Pyruvate Kinase Inhibits Proliferation during Postnatal ...glycolysis supports CGNP proliferation and medulloblastoma tumorigenesis is essential for designing metabolically directed

Molecular and Cellular Pathobiology

Pyruvate Kinase Inhibits Proliferation duringPostnatal Cerebellar Neurogenesis andSuppresses Medulloblastoma FormationKatherine Tech1,2, Andrey P. Tikunov1, Hamza Farooq3,4, A. Sorana Morrissy3,4,Jessica Meidinger2, Taylor Fish2, Sarah C. Green1, Hedi Liu2, Yisu Li5, Andrew J. Mungall5,Richard A. Moore5, Yussanne Ma5, Steven J.M. Jones5, Marco A. Marra5,Matthew G. Vander Heiden6,7, Michael D. Taylor3,4,8,9, Jeffrey M. Macdonald1, andTimothy R. Gershon2,10,11

Abstract

Aerobic glycolysis supports proliferation through unresolvedmechanisms. We have previously shown that aerobic glycolysis isrequired for the regulated proliferation of cerebellar granuleneuron progenitors (CGNP) and for the growth of CGNP-derivedmedulloblastoma. Blocking the initiation of glycolysis via dele-tion of hexokinase-2 (Hk2) disrupts CGNP proliferation andrestricts medulloblastoma growth. Here, we assessed whetherdisrupting pyruvate kinase-M (Pkm), an enzyme that acts in theterminal steps of glycolysis, would alter CGNP metabolism,proliferation, and tumorigenesis. We observed a dichotomouspattern of PKM expression, in which postmitotic neuronsthroughout the brain expressed the constitutively active PKM1isoform, while neural progenitors and medulloblastomas exclu-

sively expressed the less active PKM2. Isoform-specific Pkm2deletion in CGNPs blocked all Pkm expression. Pkm2-deletedCGNPs showed reduced lactate production and increasedSHH-driven proliferation. 13C-flux analysis showed that Pkm2deletion reduced the flow of glucose carbons into lactate andglutamate without markedly increasing glucose-to-ribose flux.Pkm2 deletion accelerated tumor formation in medulloblasto-ma-prone ND2:SmoA1 mice, indicating the disrupting PKMreleases CGNPs from a tumor-suppressive effect. These findingsshow that distal and proximal disruptions of glycolysis haveopposite effects on proliferation, and that efforts to block theoncogenic effect of aerobic glycolysis must target reactionsupstream of PKM. Cancer Res; 77(12); 3217–30. �2017 AACR.

IntroductionIncreased aerobic glycolysis, a common feature of proliferating

cells during developmental andmalignant growth (1, 2), has beenproposed as a target for anticancer therapy. CGNPs are transit

amplifying cells that proliferate in the postnatal brain (3, 4) thatutilize aerobic glycolysis during normal brain development (5).CGNPs are also cells-of-origin for SHH-subgroup medulloblas-toma (6, 7). Medulloblastomas coopt developmentally regulatedprograms of CGNPs (6, 7), including the metabolic phenotype ofincreased aerobic glycolysis (5, 8). Understanding how aerobicglycolysis supports CGNP proliferation and medulloblastomatumorigenesis is essential for designing metabolically directedmedulloblastoma therapies.

During postnatal brain development, CGNPs proliferate inthe cerebellum in response to locally secreted Sonic Hedgehog(SHH), generating the largest neuron population in the mam-malian brain (9–11). In synchrony with increased CGNP pro-liferation, SHH signaling induces hexokinase-2 (HK2) andaerobic glycolysis (5, 8). Approximately 30% of medulloblas-toma patients show SHH pathway activation (12, 13) and micewith activating SHH pathway mutations develop spontaneousmedulloblastomas that recapitulate the human disease(14, 15). These tumors arise from CGNPs and, like theircells-of-origin, upregulate HK2 and aerobic glycolysis (5, 8).CGNP proliferation and SHH-driven tumorigenesis in micetypify aerobic glycolysis supporting tumorigenesis arising fromdevelopmental growth.

We have previously shown that conditional deletion ofHk2 inthe developing brain blocks SHH-induced aerobic glycolysis,disrupts CGNP differentiation, and reduces medulloblastomagrowth, extending the survival of medulloblastoma-prone mice(5). These findings demonstrate the importance of aerobic

1Joint Department of Biomedical Engineering, University of North Carolina atChapel Hill and North Carolina State University, Chapel Hill, North Carolina.2Department of Neurology, University of North Carolina School of Medicine,Chapel Hill, North Carolina. 3Developmental & Stem Cell Biology Program, TheHospital for Sick Children, Toronto, Ontario, Canada. 4The Arthur and SoniaLabatt Brain Tumour Research Centre, The Hospital for Sick Children, Toronto,Ontario, Canada. 5Michael Smith Genome Sciences Centre, BC Cancer Agency,Vancouver, British Columbia, Canada. 6David H. Koch Institute for IntegrativeCancer Research, Massachusetts Institute of Technology, Cambridge, Massa-chusetts. 7Dana-Farber Cancer Institute, Boston,Massachusetts. 8Department ofLaboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario,Canada. 9Division of Neurosurgery, The Hospital for Sick Children, Toronto,Ontario, Canada. 10Lineberger Comprehensive Cancer Center, University ofNorth Carolina School of Medicine, Chapel Hill, North Carolina. 11UNC Neurosci-ence Center, University of North Carolina School of Medicine, Chapel Hill, NorthCarolina.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Author: Timothy R. Gershon, Department of Neurology, Uni-versity of North Carolina at Chapel Hill, Chapel Hill, NC 27599. Phone: 919-966-3618; Fax: 919-966-2922; E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-16-3304

�2017 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 3217

on February 7, 2021. © 2017 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst May 17, 2017; DOI: 10.1158/0008-5472.CAN-16-3304

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-16-3304&domain=pdf&date_stamp=2017-5-27

http://cancerres.aacrjournals.org/

glycolysis in development and cancer, suggesting that blockingglycolysis through HK2 inhibition may produce a clinically sig-nificant antitumor effect. Development of selective HK2 inhibi-tors for anticancer therapy, however, has been problematic (16).Whether targeting glycolysis downstream of HK2would similarlyinhibit tumor growth is unknown. To determine whether thedistal portion of the glycolytic pathway is required for the pro-liferation of normal and transformed CGNPs, we analyzed theeffect of disrupting pyruvate kinase (PK) during cerebellar neu-rogenesis and medulloblastoma formation.

While HK2 initiates glycolysis, PK catalyzes the final step,converting phosphoenolpyruvate (PEP) and ADP into pyruvateand ATP (17). Pkm is the pyruvate kinase expressed in the brain(18). Alternative splicing of a single exon from Pkm gives rise toeither Pkm1, which includes exon 9, or Pkm2, where exon 9replaces exon 10 (19). PKM1 is constitutively active and typicallyexpressed in differentiated cells, while PKM2 has a regulatedactivity and is commonly expressed in cancer (20–24). PKM2can be activated by fructose-1,6-bisphosphate, an upstream gly-colytic intermediate (23, 24) and inactivated by interaction withtyrosine-phosphorylated proteins responding to growth factorreceptor signaling (20, 21, 25). While the regulated activity ofPKM2may allow proliferating cells to adjust their metabolism todynamic requirements (2), the specific benefit of low PKM2activity has not been identified.

PKM2 is expressed in diverse cancers, suggesting a role in cancergrowth. Xenograft tumors engineered to overexpress either iso-form showed that PKM2 expression confers a relative growthadvantage (26). Other studies have reported nonmetabolic,growth-promoting functions such as transcriptional regulation(27, 28) and histone phosphorylation (29, 30). However, iso-form-specific deletion studies show that PKM2 is not required fortumor formation. Aged mice with isoform-specific Pkm2 deletiondevelop liver cancer (31) and breast cancers are accelerated inBrca1-deleted mice with codeletion of Pkm2 (32). These studiesidentify cancers in which Pkm2 deletion promotes tumor growth.However, neither study showed an effect of Pkm2 deletion ontumor glycolysis, potentially because PKM2 activity may be fullydownregulated in established tumors. To identify metabolicprocesses linking Pkm2 to growth, it is necessary to analyze Pkm2deletion in normal proliferative cells that, unlike cancer cells, arenot locked into a proliferative state. CGNPs present an idealopportunity to study Pkm2 function because these cells canmodulate both aerobic glycolysis and proliferation, and are alsovulnerable to malignant transformation in medulloblastomatumorigenesis.

