Recombinant Enzymes in Pyrosequencing …9615/FULLTEXT01.pdfRecombinant Enzymes in Pyrosequencing Technology 1 1. Introduction The discovery of more than 30 years ago, of restriction

i

Recombinant Enzymes in PyrosequencingTechnology

Nader Nourizad

Royal Institute of TechnologyDepartment of Biotechnology

Stockholm 2004

ii

©Nader Nourizad

Nader NourizadDepartment of BiotechnologyRoyal Institute of TechnologyAlbaNovaSE-106 91 StockholmSweden

Printed at Universitetsservice US ABBox 700 14100 44Sweden

ISBN 91-7283-756-X

iii

Nader Nourizad (2004): Recombinant Enzymes in Pyrosequencing technology.Doctoral dissertation from the Department of Biotechnology, Royal Institute ofTechnology, Stockholm, Sweden.

ISBN 91-7283-756-X

AbstractPyrosequencing is a DNA sequencing method based on the detection of released

pyrophosphate (PPi) during DNA synthesis. In a cascade of enzymatic reactions,visible light is generated, which is proportional to the number of nucleotidesincorporated into the DNA template. When dNTP(s) are incorporated into the DNAtemplate, inorganic PPi is released. The released PPi is converted to ATP by ATPsulfurylase, which provides the energy to luciferase to oxidize luciferin and generatelight. The excess of dNTP(s) and the ATP produced are removed by the nucleotidedegrading enzyme apyrase.

The commercially available enzymes, isolated from native sources, show batch-to-batch variations in activity and quality, which decrease the efficiency of thePyrosequencing reaction. Therefore, the aim of the research presented in this thesiswas to develop methods to recombinantly produce the enzymes used in thePyrosequencing method. Production of the nucleotide degrading enzyme apyrase byPichia pastoris expression system, both in small-scale and in an optimized large-scalebioreactor, is described. ATP sulfurylase, the second enzyme in the Pyrosequencingreaction, was produced in Escherichia coli. The protein was purified and utilized inthe Pyrosequencing method. Problems associated with enzyme contamination (NDPkinase) and batch-to-batch variations were eliminated by the use of the recombinantATP sulfurylase.

As a first step towards sequencing on chip-format, SSB-(single-strand DNAbinding protein)-luciferase and Klenow DNA polymerase-luciferase fusion proteinswere generated in order to immobilize the luciferase onto the DNA template.

The application field for the Pyrosequencing technology was expanded byintroduction of a new method for clone checking and a new method for templatepreparation prior the Pyrosequencing reaction.

Keywords: apyrase, Pyrosequencing technology, Zbasic tag fusion, luciferase, ATPsulfurylase, dsDNA sequencing, clone checking, Klenow-luciferase, SSB-luciferase,Pichia pastoris, Echerichia coli.

©Nader Nourizad

iv

v

To my family Ann Britt, Sarah and Sam

vi

vii

Have a vision, future is yours

viii

ix

This thesis is based on the following publications, which in the text will be referred to

by their roman numerical:

List of publications

I. Nourizad, N., Ehn, M., Gharizadeh, B., Hober, S. and Nyrén, P. (2003)

Methylotrophic yeast Pichia pastoris as a host for production of ATP-diphosphohydrolase (apyrase) from potato tubers (Solanum tuberosum).

Protein Expr. Purif. 27(2): 229-37.

II. Nourizad, N., Salmalian, R., Jahic, M., Henriksson, H., Enfors, S.O., Veide,

A. and Nyrén, P. (2004) High Level Production of ATP-diphosphohydrolase(apyrase) from potato tubers (Solanum tuberosum) in Fed-batch mode in

Methylotrophic yeast Pichia pastoris. Manuscript.

III. Nordström, T., Nourizad, K., Ronaghi, M. and Nyrén, P. (2000) Method

enabling Pyrosequencing on double-stranded DNA. Anal. Biochem. 1: 282(2):186-93.

IV. Karamohamed, S., Nilsson, J., Nourizad, K., Ronaghi, M., Pettersson, B. and

Nyrén, P. (1999) Production, purification, and luminometric analysis of

recombinant Saccharomyces cerevisiae MET3 adenosine triphosphatesulfurylase expressed in Escherichia coli. Protein Expr. Purif. 15(3):381-8.

V. Gharizadeh, B., Eriksson, J., Nourizad, N. and Nyrén, P. (2004)

Improvements in Pyrosequencing technology by employing Sequenase

polymerase. Anal. Biochem. In press.

VI. Ehn, M., Nourizad, N., Bergström, K., Ahmadian, A., Nyrén, P., Lundeberg,

J. and Hober, S. (2004) Towards Pyrosequencing on surface-attached geneticmaterial by use of DNA binding luciferase fusion proteins. Anal. Biochem. In

press.

VII. Nourizad, N., Gharizadeh, B. and Nyrén, P. (2003) Method for clone

checking. Electrophoresis 24: 1712-5.

x

xi

Table of contents1. INTRODUCTION..................................................................................................................................... 1

2. DNA SEQUENCING TECHNOLOGIES.............................................................................................. 2

2.1. THE SANGER METHOD ......................................................................................................................... 22.2. THE MAXAM-GILBERT METHOD ......................................................................................................... 52.3. PYROSEQUENCING TECHNOLOGY........................................................................................................ 7

3. PROTEINS IN THE PYROSEQUENCING METHOD ..................................................................... 9

3.1. DNA POLYMERASE.............................................................................................................................. 93.2. ATP SULFURYLASE ........................................................................................................................... 113.3. LUCIFERASE....................................................................................................................................... 123.4. APYRASE............................................................................................................................................ 133.5. SINGLE-STRANDED DNA-BINDING PROTEIN (SSB).......................................................................... 14

4. RECOMBINANT PROTEIN EXPRESSION..................................................................................... 15

4.1. ESCHERICHIA COLI.............................................................................................................................. 154.2. YEAST ................................................................................................................................................ 184.3. FILAMENTOUS FUNGI......................................................................................................................... 204.4. INSECT CELLS..................................................................................................................................... 214.5. PLANT CELLS ..................................................................................................................................... 224.6. CHINESE HAMSTER OVARY CELLS (CHO) AND MAMMALIAN CELLS ............................................... 234.7. TRANSGENIC ANIMALS ...................................................................................................................... 23

5. PROTEIN PURIFICATION ................................................................................................................. 25

5.1. CHROMATOGRAPHIC METHODS......................................................................................................... 255.1.1. Gel filtration (Size Exclusion Chromatography) ..................................................................... 255.1.2. Ion exchange chromatography ................................................................................................. 265.1.3. Hydrophobic interaction chromatography (HIC).................................................................... 265.1.4. Reversed phase chromatography (RPC).................................................................................. 275.1.5. Affinity chromatography........................................................................................................... 27

5.1.5.1. IMAC (Immobilized metal affinity chromatography).......................................................................285.1.5.2. Staphylococcal protein A and its derivates (Z, Zbasic, ZZ).................................................................29

6. PRESENT INVESTIGATION .............................................................................................................. 30

6.1. RECOMBINANT APYRASE (PAPER I, II, III) ........................................................................................ 306.1.1. Small-scale production of apyrase (paper I) ........................................................................... 30

6.1.1.1. Characterization of recombinant apyrase...........................................................................................336.1.2. Large-scale production of apyrase (paper II) ......................................................................... 34

6.2. APPLICATION OF APYRASE IN THE PYROSEQUENCING TECHNOLOGY .............................................. 366.2.1. Recombinant apyrase in the Pyrosequencing reaction ........................................................... 366.2.2. Application of apyrase for template preparation prior the Pyrosequencing reaction........... 37

6.2.2.1. Single-strand method..........................................................................................................................376.2.2.2. Double-strand method (III).................................................................................................................38

6.3. RECOMBINANT ATP SULFURYLASE (IV).......................................................................................... 416.4. DNA POLYMERASES IN PYROSEQUENCING TECHNOLOGY (V) ........................................................ 426.5. FUSION PROTEINS (VI)....................................................................................................................... 446.6. CLONE CHECKING (VII)..................................................................................................................... 47

7. CONCLUDING REMARKS AND FUTURE TRENDS.................................................................... 50

ABBREVIATIONS ..................................................................................................................................... 51

ACKNOWLEDGEMENTS ....................................................................................................................... 53

REFERENCES ............................................................................................................................................ 56

ORIGINAL PAPERS

xii

Recombinant Enzymes in Pyrosequencing Technology

1

1. IntroductionThe discovery of more than 30 years ago, of restriction enzymes that restrict

genetic material, and ligases that joins restricted genetic material, led to a new

research field: recombinant DNA technology. This new technology allowed for

cloning of genes and also their expression in different host organisms (Linn andArber, 1968; Meselson and Yuan, 1968; Olivera and Lehman, 1967; Zimmerman et

al., 1967).During the past two decades techniques for production and purification of proteins

have enabled many of the advancements in biotechnology. Recombinant DNA

technologies have revolutionized the production of biomolecules (proteins) in largequantities. Together, these techniques have proven to be very powerful for production

and purification of different biological molecules.In the mid 1970´s methods for sequencing DNA were also introduced (Maxam

and Gilbert, 1977; Sanger et al., 1977b). In vitro mutagenesis was introduced by

Smith and co-workers at the university of British Columbia (Canada); syntheticoligonucleotides were used (Hutchison et al., 1978). The introduction of the

polymerase chain reaction (PCR) technique by Karry Mullis set a new epoch for the

field of recombinant DNA technology (Mullis and Faloona, 1987).The Pyrosequencing technology, which is based on real-time detection of DNA

synthesis by a bioluminometric strategy, was developed at the Royal Institute ofTechnology (KTH). This method has shown to be a versatile sequencing technology

suitable for many applications, such as SNP analysis, bacteria typing, virus typing,

fungi typing and tag sequencing. The Pyrosequencing technology is the firstalternative to the conventional Sanger method for de novo DNA sequencing.

