2 mM each), 3-l 50 mM MgCl2, 5-lprimer mix (0.5 mM each), 1.5-l template DNA, 0.5-lTaq DNA polymerase (2.5 units) and autoclaved distilledwater to 100 l. The following conditions were applied: 94 C at 5 min (denaturing), 35 cycles at 94 C at 30 s (denaturing),58 C at 30 s (annealing), 72 C at 90 s (primer extension),followed by 5 min at 72 C. Forward primer forCtenocephalides was NC5 (5-GTAGGTGAACCTG

CGGAAGGATCATT-3) that corresponds to the conserved 3end of the ITS1 flanking the 18S region (Gasser et al. 1996) andreverse primer ITS1rev (5-GCT GCG TTC TTC ATC GACCC-3) that corresponds to the conserved 5 end of the 5.8Sgene (Vobis et al. 2004). For each set of PCR reactions andextraction of DNA, samples without DNA (negative) and aknown (positive) control DNA sample were also included.

The PCR products were checked on ethidium bromide-stained 2 % TrisborateEDTA agarose gels. Bands wereeluted and purified from the agarose gel by using theQWizard SV Gel and PCR Clean-Up System Kit (Promega).Once purified, the products were sequenced by Stab Vida(Portugal).

The intrapopulation variation was determined by se-quencing, at least, three individuals of each locality. Forinterspecific variation, molecular studies were comparative-ly carried out according to sequences of different species ofSiphonaptera available in GenBank.

Table 2 (continued)

TL (mm) TW (mm) HL (m) HW (m) GSD (m) ASL (m) ASD (m) HL (m) AW (m)

X 1.9 0.8 402.4 226.2 42.4 27.1 40.0 31.8

SD 0.1 0.9 29.1 4.2 3.3 1.7 10.0 8.3

VC (%) 7.2 11.1 7.2 1.8 7.9 6.2 25.0 26.2

TL total length, TW total width, HL length of the head, HW width of the head, GSD difference in length between the first and the second genal spine,ASL length of the setae, ASD distance between the setae and the spine located between the postmedial and apical one in hind tibia. HL length of theapical end of the hilla, AW width of the apex, MIN minimum, MAX maximum, X media, SD standard deviation, VC variation coefficient

Table 3 Biometrical data of males (M) and females (F) of Ctenocephalides canis isolated from Canis lupus familiaris from Iran

TL (mm) TW (mm) HL (m) HW (m) GSD (m) ASL (m) ASD (m) HL (m) AW (m)

Ctenocephalides canis

F 5

MIN 1.8 1.0 352.5 252.6 42.4 35.3 35.3 58.8

MAX 2.9 1.3 499.4 282.0 63.5 82.4 70.6 58.8

X 2.3 1.1 401.9 266.7 55.9 60.0 54.1 58.8

SD 405.8 139.4 58.8 12.2 9.5 22.5 14.8 0

VC (%) 17.9 12.3 14.6 4.6 17.0 37.4 27.3 0

M 1

MIN 2.4 1.1 440.6 276.1 75.3 87.1 70.6 58.8

MAX 2.4 1.1 440.6 276.1 75.3 87.1 70.6 58.8

X 2.4 1.1 440.6 276.1 75.3 87.1 70.6 58.8

SD 0 0 0 0 0 0 0 0

VC (%) 0 0 0 0 0 0 0 0

TL total length, TW total width, HL length of the head, HW width of the head, GSD difference in length between the first and the second genal spine,ASL length of the second spine located between the postmedial and apical spines, ASD distance between the second spine and the spine locatedbetween the postmedial and apical one in hind tibia, HL length of the apical end of the hilla, AW width of the apex,MIN minimum,MAX maximum,X media, SD standard deviation, VC variation coefficient

Parasitol Res

All the phylogenetic analyses were performed on therDNA datasets, and ITS1 sequences were aligned usingthe Clustal X program version 2.0 (Larkin et al. 2007).