PKM2 is induced by SHH in CGNPs and expressed in theND2:SmoA1 mouse model of medulloblastoma (8), suggestinga role in SHH-driven growth. PKM2 upregulation has also beennoted in MYC-amplified group 3 medulloblastomas (33),suggesting a role for PKM2 in tumor growth across humanmedulloblastoma subgroups. Here, we analyzed PKM-mediatedregulation of CGNP glucose metabolism, proliferation, andtumorigenesis. LikeHk2deletion, Pkm2deletion decreasedCGNPconversion of glucose to lactate. However, unlike Hk2 deletion,Pkm2 deletion increased SHH-driven proliferation, and acceler-ated medulloblastoma formation in mice expressing a constitu-tively active Smo allele. The differential effects of impeding aerobicglycolysis through deletion ofHk2 or Pkm2 identify the glycolyticsteps upstream of PK as critical to supporting proliferation duringdevelopment as well as contributing to tumorigenesis.

Materials and MethodsAnimals

All wild-type and genetically engineered mice were main-tained on the C57/Bl6 background with at least 5 backcrosses.ND2:SmoA1 mice were provided by Dr. James Olson (FredHutchinson Cancer Research Center, Seattle, WA). Math1-Cremice were provided by Dr. David Rowitch (University ofCalifornia San Francisco, San Francisco, CA) and Robert Wechs-ler-Reya (Sanford-BurnhamMedical Research Institute, La Jolla,CA). Eva Anton (University of North Carolina at Chapel Hill,Chapel Hill, NC) provided hGFAP-Cre mice. Pkm2fl/fl mice weregenerously shared by Dr. Matthew Vander Heiden (Massachu-setts Institute of Technology, Cambridge, MA). Medulloblas-toma-prone mice were monitored daily for abnormalities ofhead shape and movement. At the onset of tumor symptoms,such as weight loss, ataxia, and impaired movement, animalswere sacrificed and survival time to onset of symptoms wasconsidered the event-free survival.

For 5-ethynyl-20-deoxyuridine (EdU) experiments, mice wereintraperitoneally injectedwith EdU (#A10044, Life Technologies)at 40mg/kg in 50 mL of HBSS and dissected 24 hours later. Brainswerefixed in 4%paraformaldehyde in 1�PBS for 24hours at 4�C,then processed for histology. All animal handling and protocolswere carried out in accordance with established NIH practicesand approved under University of North Carolina InstitutionalAnimal Care and Use Committee #13-121.0 and 15-306.0.

Cell culture techniquesCGNPs were isolated and cultured as previously described

(5, 34). Briefly, cerebella were dissected from P5 pups, disso-ciated, and allowed to adhere to coated culture wells inDMEM/F12 (#11320, Life Technologies) with 25 mmol/L KCl,supplemented with FBS and N2. After 4 hours, media werereplaced with identical serum-free media. Cells were main-tained in 0.5 mg/mL SHH (#464SH, R&D Systems) or vehicle(0.1% BSA in 1� PBS). Where indicated, 1 mmol/L vismodegib(#S1082, Selleck Chemicals) was added to cultures after thefirst 24 hours, with cells harvested 24 hours after drug treat-ment. In vitro CGNP proliferation was measured by EdU incor-poration after a 1-hour exposure to 20 mmol/L EdU. EdU wasvisualized following the manufacturer's protocol (#C10337,Life Technologies). Cell counts were performed using Leica-Metamorph software (Molecular Devices). No cell lines wereuse in these studies.

In vitro metabolism studies1H NMR and liquid chromatography-mass spectrometry

(LC-MS) acquisition methods are described in detail in theSupplementary Materials and Methods. Briefly, CGNPs of eachgenotype were cultured in at least three replicate wells. ExplantedCGNPs were maintained in [1,6-13C] glucose media for 24 hoursfollowed by media sampling and cell extraction for metabolomicanalysis. We normalized to cell number at 24 hours to account fordifferences in growth rates by counting cells in a replicate set ofwells cultured in parallel.

For the enzymatic measurement of lactate, media from atleast three replicate wells were sampled at the specified timepoints and lactate was quantified using the L-Lactate Assay Kit(#1200011002, Eton Bioscience) as per manufacturer's protocol.

For PK activity assays, cells from at least three replicate wellsper condition, or whole cerebella from at least three replicate

Tech et al.

Cancer Res; 77(12) June 15, 2017 Cancer Research3218




mice per genotype, were lysed and processed for the colori-metric assay per manufacturer's protocol (#K709-100,BioVision Inc.).

Histology and IHCMouse brain and tumor tissues were processed for IHC as

described previously (35) using antibodies listed in Supple-mentary Materials and Methods. EdU was visualized per man-ufacturer's protocol. After IHC and EdU staining, where indi-cated, nuclei were counterstained with 200 ng/mL 406-diami-dino-2-phenylindole (DAPI; #D1306, Thermo Fisher Scientific)in 1� PBS for 5 minutes. Stained slides were digitally acquiredusing an Aperio ScanScope XT (Aperio). Where indicated,maximum intensity projections of stained tissue sections wereacquired on a Zeiss LSM 780 confocal microscope with a Plan-Apochromat 20� objective (NA 0.8). To quantify EdU, prolif-erating cell nuclear antigen (PCNA), and p27Kip1-positive cellsin the EGL, the EGL region was manually annotated on eachsection, which was then subjected to automated cell countingusing Tissue Studio (Definiens) for fluorescent slides. Forpremalignant lesion analysis, the entire cerebellum was anno-tated and used for cell counts.

Western blot analysisCultured cells and whole cerebella were lysed by homoge-

nization in RIPA buffer containing protease inhibitor cocktail,NaF, and sodium orthovanadate. Protein concentrations werequantified using the bicinchoninic acid (BCA) method(#23229, Thermo Fisher Scientific) and equal concentrationsof protein were resolved on SDS-polyacrylamide gels followedby transfer onto polyvinylidene difluoride membranes. Immu-nologic analysis was performed on the SNAP i.d. ProteinDetection System (Millipore) as per manufacturer's protocolwith antibodies listed in Supplementary Materials and Meth-ods. Western blots were developed using the enhanced chemi-luminescent SuperSignal West Femto Maximum SensitivitySubstrate (#34095, Thermo Fisher Scientific) and digitizedusing the C-DiGit blot scanner (LI-COR Biosciences). Quan-tification was performed using Image Studio Lite software(LI-COR Biosciences).

DNA sequencingDNA was lysed from toe cuttings and used to generate Pkm2

PCR products. Pkm2 PCR primers were TAGGGCAGGACCAAAG-GATTCCCT (forward) and CTGGCCCAGAGCCACTCACTCTTG(reverse). PCR products were extracted from a 0.8% agarose gelusing the MinElute Gel Extraction Kit (#28604, Qiagen), clonedby TOPO TA Cloning (#K4575-J10, Life Technologies) andsequenced from the M13F and M13R primer sites by Sangersequencing (Eton Bioscience).

Patients and samplesAll patient samples were obtained with consent as outlined by

individual institutional review boards. Written informed consentwas obtained at the time of surgical resection. Deidentifiedmedulloblastoma tissues were obtained from Queensland Chil-dren's Tumor Bank (Brisbane, Australia), German CancerResearch Center (Heidelberg, Germany), Sanford-BurnhamMed-ical Research Institute (La Jolla, CA), and Hospital for SickChildren (Toronto, Ontario, Canada).

