Upload
ngonhu
View
215
Download
1
Embed Size (px)
Citation preview
Acc
epte
d A
rtic
le
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/ina.12282
This article is protected by copyright. All rights reserved.
Received Date : 08-Sep-2015
Revised Date : 26-Nov-2015
Accepted Date : 18-Jan-2016
Article type : Original Article
Synergistic proinflammatory interactions of microbial toxins and
structural components characteristic to moisture-damaged buildings
Merja Korkalainen1*, Martin Täubel1, Jonne Naarala2, Pirkka Kirjavainen1, Arto Koistinen3,
Anne Hyvärinen1, Hannu Komulainen1, Matti Viluksela1,2
1National Institute for Health and Welfare, Department of Health Protection, P.O. Box 95,
70701 Kuopio, Finland
2Department of Environmental Science, University of Eastern Finland, P.O. Box 1627, 70211
Kuopio, Finland
3SIB Labs, University of Eastern Finland, P.O. Box 1627, 70211 Kuopio, Finland
* Corresponding author: Merja Korkalainen, P.O. Box 95, FIN-70701 Kuopio, Finland, email
[email protected], phone +358295246318
Running title: Synergistic interactions of microbial agents
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.2
Abstract
Indoor exposure to microbes and their structural and metabolic compounds is notoriously
complex. In order to study proinflammatory interactions between the multiple microbial
agents, macrophages derived from human THP-1 monocytic cells were exposed to several
concentrations of microbial toxins alone (emodin, enniatin B, physcion, sterigmatocystin,
valinomycin) and in combination with microbial structural components (bacterial
lipopolysaccharide [LPS] or fungal β-glucan). While the expression of proinflammatory
cytokines TNFα and IL-1β to single toxins alone were modest, low-dose co-exposure with
structural components increased the responses of emodin, enniatin B and valinomycin
synergistically, both at the mRNA and protein level, as measured by RT-qPCR and ELISA
assay, respectively. Co-exposure of toxins and β-glucan resulted in consistent synergistically
increased expression of several inflammation-related genes, while some of the responses with
LPS were also inhibitory. Co-exposure of toxins with either β-glucan or LPS induced also
mitochondrial damage and autophagocytosis. The results demonstrate that microbial toxins
together with bacterial and fungal structural components characteristic to moisture-damaged
buildings can have drastic synergistic pro-inflammatory interactions at low exposure levels.
Key words: microbial toxins, LPS, β-glucan, proinflammatory cytokines, co-exposure,
synergistic interaction
Practical implications
In this study, we evaluated joint effects between indoor microbial toxins and structural
components of bacteria and fungi commonly found in moisture damaged buildings, using
human macrophages. We show here that microbial toxins can potentiate the inflammatory
effects of structural components at very low exposure levels drastically increasing the
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.3
severity of proinflammatory responses. Co-effects are accompanied by morphological
alterations indicative of mitochondrial damage and autophagy related activation pathways.
The synergistic nature of interactions may help in understanding the adverse health effects
observed in occupants of moisture-damaged buildings.
Introduction
Microbial toxins are secondary metabolites produced by fungi and bacteria with
known or assumed toxic effects on human or animal cellular systems. Both microbes and
their secondary metabolites are ubiquitously present in indoor environments. In moisture-
damaged spaces, their amounts and numbers appear to be increased (Kirjavainen et al. 2015;
Miller and McMullin 2014; Nevalainen et al. 2015; Peitzsch et al. 2012; Täubel et al. 2011;
Täubel and Hyvärinen 2015). Exposure to indoor dampness and moisture damage is
associated with airway and systemic inflammation, exacerbation and development of asthma,
various respiratory symptoms and repeating infections (Kanchongkittiphon et al., 2015;
Mendell et al., 2011; World Health Organization, 2009). While indoor dampness and mold
related microbial exposure is assumed to be a key factor in adverse health outcomes of
occupants, the causative components and the mechanisms are not known.
Microbial toxins are typically stable, non-volatile and highly bioactive compounds
that may, depending on their chemical structure, have cytotoxic, inflammatory,
immunosuppressive and carcinogenic effects (Bennett and Klich, 2003; Council for
Agricultural Science and Technology, 2003). They act via a variety of different mechanisms,
which are better understood for ingestion exposure, but largely unknown for chronic, low
level inhalation exposure scenarios. In moisture-damaged indoor environments, microbial
toxins do not occur as individual compounds, but are present with a variety of fungi and
bacteria, their spores, cell wall components and cell fragments together with allergenic
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.4
proteins and volatile organic compounds (Nevalainen et al., 2015). Toxicological interactions
between different microbial agents are likely (Huttunen et al., 2004; Murtoniemi et al., 2005;
Penttinen et al., 2005), but poorly characterized. Especially microbial cell wall components,
such as the fungal polysaccharide β-glucan and bacterial lipopolysaccharide (LPS), are
ubiquitous and potent inducers of inflammatory responses. Some synergistic interactions
between trichothecene mycotoxins and LPS have been shown in human macrophages
(Kankkunen et al., 2009; Kankkunen et al., 2014) and mouse nasal airways (Islam et al.,
2007).
The majority of indoor mycotoxin studies have so far focused on macrocyclic
trichothecenes, especially satratoxins following initial observations on their presence in
severely moisture- and mold-damaged buildings where occupants suffered from severe and
sometimes fatal health outcomes (Dearborn et al., 1999; Etzel et al., 1998; Flappan et al.,
1999; Jarvis et al., 1998; Johanning et al., 1996). Macrocyclic trichothecenes are not,
however, highly common in building materials or floor dust of moisture-damaged schools or
homes in Europe (Huttunen et al., 2015; Kirjavainen et al., 2015; Peitzsch et al., 2012; Täubel
et al., 2011). Based on recent studies that have targeted multiple microbial toxins rather than
a few selected compounds of primary toxicological interest, the variety of compounds with
potential health implications is impressive (Kirjavainen et al., 2015; Peitzsch et al., 2012;
Täubel et al., 2011). At present it is not well established, what is their potential for
toxicological interactions, and what is their relevance to occupant health.
