Race profiling of Fusarium.pdf

Indian Agricultural Research Institute, New Delhi, India

Race Profiling and Molecular Diversity Analysis of Fusarium oxysporum f.sp.ciceris Causing Wilt in Chickpea

Sunil C. Dubey, Kumari Priyanka, Vivek Singh and Birendra Singh

Authors address: Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi, 110012, India(correspondence to Sunil C. Dubey. E-mail: [email protected])

Received January 7, 2012; accepted July 1, 2012

Keywords: races, differential cultivars, genetic diversity, universal rice primers, intersimple sequence repeats, simple sequencerepeats, random amplified polymorphic DNA, Fusarium oxysporum f.sp. ciceris

Abstract

Seventy isolates of Fusarium oxysporum f.sp. ciceris (Foc)causing chickpea wilt representing 13 states and fourcrop cultivation zones of India were analysed for theirvirulence and genetic diversity. The isolates of the patho-gen showed high variability in causing wilt incidence on anew set of differential cultivars of chickpea, namelyC104, JG74, CPS1, BG212, WR315, KWR108, GPF2,DCP92-3, Chaffa and JG62. New differential cultivarsfor each race were identified, and based on differentialresponses, the isolates were characterized into eight racesof the pathogen. The same set of isolates was used formolecular characterization with four different molecularmarkers, namely random amplified polymorphic DNA,universal rice primers, simple sequence repeats and inter-simple sequence repeats. All the four sets of markers gave100% polymorphism. Unweighted paired group methodwith arithmetic average analysis grouped the isolates intoeight categories at genetic similarities ranging from 37 to40%. The molecular groups partially corresponded tothe states of origin/chickpea-growing region of the iso-lates as well as races of the pathogen characterized in thisstudy. The majority of southern, northern and centralIndian populations representing specific races of thepathogen were grouped separately into distinct clustersalong with some other isolates, indicating the existence ofvariability in population predominated by a single raceof the pathogen. The present race profiling for theIndian population of the pathogen and its distributionpattern is entirely new. The knowledge generated in thisstudy could be utilized in resistance breeding pro-gramme. The existence of more than one race, predomi-nated by a single one, in a chickpea cultivation zone assupported by the present molecular findings is also a newinformation.

IntroductionChickpea (Cicer arietinum L.) is one of the mostimportant pulse crops cultivated in tropical and

temperate regions. Low yield of chickpea is attributedto its susceptibility to several fungal, bacterial andviral diseases (Dubey and Singh 2008). Among thediseases, the wilt caused by Fusarium oxysporum f.sp.ciceris (Padwick) Matuo and K. Sato (Foc) is animportant reason for major productivity loss in chick-pea worldwide (Haware and Nene 1982). The lossescaused by early wilting range from 77 to 94%, whilethe losses caused by late wilting range from 24 to 65%(Haware and Nene 1980). The disease has beenreported from all the chickpea-growing states of India.Its incidence varies from 14.1 to 32.0% (Dubey et al.2010a) and causes an annual loss of 10% (Singh andDahiya 1973).The cultivation of resistant varieties is one of the

most prudent and cost-effective practices availablefor the management of Fusarium wilt, but thesevarieties do not perform satisfactory in differentlocations (Jimenez-Gasco et al. 2004b) because oftheir high pathogenic variability that limits the effec-tiveness of their resistance (Jimenez-Diaz et al. 1993).Eight races of the pathogen (races 0, 1A, 1B/C, 2,3, 4, 5 and 6) were identified by their reaction on aset of differential chickpea cultivars (Haware andNene 1982; Jimenez-Diaz et al. 1993). All these raceshave distinct geographic distribution. Races 1, 2, 3and 4 were reported only from India, while races 0,1B/C, 5 and 6 were reported from the Mediterra-nean region and the USA, thus showing area-specificdistribution patterns. Honnareddy and Dubey (2006)established three new races of the pathogen in Indiabased on their reactions on a set of differential culti-vars used by earlier workers (Haware and Nene1982; Jimenez-Gasco et al. 2001). Further, based onthe reactions of 64 isolates of Foc representing fivestates of India on a set of earlier differentials, mostof which did not match with the race-specific reac-tions, it was suggested that the chickpea cultivarsnamely KWR108, GPF2 and DCP92-3 that had

J Phytopathol 160:576587 (2012) doi: 10.1111/j.1439-0434.2012.01954.x 2012 Blackwell Verlag GmbH

shown clear-cut differential reactions for the Indianpopulations of Foc should be incorporated into theearlier reported set of differentials (Dubey and Singh2008; Dubey et al. 2010a). Therefore, in the presentstudy, the virulence was tested on a new set ofdifferential cultivars standardized by Dubey andSingh (2008) so as to obtain clear-cut differentialresponses to Foc isolates.The molecular markers such as random amplified

polymorphic DNA (RAPD) (Jimenez-Gasco et al.2001; Sivaramakrishnan et al. 2002; Honnareddy andDubey 2006; Singh et al. 2006; Dubey and Singh2008), RFLP (Barve et al. 2001; Sharma et al. 2009),amplified fragment length polymorphism (AFLP)(Sivaramakrishnan et al. 2002), intersimple sequencerepeats (ISSR) (Barve et al. 2001; Dubey and Singh2008) and simple sequence repeats (SSR) (Dubey andSingh 2008) have been used to determine the variabil-ity of Foc. RAPD analysis has been applied widely inthe detection and genetic characterization of phyto-pathogenic fungi (Benali et al. 2011), including racedifferentiation in several formae speciales of F. oxy-sporum, that is, f.sp. cubense (Bentley et al. 1994),dianthi (Migheli et al. 1998), pisi (Grajal-Martin et al.1993) and vasinfectum (Assigbetse et al. 1994).Recently, Dubey et al. (2010b) developed ITS region-based markers for the detection of Indian isolates ofFoc. Universal rice primers (URPs) have been used tofingerprint diverse genomes and to determine thegenetic variability of plant pathogenic fungi (Kanget al. 2002; Sharma et al. 2005; Aggarwal et al. 2010).Therefore, URPs were also selected for studying themolecular diversity of Foc along with other molecularmarkers such as RAPD, ISSR and SSR. Earlier,Dubey and Singh (2008) analysed 64 isolates of Focby using RAPD, ISSR and SSR markers. But the iso-lates did not represent the entire Indian pathogenicpopulations, as they were collected only from fivechickpea-growing states. However, in the presentstudy, 70 isolates of Foc representing pathogenic andmorphological groups of 640 isolates (Dhar 2008;Dubey et al. 2010a) were taken from almost all themajor 13 chickpea-growing states of India. Earlierworkers did not analyse the virulence of the isolateson a set of differentials used for molecular character-ization. Instead, they simply correlated the moleculargroups with the virulence information available in theliterature (Haware and Nene 1982; Jimenez-Diaz et al.1993), which was supported by the area-specific distri-bution of the races. Therefore, in the present study,the isolates representing area and morphological groupfor the entire country were used for molecular charac-terization as well as for virulence study on a new setof differential cultivars.The aim of the present study was to analyse the

virulence of Foc isolates representing various states/agroecological regions of India on a new set of chick-pea differentials to determine the prevalence of variousraces and their diversity by using RAPD, URP, ISSRand SSR markers.