Differential Pkm isoform expression analysis of RNA-seq dataLibrary construction, sequencing, and alignment of RNA-seq

data are described in detail in the Supplementary Materialsand Methods. Transcriptome aligned binary alignment files(bams) were processed using RNA-Seq by Expectation Maxi-mization (RSEM) software (36). The reference for RSEM wasbuilt using the same GRCh37-lite assembly and GRCh37.75GTF as used by STAR aligner (37). This was followed by thecalculation of PKM isoform level FPKM using RSEM withdefault parameters in 97 human tumors. The accession numberfor the RNA-seq data is European Genome-phenome Archive:EGAD00001001899.

Survival analysis of SHH-subgroup medulloblastomapatients

PKM2 FPKM expression was converted to a Z-score and usedto segregate SHH patients into a high or low category with thecriteria of being greater than 0.5 or smaller than –0.5 respec-tively. A Cox proportional hazard model was used to determinethe presence of a survival difference.

ResultsPkm isoform expression in the brain mirrorsdifferentiation status

We found dichotomous Pkm isoform expression in the post-natal brain that varied with differentiation state. Differentiatedneurons throughout the brain expressed PKM1 and not PKM2(Fig. 1A). In contrast, neural progenitors of the cerebellar externalgranule layer (EGL), hippocampus (HC), and subventricularzone/rostral migratory stream (SVZ/RMS) expressed PKM2 andnot PKM1 (Fig. 1B).

The temporal expression of PKM2 in the cerebellum coin-cided with postnatal neurogenesis. CGNP proliferation peaks atpostnatal day 7 (P7) and ends by P15, as CGNPs progressivelyexit the cell cycle, migrate to the internal granule layer (IGL),and differentiate into cerebellar granule neurons (CGN; refs. 3,4, 7). Western blot analysis of whole cerebellum lysates show-ed that PKM2, like the CGNP proliferation marker cyclin-D2(CCND2), decreased between P7 and P15, while PKM1 con-versely increased (Fig. 1C). PKM2 was not limited to prolifer-ating progenitors: both proliferating, PCNAþ CGNPs in theouter layer of the EGL (oEGL), and differentiating, PCNA–

CGNPs of the inner EGL (iEGL) expressed PKM2 (Fig. 1D).Similarly, in the SVZ/RMS, both PCNAþ and PCNA– progeni-tors expressed PKM2 (Fig. 1E). Thus, PKM2 marked undiffer-entiated brain progenitors, whether proliferating or quiescent,while PKM1 marked differentiated neurons.

To determine whether medulloblastomas, like CGNPs, exclu-sively expressed PKM2, we analyzed PKM isoform expression intransgenic, medulloblastoma-prone ND2:SmoA1 mice. ND2:SmoA1 mice express a mutant, constitutively active allele of Smo,driven by theNeuroD2 promoter. In CGNPs ofND2:SmoA1mice,SHH-pathway activation prolongs proliferation beyond P15.These mice develop medulloblastoma with incomplete pene-trance after a variable latency (14). During this latent period,CGNPs continue to proliferate in premalignant lesions within theEGL, generating progeny that differentiate, undergo apoptosis, orremain proliferative.

We found that CGNPs in premalignant lesions of P60 ND2:SmoA1 mice expressed PKM2 and not PKM1 (Fig. 1F). Similarly,medulloblastomas derived from these premalignant lesions

PKM Suppresses Medulloblastoma

www.aacrjournals.org Cancer Res; 77(12) June 15, 2017 3219




Figure 1.

PKM1 and PKM2 correspond to differentiation state. IHC (brown) shows PKM1 in differentiated neurons throughout the brain (A-A00) and PKM2 in neuralprogenitors of the SVZ, HC, and EGL (B-B00). C, Western blot analysis of CCND2, PKM2, and PKM1 in whole cerebellum lysates harvested at the indicated age,normalized to b-actin. PKM2 decreases from P7 (n ¼ 4) to P15 (n ¼ 4), while PKM1 increases. Graph presents mean � SEM. Immunofluorescence shows PKM2 inthe PCNAþ oEGL and the PCNA� iEGL of in P7 wild-type mice (D) and PKM2 in PCNAþ and PCNA� (arrowheads; E) SVZ progenitors. F, Premalignant lesions inP60 ND2:SmoA1 mice identified by PCNA are PKM2þ and PKM1�. G, PKM2 and PCNA are expressed in a ND2:SmoA1 medulloblastoma; adjacent normal tissueexpresses PKM1. H, RNA-seq shows preferential expression of PKM2 in all human medulloblastoma subgroups. P values determined by Student t tests. Highmagnification of boxed areas are shown on the right. PC, Purkinje cell layer; ML, molecular layer; FPKM, fragments per kilobase of transcript per million mappedreads. Scale bars, 2 mm (A, B, and G); 600 mm (A0 and B0); 100 mm (A00 , B00 , and E); 50 mm (D and E inset); 1 mm (F); 500 mm (F0-F0 00); 300 mm (G0-G0 00).

Tech et al.





consistently and homogeneously expressed PKM2, while adja-cent, normal brain expressed PKM1 (Fig. 1G). We compared theexpression of PKM1 and PKM2 mRNA in human medulloblas-toma samples by RNA-seq. As in the mouse model, we foundexclusive expression of PKM2, with minimal PKM1 in all fourmedulloblastoma subgroups (Fig. 1H). Together, our studies ofmouse and human tumors show that developmental PKM2expression persists throughout medulloblastoma tumorigenesis.

SHH stimulates PKM2 expressionTo examine the effect of SHH signaling on PKM1/2 expression,

we isolated CGNPs and compared PKM isoform expression in thepresence or absence of SHH ligand. We labeled S-phase cells byadding EdU to CGNP cultures 1 hour before fixation. EdUþ and

PKM2þ cells were more numerous in SHH-treated wells (Fig. 2A;cyan arrows) compared with SHH-deprived controls (Fig. 2B;arrows). In SHH-treated wells, PKM2 was detected in both EdUþ

and EdU– cells (Fig. 2A and B;white arrowheads). Consistent withthe absence of PKM1 in the EGL, no CGNPs in either conditionshowed detectable PKM1; rare cells that were PKM1þ did not havemorphology characteristic of CGNPs (Fig. 2C and D). These datashow that SHH sustained PKM2 expression in CGNPs, whereasPKM1 expression remained low during the initiation of differen-tiation in SHH-deprived CGNPs.

To determine the effect of SHH inhibition on PKM expression,we analyzed SHH-treated CGNPs exposed to the Smo inhibitorvismodegib (38) by quantitative PKM Western blot. As an indi-cator of SHH-driven proliferation, we also measured CCND2

Figure 2.

Growth factor signaling regulates PKMexpression and activity. A and B, PKM2immunofluorescence on explantedCGNPs exposed to EdU for 1 hour,�SHH. C and D, Rare cells within CGNPexplants expressed PKM1 (arrowheads)in both SHH-treated andvehicle-treatedwells. E, Quantitative Western blotanalysis of CCND2, PKM2, and PKM1 incell cultures, normalized to b-actin(n ¼ 4/condition). F, N2-deprivedCGNPs produce less lactate detected byenzymatic assay (n ¼ 3/condition).G and H, CGNP PK activity increaseswith combined SHH and N2supplementation (n ¼ 3/condition).Graphs present mean � SEM. P valuesdetermined by Student t tests. Scalebars, 50 mm.






expression. SHH-treated CGNP explants demonstrated 5.5-foldmore CCND2 compared with SHH-deprived CGNPs, and 2-foldmore PKM2 (Fig. 2E). PKM1, which likely originated from rarecells detected by IHC (Fig. 2C and D), was also significantlyincreased SHH-treated explants. Vismodegib decreased CCND2by 30% but did not significantly alter PKM1 or PKM2 expression(Fig. 2E). Thus, both PKM2 and CCND2 were upregulated bySHH, but compared with CcnD2, Pkm was markedly less respon-sive to changes in SHH signaling. These data suggest that Pkm,unlike CcnD2 (11), is not a direct SHH target.