This thesis briefly describes (i) different DNA sequencing methods, (ii) theproduction of proteins in different host organisms and (iii) purification methods for

proteins with or without fusion tags. The main aims of this thesis were to improve the

Pyrosequencing method by production of the enzymes involved in the methodrecombinantly and to expand the application field by introducing a new method for

clone checking and a new method for DNA template preparation prior thePyrosequencing reaction.

Nader Nourizad

2

2. DNA sequencing technologiesDNA sequencing techniques are used for determination of the precise order of

nucleotides in a DNA sample. These techniques are probably the most important

techniques available to the molecular biologist. DNA sequencing is used in many

different applications, such as forensic, diagnostic, evolutionary studies, and fordetermination of the entire genome sequence of organisms ranging from yeast to

humans. The DNA sequencing technologies that are available and currently usedinclude the Sanger method, which is based on electrophoretic separation and detection

of synthesized single-stranded DNA molecules that have been terminated with

dideoxynucleotides (Sanger et al., 1977a), the Maxam-Gilbert method, which utilizeschemical degradation of the ssDNA (Maxam and Gilbert, 1977), sequencing-by-

hybridization, which is based on hybridization of a labeled ssDNA of unknownsequence to a set of sequence specific oligomers immobilized onto a solid support

(Drmanac et al., 1989) and the Pyrosequencing technology, a recently developed

sequencing method based on a luminometric approach (Nyrén, 2001; Ronaghi et al.,1998).

The following section will focus on the Sanger method, the Maxam-Gilbert

method and the Pyrosequencing technology.

2.1. The Sanger methodThe Sanger method (Sanger et al., 1977b) enabled scientists to efficiently

sequence DNA. This sequencing method is simple and elegant and after more than a

quarter of a century after its development is still frequently used with moreadvancement in chemistry and automation. In this method, ssDNA serves as a

template for in vitro DNA synthesis using an oligonucleotide (primer) with asequence complementary to the 5’-end of the template. DNA polymerase extends the

DNA strand complementary to the template starting at the 3’-end of the primer. In the

sequencing reaction the natural dNTPs are mixed with dideoxy nucleotides (ddNTPs).ddNTPs lack the hydroxyl group on the 3’-end and thus, terminate elongation of the

DNA chain by DNA polymerase. In this method four parallel DNA elongationreactions are run with dNTPs/ddATP, dNTPs/ddCTP, dNTPs/ddGTP and


3

dNTPs/ddTTP, respectively. As the dNTPs in the reaction are in excess compared to

the ddNTPs, different lengths of the DNA fragments can be obtained.The separation of the Sanger fragments is usually performed electrophoretically,

although mass spectrometry analysis has also been described (Jacobson et al., 1991;Murray, 1996). Previously, the detection of the fragments were performed by

radioactivity. The four samples were loaded onto a slab polyacrylamide gel and

separated by electrophoresis, and then the separation pattern was deduced from thedeveloped autoradiograms. These days, the radioactivity has been replaced by

fluorescent dyes and, the fragments are detected after excitation by a laser beam. Bylabeling the four ddNTPs with different fluorescent dyes, the four separate Sanger

reactions can be performed in one reaction and no modification of the primer is

required (Fig. 1). This technique has been fully automated after replacing the slab gelelectrophoresis step, which required manual gel casting and sample loading, with

capillary electrophoresis.

Nader Nourizad

4

Figure 1. A schematic drawing of the principle of the Sanger DNA sequencing method. A primed-template is used to synthesize a complementary DNA strand. The nucleotide concentration of eachddNTP and each of the four dNTPs is adjusted to produce DNA fragments terminated equal at everyddNTP position along the DNA. The labeled fragments are then separated by gel electrophoresis andthereby, allowing reconstruction of DNA sequence from the separation pattern.

3’

5’- 5’A T A G T C C G G T A C A C

Divided into four Sanger reactions

with polymerase extension and

fragment separation

dNTPsddATPDNA polymerase

dNTPsddGTPDNA polymerase

dNTPsddTTPDNA polymerase

dNTPsddCTPDNA polymerase

A C G T

Mig

ratio

n

Sequ

ence

rea

ding

ord

er

GTGTACCGGACTAT


5

2.2. The Maxam-Gilbert methodThe Maxam-Gilbert DNA sequencing method is based on chemical degradation of

ssDNA (Maxam and Gilbert, 1977). In this method the DNA is amplified either by

PCR or bacteria. After DNA amplification, the double-stranded DNA-molecules are

labeled with radioactive phosphate (32P) at only one end (5'-end) of each strand withthe help of a special enzyme (polynucleotide kinase). The labeled DNA is divided into

four different reactions with different chemical reagents that cleave the DNAspecifically after A, C, G or T. The reaction conditions are such that each strand of

DNA in each sample is cut once at a random location along the bases—adenine (A),

guanine (G), cytosine (C) and thymine (T). The reactions result in mixtures of DNA-strands of different lengths (between one and several hundred nucleotides), with one

end representing one of the bases and the other end showing the 32P phosphate. Thesefragments are applied on parallel lanes on a sequencing gel and separated by gel

electrophoresis, according to their length. The result is detected by autoradiography

(Fig 2).

Nader Nourizad

6

Figure 2. A schematic illustration of the principle of the Maxam-Gilbert method.

3’- T A T C A G G C C A T G T G -32P 5’A T A G T C C G G T A C A C5’ 32P- -3’

5’- A T A G T C C G G T A C A C - 3’3’- T A T C A G G C C A T G T G - 5’

Enzymatic end-labeling ofeach strand with 32P

Single-strandpreparation

A T A G T C C G G T A C A C5’ 32P- -3’

Base specificcleavage

Reaction 1: Dimethylsulfate (alkaline) cuts G

Reaction 2: Dimethylsulfate (acidic) cuts G +A

Reaction 3: Hydrazine plus piperdine cuts C +T

Reaction 4: Hydrazine plus 2M NaCl cuts C

R1 R2 R3 R4

Mig

ratio

n

Sequ

ence

rea

ding

ord

er

CACATGGCCTGATA

Electroforesis andradioautography

3’- T A T C A G G C C A T G T G -32P 5’


7

2.3. Pyrosequencing technologyIn the Pyrosequencing method four different enzymes are used and the DNA

sequencing is monitored in real-time (Nyrén, 2001; Ronaghi et al., 1998). The overall

reactions are described as follow:

In this method, the sequencing reaction contains template DNA, a primer thathybridizes to the single-stranded DNA template, DNA polymerase, ATP sulfurylase,

luciferase and apyrase, and the substrates APS and luciferin. The four dNTPs are

added to the reaction mixture sequentially. When the DNA polymerase incorporatesthe complementary nucleotide onto the 3’-end of the primed DNA template, PPi is

released in a quantity equimolar to nucleotide incorporation. ATP sulfurylasequantitively converts PPi to ATP in the presence of APS. The ATP that is produced

drives the luciferase-mediated conversion of luciferin to oxyluciferin, which generates

visible light in amounts that is proportional to the amount of ATP. The light producedin the luciferase-catalyzed reaction is detected by a photon multiplier tube or CCD

camera, and is recorded as a peak in a pyrogram. Each light signal is proportional tothe number of nucleotides incorporated. Apyrase continuously degrades ATP and

unincorporated excess dNTPs. When degradation is complete, another dNTP is added.