The objective of this study was to evaluate interactions between common indoor
microbial toxins and microbial cell wall components LPS and β-glucan. Our hypothesis was
that the structural components modulate the effects of toxins, or vice versa, on
proinflammatory responses, namely on the expression of proinflammatory cytokines TNFα
and IL-1β, which both play a central role in mold-induced adverse health effects (Kankkunen
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.5
et al., 2009; Pestka and Zhou, 2006). For this purpose, we studied the effects of five
structurally different microbial toxins on inflammatory response and cell morphology of
human macrophages in vitro. Macrophages were chosen as they are responsible for the first
line protection and triggering the inflammatory response through secretion of signalling
molecules. THP-1 cells used in this study have become one of most widely used cell line to
investigate immune responses. After differentiation to monocyte-derived macrophages, they
show similarities to those of peripheral blood mononuclear cells (Chanput et al., 2014). The
selected fungal toxins are commonly detected in dust samples of moisture damaged buildings
(Kirjavainen et al., 2015; Peitzsch et al., 2012; Täubel et al., 2011). Emodin, enniatin B,
sterigmatocystin and physcion are fungal mycotoxins, while valinomycin is predominantly
produced by Streptomycetes bacteria. Both valinomycin and enniatin B belong to
cyclohexadepsipeptide mycotoxins and function as ionophores by transporting monovalent
ions across the cellular membranes (Kamyar et al., 2004; Paananen et al., 2000; Tonshin et
al., 2010). Emodin and physcion are naturally occurring anthraquinones, produced not only
by fungi but also by some plants, and sterigmatocystin is a polyketide mycotoxin structurally
related to aflatoxin B1 (Nielsen, 2003).
Materials and methods
Chemicals
All microbial toxins were purchased from Sigma-Aldrich (≥90% pure) and were
dissolved in dimethyl sulfoxide (DMSO). Also LPS (lipopolysaccharides from Escherichia
coli 0111:B4) and, β-D-glucan hydrate (curdlan from Alcaligenes faecalis), were obtained
from Sigma-Aldrich. β-glucan was first diluted in 0.05 M NaOH to prepare a stock solution
of 10 mg/ml and after that serial dilutions were prepared in phosphate buffered saline (PBS).
Serial dilutions of LPS were prepared from a ready-made solution 1 mg/ml in cell culture
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.6
medium. Media, serum and other products for cell culturing were supplied by Gibco
(Invitrogen, Paisley, UK).
Cell culture and treatments
Human acute monocytic leukemia cells (THP-1) were purchased from American
Type Culture Collection and differentiated into macrophages with phorbol 12-myristate 13-
acetate (PMA, Sigma-Aldrich). The cells were grown in RPMI medium supplemented with
10% Fetal Bovine Serum, 2 mM L-glutamine, 0.05 mM 2-mercaptoethanol, 100 U/ml
penicillin and 100 µg/ml streptomycin at 37°C in a humidified atmosphere of 5% CO2 in air.
The cells were grown in suspension and the density was kept between 200 000 – 800 000
cells/ml by performing routine cell counts. The cells turned adherent after 48-hours
differentiation with 50 nM PMA.
For the gene expression and cytokine analysis, cells were plated on 6-well plates, 1.6
million cells per well. Differentiation was started by adding 50 nM PMA in the cell culture
medium and replacing the fresh PMA-medium on the next day. After 48 h, the differentiation
medium was replaced with exposure medium. Exposure medium contained single toxins,
combinations of toxins and β-glucan and/or LPS or DMSO vehicle only, so that the final
concentration of DMSO was only 0.1%. At the end of the exposure, medium was removed
and cells were harvested for gene expression analyses or cell morphology studies, or the
medium was stored for cytokine analyses.
Cell viability assay
For the proliferation test, cells were grown on 96-well plates. Cell proliferation was
determined by colorimetric assay using Cell Proliferation Reagent WST-1 (Roche,
Mannheim, Germany). First, medium was removed and WST-1 reagent added to wells. Cells
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.7
were incubated for 1 h. After shaking the cell plate for 1 min, the absorbance of the samples
was measured using a plate reader at 450 nm (EnSpire, Perkin Elmer, Waltham, MA, USA).
RT-qPCR
RNA was isolated from the pelleted cells and after determining its concentration,
purity and intergrity, generated into cDNA and used as a template for quantitative PCR as
described earlier (Koskela et al., 2012). The expression levels of proinflammatory cytokines
as well as reference gene GAPDH were analyzed using following primers: TNFα (NM-
000594), tgcccctccacccatgtgct and cagccccctctggggtctcc; IL-1β (NM-000576),
tcgccagtgaaatgatggct and ggtcggagattcgtagctgg; GAPDH (NM-002046)
cgcatcttcttttgcgtcgcca and ccacgacgtactcagcgccag together with Power SYBR Green PCR
Master Mix and Applied Biosystems 7000 Real-Time PCR System (Applied Biosystems,
Foster City, CA, USA) according to manufacturer’s protocol. Dissociation curves were run to
confirm the absence of non-specific amplification. Standard curves were generated using
isolated and purified PCR products produced with the same primers. Negative controls were
included in each run. The expression levels were related to mRNA concentrations of
housekeeping gene GAPDH to normalize the amount of cDNA in PCR reactions.
PCR arrays
RNA was isolated using RNeasy Mini Kit and RNAse free DNase (Qiagen, Hilden,
Germany). The concentration of RNA was determined using Nano Drop (Thermo Scientific,
Wilmington, DE, USA). 1 µg of RNA was generated into cDNA using RT2 First Strand Kit
(Qiagen). cDNA samples were mixed with RT2 qPCR Master Mix (Qiagen) and distributed
in every well on PCR array plate (Human Inflammatory Cytokines & Receptors by Qiagen).
This PCR Array profiled the expression of 84 key genes mediating inflammatory response,
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.8
such as chemokines, cytokines, and interleukins involved as well as their receptors. The array
also contained controls for RT reaction and PCR reaction as well as a genomic DNA control.
Applied Biosystems 7000 Real-Time PCR System was used to determine Ct-values of each
well according to the manufacturer’s protocol. The fold-changes in Ct-values were calculated
using SABiosciences’ web-based data analysis program
(www.SABiosciences.com/pcrarraydataanalysis.php).