PK activity in CGNPs is increased by growth stimulationTyrosine kinase signaling, and specifically insulin signaling, can

downregulate PKM2 catalytic activity in diverse cell lines (21, 39,40). While CGNPs are typically cultured with insulin-rich N2supplement to improve cell viability (41), we have shown thatCGNPs can be cultured without N2 for 24 hours, reducing IGFRactivation without compromising survival (5). We maintainedCGNPs in the presence or absence of SHHorN2, to determine theeffect of SHH/IGFR costimulation on Pkm expression and PKactivity in CGNPs.

We found that SHH/IGFR costimulation was required forCGNP aerobic glycolysis, as N2 deprivation reduced lactate pro-duction (Fig. 2F) in a manner comparable with SHH-withdrawal(5). We have shown that growth factor stimulation inducesaerobic glycolysis through a complex program that depends onmany genes, includingN-myc andHk2 (5). To determinewhetherthis program may include changes in PK activity and PKMexpression, we analyzed CGNPs cultured with or without SHHor N2. N2-deprivation potently inhibited IGF signaling, resultingin a 70% reduction in AKT phosphorylation, and more modestlyreduced PKM2 expression by 30% (Supplementary Fig. S1). Bymeasuring the conversion of exogenous PEP to pyruvate in CGNPlysates, we found that CGNPsmaintainedwith SHHþN2 showedsignificantly higher PKactivity comparedwith either SHHwithoutN2 or N2without SHH (Fig. 2G andH). These findings show thatCGNP PK activity and PKM2 expression were responsive toextracellular signaling, and were maximal with SHH/IGFR coac-tivation, thus varying directly with glycolysis. While reduced PKactivity has been correlated with growth factor stimulation incancer cells (20, 25, 26), in CGNPs, developmentally relevantgrowth factors increased PKM2 expression, PK activity, and aer-obic glycolysis.

Pkm2 deletion is not replaced by Pkm1 in brain progenitorsTo determine the developmental significance of PKM in

CGNPs, we examined the effect of conditionally deleting thePkm2-specific exon 10 (19). We crossed Math1-Cre mice, whichexpress Cre recombinase in CGNPs (42, 43), with Pkm2fl micethat harbor loxP sites flanking Pkm exon 10 (32). The resultingMath1-Cre;Pkm2fl/fl mice (Pkm2cKO) were viable and fertilewithout neurologic deficits. Pkm2cKO cerebellum showed nor-mal foliation and cellular organization, without PKM2 orPKM1 in the EGL (Fig. 3A and B). PKM1 expression wasincreased in IGL of Pkm2cKO mice, which is populated by CGNsthat derive from CGNPs and inherit the deletion of exon 10(Fig. 3A). Thus, Pkm2 deletion in the Math1 lineage did notinduce compensatory PKM1 in progenitors but did increasePKM1 expression by terminally differentiated neurons. Con-sistent with these changes, Western blot analysis showedreduced PKM2 and increased PKM1 in P7 Pkm2cKO cerebella

compared with no-Cre littermate controls (Fig. 3C). In wholecerebellum lysates, PK activity was equivalent in Pkm2cKO andlittermate controls (Fig. 3D). In CGNPs, however, Pkm2 dele-tion blocked all detectable PKM expression.

During the breeding of Pkm2cKO mice, we noted an unan-ticipated tendency for germline recombination of the Pkm2fl

allele. This recombination event was detected as a smaller thanexpected PCR product when primers flanking Pkm exon 10 wereused to amplify genomic DNA. While these primers wereseparated by 605 bp in the Pkm2fl/fl allele and 560 bp in thePkm2þ/þ allele, we found pups in several litters that generated220-bp PCR products consistent with the recombined allele(Supplementary Fig. S2A). Sequencing of this band demon-strated that intron 9–10 and 10–11 were brought together,separated by a single loxP site, consistent with Cre-mediatedexcision of exon 10 from Pkm (Supplementary Fig. S2B; ref. 32).Similar germline recombination has been observed whenPkm2fl mice were crossed with other nongermline Cre drivers(M. Vander Heiden, unpublished data), suggesting that Pkmexon 10 deletion is positively selected in the germline. Therecombined allele (Pkm2null) was heritable and Pkm2null/null

mice were viable and fertile without neurologic abnormalities,consistent with the published Pkm2-null phenotype (31).Pkm2-null mice have been reported to develop spontaneoushepatocellular carcinoma in the second year of life (31); how-ever, we did not observe any spontaneous tumor formation inour Pkm2null/null aged up to one year. In Pkm2null/null mice, PKM2was absent from all brain cells, while PKM1 was appropriatelylimited to differentiated neurons (Supplementary Fig. S2C andS2D). Like Pkm2cKO mice, Pkm2null/null mice showed normalbrain anatomy.

Pkm2 deletion increases CGNP proliferationAlthough Pkm2cKO cerebella had normal organization, quan-

titative analysis showed that CGNP proliferation was increasedcompared with PKM2-intact littermate controls. We analyzedproliferation dynamics in vivo, by injecting EdU at P6 intoPkm2cKO and Pkm2fl/fl no-Cre littermates. We harvested cere-bella 24 hours after EdU injection and quantified the numberof EdUþ cells in the EGL that expressed the CGNP differenti-ation marker p27Kip1. Both genotypes included differentiating,EdUþp27Kip1þ CGNPs and proliferating, EdUþp27Kip1– CGNPs(Fig. 4A and B). While EdU labeling was similar betweengenotypes (Fig. 4C), we noted a trend toward reduced p27Kip1

labeling in Pkm2cKOCGNPs (Fig. 4D). Importantly, EdUþ

CGNPs that were p27Kip1– were more numerous in the EGLof Pkm2cKO mice (Fig. 4E). In vitro studies provided additionalevidence of increased proliferation with Pkm2 deletion, asCGNPs explanted from Pkm2cKO mice showed a higher fractionof EdUþ cells after a 1-hour pulse, compared with CGNPsexplanted from littermate controls (Fig. 4F).

Consistent with increased proliferation of Pkm2cKO CGNPs,analysis of equivalent midline cerebellar sections showed thatPkm2cKO cerebella contained significantly more cells (CGNPs andCGNs) compared with littermate controls (Fig. 4G). The ratio ofEGL:IGL was not significantly different between genotypes, how-ever (Fig. 4H), indicating that Pkm2 deletion did not preventCGNPs from progressing through their normal differentiationtrajectory. Thus, Pkm2 deletion blocks all PKM expression inCGNPs, with the effects of increasing proliferation and reducingcell-cycle exit, without altering cell fate.

Tech et al.





Pkm2 deletion inhibits the catabolism of glucose to lactateWe used a nonbiased, metabolomic approach to determine the

effect of Pkm2 deletion and consequent loss of PKM function onCGNP metabolism. We isolated CGNPs from P5 Pkm2cKO miceand littermate controls and cultured them in three replicate wellsfor 24 hours in media with [1,6-13C] glucose replacing unlabeledglucose. We analyzed media metabolites from each replicate wellfor each condition at 0 and 24 hours using NMR spectroscopyfollowed by orthogonal partial least squares discriminant analysis

to identify species with metabolic rates that varied consistentlyacross genotypes (Supplementary Table S1).

Lactate production was significantly reduced in Pkm2cKO

CGNPs compared with controls (Fig. 5A). Lactate was the specieswith the largest change in metabolic rate in Pkm2cKO CGNPsversus controls (Supplementary Table S1). Lactate productionand arginine utilization were both significantly reduced in thePkm2-deleted cells, but the change in argininewas 10-fold smallerand unlikely to be directly related to glucose metabolism. We

Figure 3.