Materials and MethodsFungal cultures

Single-spore cultures of 70 isolates of Foc representing13 states (Fig. 1) and four pulse-growing agroecologi-cal zones, namely North-Eastern Plains Zone (NEPZ),North-West Plains Zone (NWPZ), Central Zone (CZ)and South Zone (SZ) of India, were selected for thepresent study (Table 1). These isolates are representa-tive populations of 640 isolates of Foc and have beencharacterized for their morphological features as wellas for pathogenicity (Dhar 2008; Dubey and Singh2008; Dubey et al. 2010a). The isolates were main-tained at 4C on potato dextrose agar.

Virulence analysis

The virulence of 70 representative isolates of the path-ogen was tested on a new set of 10 differential culti-vars of chickpea, namely C104, JG74, CPS1, BG212,WR315, KWR108, GPF2, DCP92-3, Chaffa andJG62, in a net house during the winter seasons of 20092010 and 20102011 as per the procedure describedby Dubey and Singh (2008). The first seven cultivarswere from the old set of international differentials(Haware and Nene 1982), and the remaining threewere new chickpea cultivars added in place of K850,L550 and Annigeri as suggested earlier (Dubey andSingh 2008; Dubey et al. 2010a).

DNA extraction

DNA was extracted from the single-spore pure cul-tures of Foc isolates multiplied in potato dextrosebroth (20g/l; Hi-media) at 25 1C on a shakingincubator (120 rpm) for 7 days by using cetyltrimethyl ammonium bromide (CTAB) method

Fig. 1 Map of India showing states of collection of isolates of Fusa-rium oxysporum f.sp. ciceris. The values given in the parentheses areindicating number of isolates

Races and Diversity in Fusarium oxysporum f.sp. ciceris 577

(Murray and Thompson 1980). The DNA was dis-solved in TE (10 mM Trishydrochloric acid and 1 mMsodium EDTA, pH 8) and stored at 20C. Thequality and quantity of DNA were estimated byspectrophotometer.

RAPD, URP, SSR and ISSR analyses

Four different molecular markers, namely RAPD (20),URPs (12), SSR (4) and ISSR (13), were used to deter-mine the genetic diversity within the Indian popula-tions of Foc (70 isolates) originating from 13 statesrepresenting four chickpea-growing regions, namelyNWPZ, NEPZ, CZ and SZ. Various concentrations oftemplate DNA (25, 50 and 75 ng), MgCl2 (1.5, 2.5 and3.5 mM), dNTPs (0.2, 0.4 and 0.6 mM) and primers (5,10 and 15 pmol) were tested for best amplificationaccording to the method described by Cobb and Clark-son (1994). The PCR mixture (25 ll) for RAPD andURP consisted of 50 ng template DNA, 1.0 U Taqpolymerase, 2.5 mM MgCl2, 0.6 mM of each dNTP and10 pmol of primer in 1x reaction buffer (BangaloreGenei, India). Similar PCR mixture was used for SSRand ISSR with 0.2 mM of each dNTP and 18 pmol pri-mer. The 75 ng template DNA for ISSR and 1.5 mMMgCl2 for SSR were used in the mixture. The PCRwas performed by using gradient thermal cycler (Ep-pendorf epTM, Hamburg, Germany) at 94C for 5 minfor initial denaturation followed by 40 cycles (RAPD)/35 cycles (URP) at 94C for 1-min denaturation, 35C

Table 1The details of the isolates of zusarium oxysporum f.sp. ciceris used inthe present study

S.No. States

Place ofcollection/District

Pulse growingagroecological

zonesAccession

no.

1 AndhraPradesh

ICRISAT,Hyderabad

SZ Foc 118

2 AndhraPradesh

DOR,Hyderabad

SZ Foc 168

3 AndhraPradesh

Hyderabad SZ Foc 169

4 AndhraPradesh

Guntur SZ Foc 143

5 AndhraPradesh

Nilore SZ Foc 144

6 Chhattisgarh Bilaspur CZ Foc 1277 Chhattisgarh Bilaspur CZ Foc 1628 Chhattisgarh Raipur CZ Foc 1619 Delhi IARI New

DelhiNWPZ Foc 53

10 Delhi IARI NewDelhi

NWPZ Foc 108

11 Gujarat Anand CZ Foc 12312 Gujarat Anand CZ Foc 16313 Gujarat Junagarh CZ Foc 12214 Gujarat Porbander CZ Foc 16415 Haryana Hisar NWPZ Foc 4116 Haryana Rohtak NWPZ Foc 6617 Haryana Sikohpur NWPZ Foc 3318 Jharkhand Dumka NEPZ Foc 2319 Jharkhand Darisi NEPZ Foc 10020 Jharkhand Ranchi NEPZ Foc 2821 Jharkhand Ranchi NEPZ Foc 4622 Jharkhand Ranchi NEPZ Foc 9723 Jharkhand Ranchi NEPZ Foc 9824 Karnataka Bangalore SZ Foc 12625 Karnataka Dharwad SZ Foc 12126 Karnataka Dharwad SZ Foc 15227 Karnataka Gulberga SZ Foc 15028 Karnataka Simoga SZ Foc 15129 Karnataka Raichur SZ Foc 14830 Andhra-