Cytokine ELISA
The secretion of TNFα and Il-1β into the cell culture medium was determined using
commercial kits Human TNFα and IL-1β DuoSet ELISA Development System combined
with Ancillary Reagent Kit (R&D Systems, Minneapolis, USA) according to the
manufacturer’s instructions.
Cell morphology studies
For the electron microscopic examination, the cells were firstly fixed with 2.5%
glutaraldehyde (Electron Microscopy Sciences) prepared in 0.1 M PBS for 2 h at RT.
Samples for scanning electron microscope (SEM) were dehydrated through ascending series
of ethanol: 50%, 60%, 70%, 80%, 90%, 94% and absolute ethanol followed by
hexamethyldisilane (HDMS). The coverslips were then air-dried and mounted on aluminum
stub, and coated with a thin layer of gold. Samples were examined and imaged with Zeiss
Sigma HD VP scanning electron microscope (Carl Zeiss Microscopy Ltd, Cambridge, UK).
After pre-fixation, the samples for transmission electron microscope (TEM) were postfixed
with 1% osmium tetroxide in 0.1 M PBS for 1h at RT and dehydrated through ascending
series of ethanol: 70%, 90%, 94% and absolute ethanol. The samples were then infiltrated in
epoxy resin for 2 h at RT, and polymerized for 24 h in 37°C followed by 48 h at 60°C. Thin
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.9
sections were cut using Ultracut UC ultramicrotome (Leica Microsystems, Wien, Austria)
and stained routinely with uranyl acetate and lead citrate. Samples were examined and
imaged with JEM-2100F transmission electron microscope operated at 200 kV (Jeol Ltd,
Tokyo, Japan).
Bench mark dose modelling, statistics and analysis of interactions
Dose responses were analyzed using the benchmark dose (BMD) method, PROAST
version 38.9 in R software (Slob, 2002). Based on the likelihood ratio test, the best fitted
models were selected among the exponential and the Hill model families. Benchmark doses
(critical effect dose) and their lower and upper 95%-confidence bounds were calculated at a
50% change in response compared with unexposed control.
Statistical analysis was performed by the ANOVA followed by the Least Significant
Difference test (IMB SPSS Statistics 22). In the case of nonhomogenous variances, the
Mann-Whitney U test was used. The limit of statistical significance was set at p < 0.05.
The interaction after co-exposure was considered synergistic, when the ratio of
measured co-response to the sum of individual responses to toxins and β-glucan or LPS was
more than 1. If this ratio was about 1, the interaction was additive, while ratios below 1 meant
antagonistic interaction.
Results
Comparison of cytotoxic and inflammatory responses
Since potencies and toxicity profiles of the selected microbial toxins were not
known, dose-responses and time trends were first determined separately for each toxin, LPS
and β-glucan. The strongest increase in mRNA expression of proinflammatory cytokines
TNFα and IL-1β was observed at 3 or 6 h for most toxins and at 3 h for both β-glucan and
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.10
LPS (data not shown). The following time points were selected for further studies: 3 h for
gene expression studies, 3 h and 24 h for cell viability assessment and 24 h for cell
morphology studies and analysis of TNFα and IL-1β production.
All toxins, except physcion, increased TNFα and IL-1β mRNA expression and
decreased cell viability. Half-maximal effective concentrations (EC50) for cytokine mRNA
responses and cell viability are shown in Table 1. Bacterial toxin valinomycin was the most
potent toxin for inflammatory and cytotoxic responses even at low nanomolar level, while the
other toxins caused responses at micromolar levels. With the exception of valinomycin,
toxins induced mRNA expressions at the lower concentrations than caused cytotoxicity. The
potency order for cytokine responses was valinomycin > enniatin B > sterigmatocystin >
emodin > physcion. The order for decreased cell viability was the same except that at 3 h
emodin was more potent than sterigmatocystin, which was cytotoxic only at 24 h. Physcion
did not cause significant cytokine or cell viability responses at any tested concentrations (0.5
– 100 μM).
Effects of toxin mixtures and structural components
For mimicking real-life exposure situations, the cells were exposed to mixtures of
toxins in different combinations alone and together with LPS and β-glucan (Fig.1). The used
proportions of emodin, enniatin B, physcion, sterigmatocystin and valinomycin were selected
to mimic real-life situations detected in indoor air (Kirjavainen, 2015; Peitzsch, 2012; and
unpublished data) and were 100, 5, 250, 5 and 0.1 (on molar basis), respectively. The
concentration of emodin was set to 10 μg/ml (= 37 μM) and the concentrations of other toxins
were set in relation to emodin: 0.5 μg/ml enniatin B (0.8 μM), 25 μg/ml physcion (88 μM),
0.5 μg/ml sterigmatocystin (1.5 μM), 0.01 μg/ml valinomycin (0.009 μM). LPS and β-glucan
were used at the lowest concentrations able to evoke the mRNA expression of TNFα and IL-
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.11
1β (5 ng/ml LPS and 100 ng/ml β-glucan). TNFα mRNA levels were only slightly increased
after exposure of cells to single toxins or mixtures of enniatin B + emodin, enniatin B +
emodin + physcion or enniatin B + emodin + sterigmatocystin suggesting that these toxins
have no additive interaction at the used concentrations. Addition of valinomycin to the
mixtures increased the response about 9-fold (Fig.1A). The expression of IL-1β, however,
was comparable regardless of composition of the toxin mixture (Fig.1B). Most remarkably,
simultaneous treatment of cells with β-glucan, LPS and toxin mixtures strongly elevated the
mRNA expression of TNFα. After 3 h co-treatment with toxin mixtures enniatin B + emodin,
enniatin B + emodin + physcion or enniatin B + emodin + sterigmatocystin and low
concentrations of β-glucan and LPS, the TNFα mRNA levels were clearly higher than the
sum of individual effects (ratios of measured co-responses to the sum of responses to
structural components and toxin mixtures were about 2.5) indicating a synergistic interaction
(Fig.1A). The presence of valinomycin in mixtures seemed to prevent the synergistic co-
responses in TNFα expression and even inhibit the IL-1β responses (Fig.1A-B). The
combined effects of the toxin mixtures enniatin B + emodin, enniatin B + emodin + physcion
or enniatin B + emodin + sterigmatocystin plus β-glucan and LPS on the IL-1β mRNA
expression were additive (Fig.1B). In addition, the IL-1β responses to all toxin mixtures were
at the same level as individual responses to emodin or valinomycin alone (Fig.1B).