Phylogenetic relationships were analyzed using distance andmaximum parsimony (MP) methods. A neighbor-joining (NJ)tree (Saitou and Nei 1987) was generated from Juckes andCantor (1969); MP methods using the MEGA 5 program fromTamura et al. (2011); and maximum likelihood (ML) using thePHYML package from Guindon and Gascuel (2003). Supportfor the topology was examined using bootstrapping (heuristicoption) (Felsenstein 1985) over 1,000 replications.

The phylogenetic analysis, based on ITS1 sequences,were carried out using sequences of Xenopsylla cheopis(accession No. AN: DQ295058.1), Pulex irritans (AN:EU169198.1), Spilopsyllus cuniculi (AN: EU170157.1),Echidnophaga gallinacea (AN: EU169199.1), C. felis(EU170156.1), and Tunga penetrans from Brazil (AN:

EU169194.1) and Cameroon (AN: EU169196.1) obtainedfrom GenBank.

Results

Morphological and biometrical results

A total of 907 fleas belonging to the genus Ctenocephalideswere collected from 62 dogs (C. lupus familiaris) from differentlocalities (Table 1). Two different species of Ctenocephalideswere found: C. felis and C. canis. Both species showed typicalgeneric morphological characteristics: presence of pronotal andgenal ctenidium with eight or nine spines oriented horizontally(Fig. 1a, b), presence of one or two ventral spines in thesternum II (Fig. 1a) and two plantar spines located in the Vtarse of each leg (Fig. 1c).

*

*

a b c

d e f

g h i

j k lFig. 1 ac Morphological characteristics of Ctenocephalides spp.isolated from C. lupus familiaris. a The arrows signal the genal andpronotal ctenidium and one spine in the sternum II. b male: head(arrow). c Tarse with two plantar spines. di Population A, C. felis.d Spermateca and short hilla (arrow). e Single spine. f Setae (asterisk)

closed to spine. g Metepisternite with two spines. h Metepisternitewith three spines. i Manubrium (arrow). j Distribution of spinesand setae in population B. Setae (asterisk) associated far to spine. kDoubled spine (arrow) observed in population C. l Two spinesobserved in population D

Parasitol Res

Four different populations of C. felis have been foundaccording to morphological criteria (Fig. 1):

Population A: the head of females was twice longer thanwide (not shown), while this ratio was lesser in males(Fig. 1b). Genal ctenidium presenting the first spine aslong as the second one (Fig. 1a). Typical spermathecawith a short apical part of hilla was observed in theposterior end of females (Fig. 1d). All the individuals ofthis population presented one single short and strongspine close to short setae, sometimes absent, and locatedtypically between the postmedial and apical spines(Fig. 1e, f). Presence of two (Fig. 1g) or three spines(some individuals from Seville and Mallorca (Spain),and South Africa) (Fig. 1h) in the metepisternite. Thispopulation A, with two spines in the metepisternite, wasthe most frequent and it was present in the fleas ondogs from all the geographical localities. Males withmanubrium only slightly dilated towards its apex(Fig. 1i). Biometrical data of population A are shownin Table 2.

Population B: most of the morphological characteristicsof this population overlapped those of population A,nevertheless, all the individuals of population B presenteda short and strong spine located typically between thepostmedial and apical spine and associated far to a longsetae (Fig 1j). Biometrical data are shown in Table 2. Thispopulation was observed on dogs from all the geograph-ical localities.

Population C: the main characteristic of this populationwas the presence of a doubled spine located between thepostmedial and apical spines in the hind tibia (Fig. 1k)in contrast with the specific single spine characteristicof this species. Biometrical data of individuals belong-ing to this population are shown in Table 2. This pop-ulation was observed on dogs from all the geographicallocalities except in dogs from Iran.

Population D: the main characteristic of this populationwas the presence of two single, short and strong spineslocated between the postmedial and apical spines (Fig. 1l).This character is typical of C. canis. Biometrical data areshown in Table 2. This population was observed on dogsfrom all the geographical localities except on dogs fromIran.