PradeshWarangal SZ Foc 149

31 MadhyaPradesh

Jabalpur CZ Foc 155

32 MadhyaPradesh

Indore CZ Foc 156

33 MadhyaPradesh

Rewa CZ Foc 157

34 MadhyaPradesh

Sehore CZ Foc 158

35 MadhyaPradesh

Narsingpur CZ Foc 153

36 MadhyaPradesh

Teekamgarh CZ Foc 160

37 MadhyaPradesh

Jabalpur CZ Foc 170

38 Maharashtra Badnapur CZ Foc 12439 Maharashtra Badnapur CZ Foc 17140 Maharashtra Satara CZ Foc 12841 Maharashtra Amarawati CZ Foc 16542 Maharashtra Dhule CZ Foc 16643 Punjab Faridpur NWPZ Foc 1944 Punjab Firojpur NWPZ Foc 3145 Punjab Ludhiana NWPZ Foc 4546 Punjab Ropar NWPZ Foc 6247 Punjab Dumewal NWPZ Foc 8948 Punjab Gurdaspur NWPZ Foc 9349 Punjab Abohar NWPZ Foc 1850 Rajasthan Jaipur NWPZ Foc 451 Rajasthan Jaipur NWPZ Foc 652 Rajasthan Alwar NWPZ Foc 1153 Rajasthan Udaipur NWPZ Foc 50

Table 1Continued

S.No. States

Place ofcollection/District

Pulse growingagroecological

zonesAccession

no.

54 Rajasthan Sriganganagar NWPZ Foc 6855 Rajasthan Hanumangarh NWPZ Foc 8056 Rajasthan Churu NWPZ Foc 8757 Rajasthan Sikar NWPZ Foc 3658 Rajasthan Suratgarh NWPZ Foc 5859 Rajasthan Jetsar NWPZ Foc 7960 Uttar

PradeshIIPR Kanpur NEPZ Foc 119

61 UttarPradesh

Jhansi NEPZ Foc 129

62 UttarPradesh

Gorakhpur NEPZ Foc 130

63 UttarPradesh

Shahjahanpur NEPZ Foc 137

64 UttarPradesh

Lucknow NEPZ Foc 140

65 UttarPradesh

Meerut NEPZ Foc 142

66 UttarPradesh

Kanpur NEPZ Foc 167

67 UttarPradesh

Lalitpur NEPZ Foc 133

68 UttarPradesh

Mahoba NEPZ Foc 134

69 UttarPradesh

Jaunpur NEPZ Foc 141

70 Bihar Dholi NEPZ Foc 125

NWPZ, North West Plains Zone; NEPZ, North East Plains Zone;CZ, Central Zone; SZ- South Zone.

578 Dubey et al.

(RAPD)/55C (URP) for 1-min annealing and 72Cfor 2-min extension with an elongation at 72C for5 min. The initial PCR cycling for SSR and ISSR wasas follows: 94C for 5 min for initial denaturation fol-lowed by 35 cycles of denaturation at 94C for 2 minfor SSR and 5 min for ISSR and extension at 72C for2 min with an elongation at 72C for 7 min. Appropri-ate annealing temperatures (Tables 2 and 3) for 2 minwere used for each primer set. Amplification productswere resolved by electrophoresis on agarose gel(1.25%) in 1x TAE buffer stained with ethidium bro-mide and photographed under UV light by using Bio-Rad Gel-doc system (CA, USA). A 1-kb (Fermentas)ladder was used as marker. The experiment wasrepeated twice with each primer before final scoring.The primers that gave reproducible and scorableamplifications were used for the analysis.

Observations and data analysis

Wilt reactions were graded as resistant (020% wilt)and susceptible (>20100% wilt) (Haware and Nene1982). On the basis of the resistant reactions, the culti-vars were identified to differentiate the races of thepathogen. DNA bands that could be scored unequivo-cally for their presence (1) or absence (0) were includedin the analysis. Binary matrices were analysed byNTSYS-PC (version 2.0; Exeter Biological Software,Setauket, NY, USA). Jaccards coefficients were clus-tered to generate a dendrogram by using SHAN clus-tering programme through Unweighted paired groupmethod with arithmetic average analysis (UPGMA)(Rohlf 1998).

ResultsVirulence analysis

The isolates originating from each region/state showedvariability in respect of wilt incidence ranging from 0to 100% with similar reaction patterns during 20092010 and 20102011 crop seasons (Table S1). The vari-eties C104 and GPF2 differentiated all the isolates ofAndhra Pradesh (SZ) and Karnataka (SZ) from othersby showing resistant reaction and were placed in thefirst group. The second group, which had seven iso-lates from Uttar Pradesh (NEPZ) and one isolate fromBihar (NEPZ), was differentiated by JG74 and GPF2

with resistant reaction. The varieties JG74 and C104,which showed resistant reaction against four isolatesfrom Punjab (NWPZ), two isolates from Rajasthan(NWPZ) and one isolate from Madhya Pradesh (CZ),were considered as differentials for the third group.The cultivars BG212 and KWR108, which differenti-ated two isolates of Delhi (NWPZ), three isolates ofHaryana (NWPZ), one isolate of Punjab (NWPZ), oneisolate of Maharashtra (CZ) and three isolates of Ut-tar Pradesh (NEPZ), were considered as differentialsfor the fourth group. The varieties WR315 and GPF2were considered as differentials for the fifth group con-sisting of seven isolates from Rajasthan (NWPZ). Thesixth group, which had three isolates from Chhattis-garh (CZ), four isolates from Madhya Pradesh (CZ)and six isolates from Jharkhand (NEPZ), was differen-tiated by cultivars C104 and KWR 108. The seventhgroup, which included four isolates from Gujarat(CZ), four isolates from Maharashtra (CZ) and twoisolates from Madhya Pradesh (CZ), was differentiatedby BG212 and GPF2. Only one isolate from Rajasthan(NWPZ) and two isolates from Punjab (NWPZ) weredifferentiated by GPF2 and DCP92-3 and placed inthe eighth group. Differential cultivars for the isolatesrepresenting different races were identified. Thus,based on the differential responses, 70 Foc isolateswere categorized into eight races of the pathogen(Table 4).

