A

I

ataeRb

v©

K

1

mteia

nbb(2w

0d

Available online at www.sciencedirect.com

Journal of Virological Methods 146 (2007) 36–44

Real-time reverse transcription PCR detection of norovirus, sapovirus andastrovirus as causative agents of acute viral gastroenteritis

Catriona Logan a,∗, John J. O’Leary b,c, Niamh O’Sullivan a,b

a Department of Microbiology, Our Lady’s Children’s Hospital, Crumlin, Dublin 12, Irelandb Department of Pathology, Coombe Women’s Hospital, Dolphins Barn, Dublin 8, Ireland

c Department of Histopathology and Morbid Anatomy, Trinity College Dublin, Dublin 2, Ireland

Received 15 January 2007; received in revised form 28 May 2007; accepted 31 May 2007Available online 17 July 2007

bstract

The design and development of highly sensitive real-time reverse transcription PCR assays for the detection of norovirus genogroups I, II andV, sapovirus genogroups I, II and IV, and human astrovirus from stool samples is described.

Examination of 140 stool samples from paediatric patients exhibiting symptoms of diarrhoea and/or vomiting resulted in increased detection levelss compared to examination by electron microscopy. Real-time PCR resulted in a 200% increase in the rate of detection of norovirus as comparedo electron microscopy. Only genogroup II noroviruses were detected in the stool specimens and when examined using partial-genotyping primersll were identified as clustering with the genogroup II/4 (Bristol/Lordsdale) cluster. Sapovirus was not detected in any of the stool specimens bylectron microscopy while 11% (15/140) of specimens were sapovirus positive by real-time RT-PCR, accounting for 36% of calicivirus diarrhoea.

eal-time RT-PCR resulted in a tenfold increase in the rate of detection of astrovirus when compared to detection by electron microscopy withoth type 1 and type 4 human astroviruses being detected in circulation.

The results highlight the importance of the introduction of molecular methods for the routine screening of stool samples for causative agents ofiral gastroenteritis.

2007 Elsevier B.V. All rights reserved.

ts

gctifIttr

eywords: Norovirus; Sapovirus; Astrovirus; Real-time PCR

. Introduction

Acute gastroenteritis is a worldwide cause of morbidity andortality and viral pathogens are the most common cause of gas-

roenteritis in developed countries (Lopman et al., 2003; McIvert al., 2001; Simpson et al., 2003). Known enteric viral pathogensnclude two genera of caliciviruses (Norovirus and Sapovirus),strovirus, adenovirus, and rotavirus.

Noroviruses are members of the Caliciviridae family and areow the most commonly reported cause of outbreaks of non-acterial gastroenteritis worldwide, with high attack rates amongoth children and adults, especially in semi-closed communities

Billgren et al., 2002; Vipond et al., 2004; Ward et al., 2000). In002, 84% of outbreaks of infectious intestinal disease in Irelandere either confirmed or suspected norovirus (NDSC, 2003). Of

∗ Corresponding author. Tel.: +353 1 4085715; fax: +353 1 4085608.E-mail address: catrionalogan@eircom.net (C. Logan).

dVdSceS

166-0934/$ – see front matter © 2007 Elsevier B.V. All rights reserved.oi:10.1016/j.jviromet.2007.05.031

hese outbreaks, 70% occurred in hospitals and other healthcareettings placing an enormous burden on the healthcare system.

Norovirus strains can be segregated into five separateenogroups (GI, GII, GIII, GIV and GV) on the basis of sequenceomparison of the RNA polymerase and capsid regions ofhe genome. Three groups, GI, GII and GIV are known tonfect humans. Within genogroups, norovirus strains can beurther divided into genetic clusters, or genotypes. GenogroupI/genotype4 (GII/4, Bristol/Lordsdale group) virus strains arehe most predominant worldwide and are endemic in hospi-als and long-term care facilities (Noel et al., 1999). Similarly,eports across Europe have identified norovirus GII/4 as the pre-ominant viral strains (Boga et al., 2004; Lindell et al., 2005;ipond et al., 2004; Waters et al., 2006), with reports of epi-emic spread of GII/4 norovirus variants (Lopman et al., 2004;

iebenga et al., 2007). Genogroup I (GI) virus strains mostlyommonly cause community-based sporadic infections and gen-rally exhibit much larger genetic diversity with GI/3 (Deserthield Virus) and GI/4 (Chiba) clusters frequently detected.

ologic

ide(dag

Ghssq

ieseia

fi2iGgs

deietostmigmg

2

2

eapafiplo

i

2

(wDnBatdtppeudW(�

bgslc

2

wr9oa

2

wTB((cs

GGAb

C. Logan et al. / Journal of Vir

Sapoviruses are a distinct genus within the Caliciviridae fam-ly (Green et al., 2000). While norovirus causes ‘winter vomitingisease’, sapovirus infection is predominantly a diarrhoeal dis-ase occurring chiefly in sporadic cases but also in outbreaksChiba et al., 2000). Sapovirus infections occur mostly in chil-ren less than five years old although it has been suggested thatsubset of sapoviruses may be associated with disease in all ageroups (Robinson et al., 2002).

Genetically, sapoviruses are divided into five genogroups (GI,II, GIII, GIV and GV), with GI, II, IV and V known to infectumans. Similar to norovirus classification, within genogroupsapovirus strains can be further divided into genotypes, withtrains belonging to the GI/1 cluster (Sapporo/82) most fre-uently being reported (Okada et al., 2002).

Human astrovirus (HAstV) infection has been documentedn all age groups but predominantly in young children (Espult al., 2004; Pang and Vesikari, 1999). HAstVs occurs in bothporadic cases and in outbreaks and astroviruses are report-dly the most common viral agent associated with diarrhoean immuno-suppressed adults (Cubitt et al., 1999; Grohmann etl., 1993).

HastVs are members of the genus Astrovirus and are classi-ed into eight antigenic serotypes, HAstV 1–8 (McIver et al.,000; Pang and Vesikari, 1999), with serotype 1 predominatingn most countries (De Grazia et al., 2004; Guix et al., 2002).enotypic classification is based on capsid protein precursorene sequences, and shows good correlation with serotype clas-ification.

Recently, this laboratory has published a method for the rapidetection of group F adenovirus and group A and C rotavirus andxplored its application to detection of gastrointestinal virusesn paediatric patients with vomiting and/or diarrhoea (Logant al., 2006). This paper reports real-time reverse transcrip-ion PCR assays for the detection of the other major causesf viral gastroenteritis, namely the caliciviruses, norovirus andapovirus, and human astrovirus. The increased detection ofhese viruses in the 140 paediatric stool samples examined using

olecular methods as compared to results obtained follow-ng examination by electron microscopy (EM) and preliminaryenotyping data, highlight the need for the introduction ofolecular methods for the routine definitive diagnosis of viral

astroenteritis.