Addition of dNTPs is performed one at a time. As the process continues, acomplementary DNA strand is formed and the nucleotide sequence is determined

from the signal peaks in the pyrogram (Fig. 3).

dNTP dNMP + 2 PPiApyrase

(DNA)n + dNTP DNA polymerase (DNA)n+1 + PPi

APS + PPiATP sulfurylase

ATP + SO42-

ATP + D-luciferin LightLuciferase

ATP AMP + 2 PPiApyrase

Nader Nourizad

8

Figure 3. The Pyrosequencing method is a non-electrophoretic real-time DNA sequencing method thatuses the luciferase-luciferin light release as the detection signal for nucleotide incorporation into targetDNA. The four different nucleotides are added iteratively to a four-enzyme mixture. Thepyrophosphate (PPi) released in the DNA polymerase-catalyzed reaction is quantitatively converted toATP by ATP sulfurylase, which provides the energy to firefly luciferase to oxidize luciferin andgenerate light (hu). The light is detected by a photon detection device and monitored in real time by acomputer program. Finally, apyrase catalyzes degradation of nucleotides that are not incorporated andthe system will be ready for the next nucleotide addition.


9

3. Proteins in the Pyrosequencing methodThe Pyrosequencing method utilizes an enzyme system involving four enzymes

(DNA polymerase, ATP sulfurylase, firefly luciferse, apyrase) and an extra protein

the single-stranded DNA-binding protein. This section briefly describes each of theseproteins.

3.1. DNA polymeraseDNA polymerases (E.C 2.7.7.7) fulfill various replicative and repair functions

within living cells to ensure the survival of all organisms and accurate transfer ofgenetic information to subsequent generations (Kornberg, 1988). Escherichia coli

DNA polymerase I and a virus originated T7 DNA polymerase have been the mostwidely studied of all polymerases. DNA polymerase I possess, in addition to

polymerase activity, both 3’-5’ and 5’-3’ exonuclease activity. By proteolytic

(subtilisin) cleavage of DNA polymerase I (109 kDa), a smaller fragment harboring5’-3’ exonuclease activity and one larger fragment (Klenow fragment) harboring both

polymerase and 3’-5’ exonuclease activity are obtained (Klenow et al., 1971). During

the polymerization process, nucleotides are incorporated at the 3’-end of anelongating DNA strand. This reaction is described by the following reaction formula:

The polymerase first binds to the 3’- hydroxyl group of the primer, hybridized to

the template DNA, and then selects the correct nucleotide. This selectivity improvesthe overall replication fidelity. Following nucleotide binding, a conformational

change occurs and the enzyme moves the nucleotide from the binding site to the

active site (Ramanathan et al., 2001). Formation of the chemical bond then takes placeby nucleophilic attack on the alpha-phosphorus of the nucleotide by the 3’- hydroxyl

group on the primer strand. The polymerase then releases PPi and either translocatesto the next available template position or dissociates from the template DNA

(Kornberg and Lorch, 1992).

(DNA)n + dNTPDNA polymerase

(DNA)n+1 + PPi

Nader Nourizad

10

The 3’-5’ exonuclease activity of the enzyme is responsible for proofreading ofthe elongated primer chain, to ensure high-fidelity replication in accordance with the

Watson-Crick base-paring rules. This activity acts in the opposite direction to DNA

synthesis and corrects polymerization errors by removing the dNMP before the DNAis further elongated (Brutlag and Kornberg, 1972). Notably, Klenow and T7 DNA

polymerases lack 5’-3’ exonuclease activity. Proof-reading activity in DNApolymerase I is responsible for removing DNA lesions in dsDNA or RNA/DNA

hybrids during excision repair.

The Klenow polymerase that is used in the Pyrosequencing technology is 3’-5’exonuclease deficient. The 3’-5’ exonuclease activity is removed by two point

mutations at the N-terminus of the enzyme without affecting the polymerase activity(Derbyshire et al., 1988).

The processivity of a DNA polymerase is defined as the average number of bases

polymerized per encounter of the enzyme with a DNA primer/template. Theprocessivity of DNA polymerase I (Klenow polymerase) is 20-50 nucleotides before

the enzyme dissociates from the primer-template. In contrast, when the T7polymerase binds to E. coli thioredoxin, an accessory protein, hundreds of nucleotides

are added before the enzyme dissociates (Tabor and Richardson, 1987). In order to

study the effect of the thioredoxin-binding domain from T7 DNA polymerase onDNA polymerase I, a genetic fusion was constructed that inserts this domain into the

homologous site of DNA polymerase I from E. coli. This chimeric polymerase

showed an increased processivity when it was bound to thioredoxin (Bedford et al.,1997).

The Km value for various dNTPs are different for Klenow polymerase, but it is inthe micromolar range (McClure and Jovin, 1975). For an efficient polymerization, the

nucleotide concentration should be above the Km. However, the polymerization step

has a lower fidelity when the nucleotide concentration is too high above the Km (Clineet al., 1996).

The Klenow polymerase and the T7 DNA polymerase are the only polymerasesthat have been used in the Pyrosequencing technology so far.


11

3.2. ATP sulfurylaseThe second reaction in the Pyrosequencing method is catalyzed by ATP

sulfurylase (E.C 2.7.7.4). In this reaction the PPi that is released upon DNA

polymerization is converted to ATP in the presence of APS (adenosinephosphosulfate). This reaction is described by the following formula:

The reduced form of sulfur (APS) is used in the biosynthesis of metabolites,

coenzymes and sulfolipids. ATP sulfurylase and APS kinase are responsible forcatalyzing the sequential steps that enable in the assimilation of sulfur. ATP

sulfurylase is involved in the first step and APS kinase in the second. In vivo, ATPsulfurylase catalyzes the production of APS and PPi from ATP and free sulfate. The

produced APS is further phosphorylated by APS kinase into adenosine 3’-phosphate

5’-phosphosulphate (PAPS), which is used to synthesize various sulphur- containingcompounds.

The equilibrium for APS production is unfavorable (Segel et al., 1987), whereas itis favorable for ATP synthesis (Robbins and Lipmann, 1958). However, the reaction

is pulled in the APS direction by the following removal of APS by APS kinase, and

the hydrolysis of PPi by inorganic pyrophosphatase. ATP sulphurylase activity has been found in many organisms, including baker’s

yeast, filamentous fungi (Segel et al., 1987), spinach leaf (Renosto et al., 1993) andrat (Brandan and Hirschberg, 1988). The genes encoding ATP sulfurylase have been

isolated from various species and the corresponding enzymes have been

characterized, e.g. E. coli (Leyh et al., 1988) and mouse (Li et al., 1995). The firstATP sulphurylase cloned was from the baker’s yeast, Saccharomyces cerevisiae,

namely the MET3 gene on chromosome X. This enzyme is the only commerciallyavailable ATP sulphurylase. The enzyme has a molecular weight of 315 kDa and

consists of six identical subunits (Segel et al., 1987). A recombinant form of the

enzyme has been successfully produced in E. coli (paper IV).

APS + PPiATP sulfurylase

ATP + SO42-

Nader Nourizad

12

3.3. LuciferaseThe progress of the Pyrosequencing reaction is continuously monitored by the

firefly luciferase reaction according to the following formula:

Since the dATP is a weak substrate for firefly luciferase, it has been replaced by amodified variant of this nucleotide (dATPaS) in the Pyrosequencing technology

(Ronaghi et al., 1998).

Light production in different organisms is catalyzed by luciferase (E.C. 1.13.12.7).

There are three major bioluminescent groups of beetles: Elateroidea (click beetles),Phengodidae (glow worms) and Lampyridae (firefly beetles) (Wood et al., 1989). The

light from the firefly beetles ranges from green to yellow (550-590nm). Since the lightproduced by luciferase can be monitored with great sensitivity, many applications

based on the luciferase reaction have been developed. These applications can be

divided into (i) reporter gene assays (Wibom et al., 1990), (ii) biomass assays (Thoreet al., 1975; Gallez et al., 2000; Niza-Riberio et al., 2000; Olsson et al., 1986), (iii)

monitoring of enzymes and molecular substances (Nyren and Lundin, 1985; Goswamiand Pande, 1984; Karamohamed and Guidotti, 2001) and (iv) immunoassays (Geiger

and Miska, 1987;Miska and Geiger, 1987; Kobatake et al., 1993).

The luciferase from the North American firefly, Photinus pyralis, was the first tobe cloned and sequenced (de Wet et al., 1986). This enzyme is a 61 kDa protein,

which produces light in the green-yellow region (550-590 nm) with an emission

maximum at 562 nm at the optimum pH between 7.5 - 8.5 (Sala-Newby et al., 1996).Several strategies including, site specific mutagenesis and using substrate analogs

have been used to identify and characterize the active site of firefly luciferase(Branchini et al., 1998; Branchini et al., 1999; Sala-Newby and Campbell, 1994;

Thompson et al., 1997). Different strategies have also been applied to increase the

thermostability of the enzyme, including addition of stabilizing compounds (Eriksson

ATP + D-luciferin LightLuciferase


13

et al., 2003) and by site specific mutagenesis of the enzyme (Kajiyama and Nakano,

1993; White et al., 1996).