RAPD analysis

In PCR amplification with 20 RAPD primers, 915bands were observed on agarose gel in the range of0.254 kb (Table 5). The level of polymorphism on247 DNA fragments amplified was 100%. A represen-tative RAPD profile of the pathogen with OPF1 pri-mer was created (Fig. 2). At 37% genetic similarity, 70isolates of the pathogen were classified into eight clus-ters based on UPGMA (Fig. 3). The first cluster con-tained 16 isolates from seven different statesrepresenting four zones. Thirty-three isolates from ninestates representing four zones were included in the sec-ond cluster. The third cluster contained 15 isolatesfrom eight different states representing four zones. Theseventh cluster had two isolates, one each from Punjaband Rajasthan, while the fourth (Punjab), fifth (Bihar),

Table 2Analysis of polymorphism obtained with SSR primers in isolates of Fusarium oxysporum f.sp. ciceris

Primers Sequence (5-3)Annealing

temperature(C) Total bands (no.) Polymorphism (%)Size of

amplicons (kb)

MB 05 F:ACTTGGAGGAAATGGGCTTC 54.3 11 100 0.253.0R:GGATGGCGTTTAATAAATCTGG

MB 14 F:CGTCTCTGAACCACCTTCATC 60.2 4 100 0.250.6R:TTCCTCCGTCCATCCTGAC

MB 17 F:ACTGATTCACCGATCCTTGG 55.0 5 100 0.251.0R:GCTGGCCTGACTTGTTATCG

MB 18 F:GGTAGGAAATGACGAAGCTGAC 60.0 8 100 0.251.5R:TGAGCACTCTAGCACTCCAAAC

Total 23

SSR, simple sequence repeats.


sixth (Andhra Pradesh) and eighth (Madhya Pradesh)clusters had a single isolate in each.

URP analysis

The URPs amplified all the isolates of Foc, andthe isolates were highly variable in respect of bandingprofiles. A total of 171 bands with 100% polymorphismwere obtained using 12 URPs. The size of ampliconsranged from 0.25 to 5 kb (Table 6). The primer URP2R amplified all the isolates and showed good amplifica-tion pattern (Fig. 4). The dendrogram derived fromUPGMA grouped the isolates into eight clusters at 40%genetic similarity (Fig. 5). The first, third, sixth andeighth clusters had a single isolate in each. The secondcluster consisted of 13 isolates from six states represent-ing four zones. The fourth cluster had the maximum of35 isolates from 10 states representing four zones, while16 isolates from nine states representing four zones were

grouped in the fifth cluster. The seventh cluster had onlytwo isolates from Punjab and Rajasthan.

SSR analysis

All SSR primers were found to be polymorphic(100%). A total of 23 bands ranging from 0.25 to 3 kbin size were amplified by using four different sets ofSSR primers (Table 2). A representative SSR profile of70 Fusarium wilt pathogen isolates of chickpea withMB18 primer was created (Fig. 6). UPGMA of thebanding pattern grouped 70 isolates into eight clustersat 32% genetic similarity (Fig. 7). The first cluster had10 isolates from six states representing four zones. Thesecond cluster had four isolates from three differentstates representing two zones. The third cluster con-sisted of 21 isolates from 10 states representing fourzones. The fourth cluster included six isolates fromfour states representing three zones. The fifth cluster

Table 3Analysis of polymorphism obtained with ISSR primers in isolates of Fusarium oxysporum f.sp. ciceris

Name Sequence (5-3)Annealing

temperature (C) Total bands (no.) Polymorphism (%)Size range ofamplicons (kb)

ISSR 1 CCCGCATCC [CA]9 53.0 5 100 0.41.4ISSR 2 CCCGGA TCC [GA]9 53.0 5 100 0.31.4ISSR 3 [CA]8G 53.0 7 100 0.31.5ISSR 4 [CT]8AC 53.7 100 ISSR 5 [CT]8TG 53.7 100 ISSR 6 [CA]6AC 42.0 100 ISSR 7 [GA]6GG 44.0 7 100 0.31.1ISSR 8 [GT]6CC 44.0 100 ISSR 9 [CAC]3GC 38.0 100 ISSR 10 [CTC]3GC 38.0 100 ISSR 11 ACTGACTGACTG ACT 49.0 6 100 0.41.4ISSR 12 GACACGACACGA CACGACAC 61.4 9 100 0.252.0ISSR-13 [CAC]5 53.0 9 100 0.42.5

Total 48

, not amplified; ISSR, intersimple sequence repeats.

Table 4Races of Fusarium oxysporum f.sp. ciceris and their differential cultivars of chickpea

Race Differential cultivar State/Zone Accession numbers

1 C104 and GPF2 Andhra Pradesh (SZ) Foc 118,143, 144,168,169 and149Karnataka (SZ) Foc 121,126,148,150,151 and 52

2 JG74 and GPF2 Uttar Pradesh (NEPZ) Foc 119,129,130,133.134,141 and142Bihar (NEPZ) Foc 125

3 JG74 and C104 Punjab (NWPZ) Foc 31,45,62 and93Rajasthan (NWPZ) Foc 79 and 80Madhya Pradesh (CZ) Foc 158

4 BG212 and KWR108 Delhi (NWPZ) Foc 53 and 108Haryana (NWPZ) Foc 33,41 and 66Punjab (NWPZ) Foc 89Maharashtra (CZ) Foc 166Uttar Pradesh (NEPZ) Foc 137,140 and167

5 WR315 and GPF2 Rajasthan (NWPZ) Foc 4,6,11,36,50,58 and 876 C104 and KWR108 Chhattisgarh (CZ) Foc 127,161 and 162

Madhya Pradesh (CZ) Foc 155, 156, 157 and 70Jharkhand (NEPZ) Foc 23, 28, 46, 97, 98 and 100

7 BG212 and GPF2 Gujarat (CZ) Foc 122,123,163 and164Maharashtra (CZ) Foc 124,128,165 and 171Madhya Pradesh (CZ) Foc 153 and160

8 GPF2 and DCP92-3 Rajasthan (NWPZ) Foc 68Punjab (NWPZ) Foc 18 and19

CZ, Central Zone; NEPZ, North-Eastern Plains Zone; NWPZ, North-West Plains Zone; SZ, South Zone.

580 Dubey et al.

consisted of 21 isolates from six states representingfour zones. The sixth cluster had only two isolatesfrom two states and zones. The seventh cluster con-sisted of five isolates from three states representingthree zones. The eighth cluster had a single isolatefrom Madhya Pradesh.

ISSR analysis

Seven of the 13 ISSR primers amplified a total of 48bands ranging from 0.25 to 2.5 kb in size. With each pri-mer, 59 bands were obtained and a representative ISSRprofile of 70 Foc isolates with primer ISSR3 was created(Fig. 8). All the 48 bands were polymorphic and showed100% polymorphism (Table 3). UPGMA of the ISSRdata separated the Foc isolates into eight clusters at37% genetic similarity (Fig. 9). The first cluster con-sisted of 22 isolates from nine different states represent-ing four zones. The second cluster contained 12 isolatesfrom six different states representing all zones. The thirdcluster contained six isolates from five different statesrepresenting four zones. The fourth cluster consisted of21 isolates from 10 states representing four zones. Thesixth cluster contained six isolates from four differentstates representing three zones, while the fifth, seventhand eighth clusters had a single isolate in each.