. Materials and methods

.1. Specimen collection and electron microscopy

A total of 140 stool samples were collected from patientsxhibiting symptoms of diarrhoea and/or vomiting receivedt the Microbiology laboratory, Our Lady’s Children’s Hos-ital from February 2004 to April 2005, aliquoted and storedt −80 ◦C until analysed using molecular methods. Twenty

ve stool samples received at the laboratory from paediatricatients not exhibiting symptoms of gastroenteritis were simi-arly aliquoted and stored and used as controls for the purposef this study.

nUUG

al Methods 146 (2007) 36–44 37

Stool specimens were sent to an external laboratory for exam-nation by electron microscopy.

.2. Nucleic acid extraction from stool specimens

Total nucleic acids were extracted as described previouslyLogan et al., 2006). In brief, this involved stool clarificationith STAR buffer (Stool transport and recovery buffer, Rocheiagnostics GmbH, Mannheim, Germany) and subsequent totalucleic acid purification using the QIAGEN QIAamp® DNAlood mini kit. Up to six stool samples were extracted alongsidesingle negative extraction control consisting of STAR buffer

o which no stool had been added. Total mouse RNA was intro-uced to all samples following stool clarification and carriedhrough the specimen preparation, amplification and detectionrotocols functioning as an internal positive control system, asreviously described (Logan et al., 2006). Following nucleic acidxtraction and reverse transcription, each sample was assayedsing the TaqMan® rodent glyceraldehyde-3-phosphate dehy-rogenase (GAPDH) control reagents (Applied Biosystems,arrington, UK), on the ABI Prism 7000 sequence detector

Applied Biosystems) using SDS software version 1.2. TheRn of each sample (the normalised reporter signal minus the

aseline signal) an indication of the magnitude of the signalenerated in a given reaction, was determined. An extractedtool sample was considered inhibitory if the �Rn value was ateast 20% lower than the average �Rn value for the extractionontrol.

.3. Reverse transcription reactions

Random hexamer primed reverse transcription (RT) reactionsere carried out in a final volume of 40 �l using the TaqMan®

everse transcription kit (Applied Biosystems) on a GeneAmp700 thermocycler (Applied Biosystems) as described previ-usly (Logan et al., 2006). Completed RT reactions were storedt −20 ◦C until required for further analysis.

.4. Primer and probe design for real-time PCR

DNA sequences from highly conserved target genesere used for real-time PCR assay design as outlined inable 1. Nucleic acid sequences were retrieved from Gen-ank (www.ncbi.nlm.nih.gov) and aligned using the ClustalW

www.ebi.ac.uk/clustalw) multiple sequence alignment packageHiggins and Sharp, 1988; Higgins et al., 1996). The followingomplete and partial genome sequences were used to generateequence alignments:

Norovirus GI, GI/1-accession numbers M87661 and L23828;I/2-accession numbers L07418, DQ157930 and DQ157956;I/3-accession number U04469; GI/3b-accession numbersF414405, AF414403, and AY038598; GI/4-accession num-ers AF414404, AF414402 and AJ313030; GI/5-accession

umber AF414406. Norovirus GII, GII/1-accession numbers07611, AF414419 and AF414416; GII/2-accession number02030; GII/3-accession numbers AF414413 and AF190817;II/4-accession numbers AF414424, AF414425, X86557,

3 ologic

UAGbA

AUba

aDnnbAa

stigrFbc

2

fGsttuaPsm1aswaa

2f

TN

R

A

N

N

S

M

GG

A

8 C. Logan et al. / Journal of Vir

46500 and X76716; GII/5-accession numbers AF414423,F414422 and AF397156; GII/7-accession number AF414409;II/9-accession number AY038599; GII/12-accession num-er AF414420. Norovirus GIV, GIV/1-accession numbersF414426 and AF414427.Sapovirus GI, GI/I - accession numbers U95643, U65427,

J251991, X86560, NC 006269 and X86559; GI/2 U95644,73124 and AF294739. Sapovirus GII, GII/1 accession num-ers AJ249939, U95645 and AJ271056. Sapovirus GIV,ccession number AF435814.

Human Astrovirus, serotype1–accession numbers Z25771nd L23513; serotype 2-accession numbers DQ381504,Q381501, DQ071648 and AY324857; serotype3-accessionumbers AF292074 and AF117209; serotype4-accessionumbers AB025812 and Z33883; serotype5-accession num-ers AB037274 and U15136; serotype6-accession numbersF292077 and Z46658; serotype7-accession numbers Y08632

nd L38508; serotype8-accession number DQ381506.All primers and probes were designed using Primer Express

oftware version 2.0 and were obtained from Applied Biosys-ems (Table 1). Due to the amount of sequence heterogeneity,t was necessary to design degenerate primers for some tar-ets and in some cases a mix of primers and/or probes were

equired to maximise sensitivity of the PCR assays (Table 1).AM annd VIC labelled linear MGBNFQ (Minor grooveinder/Non-fluorescent quencher) probes were used for viralDNA detection.

ad(

able 1ucleotide base sequence of primers and probes designed for development of real-tim

eaction (target gene) Primer/probe (5′ label) Sequenc

strovirus (capsid protein precursor)

Hast.fwd TCAACHastV.rev TGCWGHastV.probe1 (FAM) CAACTHastV.probe2 (FAM) CAACT

orovirus GI (RNA polymerase)

GI.fwd CGYTGGI.rev TCCTTAGI.probe1 (VIC) AGATYGI.probe2 (VIC) AGATC

orovirus G II& GIV (RNA polymerase)

GII.fwd CARGAGIV.fwd CCAAAGII&IV.revd CGACGGII.probe (FAM) ATTGCGIV.probe (VIC) CGATC

apovirus GI, II & IV (polyprotein)

sapo.fwdA ACCAGsapo.fwdB ATTTGGsapo.rev GCCCTsapo.probeA (FAM) CTGTACsapo.probeB (FAM) TTGTACsapo.probeC (FAM) TGTACCsapo.probeD (FAM) TGCAC

ixed bases in degenerate primers and probes are as follows: Y = C/T, R = A/G, B =a All probes are MGBNFQ’s with FAM (6-Carboxyfluorescein) or VIC as the repob Oligonucleotide concentration in real-time PCR amplification reactions.c The position of each primer is relative to the numbering of the following gene sequI relative to sequence with accession number U04469 (Desert Shield); norovirus GIV relative to sequence with accession number AF414426 (Fort Lauderdale); sapovd Position listed is relative to norovirus GII accession number X86557 (Lordsdale).F414426 (Fort Lauderdale) is 814–795.