3.4. ApyraseIn the Pyrosequencing reaction the excess of unincorporated nucleotides and ATP

that is generated are degraded by apyrase. The reaction formula is as follows:

Apyrase (ATP-diphophohydrolase, E.C. 3.6.1.5) catalyzes the hydrolysis of

pyrophosphate bonds in tri- and diphosphates and liberates orthophosphate (Traverso-Cori et al., 1965). Apyrase differs from other ATPases in several ways, such as

requiring divalent cations (e.g., Ca2+, Mg2+ etc) (Plesner, 1995) and being insensitive

to specific inhibitors of other types of ATPases (P-, F- and V types) (Handa andGuidotti, 1996).

Apyrases have been identified in different organisms and animal tissues. In animaltissues the enzyme is an integral membrane protein and controls the extracellular

concentration of tri- and diphospho nucleotides (Plesner, 1995; Komoszynski, 1996;

Zimmermann et al., 1998; Guranowski et al., 2000; Gendron et al., 2000; Heine et al.,1999; Boeck et al., 2002). The transmembrane domain of ectoapyrase affects its

activity and quaternary structure (Wang et al., 1998; Grinthal and Guidotti, 2000). Inplant tissues apyrase is found in the cytosolic (Valenzuela et al., 1989), nuclear (Hsieh

et al., 2000) and membrane fractions (Tognoli and Marre, 1981; Vara and Serrano,

1981); Valenzuela et al., 1998; Day et al., 2000). Thus, plant apyrases have ubiquitouslocalization, and appear to be involved in many different reactions, such as

recognition of exogenous carbohydrates (Etzler et al., 1999), phosphate nutrition(Thomas et al., 1999), legume nodulation (Day et al., 2000) and xenobiotic resistance

(Roberts et al., 1999; Thomas et al., 2000).

Potato apyrase is the most extensively studied apyrase and has a molecular weightof 49 kDa. In potato tuber, this enzyme exists in more than one molecular form

dNTP dNMP + 2 PPiApyrase

ATP AMP + 2 PPiApyrase

Nader Nourizad

14

depending on the clonal variety (Traverso-Cori et al., 1970). Apyrases from different

clonal sources show differences both in isoelectric point and relative rate ofhydrolysis of ATP and ADP (Traverso-Cori et al., 1970). Apyrase purified from

Solanum tuberosum var. Pimpernel (Pimpernel apyrase) has an ATPase/ADPase ratioclose to 10 (Del Campo et al., 1977), whereas apyrase isolated from the Desiré variety

(Desiré apyrase) has an ATPase/ADPase ratio close to 1 (Del Campo et al., 1977).

3.5. Single-stranded DNA-binding protein (SSB)The single-stranded DNA-binding protein (SSB) binds with high affinity to single-

stranded (ss) DNA and plays an important role in DNA replication, recombination,

and repair (Timothy et al., 1994). SSB does not possess any enzymatic activity and

has been referred to by many different names since its discovery in 1970, includingDNA-unwinding protein, DNA-melting protein or helix-destabilizing protein

(Timothy et al., 1994). However, the terms single-stranded DNA-binding protein

(SSB) and helix-destabilizing protein are now commonly used (Timothy et al., 1994).SSB is important for DNA replication in phage T4 (Gold et al., 1976), phage T7 (Kim

and Richardson, 1993), E. coli (Meyer et al., 1979) and yeast (Brill and Stillman,1991), and it is assumed that SSBs are important for all organisms. SSB from E. coli

(Eco SSB) forms a homotetramer in vivo where each monomer has a molecular

weight of 18.9 kDa.Since SSB stabilizes and prevents formation of secondary structures in ssDNA, it

has been used in different biotechnical applications, such as the polymerase chainreaction (PCR) (Dabrowski and Kur, 1999), site-directed mutagenesis with junction to

recA (McEntee et al., 1980), Sanger DNA sequencing (Ball and Desselberger, 1992)

and in the Pyrosequencing technology (Ronaghi, 2000).In the Pyrosequencing technology SSB is added to the primed DNA template prior

to the Pyrosequencing reaction. The addition of SSB to a Pyrosequencing reaction hasbeen shown to improve the read length of the Pyrosequencing technology, especially

for sequencing of difficult templates (Ronaghi, 2000). The application of SSB in the

Pyrosequencing technology has also facilitated the optimization of differentparameters, such as enabling a more flexible primer design and eliminating


15

intermediate washing steps that remove primers from the reaction mixture, which

could otherwise form primer-dimers or unspecifically bind the DNA template.

4. Recombinant protein expressionRecombinant DNA techniques are used for expression of genes from a variety of

sources in different host cells. Before the application of recombinant DNA techniques

for protein production, the target proteins were purified from native sources by manypurifications steps that usually resulted in low recovery. With the advent of modern

recombinant DNA techniques the pharmaceutical industry, and other protein-basedindustries, have been able to provide the market with proteins in quantities that were

previously impossible to obtain. The choice of host for the expression of heterologous

proteins depends mainly on the properties of the target protein and the final use of theexpressed protein. If the protein requires substantial post-translational modifications,

a eukaryotic host is the preferred choice.This section briefly describes some commonly used expression-hosts with respect

to their order of increasing complexity.

4.1. Escherichia coliThe most widely used host for heterologous protein production is the bacterium E.

coli. E. coli was used to produce the first recombinant protein of pharmaceutical

interest: recombinant human insulin (Johnson, 1983).

The E. coli system has several advantages compared to other systems: (i) it is wellcharacterized both genetically and physiologically, (ii) commercially available vectors

and strains are available, (iii) E. coli can be grow in inexpensive and simple media,(iv) E. coli has a short generation time (20 min) and (v) a number of cell manipulation

techniques are available.

A variety of promoters are available for recombinant protein production in the E.

coli system (Jonasson et al., 2002). Promoters can be either constitutive or inducible.

With a constitutive promoter, such as the promoter for Staphylococcal aureus protein

A (Lofdahl et al., 1983), a constant level of transcription of the target gene withsubsequent translation is obtained. Advantages of constitutive systems include

reduced formation of inclusion bodies and more efficient secretion of the target

Nader Nourizad

16

protein to the periplasmic space. With an inducible promoter system little or no

expression of the target protein is obtained before induction. An inducible promotersystem might be desirable if the recombinant protein is toxic to the host cell. A good

example of a commercially available inducible system is the pET system. In thissystem the tightly regulated T7 promoter is induced by addition of IPTG to the culture

medium (Studier and Moffatt, 1986). The T7 promoter is transcribed by the T7 phage

RNA polymerase, whose gene is integrated into the chromosome of the E. coli strainBL21 (DE3) and is regulated by the lac promoter. In E. coil strain BL21 (DE3)

transcription of the target gene is further repressed under non-induction conditions bythe activity of T7 lysozyme, an enzyme that degrades T7 RNA polymerase (Studier,

1991). Before induction the T7 lysozyme activity is sufficient for degradation of the

T7 RNA polymerase, but after induction of the cells with IPTG the amount of T7RNA polymerase increases tremendously and T7 RNA polymerase degradation is

negligible.

Other examples of inducible promoter systems are the arabinose promoter system,which is induced by addition of L-arabinose, the trp-promoter, which is induced by

either tryptophan starvation or addition of b-indoleacrylic acid (b-IAA) (Yansura and

Henner, 1990), and heat induced promoters, such as PL (l) (Bernard et al., 1979), PR

(l) (Nilsson and Abrahmsen, 1990) and lac (TS) (Hasan and Szybalski, 1995).

In the E. coli system recombinant proteins can be produced intracellularly, in the

periplasmic space or be secreted to the culture medium (Cornelis, 2000). Forsuccessful intracellular protein production it is important that the target proteins are

not susceptible to proteolysis (Maurizi, 1992; Gottesman and Maurizi, 1992), lackdisulphide bonds and are not toxic to the host cells. The level of protein production is

usually higher when expressed intracellularly than when secreted. However,

intracellularly produced products are often found in inclusion bodies. Proteins foundin inclusion bodies are easily isolated by centrifugation, but must generally be

refolded since they are found primarily in misfolded and denaturated states (Datar etal., 1993). In some cases, the denaturated protein can be solubilized and the enzyme

activity can be recovered after refolding (Rudolph and Lilie, 1996; Guise et al., 1996;

Mukhopadhyay, 1997; Lilie et al., 1998).