Because varieties of chickpea are being evaluatedand released for each chickpea-growing zones ofIndia, the isolates were categorized according to theirzone of origin. The populations of Foc included inthe present study were grouped into eight clusters byusing four sets of molecular markers. The geneticsimilarity dropped to 40% as minimum subclusterswere formed in each major cluster that partially cor-responded to the races of the pathogen. Of the sev-enty isolates, 22 were from NWPZ, 17 from NEPZ,19 from CZ and 12 from SZ. The majority of theisolates (33) were clustered in the second group byusing RAPD analysis. This group contained the maxi-mum number of isolates from NWPZ (15 of 22) andNEPZ (9 of 17). Eight isolates of CZ and one isolatefrom SZ were also included in this group. All the 33isolates of this cluster were common in the fourthcluster generated by URP analysis, while 17 isolateswere common in the third group and the fourthgroup generated by SSR and ISSR, respectively. Thefirst cluster of RAPD groups contained 16 isolates, ofwhich maximum nine isolates were from SZ followedby four isolates from NEPZ, two isolates fromNWPZ and a single isolate from CZ. The majority (9of 12) of isolates from SZ (Andhra Pradesh and

Table 5Analysis of polymorphism obtained with RAPD primers in isolates of Fusarium oxysporum f.sp. ciceris

Name of primer Sequence (5-3) Total bands (no.) Polymorphism (%) Size range of amplicons (kb)

OPA 3 AGTCAGCCAC 12 100 0.43.0OPA 12 TCGGCGATAG 13 100 0.253.0OPB 17 AGGGAACGGA 11 100 0.353.5OPE 7 AGATGCAGCC 12 100 0.253.5OPF 1 ACGGATCCTG 14 100 0.304.0OPF10 GGAAGCTTGG 09 100 0.453.5OPF 12 ACGGTACCAG 15 100 0.44.0OPF 16 GGAGTACTGG 15 100 0.33.5OPM 6 CTGGGCAACT 11 100 0.33.0OPM 12 GGGACGTTGG 13 100 0.352.5OPM 14 AGGGTCGTTC 14 100 0.253.0OPM 20 AGGTCTTGGG 14 100 0.33.5OPN 4 GACCGACCCA 14 100 0.253.5OPN15 CAGCGACTGT 15 100 0.44.0OPN 20 GGTGCTCCGT 13 100 0.353.0P 1 CGTTGGATGC 14 100 0.33.5P 15 GTCGTCGTCGTCGTC 12 100 0.43.0P 17 TACGGCTGGC 12 100 0.43.0M 13 GAGGGTGGCGGTTCT 14 100 0.253.0OPY 10 CAAACGTGGG 12 100 0.254.0

Total 247

RAPD, random amplified polymorphic DNA.

Fig. 2 DNA profile generated by random amplified polymorphic DNA (RAPD) primer (OPF 1); M = marker-1 kb; Lanes 15 and 30(Andhra Pradesh), 68 (Chhattisgarh), 910 (Delhi), 1114 (Gujarat), 1517 (Haryana), 1823 (Jharkhand), 2429 (Karnataka), 3137(Madhya Pradesh), 3842 (Maharashtra), 4349 (Punjab), 5059 (Rajasthan), 6069 (Uttar Pradesh) and 70 (Bihar) isolates of Foc


Karnataka) were grouped in this cluster. Of the six-teen isolates, 13 were common in both RAPD andURP, while nine and 10 were common in the first

cluster and the second cluster of SSR and ISSR,respectively. Altogether, six isolates were commonlyclustered by using four primers. Of the fifteen isolates

Fig. 3 Dendrogram derived from polymorphic DNA analysis of 70 isolates of Fusarium oxysporum f.sp. ciceris with 20 random amplifiedpolymorphic DNA (RAPD) primers by unweighted paired group method with arithmetic average analysis (UPGMA). The bottom scale isthe percentage of Jaccards similarity coefficient. Vertical scale representing numbers (Foc 170) and state/zone of origin of the isolates (AP,Andhra Pradesh; CG, Chhattisgarh; DL, Delhi; GJ, Gujarat; HR, Haryana; JH, Jharkhand, KN, Karnataka, MP, Madhya Pradesh; MH,Maharashtra; PB, Punjab; RJ, Rajasthan, UP, Uttar Pradesh; BR, Bihar; NEPZ, North-East Plains Zone; NWPZ, North-West Plains Zone;CZ, Central Zone; SZ, South Zone)

Table 6Analysis of polymorphism obtained with URP primers in isolates of Fusarium oxysporum f.sp. ciceris

Primer Sequence (5-3) Total bands (no.) Polymorphism (%) Size range of amplicons (kb)

URP 1F ATCCAAGGTCCGAGACAACC 15 100 0.253.5URP 2F GTGTGCGATCAGTTGCTGGG 15 100 0.253.0URP 2R CCCAGCAACTGATCGCACAC 13 100 0.253.5URP 4R GGCAAGCTGGTGGGAGGTAC 15 100 0.254.0URP 6R GGCAAGCTGGTGGGAGGTAC 15 100 0.253.5URP 9F ATGTGTGCGATCAGTTGCTG 15 100 0.255.0URP 13R TACATCGCAAGTGACACAGG 13 100 0.254.0URP 17R AATGTGGGCAAGCTGGTGGT 10 100 0.252.5URP 25R GATGTGTTCTTGGAGCCTGT 18 100 0.253.5URP 30F GGACAAGAAGAGGATGTGGA 13 100 0.253.5URP 32F TACACGTCTCGATCTACAGG 15 100 0.253.5URP 38F AAGAGGCATTCTACCACCAC 14 100 0.255.0

Total 171

URP, universal rice primers.