Interactions after co-treatment with single toxins and structural components
Next, human macrophages were exposed to individual toxins alone or in
combination with β-glucan or LPS to characterize their specific interactions. The
concentrations of toxins were selected so that they evoke proinflammatory response, but are
not highly cytotoxic to cells. The cell viabilities (% of control) after 3 h treatment with
selected concentrations were as follows: 40 μM emodin 80.3 ± 2.1 (n=4), 5 μM enniatin B
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.12
85.0 ± 2.8 (n=5), 20 μM sterigmatocystin 101.6 ± 3.7 (n=2) and 5 nM valinomycin 63.1 ± 1.3
(n=4). After 24 h treatment, the cell viabilities were 73.5 ± 1.5, 94.1 ± 1.5, 71.7 ± 1.8 and
83.6 ± 1.9, respectively. LPS and β-glucan were used at low concentrations in order to avoid
masking the effects of toxins, since especially LPS has high potency to stimulate the
production of proinflammatory cytokines. The selected concentrations, 5 ng/ml LPS and 100
ng/ml β-glucan, were not cytotoxic to cells, since the cell viabilities after 3 or 24 h treatments
were between 99.7 – 121%.
Synergistic interactions in the expression of TNFα and IL-1β were observed after
simultaneous treatment of cells with emodin, enniatin B and valinomycin together with LPS
or β-glucan (Fig.2). The interaction after co–exposure to sterigmatocystin and β-glucan or
LPS was additive (Fig.2A-D). For the combinations of emodin, enniatin B and valinomycin
plus LPS or β-glucan, the synergistic interactions in protein secretion of both cytokines
(Fig.2A,B) were notably higher than in the corresponding mRNA expressions (Fig.2C,D).
The strongest synergistic interaction was observed after simultaneous treatment of enniatin B
and LPS; the calculated ratios of measured co-response to the sum of individual responses
were over 8 for the production of both TNFα and IL-1β (Fig.2A,B). The calculated ratios also
revealed that the co-treatment with toxins and β-glucan caused somewhat stronger synergistic
effects in TNFα responses than toxins and LPS (Fig.2A,C). At the mRNA level of IL-1β, the
co-effects of these toxins and β-glucan or LPS were only slightly increased, but very high at
the protein level (Fig.2B,D).
Effects of co-exposure on cell morphology
TEM revealed increased mitochondrial damage after simultaneously 24-h co-
exposure to toxins and structural components (Fig.3) in almost every sample. Mitochondrial
swelling and fracture of cristae were especially evident after co-exposure of cells to
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.13
valinomycin and β-glucan or LPS, but not so obvious in cells treated with valinomycin alone.
Mild mitochondrial damage was also seen after exposure to β-glucan or LPS alone in some
samples. Another common consequence of co-exposure was induction of autophagocytosis.
The increased number of autophagosomes was observed in particular after exposure to LPS
together with enniatin B, valinomycin (Fig.3) or sterigmatocystin. Sterigmatocystin alone
caused also disruption of cell and nuclear membranes in about half of the treated cells (data
not shown). Co-treatment of cells with enniatin B, sterigmatocystin or valinomycin together
with β-glucan or LPS caused more damage to organelles than emodin together with β-glucan
or LPS (data not shown).
Vacuolization was very common in all treated cells, but it was observed also in cells
treated with vehicle only (0.1 % DMSO) as compared to untreated control cells. Cytoplasmic
vacuoles differed in size and state of condensation among different treatments (Fig.3).
In SEM, enniatin B revealed a lot of vacuolization, which was stronger after co-
treatment with β-glucan and LPS. Ample vacuolization was also seen after combined
exposure to valinomycin and β-glucan, and some after co-treatment with LPS (data not
shown). Overall, electron microscopy revealed that co-exposure to toxins with β-glucan or
LPS clearly increased the severity of damage.
Effects of co-exposure on inflammatory-related genes
In the PCR array, emodin (40 μM), enniatin B (5 μM) and valinomycin (5 nM) alone
evoked slight up- or downregulations of inflammatory response associated genes (encoding
e.g. chemokines, cytokines and interleukins, as well as their receptors). Even a very low
concentration of LPS (5 ng/ml) strongly increased the expression of several genes. The
magnitude of fold changes after treatment of cells with low concentration of β-glucan (100
ng/ml) was on average between the effects of toxins and LPS.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.14
When the combined response of toxin and LPS was divided by the effect of LPS
alone, the overall trend was that emodin and enniatin B seemed to inhibit the effects of LPS
(Fig.4). When taking into account only over two-fold changes in this ratio, emodin, enniatin
B and valinomycin inhibited the expression of 12, 24 and 10 genes, respectively. The
strongest inhibitory effects on LPS-induced inflammatory responses of individual genes were
seen after emodin exposure (Figure S1). On the contrary, toxins largely potentiated the
effects of β-glucan. Simultaneous exposure to β-glucan and emodin, enniatin B or
valinomycin synergistically increased the expression of 28, 34 and 36 genes, respectively,
over two-fold of the effects caused by β-glucan alone (Fig.4).