al Methods 146 (2007) 36–44

.5. Real-time PCR amplification

Each cDNA sample was analysed by PCR, in duplicate wellsor all viral targets: norovirus GI, GII and GIV, sapovirus GI,II, and GIV, and astrovirus. To enable higher throughput of

amples, norovirus GII and GIV assays were performed in mul-iplex (with FAM and VIC labelled probes, respectively), and allhree sapovirus assays were performed in the same PCR wellssing FAM labelled probes. Duplicate negative (no-template)nd positive (plasmid DNA) controls were included for eachCR assay. Real-time PCR was performed on an ABI 7000equence detector (Applied Biosystems) using universal ther-al cycling conditions and sequence detection software version

.2 as previously described (Logan et al., 2006). Real-time PCRmplification reactions (25 �l) contained 1X TaqMan® Univer-al Mastermix (containing AmpErase® uracil-N-glycosylase,ith dTTP partially replaced by dUTP), the appropriate forward

nd reverse primer(s) and MGBNFQ probe(s) at concentrationss detailed in Table 1, and 2 �l of template cDNA.

.6. Preparation of plasmid DNA and copy RNA controlsor real-time PCR assays

Plasmid DNA standards were prepared for all real-time PCRssays as follows: PCR products were generated using primersesigned external to the real-time oligonucleotide primersTable 2), or in the case of norovirus GIV using the oligonu-

e RT-PCR assays

e (5′-3′)a Concentration (�M)b Positionc

GTGTCCGTAAMATTGTCA 0.60 4546–4568GTTTTGGTCCTGTGA 0.60 4612–4593

CAGGAAACAGG 0.10 4574–4589CAGGAAACAAG 0.10 4574–4589

GATGCGNTTYCATGA 0.60 733–752GACGCCATCATCATTYAC 0.60 819–796

GCGATCYCCTGTCCA 0.10 782–763GCGGTCTCCTGTCCA 0.20 782–763

RBCNATGTTYAGRTGGATGAG 0.60 5003–5028GTTTGAGTCYATGTACAAGTG 0.60 712–737CCATCTTCATTCACA 0.60 5099–5080GATCGCCCTC 0.20 5065–5051TCGCTCCCG 0.20 777–790

GCTCTCGCCACCTA 0.30 806–824CCCTCGCCACCTA 0.30 806–824

CCATYTCAAACACTAWTTT 0.60 909–886CACCTATGAACCA 0.15 850–832CACCTATGAACCA 0.15 850–832ACCTATAAACCA 0.15 849–832

CACCTATGAAC 0.15 848–834

G/C/T, W = A/T, N = G/C/A/T, M = A/C.rter dye coupled on the 5′ end of the oligonucleotide as indicated.

ences: astrovirus relative to sequence with accession number Z25771; norovirusII relative to sequence with accession number X86557 (Lordsdale); norovirusirus relative to sequence with accession number U65427 (Sapporo/82).Position of GII&IV.rev primer relative to GIV sequence with accession number

C. Logan et al. / Journal of Virological Methods 146 (2007) 36–44 39

Table 2Oligonucleotide primers used for the construction of positive control plasmid DNA samples

Reaction Sequence (5′–3′) Primer positiona Amplicon length (bp)primer name

AstrovirusAstrovirus.ext.fwd GGACCAAAGAAGTGTGATGGCTAGCAA 4357–4737 381Astrovirus.ext.rev AACTGAGTRCTYCCAGTAGCGTCCTTAAC

Norovirus GINorovirusGI.ext.fwd CTCCATGGTGAGAAATTCTACAGAAAGAT 631–960 330NorovirusGI.ext.rev GGATCAATCATATTAACTTGTCCAGCAGT

Norovirus GIINorovirusGII.ext.fwd CGTGACCCAGCTGGTTGGTTTGG 4760–5107 348NorovirusGII.ext.rev GCGTCATTCGACGCCATCTTCATT

Norovirus GIVb

NorovirusGIV.fwd CCAAAGTTTGAGTCYATGTACAAGTG 712–814 103NorovirusGIV.rev CGACGCCATCTTCATTCACA

Sapovirus GI&IVSapovirusG1.ext.fwd1 CAAGGRGAGGGRCTGGTGCTTGT 769–1001 239SapovirusG1.ext.fwd2 GAAGGRGARGGTGTGGTGCTTGTSapovirusGIV.ext.fwd AAAGCTGAGGGGCTTGTGTTGACSapovirusG1&IV.ext.rev ACAACARCRTGGGATGTGGTCGG

Sapovirus GIISapovirusGII.ext.fwd ATGGCCACGCAATCTTTGAGGA 697–1109 316SapovirusGII.ext.rev GCACTAGCATTTGGTGTCTCAACTTGAGT

Mixed bases in degenerate primers are as follows: Y = C/T, R = A/G.a The position of each primer is relative to the numbering of the following gene sequences: astrovirus relative to sequence with accession number Z25771; norovirus

GI relative to sequence with accession number U04469 (Desert Shield); norovirus GII relative to sequence with accession number X86557 (Lordsdale); norovirusG sapovs .

IV a

ca(K1aBawA1nbfPtptNnunME

w(

tpl(((oiaoto

2a

apfD

u

IV relative to sequence with accession number AF414426 (Fort Lauderdale);apovirus GII relative to sequence with accession number U95645 (London/92)b Primers used for the generation of a positive plasmid control for norovirus G

leotide primers designed for use in the real-time PCR assays,s listed in Table 1. Solution phase PCR reactions containedin a final volume of 50 �l) 15 mM Tris–HCl, pH 8.0, 50 mMCl, 15% glycerol, 200 �M of each dNTP, 2–4 mM MgCl2,.0 �M of appropriate forward and reverse external primer(s),nd 1.25 units of Amplitaq Gold® DNA polymerase (Appliediosystems) and 2–4 �l of template DNA. For norovirus GInd GII, sapovirus GI and GII, and astrovirus, template DNA’sere cDNA samples identified as positive by real-time PCR.n oligonucleotide longmer designed for norovirus GIV (a19 base oligonucleotide corresponding to bases 704–822 oforovirus GIV accession number AF414426) was synthesisedy Sigma-Genosys (Suffolk, UK) and used as template DNAor the generation of plasmid DNA standards for norovirus GIV.CR amplification reactions (performed on GeneAmp PCR sys-

em 9700, Applied Biosystems) were performed as describedreviously (Logan et al., 2006). PCR products were cloned usinghe TOPO TA Cloning® system (Invitrogen, Groningen, Theetherlands) according to the manufacturer’s instructions. Theucleotide base sequence of the insert DNA from each plasmidsed as a DNA standard for real-time PCR was determined byucleotide sequencing of both DNA strands using the universal13 forward and M13 reverse primers (Lark Technologies Inc.,

ssex, UK).Plasmid DNA controls generated in this study were linearised

ith BamH1, purified using the MiniElute PCR purification kitQiagen) and used as template for in vitro transcription with