C. canis was collected at concomitant infestations with C.felis on dogs from Iran. The individuals presented typicalcharacteristics of this species: head strongly convex anteriorlyin both sexes and not noticeably elongate (Fig. 2a). Genalctenidium presenting the first spine shorter than the secondone (Fig. 2b). Presence of 3 spines in the metepisternite in allindividuals (Fig. 2c). Hind tibia with eight seta-bearingnotches along dorsal margin and presence of two single, shortand strong spines located between the postmedial and apicalspines in hind tibia (Fig. 2d). Males with manubrium dilatedtowards its apex (Fig. 2e). Typical spermatheca with apicalpart of hilla elongated was observed in the posterior end offemales (Fig. 2f). Biometrical data are shown in Table 3.

a b c

d e fFig. 2 af C. canis isolated from C. lupus familiaris. a Head strongly convex. b Genal ctenidium with first spine (arrow). c Metepisternite withthree spines. d Hind tibia with two spines (arrow). e Manubrium. f Spermatheca with a long hilla (arrow)

Parasitol Res

Molecular results

A single PCR product (about 700 base pairs) was amplifiedfrom the genomic DNA of C. felis and C. canis isolated fromdogs from different localities. The ITS1 sequences of therDNA of different populations of C. felis from different geo-graphical regions were 668 bp in length, while the ITS1sequences of C. canis were 671672 bp in length (Fig. 3).When the ITS1 sequences of C. felis and C. canis werecompared, a total of 44 different basis pair and 11 gaps werepresent in the ITS1 sequences of both species (8.15 % ofinterspecific variation, Fig. 3). Intraspecific variation was notobserved inC. felis from different localities while intraspecificvariation (0.3 %) was observed in the ITS1 sequences of C.canis. The comparative study of the ITS1 sequences of thedifferent morphological populations observed in C. felis didnot show molecular differences.

A phylogenetic study was carried out with the ITS1sequences of the different populations of C. felis isolatedfrom different geographical regions. Phylogenetic tree to-pology based on distances and parsimony methods showedsimilar results. The phylogenetic tree (Fig. 4) constructedfor the ITS1 sequences of C. felis and C. canis isolated fromdifferent geographical regions, revealed that populations ofC. felis and C. canis clustered together in a clade correspond-ing to the genus Ctenocephalides with high bootstrap values(BV, 7199 %; Fig. 4). Furthermore, all the populations of C.felis from different geographical regions clustered together(BV, 7599 %) and separated with high BV from C. canis(Fig. 4). Close to this group, there is a different genetic groupincluding X. cheopis. Furthermore, P. irritans and S. cuniculiclustered together and separated from E. gallinacea. T.penetrans from different geographical origins appeared asoutgroups.

C.felis ACGTACATTTACTATTTAGTGAATGAAACGTGTGCGATATGTCGTATAACCTACGACGTA 60 C.canis ACGTACATTTACTATTATGTGAATGAAACGTGTGCTATATGTCGTATAACCTACGACGTA 60 **************** ***************** ************************

C.felis TAAAATCTTAAAGCGTCTCGCAACGATGGATCATTCGTTTCATTAACGTTTGACCGGAGC 120 C.canis TAAAATCTTAAAGCGTCTCGCAACGATGGATAGTTCGTTTCATTAACGTTCGACCGGAGC 120 ******************************* ***************** *********

C.felis TAGTCGCAAAATATTGCGCAGTGTGCAAAAGCAGCGTGACGCGGTTTACAACCGCTTAGC 180 C.canis GAGTCGCAAAATATTGCGCGGTGTGCTAAAGCAACGTGACCCGGTTTACAACCGCTTAGC 180 ****************** ****** ****** ****** *******************

C.felis GCTCTTATGCATTGTGTGAGAGCACTGCCATGTATATCTGCTCGGTATCGCCAGATGCCT 240 C.canis GTGCTTGAGCATTGTGTGAGAGCACTGCCATATATATCTGCTCGGTATCGCCAGATGCTT 240 * *** *********************** ************************** *