Discussion
We show here that microbial toxins abundant in moisture-damaged indoor
environments can act synergistically in co-exposures with bacterial and fungal structural
components, drastically increasing the severity of proinflammatory responses in human
macrophages. These synergistic effects are apparent already at concentrations where the
toxins alone show only slight or modest effects. It is also noteworthy that this synergistic
interaction is seen at very low concentrations of LPS and β-glucan. In addition, simultaneous
co-exposure to toxins and structural components caused more morphological changes than
individual exposures alone. This synergistic nature of interactions may help in understanding
the adverse health effects observed in occupants of moisture damaged buildings, where
exposure situations are characterized by complex mixtures of individual microbial and
chemical agents, and the levels of individual exposing agents are often not sufficiently high
to explain the health complaints.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.15
The fungal toxins used in this study (emodin, enniatin B, physcion, and
sterigmatocystin) represent compounds abundantly present in moisture-damaged indoor
environments, some of them at high prevalence, such as emodin, enniatin B or physcion
(Kirjavainen et al., 2015; Peitzsch et al., 2012; Täubel et al., 2011). While some of these
compounds (emodin, physcion) are not exclusively produced by filamentous fungi but also
by some plants or might not be produced by species that are part of what are considered
traditionally building fungi (enniatins), we have observed associations of these compounds
with moisture damage and indoor dampness in those studies listed and some further, yet
unpublished work. We consciously chose to base our selection of model toxins on actual
measurement data from partly extensive indoor sample materials, using analytical
methodology targeting a large variety of different fungal and bacterial secondary metabolites,
rather than restricting to the ‘classic’ indoor mycotoxins, such as macrocyclic trichothecenes,
sterigmatocystin and some Penicillium metabolites only. Co-occurrence of fungal metabolites
with bacterial toxins has been shown (Täubel et al., 2011), which is why valinomycin was
included here. It is evident, however, that toxic microbial compounds also occur in buildings
without moisture problems (Kirjavainen et al., 2015; Peitzsch et al., 2012), meaning that
microbial toxins indoors is not a phenomenon of ‘moldy buildings’ only. There are very little
data on cellular and health effects of these toxins since the vast majority of earlier studies
have concentrated on satratoxins and other macrocyclic trichothecenes that are potent
immunomodulators, but not highly prevalent in many European climates (Kirjavainen et al.,
2015; Peitzsch et al, 2012). Dose-response modelling of the cytokine and cell viability a data
revealed that the ionophore toxins valinomycin and enniatin B are more potent than the others
in almost all measured endpoints.
After detailed dose-response studies, we ended up using low concentrations of LPS
(5 ng/ml) and β-glucan (100 ng/ml) in order to avoid masking the effects of toxins in
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.16
interaction studies. Selected concentrations were sufficient to evoke a mild proinflammatory
response alone, but high enough to accomplish strong synergistic interactions in co-exposures
with toxins. In many previous in vitro studies, much higher LPS concentrations have been
used, typically 100 or 1000 ng/ml. In these studies, co-exposure to mycotoxins and LPS
either reduced the cytokine production (at 100 ng/ml) (Johannessen et al., 2009) or in most
studies increased it, sometimes synergistically (Gammelsrud, 2012; Islam and Pestka, 2006;
Kankkunen et al., 2009; Kankkunen et al., 2014; Zhou et al., 1999). The immune responses to
LPS can vary between species (Munford, 2010) and depend on the dose (Morris and Li,
2012).
We observed that the combinations of four fungal toxins at proportions mimicking
real-life exposure situations showed no enhanced effects on the TNFα or IL-1β mRNA levels,
but the presence of bacterial toxin valinomycin in the toxin mixture synergistically increased
the TNFα mRNA expression. Addition of LPS and β-glucan to these mixtures further
amplified the TNFα mRNA response. Interestingly, this synergistic joint effect was not
observed in the IL-1β expression, but the co-effect was mostly additive or even inhibitory. In
many earlier studies, additive or synergistic interaction induced by mycotoxin mixtures in
contaminated foodstuff (Alassane-Kpembi et al., 2013; Prosperini et al., 2014; Ruiz et al.,
2011; Wan et al., 2013) or by indoor relevant moulds (Mueller et al., 2013; Wan et al., 2013)
has also been described. The molecular mechanisms of studied toxins or toxicological
interactions were not explored in this study, but will be addressed in further investigations.
Co-exposure of human macrophages to enniatin B, emodin or valinomycin and
either β-glucan or LPS resulted in synergistic interactions in TNFα or IL-1β responses both at
the mRNA and protein level. Toxins together with β-glucan caused somewhat stronger
synergistic proinflammatory response than together with LPS. To our knowledge, co-effects
of toxins together with low concentrations of β-glucan and LPS have not been earlier
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.17
compared. When considering larger group of inflammatory related genes, combinations of
emodin, enniatin B and valinomycin together with β-glucan mainly potentiated the
expression of inflammatory-related genes, while emodin and enniatin B together with LPS
inhibited the expression of many of these genes. These observations suggest that structural
components and toxins together may have complex, even contrasting effects on immune
system depending on the combinations of exposing agents and their concentrations, and
therefore the consequences of total exposure are difficult to predict.
Our results show that interactions of toxins and structural components can cause
morphological changes in cells that are more severe than effects of individual agents alone.
These changes occurred at the same exposure levels as the synergistic effects on
proinflammatory responses. Co-exposure to toxins and structural components induced
mitochondrial damage and autophagocytosis. Swollen and distorted mitochondria have been
reported earlier in human NK cells exposed to valinomycin at 100 ng/ml (Paananen et al.,
2000). In our study, similar mitochondrial damage was induced by almost 20-fold lower
concentration of valinomycin only after co-exposure with either β-glucan or LPS. In mouse
RAW267.4 macrophages, 10 μM enniatin B caused increased vacuolization suggesting
induction of autophagy (Gammelsrud et al., 2012). We observed increased number of
vacuoles at 5 μM enniatin B, while induced autophagocytosis was more clearly detectable
after co-exposure with LPS. In general, autophagocytosis is a mechanism involving
degradation of unnecessary or dysfunctional cellular components, while mitochondrial
damage is more harmful since it directly affects cellular energy metabolism and cell activity.
Microbial toxins are non-volatile, but are associated and do get airborne with spores
or other particulate. Concentrations of toxins within spore’s immediate microenvironment
could be extremely high (Carey et al., 2012) and structural components are simultaneously
present, making local adverse effects on the site of impaction, e.g. lung cells, plausible
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.18
(Behm et al., 2012; Carey et al., 2012). Inhalation exposure to microbial agents is likely to be
toxicologically more significant than the other relevant routes of exposure. It has been shown
in mice that trichothecene mycotoxin T-2 is more toxic through inhalation than by ingestion
(Creasia et al., 1987). Only a few epidemiological studies with partly conflicting outcome
have investigated the association between inhaled toxins and health effects. An association
between mycotoxin load in school dust and nasal symptoms has been observed in Finnish
teachers (Zock et al., 2014). In contrast, a protective trend of a mycotoxin on respiratory
symptoms have been reported in school children in Malaysia (Cai et al., 2011) and no
association between asthma development and moisture-damage linked individual toxins in
homes of Finnish children (Kirjavainen et al., 2015). These results together with our findings
highlight the complexity of this phenomenon.