(gAs

irus GI&IV relative to sequence with accession number U65427 (Sapporo/82);

re as per real time primers.

he MEGAscript high yield transcription kit® using T7 RNAolymerase (Ambion (Europe) Ltd., Cambridgeshire, UK). Fol-owing digestion of the template DNA with TURBO DNaseAmbion) at 37 ◦C for 30 min, clean up of the copy RNAcRNA) was performed using the MEGAclearTM purification kitAmbion). Duplicate tenfold serial dilutions (106–100 copies)f cRNA transcripts were prepared to assess the detection lim-ts and assay reproducibility of the optimised real-time RT-PCRssays. Inter-assay variability was evaluated by the generationf complete cRNA serial dilutions, with subsequent reverseranscription and real-time PCR amplification on three separateccasions.

.7. Differentiation of virus genotypes by PCRmplification and base sequencing

Partial genotyping of circulating, norovirus, sapovirus andstrovirus strains from a number of stool samples identified asositive for gastrointestinal virus(es) by real-time PCR was per-ormed using primers described for the generation of plasmidNA standards in this study (Table 2).Partial genotyping of norovirus strains was also performed

sing the primers (MJV12 and RegA, region A) of Vinje et al.

Vinje et al., 2004; Vinje and Koopmans, 1996), a primer pair tar-eting a region of the RNA dependent RNA polymerase gene.mplification reactions were performed on a GeneAmp PCR

ystem 9700 (Applied Biosystems) with the following thermal

4 ologic

cfiai

uistgp(fa3hfocjTp

2

PapnDwDDD

3

3

Oggdaagtnst(pMap

aga(tdsam

3l

naPsCpnGt

rdpslressGsgatYstdsttccoGioo

0 C. Logan et al. / Journal of Vir

onditions: initial denaturation at 95 ◦C for 10 min; 40 ampli-cation cycles with denaturation at 94 ◦C for 1 min, annealingt 40 ◦C for 1 min, and extension at 72 ◦C for 1 min; and a finalncubation at 72 ◦C for 10 min.

Amplified PCR products of the appropriate size were purifiedsing the QIAGEN QIAQuick® PCR purification Kit and clonednto the pCR2.1®-TOPO® vector using the TOPO TA Cloning®

ystem (Invitrogen). The possibility of multiple genotypes ofhe same virus occurring in individual samples was not investi-ated. The nucleotide base sequence of the insert DNA from eachlasmid was determined by sequencing of both DNA strandsLark Technologies Inc., Essex, UK). Sequence data generatedrom forward- and reverse-sequencing reactions was assemblednd a consensus sequence was imported into MEGA version.1 software for molecular typing determination by sequenceomology (9). Phlyogenetic analysis of sequence data was per-ormed following multiple DNA sequence alignments of databtained internal to the amplifying primers using ClustalW. Aonsensus phylogenetic tree was obtained using the neighbour-oining algorithm with a bootstrap value of 1000 replications.ype assignation was based on the shortest distance from arototype strain, as deduced from the phylogenetic tree.

.8. Nucleotide sequence accession numbers

The nucleotide sequence data were submitted to GenBank.artial human astrovirus polyprotein gene sequences weressigned accession numbers DQ887688–DQ887692. Sapovirusolyprotein partial gene sequences were assigned accessionumbers DQ887693, DQ887694, DQ887695, DQ887696 andQ887697. Partial RNA polymerse gene sequences (norovirus)ere assigned accession numbers DQ887698, DQ887699,Q887700, DQ887701, DQ887702, DQ887703, DQ887704,Q887705, DQ887706, DQ887707, DQ887708, DQ887709,Q887710, DQ887711, DQ887712, and DQ887713.

. Results

.1. Sequence analysis and primer design

Norovirus sequences (GI, II and IV) were examined at theRF1-2 junction (RNA dependent RNA polymerase/capsidene junction), the most conserved region of the norovirusenome (Kageyama et al., 2003). Due to the significant geneticiversity even within genogroups, genogroup specific primersnd probes were designed to share 100% sequence identity ton alignment of strain sequences representing the appropriateenotypes (13 sequences for GI, 17 sequences for GII, andwo sequences for GIV), thereby maximising the number oforovirus strains detected. The norovirus assays designed in thistudy are similar to those designed in the broadly reactive real-ime RT-PCR norovirus assays described by Kageyama et al.Kageyama et al., 2003). In particular, the norovirus GI forward

rimer and probe designs are identical. However, this study usesGBNFQ probes allowing for shorter probe length, includes an

ssay to target norovirus GIV, and additionally uses RNA (notlasmid DNA) standards to determine assay sensitivity.

dcf2

al Methods 146 (2007) 36–44

Sapovirus (GI, II and IV) primer and probe designlso targeted the highly conserved RNA polymerase/capsidene junction. No sequence data for GV sapovirus werevailable in this target gene region. Two forward primerssapo.fwdA targeting GI/1, GII/1 and GIV, and sapo.fwdBargeting GI/II), and four probes (sapo.probeA targeting pre-ominantly GI, sapo.probeB targeting GI/1 (Houston/86) typeequences, sapo.probeC targeting predominantly GII sequences,nd sapo.probeD targeting GIV sequences) were designed toaximise assay sensitivity.