17

There are several strategies available to increase the overall solubility of

intracellularly expressed recombinant proteins. One strategy is to geneticallyincorporate a highly soluble fusion tag into the recombinant protein (Hammarstrom et

al., 2002). Examples of useful fusion tags are thioredoxin (LaVallie et al., 1993),Staphylococcal protein A and its derivatives (Z, Zbasic and ZZ) (Fig. 4) (Nilsson and

Abrahmsen, 1990; Nilsson et al., 1987), and Streptococcus protein G (Nygren et al.,

1988). In other strategies bacterial chaperones and foldases have been used to increasethe amount of soluble protein (Hockney, 1994; Buchner and Rudolph, 1991; Georgiou

and Valax, 1996; Samuelsson et al., 1996).In order to avoid inclusion body formation, it is sometimes preferable to direct the

recombinant protein to the periplasmic space using a signal peptide at the N-terminus

of the protein (Wulfing and Pluckthun, 1994). The signal peptides PhoA, MalE,OmpA and LamB, originate from E. coli (Blight et al., 1994). The secretory

machinery for targeting recombinant proteins to the periplasmic space has been

described by Muller (Muller et al., 2001). The periplasmic space of E. coli has anoxidizing environment, which enables formation of disulphide bonds that are

necessary for the correct folding of some proteins (Fabianek et al., 2000; Raina andMissiakas, 1997). A few signal peptides have been reported to secret the protein into

the culture media (Moks et al., 1986).

The choice of strategy for production of recombinant proteins is highly dependenton the nature of the target protein. It should be noted that the cytosol of E. coli

contains approximately 4000 proteins, whereas the periplasmic space contains onlyabout 100 (Blattner et al., 1997). Therefore, the choice of protein localization strongly

influences the down-stream process.

Nader Nourizad

18

Figure 4. Schematic illustration of Staphylococcal protein A and its derivatives.

4.2. YeastS. cerevisiae (baker’s yeast), a unicellular eukaryotic microorganism, is well

known for its use in baking and brewing processes. S. cerevisiae is a model system for

studying genetics and expression of recombinant proteins in eukaryote systems. The

lack of endotoxins gives a GRAS (Generally Regarded As Safe) status to thismicroorganism, according to the US Food and Drug Administration (FDA).

There are several expression plasmids available for production of heterologous

proteins in S. cerevisiae, including yeast episomal and centromere plasmids. The yeastcentromere plasmid is stable and contains a chromosomal centromere, and is therefore

only present in one or two copies per cell. The episomal plasmid is based on theendogenous plasmid (2µ circle) and is present in 10 to 40 copies per cell (Pichuantes

et al. 1996). Plamids can also be integrated into the chromosome of S. cerevisiae by

homologues recombination.Advantages with the yeast system are optimized fermentation conditions, less

complex culture medium and ability to perform post-translational modifications.However, there are some draw-backs, including comparatively low expression levels,

different in post-translational modifications and possible hyperglycosylation

compared to animal cells (Pichuantes et al., 1996). Other yeast species have emerged as alternatives to S. cerevisiae including

Hansenula polymorpha, Kluyveromyces lactis, Schizosaccharomyces pombe,

Yarrowia lipolytica and Pichia pastoris. The methylotropic yeast P. pastoris has

gained much popularity in recent years for expression of heterologous proteins at high

levels, either intracellularly or secreted (Cereghino and Cregg, 2000). Methylotrophic

S E D A B XC M

Zbasic

Z ZZ

IgG binding Cell anchoring

Signal peptideA1 - V, G29 - A

11 aa - R


19

yeasts produce less hyperglycosylated and higher amounts of recombinant proteins

(Hollenberg and Gellissen, 1997; Gellissen and Hollenberg, 1997). Since P. pastoris

secretes low levels of endogenous proteins and the growth medium is often devoided

of added proteins, secreted recombinant proteins can be the main protein in the culturemedia (Cregg et al., 2000). The availability of commercial expression systems and the

simplicity of the techniques required for genetic manipulation makes this organism an

attractive host for recombinant protein expression (Gellissen, 2000; Cereghino et al.,2002).

The constitutive promoter GAP (glyceraldehyde-3-phosphate dehydrogenase) andthe inducible AOX1 (alcohol oxidase) promoter are frequently used for heterologous

expression in P. pastoris. The constitutive GAP promoter is strong and can be

regulated slightly by growth on different carbon sources, with the highest expressionlevels reached on glucose as a carbon source (Waterham et al., 1997). The AOX1

promoter is also strong and more widely used, and appears to be tightly regulated by a

repression/derepression and an induction mechanism (Cereghino and Cregg, 2000).The promoter is repressed by growth on glucose or unlimited growth on glycerol,

derepression of the AOX1 promoter occurs on limited growth on glycerol. Theabsence of a repressing carbon source does not result in substantial transcription of

AOX1. The induction is started with the addition of methanol to the culture media.

Methanol is also the carbon source for the cells (Tschopp et al., 1987). In theperoxisomes methanol is converted to formaldehyde and hydrogen peroxide by

alcohol oxidase using molecular oxygen. Since alcohol oxidase has a very low affinityfor oxygen, the cell compensates by producing a large amount of alcohol oxidase. All

vectors that are available for P. pastoris are shuttle vectors and are designed to

integrate into the chromosome of P. pastoris upon transformation. Integration can bedirected to the his4 locus (mutated non-functional HIS4) and a functional HIS4 will be

formed upon plasmid integration, enabling the cells to grow on histidine deficientmedium (Fig. 5) (Higgins and Cregg, 1998). In order to secret the target protein to the

culture media, a secretion signal from the S. cerevisiae a-mating factor or the acid

phosphatase signal peptide is generally used (Cereghino and Cregg, 2000).

Nader Nourizad

20

Figure 5. Schematic illustration of plasmid integration by a single cross-over event in the genome ofPichia pastoris at the his4 locus. Cells containing the integrated plasmid can be isolated by selectivegrowth on histidine deficient medium.

Multiple insertion of the target gene into the P. pastoris genome might increaserecombinant protein production (Clare et al., 1991). Several strategies to obtain clones

with multiple gene insertions have been established (Clare et al., 1991).Since the bioreactor conditions are well established for P. pastoris, high cell

density cultures can be obtained (Stratton et al., 1998; Bretthauer and Castellino,

1999).

4.3. Filamentous fungiIn many industrial processes filmanetous fungi are used to produce enzymes,

polysaccharides, pigments, lipids, vitamins, polyhydric alcohols and glycolipids.

Filamentous fungi are capable of producing large amounts of specific proteins fromfungal sources (Punt et al., 2002). Improvements in protein yield have been obtained

by traditional strain improvement-strategies using mutagenesis approaches (Punt et

al., 2002).


21

For production of non-fungal proteins protease deficient strains have been

developed (van den Hombergh et al., 1997) and fungal proteins have been used asfusion-carriers to improve the secretion of heterologous proteins (Ward et al., 1990).

Aspergillus and Trichoderma are widely used in the industry for large-scaleproduction of proteins. Fungi cells are able to secrete proteins to the culture medium

at high concentrations, up to 30 g/L (Punt et al., 2002). Many strains have GRAS

status and are able to perform post-translational modifications.

4.4. Insect cellsThe use of insect cells for heterologous protein production is a more cost-effective

alternative to mammalian cell cultures (Altmann et al., 1999; McCarroll and King,

1997). The maintenance of cell lines is relatively easy and the yield of correctlyfolded and processed target proteins is generally high, whereas all post-translational

modifications of proteins from higher mammals are not always correct.

Expression systems that use recombinant baculovirus, such as Spodoptera

frugiperda, to introduce target genes into different cells are commonly used (Altmann

et al., 1999). The sf/9 baculovirus vector system has been used to produce a specificHIV envelope protein, which is used for vaccine production. The system has also

been used to express the human prostate-specific antigen (PSA) in a pilot scale

experiment with production levels of 2-4 mg/L (Kurkela et al., 1995). The cell culturemedium is complex and can be up to 15 times more expensive than that used for yeast

or E. coli. Post-translationally modificated proteins expressed in insect cells can besecreted and properly folded. However, post-translational modifications performed in

insect cells are not identical to those occuring in mammalian systems, and there is risk

for incorrect glycosylation. Advantages of this system, compared to mammaliansystems, include low back-ground expression, lower growth temperature and less

expensive culture media (Pfeifer, 1998).

Nader Nourizad

22

Whole insect larvae have also been use to manufacture humanized antibodies. The

level of production of heterologous proteins in this system is higher than when usingmammalian cells, with a potential for protein yields higher than 100 mg/L (Simonsen

and McGrogan, 1994).

4.5. Plant cellsPlant cells also provide an inexpensive and convenient system for large-scale

production of recombinant proteins. Several efficient plant-based expression systems

have been developed. Plant-derived biopharmaceutical proteins, such as antibodies,vaccines, human blood products, hormones and growth regulators, are reaching the

late stages of commercial development (Fischer and Emans, 2000). Industrial

enzymes, such as phytase and glucanase, are other examples of proteins that areproduced in plants (Twyman et al., 2003).