582 Dubey et al.

included in the third RAPD group, nine were fromCZ followed by three from NEPZ, two from NWPZand a single isolate from SZ. This group partiallycorresponded to the fourth group of URPs, the fifthgroup of SSR and the first group of ISSR analysis.Altogether, six isolates were common for all themarkers. An isolate from NWPZ (Foc18, Punjab)belonging to race eight grouped separately in RAPD

(fourth cluster) and URP (third cluster) analyses. Thisisolate was placed in the second cluster of SSR andthe third cluster of ISSR along with other isolates.The fifth, sixth and seventh clusters of RAPD andURP analyses represented the isolates of race 2, race1 and race 3, respectively. The eighth cluster ofRAPD and URPs and the remaining clusters of SSRand ISSR analyses had isolates from different parts

Fig. 4 DNA profile generated by primer universal rice primers (URP) 2R; M = marker-1 kb; Lanes 15 and 30 (Andhra Pradesh), 68(Chhattisgarh), 910 (Delhi), 1114 (Gujarat), 1517 (Haryana), 1823 (Jharkhand), 2429 (Karnataka), 3137 (Madhya Pradesh), 3842(Maharashtra), 4349 (Punjab), 5059 (Rajasthan), 6069 (Uttar Pradesh) and 70 (Bihar) isolates of Foc

Fig. 5 Dendrogram derived from polymorphic DNA analysis of 70 isolates of Fusarium oxysporum f.sp. ciceris with 12 universal rice primers(URP) primers by unweighted paired group method with arithmetic average analysis (UPGMA). The bottom scale is the percentage of Jac-cards similarity coefficient. Vertical scale representing numbers (Foc 170) and state of origin of the isolates (AP, Andhra Pradesh; CG,Chhattisgarh; DL, Delhi; GJ, Gujarat; HR, Haryana; JH, Jharkhand; KN, Karnataka; MP, Madhya Pradesh; MH, Maharashtra; PB, Pun-jab; RJ, Rajasthan; UP, Uttar Pradesh; BR, Bihar; NEPZ, North-East Plains Zone; NWPZ, North-West Plains Zone; CZ, Central Zone; SZ,South Zone)


of the country representing various races of thepathogen.

DiscussionVirulence analysis on a new set of chickpea differen-tial cultivars indicated the existence of highly variableFoc populations across India. The isolates weregrouped into eight races, and the differential cultivarsfor each race were identified. All the isolates originat-

ing from SZ (Andhra Pradesh and Karnataka) weredesignated as race 1. Most of the isolates included inrace 1 corresponded to the first molecular group ofRAPD, SSR and ISSR but to the second moleculargroup of URPs. A majority of the isolates fromUttar Pradesh and Bihar (NEPZ) grouped in race 2and partially corresponded to the second moleculargroup. Four isolates from Punjab, two isolates fromRajasthan (NWPZ) along with one isolate from

Fig. 6 DNA profile generated by simple sequence repeats (SSR) primer MB18; M = marker-1 kb; Lanes 15 and 30 (Andhra Pradesh), 68(Chhattisgarh), 910 (Delhi), 1114 (Gujarat), 1517 (Haryana), 1823 (Jharkhand), 2429 (Karnataka), 3137 (Madhya Pradesh), 3842(Maharashtra), 4349 (Punjab), 5059 (Rajasthan), 6069 (Uttar Pradesh) and 70 (Bihar) isolates of Foc

Fig. 7 Dendrogram derived from polymorphic DNA analysis of 70 isolates of Fusarium oxysporum f.sp. ciceris with four simple sequencerepeats (SSR) primers by unweighted paired group method with arithmetic average analysis (UPGMA). The bottom scale is the percentageof Jaccards similarity coefficient. Vertical scale representing numbers (Foc 170) and state of origin of the isolates (AP, Andhra Pradesh;CG, Chhattisgarh; DL, Delhi; GJ, Gujarat; HR, Haryana; JH, Jharkhand; KN, Karnataka; MP, Madhya Pradesh; MH, Maharashtra; PB,Punjab; RJ, Rajasthan; UP, Uttar Pradesh; BR, Bihar; NEPZ, North-East Plains Zone; NWPZ, North-West Plains Zone; CZ, Central Zone;SZ, South Zone)

584 Dubey et al.

Madhya Pradesh (CZ) were placed in race 3. Six iso-lates from NWPZ (two from Delhi, three from Har-yana and one from Punjab), three isolates fromNEPZ (Uttar Pradesh) along with one isolate fromCZ (Maharashtra) were designated as race 4. Most ofthe isolates of this race corresponded to the secondand the third molecular groups. Seven NEPZ (Rajas-than) isolates were grouped in race 5. Seven isolatesfrom CZ (three from Chhattisgarh and four fromMadhya Pradesh) along with six isolates from NEPZ

(Jharkhand) were grouped in race 6. Race 7 had 10isolates only from CZ (4 from Gujarat, 4 from Ma-harashtra and 2 from Madhya Pradesh). Race 8 hadthree isolates only from NWPZ (one from Rajasthanand two from Punjab). Therefore, the races partiallycorresponded to the chickpea-growing zones of thecountry as well as the molecular groups generatedusing four different types of markers. Previous studiesbased on old differentials showed the presence ofeight races of the pathogen worldwide, of which only

Fig. 8 DNA profile generated by primer intersimple sequence repeats (ISSR) 3; M = marker- 1 kb; Lanes 15 and 30 (Andhra Pradesh), 68(Chhattisgarh), 910 (Delhi), 1114 (Gujarat), 1517 (Haryana), 1823 (Jharkhand), 2429 (Karnataka), 3137 (Madhya Pradesh), 3842(Maharashtra), 4349 (Punjab), 5059 (Rajasthan), 6069 (Uttar Pradesh) and 70 (Bihar) isolates of Foc

Fig. 9 Dendrogram derived from polymorphic DNA analysis of 70 isolates of Fusarium oxysporum f.sp. ciceris with 13 intersimple sequencerepeats (ISSR) primers by unweighted paired group method with arithmetic average analysis (UPGMA). The bottom scale is the percentageof Jaccards similarity coefficient. Vertical scale representing numbers (Foc 170) and state of origin of the isolates (AP, Andhra Pradesh;CG, Chhattisgarh; DL, Delhi; GJ, Gujarat; HR, Haryana; JH, Jharkhand; KN, Karnataka; MP, Madhya Pradesh; MH, Maharashtra; PB,Punjab; RJ, Rajasthan; UP, Uttar Pradesh; BR, Bihar; NEPZ, North-East Plains Zone; NWPZ, North-West Plains Zone; CZ, Central Zone;SZ, South Zone)