Pkm2 deletion blocks all PKM expression in CGNPs. A and B, IHC shows PKM1 and PKM2 in representative sagittal cerebellar sections from P7 Ctrl and Pkm2cKO

mice. Pkm2 deletion does not induce compensatory PKM1 expression in the EGL. High magnification of boxed area is shown on the right. C, QuantitativeWestern blot normalized to b-actin in whole P7 cerebellum lysates demonstrates decreased PKM2 and increased PKM1 (n ¼ 4/condition). D, PK activity inwhole P7 cerebellum lysates is similar between genotypes. Graphs present mean � SEM. P values determined by Student's t tests. Scale bars, 500 mm;100 mm (insets).






confirmed that Pkm2cKO CGNPs produced less lactate by mea-suring media lactate in replicate wells by colorimetric assay (Fig.5B). The 13C fractional enrichment of lactatewas also decreased inPkm2cKO CGNPs (Fig. 5C and D), showing that a smaller propor-tion of utilized glucose was converted to lactate.

To determine how Pkm2 deletion altered the intracellulardisposition of glucose in CGNPs, we analyzed cell extracts byLC-MS. Diverse molecules detected by LC-MS detected did notshow significantly different distribution between genotypes. We

noted a trend toward increased choline in Pkm2cKO CGNPs; thistrend cannot be directly related to glucose metabolism, but isconsistent with increased proliferation (Fig. 5E). We were able todetect 13C labeling in glutamate, which we used as a measure offlow through the Krebs cycle, and in the ribose component of ATP,ADP, and AMP, which we used as a measure of flow through thepentose phosphate pathway (PPP; Fig. 6).

Relative to Pkm2-intact controls, Pkm2cKO CGNPs showed asmall, but statistically significant decrease in glutamatewith 3 or 4

Figure 4.

Pkm2 deletion increases CGNP proliferation. A and B, Representative confocal images of P7 Ctrl and Pkm2cKO cerebellar sections labeled for the p27Kip1 andfor EdU, 24 hours after EdU injection (n¼ 3/condition). Highmagnifications of boxed areas are shown on the right.C andD,Quantification of EdUþ cells and p27Kip1þcells in the EGL. E, The p27Kip1– fraction of the EdUþ population is significantly larger in the Pkm2cKO EGL, indicating increased cell-cycle reentry. F,Comparison EdU incorporation by CGNPs of indicated genotype, cultured with SHH and exposed to EdU for 1 hour. G and H, Analysis of midsagittalcerebellar sections shows increased EGL and IGL populations in Pkm2cKO mice (n ¼ 5) versus controls (n ¼ 4), with preserved EGL:IGL ratio. Graphs presentmean � SEM. P values determined by Student t tests. Scale bars, 500 mm; 50 mm (insets).

Tech et al.





13C atoms (Fig. 6). The incorporation ofmultiple 13C atoms from[1,6-13C] glucose requires both conversion of pyruvate to acetyl-CoA by PDH and multiple turns of the Krebs cycle (Supplemen-tary Fig. S3). The reduced glutamate with 3 or 4 13C atoms incontrols indicates that that PKM2 deletion marginally reducedlabeling downstream of PDH, consistent with a shift in fate ofglucose-derived carbons.

Both genotypes demonstrated 13C incorporation into ribose.LC-MS demonstrated labeled parent masses of ATP, ADP, andAMP that fragmented into unlabeled adenine and 13C-labeledribose. These data demonstrate active flow through the PPP.However, we did not detect a robust difference in PPP fluxbetween genotypes (Fig. 6). These data suggest that unidentifiedreactions in Pkm2cKO CGNPs bypass the conversion of PEP to

pyruvate, allowing the incorporation of 13C into glutamate andlactate at a reduced but detectable rate, while maintaining com-parable flow through the PPP. In net, Pkm2 deletion redirectedglucose-derived metabolites away from both lactate generationand retention in the Krebs cycle, without causing a large increasein PPP flux.

Medulloblastoma tumorigenesis is exacerbatedby loss of PKM2We examined the functional consequence of Pkm2 deletion on

SHH-driven medulloblastoma tumorigenesis by crossingPkm2cKO and Pkm2null/null mice with medulloblastoma-pronemouse lines. We generated tumor-prone mice using either theSmoM2 allele that induces rapidly developing progressive medul-loblastoma with 100% incidence by P20, or with theND2:SmoA1

Figure 5.

Pkm2 deletion reduces lactateproduction. A, 1H NMR analysis of mediasampled after 24 hours of culturedemonstrates decreased lactate inPkm2cKO wells (n ¼ 4) compared withcontrols (n ¼ 3; �� , P ¼ 0.029). B,Comparison of media lactate betweengenotypes, measured by enzymaticassay. C, Representative 1H NMR spectraof Ctrl and Pkm2cKO 24-hour mediademonstrate the peaks representing[3-13C] lactate (dashed line) andunlabeled lactate (solid line). D,Quantification of 13C-enriched fraction oflactate from samples in A. E, LC-MSanalysis of indicated metabolites inCGNP extracts, comparing genotypes.Graphs present mean � SEM. P valuesdetermined by Student t tests. FE,fractional enrichment.






Figure 6.

Pkm2-deleted CGNPs show altered glutamate progression through the Krebs cycle but comparable PPP flux. Comparison between SHH-treated CGNPs ofindicated genotypes cultured for 24 hours with [1,6-13C] glucose showing 13C labeling of ribose-labeled adenine nucleotides and glutamate (mean � SEM).The diagram is provided to show how 13C glucose carbons accumulate in ribose and glutamate. P values determined by Student t tests. OxPPP, oxidative phase ofpentose phosphate pathway; non-OxPPP, nonoxidative phase of pentose phosphate pathway; GAP, glyceraldehyde-3-phosphate; X5P, xylulose-5-phosphate;E4P, erythrose-4-phosphate; F6P, fructose-6-phosphate; S7P, sedoheptulose-7-phosphate; R5P, ribose-5-phosphate; Ru5P, ribulose-5-phosphate; LDH,lactate dehydrogenase; PDH, pyruvate dehydrogenase; PC, pyruvate carboxylase.

Tech et al.





allele that induces tumors more slowly. In contrast to the anti-tumor effect ofHk2deletion, we found that Pkm2 deletion did notslow tumor progression in Math1-Cre;SmoM2;Pkm2fl/null mice

(Fig. 7A) or hGFAP-cre;SmoM2;Pkm2fl/null mice (data not shown)compared with Pkm2-intact, littermate controls. In both of thesemodels, however, rapid tumor growth limits the ability to

Figure 7.

Pkm2 deletion acceleratesmedulloblastoma tumorigenesis.A–D,Kaplan–Meier curves demonstrate the effect ofPkm2 deletion on survival in the rapidly progressiveMath1-Cre;SmoM2 model (A) and the slow-growing ND2:SmoA1 model (B), including ND2:SmoA1 mice with conditional (C) or global Pkm2 deletion (D).E and F, A representative P147 Pkm2-deleted ND2:SmoA1 medulloblastoma shows PKM1 (brown) in normal brain (E-E0 00) and absence of PKM2 (brown; F-F00).G, Comparison of premalignant lesions at P60 and P120 between genotypes. The proportion of PCNAþ/total cells in the cerebellum increases over time inthe Pkm2-deleted genotypes. H, Kaplan–Meier curve demonstrates a trend toward shorter survival in SHH medulloblastoma patients with low PKM2 expression.P values determined by log-rank test (A–D), Cox proportional hazard model (H), and by Student t test (G). Scale bars, 2 mm (E and F); 100 mm (E0-E0 00 and F0-F0 00).






determine whether PKM2 ablation accelerates disease. To addressthis question, we examined Pkm2 deletion in ND2:SmoA1 mice.