Conclusions
Microbial toxins potentiated the low-dose proinflammatory effects of the key
structural components of bacteria and fungi in human macrophages. These interactions in
proinflammatory cytokine responses were synergistic both at the mRNA and protein level
and accompanied by morphological alterations indicative of mitochondrial damage and
autophagy related activation pathways. Toxins together with the fungal cell component β-
glucan induced synergistic effects also on the expression of many other inflammatory related
genes, while interactions with the bacterial cell wall component LPS, were mostly inhibitory.
Therefore, an inflammatory response induced by complex exposures to multiple different
microbial agents are potentially significant and cannot be predicted based on data on one
individual component alone. The research on causative agents should be focused more on
mixtures since this is the most common scenario.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.19
Acknowledgments
We thank Arja Moilanen for excellent technical assistance.
Supporting Information
Additional Supporting Information may be found in the online version of this article:
Figure S1. Fold regulations in inflammation-related genes after co-exposure of THP-1 cells
to emodin (40 μM), enniatin B (5 μM) or valinomycin (5 nM) and β-glucan (100 ng/ml) or
LPS (5 ng/ml) for 3 h. The change in gene transcription caused by co-exposure to toxin and
structural component was divided by the effects of structural component alone (e.g. [Emo +
LPS]/LPS). Only genes showing ≥2-fold changes are shown.
References
Alassane-Kpembi, I., Kolf-Clauw, M., Gauthier, T., Abrami, R., Abiola, F.A.,
Oswald, I.P. and Puel, O. (2013) New insights into mycotoxin mixtures: the toxicity of low
doses of Type B trichothecenes on intestinal epithelial cells is synergistic, Toxicol. Appl.
Pharmacol., 272, 191-198.
Behm, C., Follmann, W. and Degen, G.H. (2012) Cytotoxic potency of mycotoxins
in cultures of V79 lung fibroblast cells, J. Toxicol. Environ. Health A, 75, 1226-1231.
Bennett, J.W. and Klich, M. (2003) Mycotoxins, Clin. Microbiol. Rev., 16, 497-516.
Cai, G.H., Hashim, J.H., Hashim, Z., Ali, F., Bloom, E., Larsson, L., Lampa, E. and
Norback, D. (2011) Fungal DNA, allergens, mycotoxins and associations with asthmatic
symptoms among pupils in schools from Johor Bahru, Malaysia, Pediatr. Allergy Immunol.,
22, 290-297.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.20
Carey, S.A., Plopper, C.G., Hyde, D.M., Islam, Z., Pestka, J.J. and Harkema, J.R.
(2012) Satratoxin-G from the black mold Stachybotrys chartarum induces rhinitis and
apoptosis of olfactory sensory neurons in the nasal airways of rhesus monkeys, Toxicol.
Pathol., 40, 887-898.
Chanput, W., Mes, J.J. and Wichers, H.J. (2014) THP-1 cell line: an in vitro cell
model for immune modulation approach, Int. Immunopharmacol., 23, 37-45.
Council for Agricultural Science and Technology (CAST). (2003) Mycotoxins: Risk
in plant, animal, and human systems. Ames, Iowa, USA, Task force report 139, 13-15.
Creasia, D.A., Thurman, J.D., Jones, L.J.,3rd, Nealley, M.L., York, C.G.,
Wannemacher, R.W.,Jr and Bunner, D.L. (1987) Acute inhalation toxicity of T-2 mycotoxin
in mice, Fundam. Appl. Toxicol., 8, 230-235.
Dearborn, D.G., Yike, I., Sorenson, W.G., Miller, M.J. and Etzel, R.A. (1999)
Overview of investigations into pulmonary hemorrhage among infants in Cleveland, Ohio,
Environ. Health Perspect., 107, 495-499.
Etzel, R.A., Montana, E., Sorenson, W.G., Kullman, G.J., Allan, T.M., Dearborn,
D.G., Olson, D.R., Jarvis, B.B. and Miller, J.D. (1998) Acute pulmonary hemorrhage in
infants associated with exposure to Stachybotrys atra and other fungi, Arch. Pediatr. Adolesc.
Med., 152, 757-762.
Flappan, S.M., Portnoy, J., Jones, P. and Barnes, C. (1999) Infant pulmonary
hemorrhage in a suburban home with water damage and mold (Stachybotrys atra), Environ.
Health Perspect., 107, 927-930.
Gammelsrud, A., Solhaug, A., Dendele, B., Sandberg, W.J., Ivanova, L., Kocbach
Bolling, A., Lagadic-Gossmann, D., Refsnes, M., Becher, R., Eriksen, G. and Holme, J.A.
(2012) Enniatin B-induced cell death and inflammatory responses in RAW 267.4 murine
macrophages, Toxicol. Appl. Pharmacol., 261, 74-87.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.21
Huttunen, K., Pelkonen, J., Nielsen, K.F., Nuutinen, U., Jussila, J. and Hirvonen,
M.-R. (2004) Synergistic interaction in simultaneous exposure to Streptomyces californicus
and Stachybotrys chartarum, Environ. Health Perspect., 112, 659-665.
Huttunen, K., Tirkkonen, J., Täubel, M., Krop, E., Mikkonen, S., Pekkanen, J.,
Heederik, D., Zock, J.P., Hyvärinen, A. and Hirvonen, M.-R. (2015) Inflammatory potential
in relation to the microbial content of settled dust samples collected from moisture-damaged
and reference schools: results of HITEA study, Indoor Air (in press).
Islam, Z., Amuzie, C.J., Harkema, J.R. and Pestka, J.J. (2007) Neurotoxicity and
inflammation in the nasal airways of mice exposed to the macrocyclic trichothecene
mycotoxin roridin a: kinetics and potentiation by bacterial lipopolysaccharide coexposure,
Toxicol. Sci., 98, 526-541.