.2. PCR reaction specificity, sensitivity and detectionimits

Plasmid DNA standards (105 copies of norovirus GI/4,orovirus GII/4, norovirus GIV, sapovirus I/2, sapovirus II/1nd astrovirus serotype1) were examined with all four real-timeCR assays (astrovirus, norovirus GI, norovirus GII & GIV, andapovirus GI, II and IV) to examine PCR reaction specificity.ross reactivity of primer and probes was not observed whenlasmid DNA standards were used as template. Of particularote is that cross reactivity did not occur between the norovirusII, and GIV assays that were multiplexed for the purpose of

his study.The detection limit and amplification efficiency of each

eal-time PCR assay was demonstrated by amplifyinguplicate aliquots of tenfold serial dilutions of the appro-riate cRNA standard. The resulting standard curves, withtrong correlation coefficients (r2 ≥ 0.980) indicated theinear relationship over the range of 102 to 106 copies pereaction for all primer/probe sets examined, with low lev-ls of inter-assay variability as determined by the meanlopes and Y-intercepts ± standard deviations (astrovirus:lope = −3.54 ± 0.05, Y-intercept = 39.90 ± 0.65, norovirusI: slope = −3.33 ± 0.04, Y-intercept = 43.80 ± 1.85). The

apovirus assay was examined using cRNA standardsenerated from both GI and GII sapovirus plasmids,nd displayed similar amplification efficiency using bothemplates (sapovirus GI template: slope = −3.53 ± 0.05,-intercept = 43.84 ± 0.79, sapovirus GII template:lope = −3.56 ± 0.13, Y-intercept = 44.05 ± 0.36). Similarly,he norovirus GII&IV assay was examined using cRNA stan-ards for both norovirus GII and GIV (norovirus GII template:lope = –3.25 ± 0.07, Y-intercept = 42.50 ± 0.72, norovirus GIVemplate: slope = –3.21 ± 0.12, Y-intercept = 42.67 ± 0.47). Athe lower copy detection limits for astrovirus (10 copies ofRNA per reaction) and sapovirus GI and GII (100 copies ofRNA per reaction) assays, 100% assay reproducibility wasbserved. The lower copy detection limit for norovirus GI,II and GIV (ten copies of cRNA per reaction) was positive

n more than 50% of replicate reactions, while 100 copiesf cRNA transcripts was reproducibly amplified in 100%f the wells examined. The detection limits of the assays

eveloped in this study are comparable to other studies whereRNA standards were constructed to examine assay sensitivityor norovirus GI, GII and GIV detection (Trujillo et al.,006).”

C. Logan et al. / Journal of Virological Methods 146 (2007) 36–44 41

Table 3Summary table of results for the detection of human astrovirus, norovirus and sapovirus by real-time RT-PCR

Real-time PCR

Astrovirus Norovirus Sapovirus

Positive Negative Positive Negative Positive Negative

E

T minat

3p

chrr

tnwaaib

tiadtNspa

cawser8pwda

1sai(mta

pGap

3

uws(aoa(S(t

c(ttGitKiD

caas

tfsctDsequence identity with each other. BLAST analysis identified

lectron microscopyPositive 1 0Negative 10 129

he real-time PCR detection rates are compared to viral detection by direct exa

.3. Detection of target viruses in stool specimens fromatients with acute gastroenteritis

All 140 stool samples examined by real-time PCR amplifi-ation using the TaqMan® rodent GAPDH assay were shown toave a �Rn of greater than 87% of that obtained for the cor-esponding extraction control. This data confirmed the efficientemoval of PCR inhibitors from each individual sample.

All negative extraction control samples and no-template con-rol samples were identified as real-time RT-PCR negative fororovirus, sapovirus and astrovirus. Asymptomatic infectionsere not detected in the control patient samples examined, as

ll 25 specimens were negative for norovirus, sapovirus andstrovirus by real-time RT-PCR. All specimens were examinedn duplicate for all PCR targets with 100% results concordanceetween duplicate wells.

Electron microscopy detected norovirus particles in nine ofhe 140 stool samples examined. Only five of these EM pos-tive samples were detected by real-time PCR for norovirus,ll of which were positive for GII. However, real-time PCRetected an additional 22 samples as norovirus positive (GII)hat were not detected by electron microscopy (Table 3).either norovirus GI nor GIV were detected in any of the

tool samples examined. Norovirus was detected in paediatricatients of all ages, ranging from one month to 15 years ofge.

Electron microscopy did not detect sapovirus or reportlassic calicivirus structure on examination of the 140 paedi-tric stool specimens. Fifteen of the 140 specimens examinedere PCR positive for sapovirus. Fourteen of these 15

amples were reported as ‘no virus on examination’ bylectron microscopy (Table 3). The remaining sample waseported as ‘norovirus observed on examination’. In this study,7% (13/15) of sapovirus PCR positive samples were inatients under five years of age. The remaining two patientsere 12 and 14 years old, respectively. Sapovirus was notetected in any of the patients less than six months ofge.

Astrovirus particles were detected by EM in one of the40 stool samples examined. Real-time PCR targeting the cap-id protein precursor gene of human astroviruses identifiedstrovirus RNA in 11 of the 140 clinical specimens exam-ned, including the stool sample positive for astrovirus by EMTable 3). Nine of the 11 (82%) astrovirus PCR positive speci-

ens were from patients less than 3.5 years old. The remaining

wo astrovirus PCR positive specimens were from patients ofge 7.5 and 15.5 years.

ta(

5 4 0 022 109 15 125

ion using electron microscopy in the 140 clinical stool specimens examined.

Dual infections were observed in six of the 53 real-time PCRositive samples (11%). Three specimens were PCR positive forII norovirus and astrovirus, two specimens were GII norovirus

nd sapovirus PCR positive and one stool specimen was PCRositive for both astrovirus and sapovirus.

.4. Examination of virus genotypes

Norovirus GI RNA (obtained from an external laboratory)sed for validation of the norovirus GI real-time PCR assayas examined with the partial genotyping assay designed in this

tudy and also with the partial genotyping assay of Vinje et al.Vinje et al., 2004; Vinje and Koopmans, 1996). Phylogeneticnalysis of sequence data internal to the amplification primersf Vinje et al. (286 bp), and sequence data obtained followingmplification with the external GI primers designed in this study272 bp), both classified the norovirus GI RNA sample as GI/4.imilar analysis of the norovirus GIV plasmid insert sequencegenerated from an oligonucleotide longmer), correctly groupedhe insert sequence (57 bp) with other GIV norovirus sequences.

Eleven stool specimens positive for norovirus GII wereloned and sequenced with the external norovirus GII primersTable 2). Analysis of all 11 clones sequences (301 bp internalo the amplifying primers) identified 95–100% sequence iden-ity (accession number DQ887703–DQ887713). Five norovirusII positive specimens (including three of the specimens exam-

ned using the external norovirus GII primers) examined withhe primers of Vinje et al. (Vinje et al., 2004; Vinje andoopmans, 1996) produced PCR products (327 bp) display-

ng 98–100% sequence identity (accession number DQ887698–Q887702).Phylogenetic analysis of amplicon nucleotide sequences from

linical specimens using the external primers from this study,nd the primers of Vinje et al. (Vinje et al., 2004; Vinjend Koopmans, 1996), both resulted in the clinical specimenequences clustering with GII/4 norovirus sequences.