C.felis GAGCGAATGACGAAGTTCGTTGTGAAA-ACGGCGTTCTTTTTGAATATTATACTTTAAAC 299 C.canis GAGCGAATGACGAAGTTCGTTGTGAAATACAGCGTTCTTTTTGAATATAATACCC-AAAC 299 *************************** ** ***************** **** ****

C.felis GCATAGCTCAATCAATTCTTTGGGCGCTAGA----TGAAAGTCTAGTGTTTCAAAG--TC 353 C.canis GCAAAGCTCAATCAATACTTTGGGCACTAGACAACTAACTGTCCAGTGTTTCATATATTT 359 *** ************ ******** ***** * * *** ********* * *

C.felis GATTGTAGTAAACGCTTGCGTTAGTATTCTATATACTCTGCACATTTTATTCAAATTGTG 413 C.canis GATTGTAGTAATCGCTTGCGTTAGTATTCTAT--ACTCTGCACATTTTACTCAAATTGTG 417 *********** ******************** *************** **********

C.felis CGAATTTGAACATTCGCTTCATTGCGTTGTTTTAAGAAAATGAAAGATCAGCGAAAGCAG 473 C.canis CGATTGTGAACATTCGCTTAATTGCGTTGTTTTAAGAAAATGAAAGATCAGCGAAAGCAG 477 *** * ************* ****************************************

C.felis ATTTTTCAATCTCACACACAATGAAATATTCATATTTCAATTTTGAAACGAGGTCTCGTA 533 C.canis ATTTTTCAATCTCACACACAATGAAATATTCATATTTCAATTTTGAAACGAGATCTTGTA 537 **************************************************** *** ***

C.felis TCTCGGACCGAAAAGCGAAAGCTTTACGGTGTACTAATTGTAACCATAATAAACATACTA 593 C.canis TCTCGGGCCGAAGAGCGAAAGCTTTACGGTGTACTAATTGTAACCATAATGAACATACTA 597 ****** ***** ************************************* *********

C.felis GTTTCAGAATCGCCCGAGTTATCTTAAACGATTTCGAGGGAATCACGATTGAAACATGTA 653 C.canis GTTTTAGCATCGCCCGAGTTATCTTAACCGATTTCGAGGGAATTACGATCGAAACATGTA 657 **** ** ******************* *************** ***** **********

C.felis TAAATATATATAAAA 668 C.canis TAAA-ATATATAAAA 671 **** **********

Fig. 3 Alignment of theconsensus nucleotide sequencesof the ITS1 for C. felis and C.canis isolated from C. lupusfamiliaris. Gaps generated byalignment (en dash)

Parasitol Res

The alignment of the ITS1 sequences of different speciesof Siphonaptera revealed different clades (Fig. 4) separatedfrom the Ctenocephalides species.

Based on the ITS1 sequences, restriction mapping identifiedmany endonucleases that could be used to delineate both spe-cies ofCtenocephalides (C. felis andC. canis). Thus, BfrBI andDraI sites were present in the sequence ofC. felis but not in thatof C. canis. Furthermore, HaeIII and PhoI presented only onerestriction site in C. canis but none in C. felis.

The ITS1 consensus sequence data of C. felis and C. canishave been deposited in GenBank database under the followingaccession No. HF583247 and HF563590, respectively.