In vegetative plants the recombinant proteins are secreted into their exudates (e.g.

leaves or roots), enabling proteins to be collected continuously (Borisjuk et al., 1999;Komarnytsky et al., 2000). Some plant-based transient expression systems allow rapid

screening of recombinant protein production (Fischer et al., 1999).Plants are considered to be much safer than both microbes and animals as they

generally lack human pathogens, oncogenic DNA sequences and endotoxins

(Twyman et al., 2003). The ability of plants to post-translationally modifyrecombinant proteins was demonstrated by production of functional antibodies

(Twyman et al., 2003). However, there are some differences in post-translationalmodifications compared to mammalian cells, particularly with respect to glycan-chain

structures (Twyman et al., 2003).

The strong and constitutive cauliflower mosaic virus 35S (CaMV 35S) promoter isoften chosen to drive transgene expression in dicotyledonous species. Since the

CaMV 35S promoter has a lower activity in cereals, the maize ubiquitin-1 (ubi-1)promoter is preferred (Twyman et al., 2003).

The compartment in which the recombinant protein accumulates strongly

influences the interrelated processes of protein folding, assembly and post-translational modification (Schillberg et al., 2003). As a result, sub-cellular targeting

can also be used as a general method to increase the yield of recombinant proteins.


23

Targeting recombinant proteins to oil bodies or to the plasma membrane can also

facilitate protein purification (Twyman et al., 2003).Maize has been used to commercially produce recombinant avidin and

glucuronidase (Hood et al., 2002; Lamphear et al., 2002), recombinant antibodies,laccase, trypsin and aprotinin (Hood et al., 2002). Potato is the major host for vaccine

production and transgenic potato tubers have been administered to humans in at least

three different clinical trials (Twyman et al., 2003).

4.6. Chinese hamster ovary cells (CHO) and mammalian cellsIn general, proteins that require complex post-translational modifications are

poorly produced in bacteria and yeast. Therefore, more complex expression systems,

such as mammalian cells lines, African Green Monkey kidney cell lines (COS)(Gluzman, 1981) and Chinese Hamster Ovary cell lines (CHO) (Urlaub and Chasin,

1980) are preferred. Expression vectors for transfection of mammalian cell lines have

viral origin and they can be introduced to the host cells either as a non-integrating andnon-replicating DNA vector or as an integrating vector for stable integration of the

target gene into the host cell genome (Makrides, 1999; Colosimo et al., 2000). In thecase of stable integration, all daughter cells will express the recombinant protein for a

considerable period of time (Shoji et al., 1997).

Chinese hamster ovary (CHO) cells are used to produce several commerciallyavailable products, including tissue plasminogen activator (tPA), erythropoetin (EPO)

and recombinant human DNase. Compared to bioreactor conditions for E. coli andyeast, the culture media required for mammalian cell lines is complex and expensive,

but post-translation modifications of recombinant protein, such as glycosylation can

be properly made. Production levels are typically in the range of tens of milligramsper liter per day and the growth rate is slow. Growth supplements, such as mammalian

serum components, can reduce the biosafety of this production system.

4.7. Transgenic animalsThe potential of transgenic animals to produce biologically active recombinant

proteins in an effective and economic manner has stimulated a great interest in this

system. Since milk is a product that can be easily collected in large volumes, the

Nader Nourizad

24

mammary gland tissue has generally been considered the preferred choice of

production of recombinant proteins. Traditional dairy species, such as sheep, goatsand cows have been used to produce recombinant proteins (Eyestone, 1999; Dyck et

al., 2003). Other forms of collectable body fluids, such as blood, urine and seminal-fluid could also be used for production of target proteins (Dyck et al., 2003). The use

of transgenic eggs for large-scale production of recombinant proteins is another

option (Dyck et al., 2003).Techniques that have been successful at introducing a foreign gene into animals

include micro-injection of DNA into the pronuclei of fertilized eggs (Gordon et al.,1980), retrovirus systems in which the viral gene sequences are removed and replaced

with a transgene, and the use of motile sperms as vectors to introduce the target DNA

into oocytes (Dyck et al., 2003).Although the future for production of therapeutic proteins in transgenic animals

looks promising and the transgenic animal bioreactor represent a powerful tool for

producing recombinant proteins, development of transgenic domestic animals iscomplicated (Dyck et al., 2003). Present methods to generate transgenic animals are

relatively ineffective and time-consuming, and efforts to improve transgenesis byvarious methods have had limited achievement (Dyck et al., 2003).


25

5. Protein purificationThe demand for recombinant and biologically active proteins, such as enzymes,

hormones, antibodies, and biopharmaceuticals for industrial applications, diagnosis

and medical therapy is constantly increasing. A product is usually isolated andpurified from a complex mixture containing solids, other proteins, carbohydrates,

lipids and other chemicals. Examples of complex mixtures are fermentation broths ofwhole or disrupted recombinant microorganisms, tissue cultures and body fluids, e.g.

blood. Protocols to separate the recombinant protein from contaminating material

usually require a series of different unit operations, such as solid-liquid separation,cell disruption, liquid-liquid extraction, ultra-filtration, salt or alcohol fractionation.

For some products, especially injectable biotherapeutic agents, further purification byone or more polishing steps is necessary. Various fractionation methods are available

to separate proteins, such as ultracentrifugation, chromatography, isoelectric focusing,

gel electrophoresis and aqueous two-phase systems (Issaq et al., 2002; Kepka et al.,2003). This section briefly describes chromatographic methods used for protein

purification.

5.1. Chromatographic methodsThe principle of most chromatographic purification methods is based on

interaction of proteins or peptides with a solid-support (stationary phase) and a

mobile-phase.

5.1.1. Gel filtration (Size Exclusion Chromatography)Gel filtration chromatography is based on partitioning proteins between two liquid

phases, one stationary inside the gel particles and one mobile making up the void

volume between the particles. As a result, molecules are separated relative to

differences in the size and shapes of the proteins and the pore size distribution of thethree-dimensional network of the matrix (Bollag, 1994a). Since only a small volume

of the sample can be loaded onto the column, gel filtration chromatography is suitableas a last polishing step.

Nader Nourizad

26

5.1.2. Ion exchange chromatographyIon exchange chromatography is one of the most important and general separation

methods for purifying proteins. In ion exchange chromatography proteins are

separated according to differences in surface charges. Charges on the proteins bind toopposite charges in the chromatography medium. An ion exchanger consists of an

inert gel matrix that carries the charged groups, which participate in the ion exchangeprocess. Most ion exchangers are either anion exchangers, which carry positively

charged groups and bind anions, e.g., diethylaminoethyl (DEAE) and quaternary

amino (Q), or cation exchangers, which carry negatively charged groups and bindcations, e.g., carboxymethyl (CM) and sulfonate (S). The bound proteins are eluted

from the ion exchanger either by increasing the concentration of salt, which competesfor the same binding site on the ion exchanger, or by changing the pH of the eluent

and as a consequence the proteins lose their charges by titration.

Ion exchange chromatography is easy to use, widely applicable, can give goodresolution and high yield of active material, and can be used to concentrate the sample

(Bollag, 1994b). However, this method usually requires optimization for each targetprotein. In some cases, in order to improve the binding of the target protein onto the

ion exchanger, gene fusion strategies have been used, for example a positively

charged tag (hexa-arginine) was fused to a target protein, which increased its bindingto a cation exchanger (Smith et al., 1984).

5.1.3. Hydrophobic interaction chromatography (HIC)In HIC, proteins are separated based on differences in their content of surface

hydrophobic amino acids and presence of clefts and crevices at or near the proteinsurface (Queiroz et al., 2001). The strength of protein binding depends on the density

of hydrophobic groups at the surface or near the surface of the protein, and on the

type and degree of hydrophobic ligands coupled to the polymer matrix. The mostwidely used ligands for HIC are straight chain alkanes (-Cn) or simple aromatic

compounds (phenyl). The strength of interaction increases with increasing alkyl chainlength (methyl < ethyl <……..< octyl). Proteins are usually eluted by decreasing the

salt concentration in the elution buffer. As HIC requires that the proteins should be in


27

high salt concentration, this separation method is of practical use after salt

precipitation or after ion exchange chromatography.

5.1.4. Reversed phase chromatography (RPC)In reversed phase chromatography, separation is based on the hydrophobic

interaction between proteins and immobilized organic molecules (el Rassi et al.,

1990). This separation method differs from HIC by the degree of substitution, as wellas aliphatic content of the groups on the matrix, which is higher for RPC than HIC. In

RPC, the purification is often performed at low pH in order to increase the exposureof hydrophobic patches of the protein. Since the interaction between adsorbent and

protein is much stronger in RPC than HIC, an organic solvent is required for efficient

elution. Purification at low pH and elution by an organic solvent often destroy thethree-dimensional structure of the target protein, and in many cases, leads to protein

denaturation and irreversible inactivation of biological activity. However, in cases

when these treatments are tolerated, RPC can be use as a final polishing step since theresolution of this technology is very high.