Five stool samples identified as positive for sapovirus by real-ime PCR were examined using external primers sets specificor GI and GIV sapovirus, and a second primer set specific forapovirus GII amplification (Table 2). Analysis of three ampli-ons produced with the sapovirus GI&IV primer set internal tohe amplifying primers (193 bp, accession numbers DQ887693,Q887693 and DQ887695) identified the clones shared 92–97%

op database hits as GI/2 sapoviruses. Analysis of two clonedmplicons produced from the sapovirus GII external primer set265 bp internal to the amplifying primers, accession number

42 C. Logan et al. / Journal of Virologic

Fig. 1. Consensus phylogenetic tree derived from nucleotide sequence align-ment of cloned amplicons generated by sapovirus partial-genotyping PCRreactions and sequences available in GenBank. The tree was generated usingMEGA 3.1 with bootstrap values (from 1000 replicates) expressed as per-centage for each node. Bootstrap values of less than 75% are not shown.DNA sequences obtained from GenBank are listed as: accession number,strain name, genogroup/genotype. DNA sequences (corresponding to clinicals(s

Dtfsnft(r

aubpPiiioDa(h

3

Eud

rddsGsa

4

sIanOdLvrndS

dNmebssTtsjopthPa2feosododsco

pecimens) determined in this study are indicated by their accession numberDQ887693–DQ887697). Clone sequences clearly cluster with GI/2 or GII/1apovirus sequences.

Q887696 and DQ887697) identified 99% identity between thewo sequences. BLAST analysis identified the top database hitor both clones (97% sequence identity) as the sapovirus GII/1equence Lyon598/97 (accession number AJ271056). Phyloge-etic analysis of the nucleotide sequences of clones generatedrom stool specimens PCR positive for sapovirus, were observedo cluster with either GI/2 (Parkville/94 type strains) or GII/1London/92 type strains), consistent with the BLAST analysisesults (Fig. 1).

RNA samples of known HastV serotpyes (serotypes I, IIInd IV) received from an external laboratory were examinedsing the primers designed for astrovirus genotyping (Table 2),y way of validating the genotyping assay. Five stool sam-les identified as positive for human astrovirus by real-timeCR were subsequently examined using the astrovirus genotyp-

ng primers. PCR amplicons from clinical specimens (325 bpnternal to the amplifying primers) displayed 81–99% sequencedentity with each other. Following phylogenetic analyses, threef the five clinical specimens (accession number DQ887688,Q887689 and DQ88769) clustered with serotype 4 human

strovirus sequences, while sequences of two of the specimensaccession number DQ887690 and DQ887692) clustered withuman astrovirus serotype 1 sequences.

.5. Analysis of discrepant results

Four of the 140 specimens examined in this study wereM positive for norovirus but were negative for norovirus,sing the real-time primers targeting norovirus GI, II and IVesigned in this study. Re-extraction, reverse transcription and

ds

t

al Methods 146 (2007) 36–44

e-examination of the specimens by real-time PCR failed to pro-uce an amplicon while the internal control mouse RNA wasetected within the defined limits. The four specimens were sub-equently examined by solution-phase PCR using the norovirusII, GII and GIV partial-genotyping primers designed in this

tudy and also using the norovirus primers of Vinje at al. (Vinje etl., 2004). All four specimens failed to produce a PCR amplicon.

. Discussion

This work describes the design and development of highlyensitive molecular assays for the detection of norovirus (GI,I and IV), sapovirus (GI, II and IV), and human astrovirus andpplication of the assays to the routine detection of gastrointesti-al viruses in paediatric patients with vomiting and/or diarrhoea.f the 140 samples examined, one or more enteric viruses wereetected in 53 of the stool samples (38%) by real-time RT-PCR.ess that 8% (10/140) of stool specimens were positive for theseiruses using direct examination by electron microscopy. Theseesults compare favourably with previous studies that report sig-ificantly increased levels of norovirus, sapovirus and astrovirusetection by PCR as compared to EM (Gunson et al., 2003;impson et al., 2003).

Real-time PCR resulted in a 200% increase in the rate ofetection of norovirus as compared to electron microscopy.either GI nor GIV norovirus were detected in the stool speci-ens. A number of specimens PCR positive for norovirus GGII

xamined using partial-genotyping primers were identified aselonging to the GII/4 (Bristol/Lordsdale) cluster. Levels ofequence identity between norovirus isolates in the highly con-erved 3′end of RNA polymerase gene ranged from 95–100%.hese high levels of sequence identity are not unexpected in

he most conserved region of the norovirus genome, from stoolamples collected from a single site over a limited time period ofust 15 months, with isolates most likely have a strong epidemi-logic link. The finding of only GII/4 norovirus strains in theatient cohort examined is consistent with the predominance ofhis norovirus cluster worldwide and also with its prevalence inospitals and other long-term care facilities (Noel et al., 1999).revious studies of norovirus strains circulating in Ireland havelso identified GII/4 types strains as predominant (Foley et al.,000; Waters et al., 2006). It is worth noting however, that thatailure to detect norovirus GI could be due in part to the high lev-ls of sequence diversity of GGI that complicates the selectionf primers/probes for detection, often resulting in lower overallensitivity (Kageyama et al., 2003; Trujillo et al., 2006). A studyf 12 laboratories across nine European countries examining theetection of norovirus using several different molecular meth-ds identified that a number of assays had significantly higheretection rates for novovirus GII/4 (Lopman et al., 2004). Theuggestion that the predominance of GII/4 may even be artifi-ial has been raised (Kirkwood, 2004), such that the specificityf diagnostic PCR protocols in use have significantly higher

etection rates for GII/4, than for other GII or GI norovirustrains.

Four stool specimens deemed positive for norovirus by elec-ron microscopy, were not detected by real-time PCR or using the

ologic

tsPotlc

bidccasmG

pcrrgcaag

dtmwep2pa

nfiaWfaficdsrugrcisiA

ao

tcedsgr

A

kINoigo

R

B

B

C

C

D

E

F

F

G

G

G

C. Logan et al. / Journal of Vir

wo partial-genotyping assays examined in this study. One of thepecimens was however, positive for sapovirus by real-time RT-CR. All four specimens were obtained from different patientsver a period of less that one-month and the possibility thathese samples contained virus particles morphologically simi-ar to norovirus, but with little nucleotide sequence homologyannot be ruled out.