Discussion

In the present work we found two species of Ctenocephalidesparasitizing C. lupus familiaris from different geographicalregions: C. felis and C. canis. Morphological characteristicswere in agreement with those cited by Gil Collado (1949),Lewis (1993), Beaucournu and Mnier (1998), Mnier andBeaucournu (1998), Beaucournu and Launay (1990), andDurden and Traub (2002). Nevertheless, some populationsof C. felis (populations A and D) showed typical morpholog-ical characteristics of C. canis (presence of three spines in themetepisternite of some individuals from Seville and Mallorca

223ITS1 222ITS1 216ITS1 215ITS1 35ITS1 143ITS1 113ITS1 102ITS1 82ITS1 75ITS1 31ITS1 27ITS1 24ITS1 58ITS1 12ITS1 40ITS1 28ITS1 Ctenocephalides felis 199ITS1

197ITS1 198ITS1 212ITS1

Xenopsylla cheopis Pulex irritans

Spilopsyllus cuniculi Echidnophaga gallincea

BrasilTunga penetrans Tunga penetrans(Cameroon)

96

0.1

C. canis (Iran) C. canis (Iran) C. canis (Iran)

Pulex irritansSpilopsyllus cuniculi

Echidnophaga gallinacea

Tunga penetrans (Cameroon) Tunga penetrans (Brasil)

Xenopsylla cheopis

96/75/99

99/71/99

95/-/82

100/100/9970/75/76

100/-/99

100/-/99 100/-/99

-/100/99

C. felis D (Cadiz)C. felis D (Seville)C. felis D (Mallorca) C. felis D (South Africa)C. felis C (Cadiz)C. felis C (Seville)C. felis C (Mallorca) C. felis C (South Africa)C. felis B (Seville)C. felis B (South Africa)C. felis B (Iran)C. felis B (Mallorca)C. felis B (Cadiz)C. felis A (Cadiz) C. felis A (Seville)C. felis A (Mallorca)C. felis A (South Africa)C. felis A (Iran)C. felis (EU170156.1)

Fig. 4 Phylogenetic tree of ITS1 sequences of the family Pulicidae.The evolutionary was inferred using the neighbor-joining (K2), max-imum composite likelihood (GTR+G), and maximum parsimony

methods. The percentage of replicate trees in which the associated taxaclustered together in the bootstrap test (1,000 replicates) is shown onto thebranches (NJ/ML/MP). Bootstrap values lower than 60 % are not shown

Parasitol Res

(Spain), and South Africa, and presence of two single, shortand strong spines located between the postmedial and apicalsetae in hind tibia). This fact was found by Linardi and Santos(2012). Thus, these morphological characteristics should notbe used as differential character between these species.However, the degree of dilation of the apex and the degreeof elongation of the apical part (hilla) of the spermatheca wasthe most differential character between both species what is inagreement with Mnier and Beaucournu (1998) and Lewis(1993), respectively. The length observed between the firstand the second genal spines was the most specific biometricalparameter observed between both species and it was in agree-ment to Gil Collado (1960). Furthermore, and in accordancewith Durden and Traub (2002), the length/wide ratio ofthe head was a specific parameter to differentiate C. felisand C. canis.

For decades, the specific differentiation of fleas hasbeen based on morphological criteria (shape and structure oftheir complex genitalia, distribution of setae, spines andctenidia, etc). According to these criteria, different species ofCtenocephalides have been reported parasitizing different hostsfrom different geographical origin (Mnier and Beaucournu1998). Furthermore, different subspecies of C. felis have beendescribed (Beaucournu and Mnier 1998; Mnier andBeaucournu 1998), although other authors do not support theexistence of subspecies of C. felis (Vobis et al. 2004).

However, scarce studies have been carried out on molecu-lar differentiation in fleas. Thus, Vobis et al. (2004) carried outa molecular phylogeny of isolates of C. felis based on analysisof the internal transcribed spacers 1 and 2 (ITS1 and ITS2).These regions have been used to differentiate populationswithin species, e.g., mites (de Rojas et al. 2002, 2007).