ND2:SmoA1mice with Pkm2 deletion developed tumors morefrequently than Pkm2-intact ND2:SmoA1 controls. We comparedND2:SmoA1 mice with two mutant copies of Pkm2, includingMath1-Cre;ND2:SmoA1;Pkm2fl/fl, Math1-Cre;ND2:SmoA1;Pkm2fl/null,andND2:SmoA1;Pkm2null/null genotypes to controlND2:SmoA1micewith two intact copies of Pkm2, including no-Cre;ND2:SmoA1;Pkm2þ/þ, no-Cre;ND2:SmoA1;Pkm2fl/þ, and Math1-Cre;ND2:SmoA1;Pkm2þ/þ genotypes. We observed a trend toward increasedtumor formation in Pkm2–deleted mice at P150, where theincidence was 37.5% with Pkm2 deletion versus 15.8% for controls(P ¼ 0.245, Fisher exact test). By 300, tumor incidence was 100%in Pkm2-deleted mice versus 57.9% for controls (P ¼ 0.004,Fisher exact test). Consistently, ND2:SmoA1 mice with Pkm2 dele-tion demonstrated significantly shorter progression-free survival(Fig. 7B).

To determine whether Pkm2 deletion accelerated tumor growththrough a cell-autonomous process, we separately compared theMath1-Cre;ND2:SmoA1;Pkm2fl/null and ND2:SmoA1;Pkm2null/null

subgroups to Pkm2-intactND2:SmoA1 controls. This analysis alsoshowed significantly shorter survival for both Math1-Cre;ND2:SmoA1;Pkm2fl/null (Fig. 7C) and ND2:SmoA1;Pkm2null/null geno-types (Fig. 7D). We found no statistically significant differencebetween different Pkm2-deleted genotypes. Thus, the acceleratingeffect of Pkm2 deletion on SmoA1-driven tumorigenesis was cellautonomous.

Like Pkm2-deleted CGNPs, Pkm2-deleted medulloblastomacells expressed neither PKM2 (Fig. 7E) or PKM1 (Fig. 7F).However, we noted scattered PKM1þ cells within Pkm2-deletedtumors (Fig. 7E00 0). These cells were consistently PCNA– (Sup-plementary Fig. S4) and were also found in Pkm2-intact tumors.These nonproliferative, PKM1þ cells may be entrapped neuronsor differentiated progeny of tumor cells. Similar PKM1þ stro-mal cells were previously observed in Pkm2-deleted breasttumors (32).

The slow process of tumor formation in ND2:SmoA1 miceallowed us to analyze the effect of Pkm2 deletion on the growthof premalignant lesions. We counted PCNAþ cells in cerebellaof ND2:SmoA1 mice with deleted or intact Pkm2, harvested ateither P60 or P120 and normalized the number of PCNAþ cellsto the total number of cells in each cerebellar section (Fig. 7G).In controls, the median fraction of PCNAþ cells in the cere-bellum and the range of these values decreased over time,consistent with a dynamic balance between growth and growthsuppression. In contrast, in Pkm2-deleted genotypes, the medi-an and range of PCNAþ fractions increased over time, consis-tent with reduced growth suppression during the premalignantperiod. Altogether, Pkm2 deletion increased SHH-driven CGNPproliferation during development, accelerated tumorigenesis inpremalignant lesions in Smo-mutant mice, and increased theincidence of tumor formation from these lesions.

The more rapid progression of mouse tumors with Pkm2deletion was mirrored by a trend toward shorter survival inmedulloblastoma patients with low PKM2 expression. We clas-sified SHH-subgroup medulloblastoma patients as having eitherhigh or lowPKM2–expressing tumors and compared their clinicaloutcomes. All patients were treated similarly with radiation andchemotherapy. While not statistically significant, we found thatpatients with low PKM2 expression trended toward shorter sur-vival times (Fig. 7H). Together, these data confirm that PKM2 is

not essential for tumor progression and suggest that low PKM2expression, like Pkm2 deletion, enhances medulloblastomatumor growth.

DiscussionWe analyzed the functional significance of pyruvate kinase

isoform expression in the developing brain and in medullo-blastoma. While aerobic glycolysis has been associated withproliferation in both development (5, 44) and cancer (1, 2),our data show that disrupting glycolysis at PK increases, ratherthan decreases both developmental proliferation and tumori-genesis. We show that within the neural lineage, Pkm is splicedinto mutually exclusive expression patterns that correlate PKactivity with differentiation state. In the postnatal brain, undif-ferentiated progenitors in the cerebellum, hippocampus, andSVZ expressed the less active PKM2 isoform, while differenti-ated neurons expressed the more active PKM1. The correlationof PKM2 with the undifferentiated state was maintained inmedulloblastoma. The PKM1:PKM2 dichotomy persisted afterconditional or germline deletion of Pkm2, which increasedPKM1 in differentiated cells but not in progenitors. The lackof compensatory upregulation of PKM1 in brain progenitorscontrasts with prior observations in MEFs and other tissues,where PKM1 expression increases on Pkm exon 10 deletion(31, 45). In Pkm2-deleted MEFs, increased PKM1 caused nucle-otide scarcity and cell-cycle arrest. However, Pkm2cKO CGNPsexpressed neither PKM isoform, showed decreased conversionof glucose to lactate and increased proliferation. Pkm2 deletionalso enhanced the growth of premalignant lesions and tumorsin ND2:SmoA1 mice. These findings demonstrate that theabsence of detectable PKM2 in Pkm2cKOmice increased devel-opmental proliferation and neural progenitor susceptibility totumorigenesis.

The different effects of Pkm2 deletion in CGNPs and MEFsargue that proliferation is restricted by PKM1, rather thanenhanced by PKM2. We propose that high PK activity inhibitsSHH-driven proliferation and suppresses tumor formation.Consistent with this model, splicing Pkm to PKM2 has apermissive effect on proliferation and abrogating PKM expres-sion is more permissive. The finding that SHH/IGFR cosignal-ing increased CGNP PK activity is not necessarily inconsistentwith this model as growth factors are known to induce simul-taneously both positive and negative regulation of proliferationin primary cells. For example, SHH activation induces Patched(Ptc) expression in CGNPs, which negatively regulates SHHsignaling (46, 47). Activating PKM2may be a similar inhibitoryelement within the normal regulation of SHH-induced growthin primary cells.

Our prior Hk2 deletion studies demonstrate that the initia-tion of glycolysis supports postnatal neurogenesis and sustainsthe malignant growth of medulloblastomas. In contrast, ourcurrent studies of Pkm2 deletion show that impeding the flowof glucose to lactate increases CGNP proliferation and accel-erates medulloblastoma tumorigenesis. Together, these dele-tion studies show that the pathways through which glucose ismetabolized significantly influence the proliferative behaviorof undifferentiated cells. The divergent effects of Hk2 deletionversus Pkm2 deletion establish the glycolytic steps upstream ofPK as critical to supporting the proliferative phenotype ofneural progenitors and cognate tumors.

Tech et al.





Between the reactions catalyzed by HK2 and PKM2 are severalreversible reactions that permit glycolytic intermediates to beshunted toward biosynthetic processes. We and others havepreviously proposed that low flow downstream of PEP, achievedby preferentially splicing PKM to generate PKM2, may supportgrowth by diverting glycolytic intermediates away from lactategeneration and toward the synthesis of macromolecules (2, 48,49). However, evidence for decreased lactate and increased anab-olism with Pkm2 deletion was lacking in Pkm2-deleted breasttumors (32) and MEFs (45). Recent work found that the directincorporation of glucose carbons is a minor component of thebiomass of proliferating cancer cells (50). Working with primaryneural progenitors limited the amount of material for analysisand thus the range of metabolites we could detect. However, wewere able to detect 13C in extracellular lactate and in intracellularglutamate and ribose. Pkm2 deletion decreased the incorporationof glucose into lactate and glutamate, suggesting that that alteringPEP metabolism redirects glucose carbons to different metabolicfates. Pkm2 deletion did not produce a detectable effect on theincorporation of glucose into ribose, suggesting that PPP flux isnot themajor destination of glucose carbons redirected by low PKactivity.

Our 13C studies show that CGNPs lacking both PKM1 andPKM2 canmetabolize glucose to pyruvate, raising the question ofwhat alternative pathway metabolizes PEP. We were not able todetect changes in glycolytic intermediates thatmight indicate howPEP is processed in Pkm2cKO CGNPs. However, prior studies haveshown that PKM2-expressing cells with low PK activity cangenerate pyruvate by transferring the high-energy phosphate ofPEP to the enzyme PGAM1 (51). This phosphorylation activatesPGAM1, which may promote biosynthetic metabolism (52). IfPEP-PGAM1 phosphotransfer occurs in CGNPs, it may mediatethe growth-promoting effect of PKM2 splicing that is enhanced byPkm2 deletion.