4, namely 1A, 2, 3 and 4, were reported from India(Haware and Nene 1982; Phillips 1988). Previousexperimental findings (Honnareddy and Dubey 2006;Dubey and Singh 2008; Dubey et al. 2010a) showedthat the reactions on earlier reported (Haware andNene 1982) international differential cultivars ofchickpea were not able to distinguish the isolates intoknown races of the pathogen. It was suggested thatthe international differentials, which were developedduring 1982, should be modified with new cultivarsof chickpea to obtain distinct differential reactionsfor the changed populations of the pathogen (Dubeyand Singh 2008; Dubey et al. 2010a). Accordingly,the present study was conducted using a modifiednew set of differential cultivars. The present set ofdifferential cultivars clearly distinguished the existingIndian populations of Foc into eight races instead offour races reported earlier. The differential cultivarsstandardized for each race in the present study shouldbe tested against the foreign population of the patho-gen reported as distinct races. The new distributionpattern of the Indian races of the pathogen is likelyto be utilized in resistance breeding programmes.All the four sets of molecular markers used in the

present study were found suitable for diversity analysis.Although these markers gave somewhat similar group-ings, RAPD and URPs were more efficient for polymor-phism and partially grouped the isolates into differentrace-specific clusters. None of the molecular markerswas able to group the isolates consistent with its viru-lence group, but each molecular group was predomi-nated by a specific race of the pathogen. Most of theisolates belonging to the races 1 and 6 were clusteredseparately by the use of the four sets of markers. Theisolates of race 6 of the pathogens originated from thecentral part of India, whereas the isolates of race 1 origi-nated from southern India. The isolates from northernIndia were grouped together by the use of primers andwere predominated by the races 2, 3, 4 and 8. Earlierworkers also could not establish a strong correlationbetween molecular and pathogenic groups in respect ofFusariumhost interactions (Jimenez-Gasco et al. 2001,2004b; Sharma et al. 2009; Datta et al. 2011). Virulenceanalysis on a set of cultivars is required to authenticatethe groups generated by the molecular markers (Abd-Elsalam et al. 2004). The present study revealed thatmolecular markers alone are not suitable for the charac-terization of the races of Foc. Further work is needed todetermine the virulence factors for designing specificmolecular markers to distinguish different races of thepathogen. The molecular groups generated in the pres-ent study only partially corresponded to the chickpeacultivation zones of India. The present findings are inaccordance with the observations made by earlier work-ers working on Fusarium species that molecular groupswere not clearly correlated with the pathogenicity andgeographic origin of the isolates (Migheli et al. 1998;Cramer et al. 2003).The genetic variability and phylogenetic relationship

existing among the earlier known eight pathogenic

races of the pathogen were analysed by Jimenez-Gascoet al. (2004a), who inferred intraspecific phylogeny ineach of the races forming a monophyletic lineage.Moreover, the virulence of races to resistant chickpeacultivars was acquired in a simple stepwise pattern,with few parallel gains or losses. Unlike other patho-systems, Focchickpea had only limited probabilitiesof obtaining parallel changes in virulence. The findingsof Lebeda and Petrzelova (2004) clearly indicated vari-ability in spatially isolated populations and within thepopulations of Bremia lactucae, and also geographicdifferences in virulence. In the present study, differ-ences in virulence were observed among Foc isolatesoriginating from southern and northern parts of India.Similar to the observations made by Lebeda and Petr-zelova (2004) in the case of B. lactucae, the distribu-tion of virulence within and among the populations ofFoc is probably the result of different selection pres-sures exerted by a specific resistant gene in the chick-pea varieties cultivated in an area.Of the four markers evaluated, RAPD and URPs

showed more or less similar grouping patterns becausemore than 95% of the isolates shared common cluster-ing. SSR and ISSR markers were also found suitableto determine the genetic diversity with approximately50% isolates showing common grouping patterns.Considering all the four markers together, 34% (24 of70 isolates) of isolates shared common grouping pat-tern. (Bayraktar et al. 2008) analysed the genetic vari-ability of Foc isolated from Turkey by using RAPDand ISSR markers. The molecular groups were notcorrelated with different geographic regions. It is evi-dent from the present study that the molecular groupspartially corresponded to the places of origin/zones ofthe isolates. In addition, the fact that the moleculargroups also had isolates from various parts of thecountry representing different races indicated themigration of the population from one part to otherparts of the country through infected seeds and con-taminated soils.The present study clearly re-characterized the Indian

populations of Foc into eight races on the basis of viru-lence analysis on a new set of 10 differential cultivars ofchickpea. The racial distribution patterns partially cor-responded to the chickpea-growing zones of India.Diversity analyses carried out using RAPD, URPs, SSRand ISSR markers also grouped the isolates into eightclusters, and these clusters partially corresponded to thechickpea-growing zones as well as races of the pathogen.Similarly, the groups generated by virulence and molec-ular analyses partially corresponded to each other whenall the four markers were considered together.

AcknowledgementAuthors are thankful to ICAR, New Delhi, India, for financial

support through outreach project.

ReferencesAbd-Elsalam KA, Omar MR, Migheli Q, Nirenberg HI. (2004)Genetic characterization of Fusarium oxysporum f.sp. vasinfectum

586 Dubey et al.

isolates by random amplification of polymorphic DNA (RAPD)and amplified fragment length polymorphism (AFLP). J Plant DisProt 111:534544.

Aggarwal R, Tripathi A, Yadav A. (2010) Pathogenic and geneticvariability in Tilletia indica monosporidial culture lines using uni-versal rice primer-PCR. Eur J Plant Pathol 128:333342.

Assigbetse KB, Fernandez D, Dubois MP, Geiger JP. (1994) Differ-entiation of Fusarium oxysporum f.sp. vasinfectum races on cottonby random amplified polymorphic DNA (RAPD) analysis. Phyto-pathology 84:622626.

Barve MP, Haware MP, Sainani MN, Ranjekar PK, Gupta VS.(2001) Potential of microsatellites to distinguish four races ofFusarium oxysporum f.sp. ciceri prevalent in India. Theor ApplGenet 102:138147.

Bayraktar H, Dolar FS, Maden S. (2008) Use of RAPD and ISSRmarkers in detection of genetic variation and population structureamong Fusarium oxysporum f. sp. ciceris isolates on chickpea inTurkey. J Phytopathol 156:146154.

Benali S, Mohamed B, Eddine HJ, Neema C. (2011) Advances ofmolecular markers application in plant pathology research. Eur JSci Res 50:110123.

Bentley S, Pegg KG, Dale JL. (1994) Optimization of RAPD finger-printing to analyze genetic variation within populations of Fusariumoxysporum f.sp. cubense. J Phytopathol 142:6478.