The comparative molecular study, based on ITS1 se-quences, of different morphological populations of C. felisfrom different geographical regions (Cadiz, Seville andMallorca in Spain; South Africa and Iran) revealed a 100 %of identity. This fact is not in agreement with Gamerschlag etal. (2008) who found different length in the ITS1 rDNA of T.penetrans from Africa and South America. Nevertheless,Vobis et al. (2004) found that the ITS1 and ITS2 nucleotidesequences of different C. felis populations from Germany,Australia, and South Africa proved rather invariant. Thisresult has been explained as a recent human-mediated trans-port of fleas rather than long-term separation (Vobis et al.2004). Therefore, the possible adaptation-dependent morpho-logical differences observed in the different populations of C.felis did not correspond with different molecular data. Thus,the presence of two or three spines in the metepisternite or thedistribution of spines in the hind tibia does not correspondwith a specific differential character between C. felis and C.canis.

All the individuals of C. canis were collected on dogsfrom Iran and they did not show morphological variations.

The comparative study of the ITS1 sequences of C. felis andC. canis revealed interspecific variability. These data arepartially in agreement with Vobis et al. (2004); nevertheless,these authors did not sequence the ITS1 region of C. canis.Therefore, this sequence is cited for the first time in thepresent study and constitutes a useful tool for the differen-tiation of both species of fleas.

The phylogenetic analysis of the ITS1 sequences datarevealed a strong support for the separation of C. felis and C.canis in two different genetic groups and the trees, studied bydifferent methods, showed essentially, the same topology(Fig. 4). Thus, one group included C. felis populations clus-tered together with high BV and separated from C. canis. X.cheopis appeared close to this group in agreement with Vobiset al. (2004).

We can conclude that, based on the ITS1 sequences ob-served in four morphological populations of C. felis isolatedfrom dogs from five geographical locations, no moleculardifferences were detected. Furthermore, some specific recog-nition sites for endonucleases were detected in order to differ-entiate both species ofCtenocephalides (C. felis andC. canis).Thus, BfrBI and DraI sites has diagnostic value for specificdetermination in C. felis, since there was a restriction site inthe ITS1 sequence of this species, but not of that from C.canis. On the other hand, HaeIII and PhoI was only onerestriction site in C. canis but not in C. felis.

Finally, we conclude that ITS1 region is a useful tool toapproach different taxonomic and phylogenetic questions inCtenocephalides species.

References

Amin OM (1976) Host associations and seasonal occurrence of fleasfrom Southeastern Wiscosin mammals with observations on mor-phologic variations. J Med Entomol 13:179192

Amin OM, Wells TR, Gately HL (1974) Comb variations in the catflea, Ctenocephalides f. felis (Bouch). Ann Ent Soc Amer67:831834

Beaucournu JC, Launay H (1990) Les Puces (Siphonaptera) de Franceet du Bassin mditerranen occidental. Faune de France, 76, Paris.Fd Franc Soc Sci Nat 548 pp

Beaucournu JC, Mnier K (1998) Le genre Ctenocephalides Stiles etCollins, 1930 (Siphonaptera, Pulicidae). Parasite 5:316

Bitam I, Dittmar K, Parola P, Whiting MF, Raoult D (2010) Fleas andflea-borne diseases. Int J Infect Dis 14:667676

De Rojas M, Mora MD, beda JM, Cutillas C, Navajas M, GuevaraDC (2002) Phylogenetic relationships in rhinonyssid mites(Acari: Rhinonyssidae) based on ribosomal DNA sequences: in-sights for the discrimination of closely related species. ParasitolRes 88:675681

De Rojas M, Ubeda JM, Cutillas C, Mora D, Ariza C, Guevara DC(2007) Utility of ITS1-5.8S-ITS2 and 16S mitochondrial DNAsequences for species identification and phylogenetic inferencewithin the genus Rhinonyssus: the Rhinonyssus coniventris com-plex. Parasitol Res 100:10411046

Parasitol Res

Dobler G, Pfeffer M (2011) Fleas as parasites of the family Canidae.Parasite Vector 4:139

Dunnet GM, Mardon DK (1999) Siphonaptera, the insects of Australia:a textbook for students and research workers, 2nd edn. CSIROand Melbourne University Press, Melbourne, pp 125140