Islam, Z. and Pestka, J.J. (2006) LPS priming potentiates and prolongs
proinflammatory cytokine response to the trichothecene deoxynivalenol in the mouse,
Toxicol. Appl. Pharmacol., 211, 53-63.
Jarvis, B.B., Sorenson, W.G., Hintikka, E.L., Nikulin, M., Zhou, Y., Jiang, J., Wang,
S., Hinkley, S., Etzel, R.A. and Dearborn, D. (1998) Study of toxin production by isolates of
Stachybotrys chartarum and Memnoniella echinata isolated during a study of pulmonary
hemosiderosis in infants, Appl. Environ. Microbiol., 64, 3620-3625.
Johannessen, L., Lovik, M., Lydersen, S. and Nilsen, A.M. (2009) Combined cell
wall polysaccharide, mycotoxin and bacterial lipopolysaccharide exposure and inflammatory
cytokine responses, APMIS, 117, 507-517.
Johanning, E., Biagini, R., Hull, D., Morey, P., Jarvis, B. and Landsbergis, P. (1996)
Health and immunology study following exposure to toxigenic fungi (Stachybotrys
chartarum) in a water-damaged office environment, Int. Arch. Occup. Environ. Health, 68,
207-218.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.22
Kamyar, M., Rawnduzi, P., Studenik, C.R., Kouri, K. and Lemmens-Gruber, R.
(2004) Investigation of the electrophysiological properties of enniatins, Arch. Biochem.
Biophys., 429, 215-223.
Kanchongkittiphon, W., Mendell, M.J., Gaffin, J.M., Wang, G. and Phipatanakul,
W. (2015) Indoor environmental exposures and exacerbation of asthma: an update to the
2000 review by the institute of medicine, Environ. Health Perspect., 123, 6-20.
Kankkunen, P., Rintahaka, J., Aalto, A., Leino, M., Majuri, M.L., Alenius, H.,
Wolff, H. and Matikainen, S. (2009) Trichothecene mycotoxins activate inflammatory
response in human macrophages, J. Immunol., 182, 6418-6425.
Kankkunen, P., Välimäki, E., Rintahaka, J., Palomäki, J., Nyman, T., Alenius, H.,
Wolff, H. and Matikainen, S. (2014) Trichothecene mycotoxins activate NLRP3
inflammasome through a P2X7 receptor and Src tyrosine kinase dependent pathway, Hum.
Immunol., 75, 134-140.
Kirjavainen, P.V., Täubel, M., Karvonen, A.M., Sulyok, M., Tiittanen, P., Krska, R.,
Hyvärinen, A. and Pekkanen, J. (2015) Microbial secondary metabolites in homes in
association with moisture damage and asthma, Indoor Air (in press).
Koskela, A., Viluksela, M., Keinänen, M., Tuukkanen, J. and Korkalainen, M.
(2012) Synergistic effects of tributyltin and 2,3,7,8-tetrachlorodibenzo-p-dioxin on
differentiating osteoblasts and osteoclasts, Toxicol. Appl. Pharmacol., 263, 210-217.
Mendell, M.J., Mirer, A.G., Cheung, K., Tong, M. and Douwes, J. (2011)
Respiratory and allergic health effects of dampness, mold, and dampness-related agents: a
review of the epidemiologic evidence, Environ. Health Perspect., 119, 748-756.
Miller, J.D. and McMullin, D.R. (2014) Fungal secondary metabolites as harmful
indoor air contaminants: 10 years on, Appl. Microbiol. Biotechnol., 98, 9953-9966.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.23
Morris, M. and Li, L. (2012) Molecular mechanisms and pathological consequences
of endotoxin tolerance and priming, Arch. Immunol. Ther. Exp., 60, 13-18.
Mueller, A., Schlink, U., Wichmann, G., Bauer, M., Graebsch, C., Schüürmann, G.
and Herbarth, O. (2013) Individual and combined effects of mycotoxins from typical indoor
moulds, Toxicol. In Vitro, 27, 1970-1978.
Munford, R.S. (2010) Murine responses to endotoxin: another dirty little secret? J.
Infect. Dis., 201, 175-177.
Murtoniemi, T., Penttinen, P., Nevalainen, A. and Hirvonen, M-.R. (2005) Effects of
microbial cocultivation on inflammatory and cytotoxic potential of spores, Inhal. Toxicol.,
17, 681-693.
Nevalainen, A., Täubel, M. and Hyvärinen, A. (2015) Indoor fungi: companions and
contaminants, Indoor Air, 25, 125-156.
Nielsen, K.F. (2003) Mycotoxin production by indoor molds, Fungal Genet. Biol.,
39, 103-117.
Paananen, A., Mikkola, R., Sareneva, T., Matikainen, S., Andersson, M., Julkunen,
I., Salkinoja-Salonen, M.S. and Timonen, T. (2000) Inhibition of human NK cell function by
valinomycin, a toxin from Streptomyces griseus in indoor air, Infect. Immun., 68, 165-169.
Peitzsch, M., Sulyok, M., Täubel, M., Vishwanath, V., Krop, E., Borras-Santos, A.,
Hyvärinen, A., Nevalainen, A., Krska, R. and Larsson, L. (2012) Microbial secondary
metabolites in school buildings inspected for moisture damage in Finland, The Netherlands
and Spain, J. Environ. Monit., 14, 2044-2053.
Penttinen, P., Huttunen, K., Pelkonen, J. and Hirvonen, M.-R. (2005) The
proportions of Streptomyces californicus and Stachybotrys chartarum in simultaneous
exposure affect inflammatory responses in mouse RAW264.7 macrophages, Inhal. Toxicol.,
17, 79-85.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.24
Pestka, J. and Zhou, H.R. (2006) Toll-like receptor priming sensitizes macrophages
to proinflammatory cytokine gene induction by deoxynivalenol and other toxicants, Toxicol.
Sci., 92, 445-455.
Prosperini, A., Font, G. and Ruiz, M.J. (2014) Interaction effects of Fusarium
enniatins (A, A1, B and B1) combinations on in vitro cytotoxicity of Caco-2 cells, Toxicol. In
Vitro, 28, 88-94.