5.1.5. Affinity chromatographyAffinity chromatography is a type of adsorption chromatography in which the

molecule to be purified is specifically and reversibly adsorbed by a complementarybinding substance (ligands) immobilized to an insoluble support (matrix). Examples

of useful ligand molecules are antibodies, metals, lectins and biotin (Issaq et al.,2002). Purification is often of a high order and recoveries of active proteins are

generally very high compared to other chromatographic methods. Affinity

chromatography can also concentrate samples, which enables large volumes to beconveniently processed. In this purification method the sample is loaded onto the

column and the proteins of interest are captured by the functional group (immobilizedligand). The bound protein is often recovered by washing the column with a

competitive substrate or a solution that disrupts the interaction between protein and

immobilized ligand (Issaq et al., 2002).By genetic design a fusion tag of different size can be incorporated at the N or C

terminus of a target protein to facilitate its purification, and increase the overall

Nader Nourizad

28

efficiency in the down-stream process. Examples of fusion tag strategies are outlined

in table 1. Immobilized metal affinity chromatography and Staphylococcal protein Aand its derivates (Z, Zbasic, ZZ) are described in more detail in the next section.

References: I (Stahl et al., 1997), II (Stahl and Nygren, 1997), III (Porath et al., 1975), IV (Smith andJohnson, 1988), V (Einhauer and Jungbauer, 2001), VI (Brizzard et al., 1994), VII (di Guan et al.,1988) VIII (Schmidt and Skerra, 1993), IX (Schmidt et al., 1996).

5.1.5.1. IMAC (Immobilized metal affinity chromatography)In the IMAC method, chelating compounds that are covalently bound to a solid

phase are used to catch transition-metal ions (Cu2+, Ni2+, Zn2+, Co2+, Fe3+, Al3+), which

serve as affinity ligands for various proteins. The metal ligand can bind amino acidresidues, such as poly-histidine, tryptophan, or multiple copies of the peptide Ala-His-

Gly-His-Arg-Pro, which can be genetically fused to either the N or the C terminus of

a recombinant protein (Chaga, 2001). Since the interaction between immobilizedmetal ions and the side chains (e.g. poly histidine) has reversible character, it can be

used to capture of the target protein and then be disrupted using mild (non-denaturing)conditions. A major benefit of the His (6) affinity tag is that a recombinant protein can

also be purified under denaturing conditions, which is very suitable for proteins that

are found in inclusion bodies (Nilsson et al., 1997).

Table 1. Examples of affinity fusion tags which are used for protein purification. SPA, StaphylococcalProtein A; SPG, Streptococcal protein G; GSA, Glutatione S transferase; MBP, Maltose Binding protein.

Ligand ReferencesSPA and derivatives Human IgG ISPG and derivatives Human serum alumin IIPoly His Me2+-chelator IIIGST Glutatione IVMonoclonal antibody-peptide

Monoclonal antibodies V

FLAG peptide (mAb M1, mAb M2) VIMBPStreptavidin-peptidase Iand II

AmyloseStreptavidin

VIIVIII & IX


29

5.1.5.2. Staphylococcal protein A and its derivates (Z, Zbasic, ZZ)Staphylococcal protein A (SPA) is an immunoglobulin-binding receptor present

on the surface of the gram-positive bacteria Staphylococcus aureus. SpA interacts

with (Ig) of various origins, such as human IgG subclasses (1, 2, 4) via the constantdomain (Langone, 1982; Eliasson et al., 1988). Different variants of SPA (Z, Zbasic,

ZZ) (Fig. 4) (Graslund et al., 2002) have been widely used as fusion partners, becauseof their high IgG binding capacity, high solubility, and stability against proteolysis

(Nilsson et al., 1997). Since SPA has no disulphide bonds, which can otherwise

interfere with disulphide formation in the target protein, the protein and its variantshave been successfully expressed in the cytoplasm, in the periplasm and to the

cultivation media of E. coli. SPA and variant have also been successfully produced inother expression systems, such as yeast, plant, insect and mammalian cells (Nilsson et

al., 1997).

Nader Nourizad

30

6. Present investigationCommercially available enzymes, isolated from native sources, show batch-to-

batch variation in activity and quality and contain contaminants that interfer with the

Pyrosequencing reaction. Thus, the aim of the research presented in this thesis was toproduce the enzymes involved in the Pyrosequencing method by recombinant DNA

technology.Paper I describes small-scale production of the nucleotide degrading enzyme

apyrase and paper II describes optimization of large-scale production of the same

enzyme in a bioreactor. The application of apyrase for template preparation prior tothe Pyrosequencing reaction is discussed in paper III. The production of ATP

sulfurylase, the second enzyme in the Pyrosequencing reaction, is discussed in paperIV. A comparison of the two most widely used exo (-) DNA polymerases, Klenow

polymerase and Sequenase, is discussed in paper V.

A strategy for immobilization of luciferase onto the DNA template, which enablesthe Pyrosequencing reaction to be performed on a chip format, is discussed in paper

VI.

In paper VII a new method for clone checking by the Pyrosequencing method isdescribed. The N-terminus of the His (6)-apyrase construct (discussed in paper II) was

(re)sequenced by this new method.

6.1. Recombinant apyrase (paper I, II, III)Apyrase was produced both in small-scale (shaking-flask culture) and in large-

scale (bioreactor). These production experiments together with application of the

recombinant apyrase in the Pyrosequencing reaction and in a new templatepreparation method are described in the following section.

6.1.1. Small-scale production of apyrase (paper I)Apyrase catalyzes the hydrolysis of phosphoanhydride bonds of nucleoside tri-

and diphosphates in the presence of divalent cations (Plesner, 1995). In thePyrosequencing reaction, apyrase is responsible for degradation of unincorporated

nucleotides and ATP. Since the only commercially available apyrase, isolated from


31

potato tubers, showed batch-to-batch variations in activity and quality, we decided to

produce this enzyme recombinantly. The plasmid carrying the cDNA of S. tubersum

apyrase, provided by Harvard University (Handa and Guidotti, 1996), was sequenced

and showed one base deletion (nucleotide G in position 375) in comparison with thepublished sequence (Handa and Guidotti, 1996). A PCR-based method for site

directed mutagenesis of this apyrase clone was applied (Fig. 6).

Figure 6. A schematic representation of the procedure for site directed mutagenesis of the potato tubersapyrase cDNA clone. (A) Two separate PCR reactions were performed on the plasmid carrying theapyrase gene, using primer pair a/b (Ap-EcoRI-up/Biotin-Ap-mut-reverse) and c/d (Biotin-Ap-mut-forward/Ap-XbaI-down), respectively. Primer b and c harbors an extra base represented by a grey box.(B) In order to get a full length template, the non-biotinylated strand from both PCR products wereannealed to each other and a primer extension reaction was performed. (C) The product was used astemplate in a second PCR reaction using primer pair a/d. The full length product harbored the extrabase.

Attempts to produce recombinant apyrase in E. coli resulted in insoluble

aggregates that showed to be difficult to refold. As an alternative expression host themethyltrophic yeast P. pastoris was chosen. The coding sequence of potato apyrase,

without the signal peptide, was cloned into the YpDC541 vector to create a fusion

with the a-mating secretion signal of S. cerevisiae. Thereby, the apyrase gene was

placed under the control of the methanol inducible alcohol oxidase promoter (Fig. 7).

a

b d

c

a

d

A

B

C

Nader Nourizad

32

Figure 7. Schematic picture of the constructed plasmid YpDC541-apyrase. Abbreviations used: 5’-AOX1 promoter, methanol-inducible promoter; 3’-AOX1 terminator, transcription terminatorregion; alfa factor, secretion signal from S. cerevisiae; His4, selection marker in P. pastoris; Kan res,kanamycin resistance gene; COLE1 ori, origin of replication in E. coli; Amp res, ampicillin resistancegene (functional in E. coli only). The constructed plasmid was linearized with StuI beforeelectroporation into P. pastoris.

The YpDC541-apyrase construct was integrated into a protease deficient strain of

P. pastoris (SMD1168). A five hundred ml culture, in a shaking flask, was set up, inwhich the amount of added yeast extract, peptone, and methanol were optimized. A

methanol induction (2% v/v) resulted in secretion of apyrase to a level of 1 mg/L. The

biologically active recombinant apyrase was concentrated and purified. The purifiedenzyme was estimated to be at least 90 percent pure with an overall purification yield

of about 27 percent. The SDS-PAGE and Western blot analyses, showed that thepurified enzyme was hyperglycosylated. N-glycans was removed by endoglycosidase

H, without affecting the enzymatic activity of the apyrase. After deglycosylation a

single band corresponding to a molecular mass of 48 kDa was detected by SDS-PAGE and Coomassie brilliant blue staining (Fig. 8). Although the amount of apyrase

produced in this study was rather low, it was the first reported method for productionof recombinant apyrase.