Durden LA, Hinkle NC (2009) Fleas (Siphonaptera). In: Mullen GR,Durden LA (eds) Medical and veterinary entomology, 2nd edn.Academic, San Diego, pp 115135

Durden LA, Traub R (2002) Medical and veterinary entomology, vol.7. Academic, San Diego, pp 103125

Felsenstein J (1985) Confidence limits on phylogenies: an approachusing the bootstrap. Evolution 39:783791

Fox I (1952) Notes on the cat flea in Puerto Rico. AmJTrop Med Hyg2:337342

Gamerschlag S, Mehlhorn H, Heukelbach J, Feldmeier H, DHaese J(2008) Repetitive sequences in the ITS1 region of the ribosomalDNA of Tunga penetrans and other flea species (Insecta,Siphonaptera). Parasitol Res 102:193199

Gasser RB, Nansen P, Guldberg P (1996) Fingerprinting sequencevariation in ribosomal DNA of parasites by DGGE. Mol CellProbes 10:99105

Gil Collado J (1949) Pulgas espaolas parsitas de roedores. Rev IberParasitol 9:214258

Gil Collado J (1960) Insectos y caros de los animales domsticos. EdSalvat 20:305325

Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm toestimate large phylogenies by maximum likelihood. Syst Biol52:696704

Holland GP (1949) The Siphonaptera of Canada. Can Dept Agric TechBul 70:1306

Juckes TH, Cantor CR (1969) Evolution of protein molecules.Mammalian protein metabolism. Academic, New York, pp 21132

Kaal JF, Baker K, Torgerson PR (2006) Epidemiology of flea infesta-tion of ruminants in Libya. Vet Parasitol 141:313318

Larkin MA, Blackshields G, Brown NP (2007) Clustal W and ClustalX version 2.0. Bioinformatics 23:29472948

Lewis RE (1972) Notes on the geographical distribution and hostpreferences in the order Siphonaptera. 1. Pulicidae. J MedEntomol 9:511520

Lewis RE (1993) Notes on the geographical distribution and hostpreferences in the order Siphonaptera. Part 8. New taxa describedbetween 1984 and 1990, with a current classification of the order.Entomol Soc Am 30:239256

Linardi PM, Guimares LR (2000) Sifonpteros do Brasil. Sao Paulo:Museu de Zoologia USP/FAPESP

Linardi PM, Santos JLC (2012) Ctenocephalides felis felis vsCtenocephalides canis (Siphonaptera:Pulicidae): some issues incorrectly identify these species. Rev Bras Parasitol Vet 4:345354

Medvedev SG (2002) Peculiarities of the distribution and host-associations of fleas (Siphonaptera). Entomol Obozr 81:737753

Mnier K, Beaucournu JC (1998) Taxonomic study of the genusCtenocephalides Stiles & Collins, 1930 (Insecta: Siphonaptera:Pulicidae) by using aedeagus characters. J Med Entomol 35:883890

Rothschild M (1975) Recent advances in our knowledge of the orderSiphonaptera. Annu Rev Entomol 20:241259

Saitou N, Nei N (1987) The neighbor-joining method: a new methodfor reconstructing phylogenetic trees. Mol Biol Evol 4:406425

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011)MEGA5: molecular evolutionary genetics analysis using maxi-mum likelihood, evolutionary distance, and maximum parsimonymethods. Mol Biol Evol. doi:10.1093/molbev/msr121

Vobis M, DHaese J, Mehlhorn H, Mencke N, Blagburn BL, Bond R,Denholm I, Dryden MW, Payne P, Rust MK, Schroeder I, VaughnMB, Bledsoe D (2004) Molecular phylogeny of isolates ofCtenocephalides felis and related species based on analysis ofITS1, ITS2 and mitochondrial 16S rDNA sequences and randombinding primers. Parasitol Res 94:219226

Parasitol Res

Morphological,...AbstractIntroductionMaterials and methodsCollection of samplesMorphological studyBiometrical studyMolecular study

ResultsMorphological and biometrical resultsMolecular results

DiscussionReferences