Our work suggests that Pkm functions as a tumor suppressor.Identifying Pkm as a tumor suppressor has profound implicationsfor aerobic glycolysis and may be effectively targeted in cancertreatment. Inhibiting PKM function as an anticancer therapywould be counterproductive while drugs that increase PKM cat-alytic activity may be of limited therapeutic value if tumors canthrive with low PKM expression. The loss of tumor suppressorgenes, however, may be targeted through alternative approachesthat require defining the consequent changes in pathway regula-

tion (53, 54). A detailed understanding of how low PK activitypromotes proliferation may produce novel clinical strategies totreat tumor growth.

Disclosure of Potential Conflicts of InterestM.G. Vander Heiden has ownership interest (including patents) in Agios

Pharmaceuticals and is a consultant/advisory board member for Agios Phar-maceuticals and Aeglea Biotherapeutics. No potential conflicts of interest weredisclosed by the other authors.

Authors' ContributionsConception and design: K. Tech, A.P. Tikunov, M.G. Vander Heiden,T.R. GershonDevelopment of methodology: K. Tech, A.P. Tikunov, J. MacDonald,T.R. GershonAcquisition of data (provided animals, acquired and managed patients, pro-vided facilities, etc.): K. Tech, A.P. Tikunov, J. Meidinger, T. Fish, A.J. Mungall,R.A. Moore, S.J.M. Jones, M.A. Marra, M.D. Taylor, J. MacDonaldAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): K. Tech, A.P. Tikunov, H. Farooq, A.S. Morrissy,T. Fish, S.C. Green, Y. Li, Y. Ma, S.J.M. Jones, M.D. Taylor, J. MacDonald,T.R. GershonWriting, review, and/or revision of the manuscript: K. Tech, A.P. Tikunov,H. Farooq, T.R. GershonAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): K. Tech, J. Meidinger, H. Liu, Y. LiStudy supervision: K. Tech, T.R. GershonOther (provided unpublished (at the time) animals and had numerousdiscussions regarding data interpretation): M.G. Vander Heiden

AcknowledgmentsWe thank the UNC CGBID Histology Core, the UNC Tissue Pathology

Laboratory Core and UNC UCRF, and the UNC Neuroscience Center Confocaland Multiphoton Imaging facilities for providing expertise in immunohis-tochemistry and confocal imaging.

Grant SupportUNCCGBIDHistology Corewas supported by P30DK034987 and theUNC

Tissue Pathology Laboratory Core was supported by NCI CA016086. K. Tech,J.M. Macdonald, and T.R. Gershon were supported by the National Institute ofNeurologic Disorder and Stroke (R01NS088219). K. Tech and T.R. Gershonwere supported by the American Institute for Cancer Research.

The costs of publication of this article were defrayed in part by the paymentof page charges. This article must therefore be hereby marked advertisementin accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received December 15, 2016; revised February 20, 2017; accepted April 18,2017; published OnlineFirst May 17, 2017.

References1. Warburg O. On the origin of cancer cells. Science 1956;123:309–14.2. Lunt SY, Vander Heiden MG. Aerobic glycolysis: meeting the metabolic

requirements of cell proliferation. Annu Rev Cell Dev Biol 2011;27:441–64.

3. Hatten ME, Rifkin DB, Furie MB, Mason CA, Liem RK. Biochemistry ofgranule cell migration in developingmouse cerebellum. Prog Clin Biol Res1982;85:509–19.

4. Hatten ME, Alder J, Zimmerman K, Heintz N. Genes involved in cerebellarcell specification and differentiation. Curr Opin Neurobiol 1997;7:40–7.

5. Gershon TR, Crowther AJ, Tikunov A, Garcia I, Annis R, Yuan H, et al.Hexokinase-2-mediated aerobic glycolysis is integral to cerebellar neu-rogenesis and pathogenesis of medulloblastoma. Cancer Metab 2013;1:1–17.

6. Marino S. Medulloblastoma: developmental mechanisms out of control.Trends Mol Med 2005;11:17–22.

7. Roussel MF, HattenME. Cerebellum: development andmedulloblastoma.Curr Top Dev Biol 2011;94:235–82.

8. Bhatia B, Potts CR, Guldal C, Choi S, Korshunov A, Pfister S, et al.Hedgehog-mediated regulation of PPARg controls metabolic patterns inneural precursors and shh-driven medulloblastoma. Acta Neuropathol2012;123:587–600.

9. Dahmane N, Ruiz i Altaba A. Sonic hedgehog regulates the growth andpatterning of the cerebellum. Development 1999;126:3089–100.

10. Wechsler-Reya RJ, Scott MP. Control of neuronal precursor pro-liferation in the cerebellum by sonic hedgehog. Neuron 1999;22:103–14.

11. Kenney AM, Rowitch DH. Sonic hedgehog promotes G1 cyclin expressionand sustained cell cycle progression in mammalian neuronal precursors.Mol Cell Biol 2000;20:9055–67.

12. KoolM, Korshunov A, RemkeM, Jones DTW, SchlansteinM,Northcott PA,et al. Molecular subgroups of medulloblastoma: an international meta-analysis of transcriptome, genetic aberrations, and clinical data of WNT,SHH, Group 3, and Group 4 medulloblastomas. Acta Neuropathol 2012;123:473–84.






13. Northcott PA, Korshunov A,Witt H,Hielscher T, Eberhart CG,Mack S, et al.Medulloblastoma comprises four distinct molecular variants. J Clin Oncol2011;29:1408–14.

14. Hallahan AR, Pritchard JI, Hansen S, Benson M, Stoeck J, Hatton BA, et al.The SmoA1 mouse model reveals that Notch signaling is critical for thegrowth and survival of sonic hedgehog-induced medulloblastomas.Cancer Res 2004;21:7794–800.

15. Mao J, Ligon KL, Rakhlin EY, Thayer SP, Bronson RT, Rowitch D, et al. Anovel somaticmousemodel to survey tumorigenic potential applied to thehedgehog pathway. Cancer Res 2006;66:10171–8.

16. Lin H, Zeng J, Xie R, Schulz MJ, Tedesco R, Qu J, et al. Discovery of a novel2,6-disubstituted glucosamine series of potent and selective hexokinase 2inhibitors. ACS Med Chem Lett 2016;7:217–22.

17. Lehninger AL. Lehninger principles of biochemistry. 4th ed. Nelson DL,Cox MM, editors. New York, NY: W.H. Freeman; 2005.

18. Imamura K, Tanaka T. Multimolecular forms of pyruvate kinase from ratand other mammalian tissues. J Biochem 1972;71:1043–51.

19. Noguchi T, Inoue H, Tanaka T. The M1- and M2-type isozymes of ratpyruvate kinase are produced from the same gene by alternative RNAsplicing. J Biol Chem 1986;261:13807–12.

20. Varghese B, Swaminathan G, Plotnikov A, Tzimas C, Yang N, Rui H, et al.Prolactin inhibits activity of pyruvate kinase M2 to stimulate cell prolif-eration. Mol Endocrinol 2010;24:2356–65.

21. Christofk HR, Vander Heiden MG, Wu N, Asara JM, Cantley LC. PyruvatekinaseM2 is a phosphotyrosine-binding protein. Nature 2008;452:181–8.

22. Anastasiou D, Yu Y, Israelsen WJ, Jiang J-K, Boxer MB, Hong BS, et al.Pyruvate kinase M2 activators promote tetramer formation and suppresstumorigenesis. Nat Chem Biol 2012;8:839–47.

23. Ikeda Y, Noguchi T. Allosteric regulation of pyruvate kinase M2 isozymeinvolves a cysteine residue in the intersubunit contact. J Biol Chem1998;273:12227–33.