Cobb BD, Clarkson JM. (1994) A simple procedure for optimizingthe polymerase chain reaction (PCR) using modified Taguchimethods. Nucleic Acids Res 22:38013805.

Cramer RA, Byrne PF, Brick MA, Panella L, Wickliffe E, SchwartzHF. (2003) Characterization of Fusarium oxysporum isolates fromcommon bean and sugar beet using pathogenicity assays and ran-dom-amplified polymorphic DNA markers. J Phytopathol 151:352360.

Datta S, Choudhary RG, Shamim M, Singh RK, Dhar V. (2011)Molecular diversity in Indian isolates of Fusarium oxysporum f.sp.lentis inciting wilt disease in lentil (Lens culinaris Medik). Afr JBiotechnol 10:73147323.

Dhar V. (2008) Wilt of crops with special reference to cultural, mor-phological, molecular characterization and pathogenic variabilityof isolates in India, Final technical report (20042008), ICARad-hoc project, pp 6885.

Dubey SC, Singh SR. (2008) Virulence analysis and oligonucleotidefingerprinting to detect diversity among Indian isolates of Fusari-um oxysporum f.sp. ciceris causing chickpea wilt. Mycopathologia165:389406.

Dubey SC, Singh SR, Singh B. (2010a) Morphological and patho-genic variability of Indian isolates of Fusarium oxysporum f. sp.ciceris causing chickpea wilt. Arch Phytopathology Plant Protect43:174189.

Dubey SC, Tripathi A, Singh SR. (2010b) ITS RFLP fingerprint-ing and molecular markers for detection of Fusarium oxysporum f.sp. ciceris. Folia Microbiol 55:629634.

Grajal-Martin MJ, Simon CJ, Muehlbauer FJ. (1993) Use of randomamplified polymorphic DNA (RAPD) to characterize race 2 ofFusarium oxysporum f.sp. pisi. Phytopathology 83:612614.

Haware MP, Nene YL. (1980) Influence of wilt at different stages onthe yield loss in chickpea. Trop Grain Legume Bull 19:3840.

Haware MP, Nene YL. (1982) Races of Fusarium oxysporum f.sp.ciceri. Plant Dis 66:809810.

Honnareddy N, Dubey SC. (2006) Pathogenic and molecular charac-terization of Indian isolates of Fusarium oxysporum f.sp. ciceriscausing chickpea wilt. Curr Sci 91:661666.

Jimenez-Diaz RM, Alcala-Jimenez AR, Hervar A, Trapero-Casas JL.(1993) Pathogenic variability and host resistance in the Fusarium

oxysporum f.sp. ciceri/Cicer arietinum pathosystem. In: ArseniukE, Goral T, (ed.) Third Proceedings of European seminar: Fusarium-mycotoxins Taxonomy, Pathogenicity and Host Resistance. Rodzi-kov, Poland: Plant Breeding and Acclimatization Institute,pp 8794.

Jimenez-Gasco MM, Perez-Artes E, Jimenez-Diaz RM. (2001)Identification of pathogenic races 0, 1B/C, 5 and 6 of Fusariumoxysporum f.sp. ciceri with random amplified polymorphic DNA(RAPD). Eur J Plant Pathol 107:237248.

Jimenez-Gasco MM, Milgroom MG, Jimenez-Diaz RM. (2004a)Stepwise evolution of races in Fusarium oxysporum f.sp cicerisinferred from fingerprinting with repetitive DNA sequences. Phy-topathology 94:228235.

Jimenez-Gasco MM, Navas-Cortes JA, Jimenez-Daz RM. (2004b)The Fusarium oxysporum f.sp. ciceris/Cicer arietinum pathosystem:a case study of the evolution of plant-pathogenic fungi into racesand pathotypes. Int Microbiol 7:95104.

Kang HW, Park DS, Go SJ, Eun MY. (2002) Fingerprinting ofdiverse genomes using PCR with universal rice primers generatedfrom repetitive sequence of Korean weedy rice. Mol Cell 13:281287.

Lebeda A, Petrzelova I. (2004) Variation and distribution of viru-lence phenotypes of Bremia lactucae in natural populations ofLactuca serriola. Plant Pathol 53:316324.

Migheli Q, Briatore E, Garibaldi A. (1998) Use of random amplifiedpolymorphic DNA (RAPD) to identify races 1, 2, 3 and 8 of Fusa-rium oxysporum f.sp. dianthi in Italy. Eur J Plant Pathol 104:4957.

Murray MG, Thompson WF. (1980) Rapid isolation of high molecu-lar weight DNA. Nucleic Acids Res 8:43214325.

Phillips JC. (1988) A distinct race of chickpea wilt in California. IntChickpea Newslett 18:1921.

Rohlf FJ. (1998) NTSYS-pc: Numerical Taxonomy and MultivariateAnalysis System. Version 2.02. Setauket, NY, Exeter Software.

Sharma M, Gupta SK, Sharma TR. (2005) Characterization of vari-ability in Rhizoctonia solani by using morphological and molecularmarkers. J Phytopathol 153:449456.

Sharma M, Varshney RK, Rao JN, Kannan S, Hoisington D, PandeS. (2009) Genetic diversity in Indian isolates of Fusarium oxyspo-rum f.sp. ciceris, chickpea wilt pathogen. Afr J Biotechnol 8:10161023.

Singh KB, Dahiya BS. (1973) Breeding for wilt resistance in chick-pea. In: Symposium on Problem and Breeding for Wilt RESIS-TANCE in Bengal Gram. New Delhi, IARI, pp 1314.

Singh BP, Saikia R, Yadav M, Singh R, Chauhan VS, Arora DK.(2006) Molecular characterization of Fusarium oxysporum f.sp.ciceri causing wilt of chickpea. Afr J Biotechnol 5:497502.

Sivaramakrishnan S, Kannan S, Singh SD. (2002) Genetic variabilityof Fusarium wilt pathogen isolates of chickpea (Cicer arietinum L.)assessed by molecular markers. Mycopathologia 155:171178.

Supporting InformationAdditional Supporting Information may be found in the onlineversion of this article:

Table S1. Reaction of chickpea varieties against different isolatesof Fusarium oxysporum f.sp. ciceris.

Please note: Wiley-Blackwell are not responsible for the contentor functionality of any supporting materials supplied by the authors.Any queries (other than missing material) should be directed to thecorresponding author for the article.


Documents

Race profiling of Fusarium.pdf