Ruiz, M.J., Macakova, P., Juan-Garcia, A. and Font, G. (2011) Cytotoxic effects of
mycotoxin combinations in mammalian kidney cells, Food Chem. Toxicol., 49, 2718-2724.
Slob, W. (2002) Dose-response modeling of continuous endpoints, Toxicol. Sci., 66,
298-312.
Täubel, M. and Hyvärinen, A. (2015) Occurrence of Mycotoxins in Indoor
Environments, Environmental Mycology in Public Health: Fungi and Mycotoxins Risk
Assessment and Management. Academic Press, 291-316.
Täubel, M., Sulyok, M., Vishwanath, V., Bloom, E., Turunen, M., Järvi, K.,
Kauhanen, E., Krska, R., Hyvärinen, A., Larsson, L. and Nevalainen, A. (2011) Co-
occurrence of toxic bacterial and fungal secondary metabolites in moisture-damaged indoor
environments, Indoor Air, 21, 368-375.
Tonshin, A.A., Teplova, V.V., Andersson, M.A. and Salkinoja-Salonen, M.S. (2010)
The Fusarium mycotoxins enniatins and beauvericin cause mitochondrial dysfunction by
affecting the mitochondrial volume regulation, oxidative phosphorylation and ion
homeostasis, Toxicology, 276, 49-57.
Wan, L.M., Woo, C.J., Turner, P.C., Wan, J.M. and El-Nezami, H. (2013) Individual
and combined effects of Fusarium toxins on the mRNA expression of pro-inflammatory
cytokines in swine jejunal epithelial cells, Toxicol. Lett., 220, 238-246.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.25
World Health Organization. (2009) WHO Guidelines for Indoor Air Quality:
Dampness and Mould, Copenhagen, WHO Regional Office for Europe.
Zhou, H.R., Harkema, J.R., Yan, D. and Pestka, J.J. (1999) Amplified
proinflammatory cytokine expression and toxicity in mice coexposed to lipopolysaccharide
and the trichothecene vomitoxin (deoxynivalenol), J. Toxicol. Environ. Health A, 57, 115-
136.
Zock, J.P., Borras-Santos, A., Jacobs, J., Täubel, M., Espinosa, A., Haverinen-
Shaughnessy, U., Peitsch, M., Sulyok, M., Hyvärinen, A. (2014) Dampness and microbial
secondary metabolites in schools and respiratory symptoms in teachers. In: European
Respiratory Society Annual Conference, Munich, Abstract 2161.
Figure legends
Fig.1. TNFα (A) and IL-1β (B) mRNA responses after treatment of macrophages derived
from THP-1 monocytic cells with mixtures of toxins consisting of 10 μg/ml emodin (Emo),
0.5 μg/ml enniatin B (EnB), 25 μg/ml physcion (Phy), 0.5 μg/ml sterigmatocystin (Ste) and
0.01 μg/ml valinomycin (Val) alone and together with structural components 5 ng/ml LPS
and 100 ng/ml β-glucan (β-glu) for 3 h. Columns represent mean ± SE of 3 replicates from
one representative experiments out of two independent experiment. Statistically significant
differences (p<0.05) are indicated by a, b or c: a, different from medium control; b, different
from β-glucan+LPS; and c, different from the same toxin mixture without β-glucan+LPS.
Fig.2. The production of TNFα (A) and IL-1β (B) protein and the mRNA expression of
TNFα (C) and IL-1β (D) in macrophages derived from THP-1 monocytic cells. Cells were
exposed to emodin, enniatin B or valinomycin (at concentrations of 40 μM, 5 μM and 5 nM,
respectively) and structural components (=SC) β-glucan (100 ng/ml) or LPS (5 ng/ml) alone
and in combinations. TNFα and IL-1β mRNA expression was measured after 3 h and protein
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.26
secretion after 24 h exposure. Columns represent mean ± SE of 3 replicates from 3-7 (mRNA
expression) or 2 (protein secretion; one experiment with sterigmatocystin) independent
experiments.
Fig.3. TEM images after 24 h treatment of macrophages derived from THP-1 cells with
toxins enniatin B (5 μM) and valinomycin (5 nM) alone and simultaneously with structural
components β-glucan (100 ng/ml) or LPS (5 ng/ml). Cells were also treated with structural
components and DMSO vehicle (0.1 %) (upper panel). Examples of damaged mitochondria
are indicated with yellow arrows, autophagosomes with green and condensed vacuoles with
blue arrows. Scale bar is 2 μm.
Fig.4. Interactions in inflammation-related genes after co-exposure of THP-1 cells to emodin
(40 μM), enniatin B (5 μM) or valinomycin (5 nM) and β-glucan (100 ng/ml) or LPS (5
ng/ml) for 3 h. The change in gene transcription caused by co-exposure to toxin and structural
component was divided by the effects of structural component alone (e.g. (Emo + LPS)/LPS).
Only ≥2-fold changes are shown. Red color indicates upregulation (addition/synergism),
green downregulation (inhibition) and grey no interaction (< 2-fold change).
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.27
Table 1: Half-maximal effective concentrations of toxins (EC50) and 95% confidence
intervals for cytokine mRNA responses and cell viability. Dose-responses for cytokine
expression after 3 h exposure and for cell viability after 3 and 24 h exposure were modelled
by PROAST using exponential and Hill model families.
Endpoint EC50 (95% confidence intervals) in μM
Emodin Enniatin B Sterigmatocystin Valinomycin
TNFα mRNA 42.9
(41.5 - 73.5)
2.4
(1.4 - 3.4)
10.3
(9.4 - 12.0)
0.037
(0.025 – 0.079)
IL-1β mRNA 15.1
(13.5 - 16.7)
1.8
(1.0 - 2.5)
11.5
(10.6 - 13.9)
0.006
(0.005 – 0.007)
Cell viability,
3 h
82.0
(77.6 - 87.7)
19.9
(17.4 - 23.1)
NA
0.006
(0.006 – 0.007)
Cell viability,
24 h
79.3
(69.6 - 91.3)
26.4
(13.7 - 74.0)
57.5
(41.1 - 95.7)
0.009
(0.007 – 0.010)
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.28
NA= not applicable (no dose response)