24. Ashizawa K, Willingham MC, Liang CM, Cheng SY. In vivo regulation ofmonomer-tetramer conversionof pyruvate kinase subtypeM2by glucose ismediated via fructose 1,6-bisphosphate. J Biol Chem 1991;266:16842–6.

25. Hitosugi T, Kang S, Vander Heiden MG, Chung T-W, Elf S, Lythgoe K, et al.Tyrosine phosphorylation inhibits PKM2 to promote the Warburg effectand tumor growth. Sci Signal 2009;2:1–8.

26. ChristofkHR, VanderHeidenMG,HarrisMH,RamanathanA,GersztenRE,Wei R, et al. The M2 splice isoform of pyruvate kinase is important forcancer metabolism and tumour growth. Nature 2008;452:230–4.

27. Gao X, Wang H, Yang JJ, Liu X, Liu Z-R. Pyruvate kinase M2 regulates genetranscription by acting as a protein kinase. Mol Cell 2012;45:598–609.

28. Yang W, Xia Y, Ji H, Zheng Y, Liang J, Huang W, et al. Nuclear PkM2regulates beta-catenin transactivation upon EGFR activation. Nature2011;480:118–22.

29. Yang W, Xia Y, Hawke D, Li X, Liang J, Xing D, et al. PKM2 phosphorylateshistone H3 and promotes gene transcription and tumorigenesis. Cell2012;150:685–96.

30. Ignacak J, StachurskaMB. The dual activity of pyruvate kinase typeM2 fromchromatin extracts of neoplastic cells. Comp Biochem Physiol B BiochemMol Biol 2003;134:425–33.

31. Dayton TL, Gocheva V, Miller KM, Israelsen WJ, Bhutkar A, Clish CB, et al.Germline loss of PKM2 promotes metabolic distress and hepatocellularcarcinoma. Genes Dev 2016;30:1020–33.

32. Israelsen WJ, Dayton TL, Davidson SM, Fiske BP, Hosios AM, Bellinger G,et al. PKM2 isoform-specific deletion reveals a differential requirement forpyruvate kinase in tumor cells. Cell 2013;155:397–409.

33. Staal JA, Lau LS, Zhang H, Ingram WJ, Hallahan AR, Northcott PA, et al.Proteomic profiling of high risk medulloblastoma reveals functionalbiology. Oncotarget 2015;6:14584–95.

34. KenneyAM,ColeMD,RowitchDH.Nmycupregulationby sonic hedgehogsignaling promotes proliferation in developing cerebellar granule neuronprecursors. Development 2003;130:15–28.

35. Garcia I, Crowther AJ, Gama V, Miller CR, Deshmukh M, Gershon TR. Baxdeficiency prolongs cerebellar neurogenesis, accelerates medulloblastomaformation and paradoxically increases both malignancy and differentia-tion. Oncogene 2013;32:2304–14.

36. Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seqdata with or without a reference genome. BMC Bioinformatics 2011;12:323.

37. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR:Ultrafast universal RNA-seq aligner. Bioinformatics 2013;29:15–21.

38. Rubin LL, de Sauvage FJ. Targeting the Hedgehog pathway in cancer. NatRev Drug Discov 2006;5:1026–33.

39. Salani B, Ravera S, Amaro A, Salis A, Passalacqua M, Millo E, et al. IGF1regulates PKM2 function through Akt phosphorylation. Cell Cycle2015;14:1559–67.

40. Iqbal MA, Siddiqui FA, Gupta V, Chattopadhyay S, Gopinath P, KumarB, et al. Insulin enhances metabolic capacities of cancer cells by dualregulation of glycolytic enzyme pyruvate kinase M2. Mol Cancer2013;12:72–83.

41. Dudek H, Datta SR, Franke TF, Segal RA, Kaplan DR, Greenberg ME.Regulation of neuronal survival by the serine-threonine protein kinaseAkt. Science 1997;275:661–5.

42. Helms AW, Abney AL, Ben-Arie N, Zoghbi HY, Johnson JE. Autoregulationand multiple enhancers control Math1 expression in the developingnervous system. Development 2000;127:1185–96.

43. Machold R, Fishell G. Math1 is expressed in temporally discrete pools ofcerebellar rhombic-lip neural progenitors. Neuron 2005;48:17–24.

44. Goyal MS, Hawrylycz M, Miller JA, Snyder AZ, Raichle ME. Aerobicglycolysis in the human brain is associated with development and neote-nous gene expression. Cell Metab 2014;19:49–57.

45. Lunt SY,Muralidhar V,Hosios AM, IsraelsenWJ,GuiDY,Newhouse L, et al.Pyruvate kinase isoform expression alters nucleotide synthesis to impactcell proliferation. Mol Cell 2015;57:95–107.

46. Johnson RL, Grenier JK, Scott MP. Patched overexpression alters wing discsize and pattern: transcriptional and post-transcriptional effects on hedge-hog targets. Development 1995;121:4161–70.

47. Goodrich LV, Jung D, Higgins KM, Scott MP. Overexpression of ptc1inhibits induction of Shh target genes and prevents normal patterning inthe neural tube. Dev Biol 1999;211:323–34.

48. Eigenbrodt R, Reinacher M, Scheefers-Borchel U, Scheefers H, Friss R.Double role for pyruvate kinase type M2 in the expansion of phospho-metabolite pools found in tumor cells. Crit Rev Oncog 1992;3:91–115.

49. Tech K, Deshmukh M, Gershon TR. Adaptations of energy metabolismduring cerebellar neurogenesis are co-opted in medulloblastoma. CancerLett 2014;356:268–72.

50. Hosios AM, Hecht VC, Danai LV, Johnson MO, Rathmell JC, SteinhauserML, et al. Amino acids rather than glucose account for the majority of cellmass in proliferating mammalian cells. Dev Cell 2016;36:540–9.

51. Vander Heiden MG, Locasale JW, Swanson KD, Sharfi H, Heffron GJ,Amador-Noguez D, et al. Evidence for an alternative glycolytic pathway inrapidly proliferating cells. Science 2010;329:1492–9.

52. Hitosugi T, Zhou L, Elf S, Fan J, Kang H-B, Seo JH, et al. Phosphoglyceratemutase 1 coordinates glycolysis and biosynthesis to promote tumorgrowth. Cancer Cell 2012;22:585–600.

53. Morris LGT, Chan TA. Therapeutic targeting of tumor suppressor genes.Cancer 2015;121:1357–68.

54. Liu Y, Hu X, Han C, Wang L, Zhang X, He X, et al. Targeting tumorsuppressor genes for cancer therapy. BioEssays 2015;37:1277–86.


Tech et al.




2017;77:3217-3230. Published OnlineFirst May 17, 2017.Cancer Res Katherine Tech, Andrey P. Tikunov, Hamza Farooq, et al. Neurogenesis and Suppresses Medulloblastoma FormationPyruvate Kinase Inhibits Proliferation during Postnatal Cerebellar

Updated version

10.1158/0008-5472.CAN-16-3304doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2017/06/07/0008-5472.CAN-16-3304.DC3 http://cancerres.aacrjournals.org/content/suppl/2017/05/13/0008-5472.CAN-16-3304.DC1 http://cancerres.aacrjournals.org/content/suppl/2017/05/17/0008-5472.CAN-16-3304.DC2

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/77/12/3217.full#ref-list-1

This article cites 53 articles, 14 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/77/12/3217.full#related-urls

This article has been cited by 7 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/77/12/3217To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-16-3304

http://cancerres.aacrjournals.org/content/suppl/2017/05/17/0008-5472.CAN-16-3304.DC2



http://cancerres.aacrjournals.org/content/77/12/3217.full#ref-list-1

http://cancerres.aacrjournals.org/content/77/12/3217.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/77/12/3217


Documents

Pyruvate Kinase Inhibits Proliferation during Postnatal ...glycolysis supports CGNP proliferation and medulloblastoma tumorigenesis is essential for designing metabolically directed