Sapovirus was not detected in any of the stool specimensy EM while 11% (15/140) of specimens were sapovirus pos-tive by real-time RT-PCR, accounting for 36% of calicivirusiarrhoea. These findings are consistent with the study of aohort of children by Farkas et al., reporting that sapovirus is theausative agent of approximately 40% of all human calicivirus-ssociated diarrhoea (Farkas et al., 2000). Partial genotyping ofapovirus amplicons produced from a number of stool speci-ens in this study identified sapovirus GI/2 (Parkville/94) andII/1 (London/92) type strains circulating in the patient cohort.The partial-genotyping (or external) norovirus and sapovirus

rimers designed in this study enables the sequencing of cir-ulating viral strains in the sequence region also used foreal-time PCR amplification, thus facilitating the updating ande-designing of primer and probe sequences with the emer-ence of divergent strains. While complete sequencing of theapsid gene would be required for comprehensive phylogeneticnalysis (Green et al., 1997), the amplicons lengths in thesessays are sufficient to provide preliminary information allowingenogroup cluster assignation.

Real-time PCR resulted in a tenfold increase in the rate ofetection of astrovirus as compared to electron microscopy inhe 140 stool specimens examined, with almost 8% of speci-

ens examined positive for the virus. This compares favourablyith a study by Foley et al. in 2000, where 7% of Irish patients

xamined with non-bacterial, non-rotaviral gastroenteritis testedositive for astrovirus using molecular methods (Foley et al.,000). Examination of almost half (5 of 11) of the astrovirusositive specimens detected in this study identified only humanstrovirus genotypes 1 and 4 in circulation.

The results of this research confirm the endemic levels oforovirus previously reported in Irish hospitals and detail for therst time that astrovirus and sapovirus are common causativegents of acute gastroenteritis in hospitalised Irish children.

hen used in conjunction with the recently published methodor the rapid detection of group F adenovirus and group And C rotavirus, causative agents of gastroenteritis were identi-ed in 176% more patient specimens (69/140) as compared toombined latex agglutination (rotavirus and adenovirus antigenetection) and electron microscopy testing (25/140) of the 140tool specimens examined (Logan et al., 2006). Combined, theseesearch papers provide the first reports detailing the molec-lar detection of the principal causative agents of acute viralastroenteritis carried out in Ireland, and provide a true rep-esentation of the predominance of the viruses in the patientohort examined. Based on the predominant viruses detected

n this study, it is envisaged that the routine screening of stoolpecimens in Irish paediatric hospitals using this protocol shouldnvolve initial screening of specimens for norovirus GII, group

rotavirus and sapovirus. Specimens PCR negative with these

G

al Methods 146 (2007) 36–44 43

ssays could subsequently be examined using astrovirus, aden-virus and norovirus GI assays.

The results of this research emphasize the importance ofhe introduction of rapid molecular methods to routine clini-al hospital laboratories to provide definitive diagnoses. Thextraction of total nucleic acids in conjunction with single ran-om hexamer-primed reverse transcription reactions, provide aimple, efficient and novel system adaptable to detection of anyastrointestinal viruses, pending the design of highly sensitiveeal-time PCR assays.

cknowledgements

Norovirus GI and human astrovirus (types I, III and IV) RNA,indly provided by Bas van der Veer and Erwin Duizer, Nationalnstitute for Public Health and the Environment, Bilthoven,etherlands, were used to generate plasmid standards for theptimisation of the real-time PCR assays. The Children’s Med-cal & Research Foundation, Our Lady’s Children’s Hospital isratefully acknowledged for their financial support for purchasef items of equipment used in this research.

eferences

illgren, M., Christenson, B., Hedlund, K.O., Vinje, J., 2002. Epidemiology ofNorwalk-like human caliciviruses in hospital outbreaks of acute gastroen-teritis in the Stockholm area in 1996. J. Infect. 44, 26–32.

oga, J.A., Melon, S., Nicieza, I., De Diego, I., Villar, M., Parra, F., De Ona, M.,2004. Etiology of sporadic cases of pediatric acute gastroenteritis in asturias,Spain, and genotyping and characterization of norovirus strains involved. J.Clin. Microbiol. 42, 2668–2674.

hiba, S., Nakata, S., Numata-Kinoshita, K., Honma, S., 2000. Sapporo virus:history and recent findings. J. Infect. Dis. 181 (Suppl 2), S303–S308.

ubitt, W.D., Mitchell, D.K., Carter, M.J., Willcocks, M.M., Holzel, H., 1999.Application of electronmicroscopy, enzyme immunoassay, and RT-PCR tomonitor an outbreak of astrovirus type 1 in a paediatric bone marrow trans-plant unit. J. Med. Virol. 57, 313–321.

e Grazia, S., Giammanco, G.M., Colomba, C., Cascio, A., Arista, S., 2004.Molecular epidemiology of astrovirus infection in Italian children with gas-troenteritis. Clin. Microbiol. Infect. 10, 1025–1029.

spul, C., Martinez, N., Noel, J.S., Cuello, H., Abrile, C., Grucci, S., Glass,R., Berke, T., Matson, D.O., 2004. Prevalence and characterization of astro-viruses in Argentinean children with acute gastroenteritis. J. Med. Virol. 72,75–82.

arkas, T., Jiang, X., Guerrero, M.L., Zhong, W., Wilton, N., Berke, T., Matson,D.O., Pickering, L.K., Ruiz-Palacios, G., 2000. Prevalence and genetic diver-sity of human caliciviruses (HuCVs) in Mexican children. J. Med. Virol. 62,217–223.

oley, B., O’Mahony, J., Morgan, S.M., Hill, C., Morgan, J.G., 2000. Detectionof sporadic cases of Norwalk-like virus (NLV) and astrovirus infection in asingle Irish hospital from 1996 to 1998. J. Clin. Virol. 17, 109–117.

reen, K.Y., Ando, T., Balayan, M.S., Berke, T., Clarke, I.N., Estes, M.K.,Matson, D.O., Nakata, S., Neill, J.D., Studdert, M.J., Thiel, H.J., 2000.Taxonomy of the caliciviruses. J. Infect. Dis. 181 (Suppl 2), S322–S330.

reen, S.M., Lambden, P.R., Caul, E.O., Clarke, I.N., 1997. Capsid sequencediversity in small round structured viruses from recent UK outbreaks ofgastroenteritis. J. Med. Virol. 52, 14–19.

rohmann, G.S., Glass, R.I., Pereira, H.G., Monroe, S.S., Hightower, A.W.,Weber, R., Bryan, R.T., 1993. The enteric opportunistic infections working

group enteric viruses and diarrhea in HIV-infected patients. N. Engl. J. Med.329, 14–20.

uix, S., Caballero, S., Villena, C., Bartolome, R., Latorre, C., Rabella, N., Simo,M., Bosch, A., Pinto, R.M., 2002. Molecular epidemiology of astrovirusinfection in Barcelona, Spain. J. Clin. Microbiol. 40, 133–139.

4 ologic

G

H

H

K

K

L

L

L

L

M

M

N

N

O

P

R

S

S

T

V

V

V

W

4 C. Logan et al. / Journal of Vir

unson, R.N., Mackie, P., Leanord, A., Carman, W.F., 2003. First rotavirus, nowastrovirus: the evolving benefits of RT-PCR. Commun. Dis. Public Health6, 66–67.

iggins, D.G., Sharp, P.M., 1988. CLUSTAL: a package for performing multiplesequence alignment on a microcomputer. Gene 73, 237–244.

iggins, D.G., Thompson, J.D., Gibson, T.J., 1996. Using CLUSTAL for mul-tiple sequence alignments. Methods Enzymol. 266, 383–402.

ageyama, T., Kojima, S., Shinohara, M., Uchida, K., Fukushi, S., Hoshino,F.B., Takeda, N., Katayama, K., 2003. Broadly reactive and highly sensi-tive assay for Norwalk-like viruses based on real-time quantitative reversetranscription-PCR. J. Clin. Microbiol. 41, 1548–1557.

irkwood, C., 2004. Viral gastroenteritis in Europe: a new norovirus variant?Lancet 363, 671–672.

indell, A.T., Grillner, L., Svensson, L., Wirgart, B.Z., 2005. Molecular epi-demiology of norovirus infections in Stockholm, Sweden, during the years2000 to 2003: association of the GGIIb genetic cluster with infection inchildren. J. Clin. Microbiol. 43, 1086–1092.

ogan, C., O’Leary, J.J., O’Sulivan, N., 2006. Real-time reverse transcriptionPCR for detection of rotavirus and adenovirus as causative agents of acuteviral gastroenteritis in children. J. Clin. Microbiol. 44, 3189–3195.

opman, B., Vennema, H., Kohli, E., Pothier, P., Sanchez, A., Negredo, A.,Buesa, J., Schreier, E., Reacher, M., Brown, D., Gray, J., Iturriza, M., Gal-limore, C., Bottiger, B., Hedlund, K.O., Torven, M., von Bonsdorff, C.H.,Maunula, L., Poljsak-Prijatelj, M., Zimsek, J., Reuter, G., Szucs, G., Melegh,B., Svennson, L., van Duijnhoven, Y., Koopmans, M., 2004. Increase in viralgastroenteritis outbreaks in Europe and epidemic spread of new norovirusvariant. Lancet 363, 682–688.

opman, B.A., Reacher, M.H., Van Duijnhoven, Y., Hanon, F.X., Brown, D.,Koopmans, M., 2003. Viral gastroenteritis outbreaks in Europe, 1995–2000.Emerg. Infect. Dis. 9, 90–96.

cIver, C.J., Hansman, G., White, P., Doultree, J.C., Catton, M., Rawlinson,W.D., 2001. Diagnosis of enteric pathogens in children with gastroenteritis.Pathology 33, 353–358.

cIver, C.J., Palombo, E.A., Doultree, J.C., Mustafa, H., Marshall, J.A., Rawlin-

son, W.D., 2000. Detection of astrovirus gastroenteritis in children. J. Virol.Methods 84, 99–105.

DSC. 2003. National guidelines on the management of outbreaks of Norovirusinfection in healthcare settings, National Disease Surveillance Centre, pp.1–18.

W

al Methods 146 (2007) 36–44

oel, J.S., Fankhauser, R.L., Ando, T., Monroe, S.S., Glass, R.I., 1999. Identifi-cation of a distinct common strain of “Norwalk-like viruses” having a globaldistribution. J. Infect. Dis. 179, 1334–1344.

kada, M., Shinozaki, K., Ogawa, T., Kaiho, I., 2002. Molecular epidemiol-ogy and phylogenetic analysis of Sapporo-like viruses. Arch. Virol. 147,1445–1451.

ang, X.L., Vesikari, T., 1999. Human astrovirus-associated gastroenteritis inchildren under 2 years of age followed prospectively during a rotavirusvaccine trial. Acta Paediatr. 88, 532–536.

obinson, S., Clarke, I.N., Vipond, I.B., Caul, E.O., Lambden, P.R., 2002.Epidemiology of human Sapporo-like caliciviruses in the South West ofEngland: molecular characterisation of a genetically distinct isolate. J. Med.Virol. 67, 282–288.

iebenga, J.J., Vennema, H., Duizer, E., Koopmans, M.P., 2007. Gastroenteritiscaused by norovirus GGII.4, The Netherlands, 1994–2005. Emerg. Infect.Dis. 13, 144–146.

impson, R., Aliyu, S., Iturriza-Gomara, M., Desselberger, U., Gray, J., 2003.Infantile viral gastroenteritis: on the way to closing the diagnostic gap. J.Med. Virol. 70, 258–262.

rujillo, A.A., McCaustland, K.A., Zheng, D.P., Hadley, L.A., Vaughn, G.,Adams, S.M., Ando, T., Glass, R.I., Monroe, S.S., 2006. Use of TaqManreal-time reverse transcription-PCR for rapid detection, quantification, andtyping of norovirus. J. Clin. Microbiol. 44, 1405–1412.

inje, J., Hamidjaja, R.A., Sobsey, M.D., 2004. Development and applicationof a capsid VP1 (region D) based reverse transcription PCR assay for geno-typing of genogroup I and II noroviruses. J. Virol. Methods 116, 109–117.

inje, J., Koopmans, M.P., 1996. Molecular detection and epidemiology of smallround-structured viruses in outbreaks of gastroenteritis in the Netherlands.J. Infect. Dis. 174, 610–615.

ipond, I.B., Caul, E.O., Hirst, D., Carmen, B., Curry, A., Lopman, B.A., Pead,P., Pickett, M.A., Lambden, P.R., Clarke, I.N., 2004. National epidemic ofLordsdale Norovirus in the UK. J. Clin. Virol. 30, 243–247.

ard, J., Neill, A., McCall, B., Stafford, R., Smith, G., Davison, R., 2000.

Three nursing home outbreaks of Norwalk-like virus in Brisbane in 1999.Commun. Dis. Intell. 24, 229–233.

aters, A., Coughlan, S., Dunford, L., Hall, W.W., 2006. Molecular epidemiol-ogy of norovirus strains circulating in Ireland from 2003 to 2004. Epidemiol.Infect. 134, 917–925.