YpDC541

alpha factor

His4

Kan res

ColE1 ori

Amp res

5'AOX1 promoter3'AOX1 terminator

Stu I

apyrase

NotIXhoI

YpDC541-apyrase


33

Figure 8. SDS-PAGE analysis of recombinant apyrase produced in P. pastoris. The SDS-PAGE wasperformed under reducing conditions on a gradient (10-20%) gel. Protein bands were stained byCoomassie brilliant blue. Lanes 1 and 5, standard low weight molecular marker with weights given inthe right margin; lane 2, 15 units commercial apyrase (Sigma Chemical Co.); lane 3, 15 units purifiedrecombinant apyrase; lane 4, 15 units purified recombinant apyrase after endoglycosidase H treatment.

6.1.1.1. Characterization of recombinant apyraseIn potato tuber, apyrase exists in more than one molecular form depending on the

clonal variety (Traverso-Cori et al., 1970). Apyrases from different clonal sources

show differences both in isoelectric point and relative rate of hydrolysis of ATP and

ADP (Traverso-Cori et al., 1970). Apyrase purified from S. tuberosum var. Pimpernel(Pimpernel apyrase, apyrase A) has an ATPase/ADPase ratio close to 10 (Del Campo

et al., 1977) and apyrase isolated from the Desiré variety (Desiré apyrase, apyrase B)has an ATPase/ADPase ratio close to 1 (Del Campo et al., 1977).

The recombinant apyrase produced in both paper I and II was found to be an

apyrase B variant. This was determined by a nucleotide analog inhibition experiment(data not shown). In Fig. 9 the principle for the experimental set up for determination

of apyrase type is schematically illustrated.

1 2 3 4 5 kDa

94.0

43.067.0

30.0

14.4

20.1

Nader Nourizad

34

Figure 9. Schematic illustration of characterization of apyrase types. Traces from real-time monitoring(luminometric assay) of nucleotide degradation by: (a) apyrase A, (b) apyrase B, and (c) recombinantapyrase in the absence or presence of an inhibitor. All reactions were started by addition of 10 pmolATP.

6.1.2. Large-scale production of apyrase (paper II)In a bioreactor, the growth conditions can be better controlled than in a shaking-

flask culture, and high cell densities, which might result in high yields of recombinantprotein, can be obtained (Cereghino et al., 2002).

In paper II, we show that recombinant apyrase can be produced in high amountsby fermentation of P. pastoris in a bioreactor. The fermentation of P. pastoris can be

Apyrase A Apyrase A with inhibitor

Apyrase B

Recombinant apyrase

Apyrase B with inhibitor

Recombinant apyrase with inhibitor

a

c

b


35

divided into three different phases. The aim of the first phase is to obtain a high cell

density by growing the cells on glycerol. In the second step, the cells are still fed withglycerol, but at a growth-limiting rate. This will prepare the cells for the transition to

methanol feeding. The third phase is the methanol phase, where the cells are startingto produce the recombinant enzyme.

In order to simplify the down-stream process, a His (6) tag was genetically

incorporated at the N-terminus of the protein by sub-cloning of the apyrase gene intothe pFastBacHTa vector, and thereafter, cloning into the YpDC541 vector (see paper

I). An optimization of the pH and media composition, including fermentation atdifferent pH (5, 6 and 7) and addition of yeast extract and peptone into the cultivation

medium, was performed. At the optimal conditions (pH 7 and addition of yeast extract

and peptone to the medium), 40 mg/L of apyrase was obtained. The production levelwas 40 times higher than earlier obtained for the apyrase in shaking-flask culture. The

recombinant His (6)-apyrase was purified by cation exchange chromatography

(Trisacryl gel) and metal-chelate affinity chromatography (Co2+). The recombinantHis (6)-apyrase was found to be hyperglycosylated and the N-glycan on the protein

was removed by means of a-mannosidase and endoglycosidase H. The metal-chelate

affinity chromatography step removed both remaining contaminants from the cationexchange step and the endoglycosidases used for deglycosylation (Fig. 10).

Figure 10. SDS-PAGE analysis of recombinant His (6)- apyrase produced in P. pastoris. The SDS-PAGE was performed under reducing conditions on a gradient (10-20%) gel. Protein bands werestained by Coomassie brilliant blue. Lane 1, standard low weight molecular marker with weights givenin the left margin; lane 2, 30 units SP-Trisacryl cation exchange purified recombinant His (6)-apyrase;lane 3, 20 units purified recombinant apyrase after endoglycosidase H and a-mannosidase treatment,and metal-chelate chromatography purification.

94.067.043.030.020.114.4

kDa 1 2 3

Nader Nourizad

36

6.2. Application of apyrase in the Pyrosequencing technologyThe activity of (recombinant) apyrase in the Pyrosequencing reaction and in an

enzymatic template preparation method are described in this section.

6.2.1. Recombinant apyrase in the Pyrosequencing reactionThe activity of recombinant native apyrase (paper I) (Fig. 11) and His (6)-apyrase

(paper II) (Fig. 12) were tested in combination with the Pyrosequencing technology.

Both recombinant enzymes showed good activity in comparison to the commercial

apyrase (Fig. 11, 12).

Figure 11. Raw pyrogram sequence data. The Pyrosequencing reaction was performed on a 300 bplong PCR product in the presence of 40 mU commercial apyrase (A) or in the presence of 40 mUpurified recombinant apyrase (B). About 1 pmol of template-primer was used in the assay. The cyclicnucleotide dispensation order was A,C,G,T. The correct DNA sequence is indicated above the traces.

T C5 T G2 A2 G C T C3 T C G T G C G C T C T C2 T G T2 C2 G A C3 T

T C5 T G2 A2 G C T C3 T C G T G C G C T C T C2 T G T2 C2 G A C3 T

A

B

ACGT nucleotide addition order


37

Figure 12. Raw pyrogram sequence data. The Pyrosequencing reaction was performed on a 150 bplong PCR product in the presence of 40 mU purified recombinant His (6)-apyrase. About 1 pmol oftemplate-primer was used in the assay. The cyclic nucleotide dispensation order was A,C,G,T. Thecorrect DNA sequence is indicated above the trace.

6.2.2. Application of apyrase for template preparation prior the Pyrosequencingreaction

PCR products that are to be sequenced contain excess amounts of PCR primers,

nucleotides and PPi, which have to be removed or degraded prior to sequencing by

the Pyrosequencing method. These by-products can interfere in the course of DNAsequencing since the amplification primers can re-anneal to the amplified DNA,

causing unspecific sequence signals, and the remaining nucleotides and PPi can causeasynchronous extension and depletion of APS. The salt in the PCR buffer slightly

inhibits the enzyme system and should be removed or diluted.

There are two approaches currently used for template preparation: single-strandtemplate preparation methods (Fig. 13) and double-strand template preparation

methods (Fig. 14).

6.2.2.1. Single-strand methodIn the single-strand method one of the PCR primers is biotin-labeled at the 5’-

terminus. The biotinylated PCR product binds to a streptavidin coated solid support,

allowing the immobilization of the DNA fragment. This permits the immobilized

DNA to be single-stranded by alkali treatment (high pH), and simultaneously, theinterfering components to be removed. The eluted non-biotin-labeled strand can also

be collected and used for sequencing. After the separation step, a sequencing primer isannealed to the single-stranded DNA. There are two methods available for single-

strand DNA preparation: (i) streptavidin coated magnetic beads, using a magnet for

A C G C A G T A C 3A T A T G A C A C T A T G T

Nader Nourizad

38

purification, denaturation and elution, and (ii) streptavidin coated Sepharose beads,

based on filter separation by a vacuum system.

Figure 13. A schematic illustration of the single-strand template preparation method utilized for thePyrosequencing technology.

6.2.2.2. Double-strand method (III)There are two different methods available for preparation of double-stranded

template. In the first method (III), nucleotides, PPi and amplification primers are

removed enzymatically. Nucleotides and PPi are degraded by addition of apyrase andpyrophosphatase, and the amplification primers are removed by exonuclease I, which

specifically degrades single-stranded DNA. The double-stranded DNA is thendenaturated by heat and the sequencing primer is annealed.

The left over nucleotides in the PCR can be degraded either by alkaline

phosphatase (in this study: calf intestine alkaline or shrimp alkaline phosphatase) orapyrase treatment. Among these enzymes apyrase showed to be the most effective for

PCR product withbiotin at the 5´- end

Immobilization andNaOH treatment

Annealing of sequencing primer

3´ 5´

5´5´3´

3´

5´5´3´

3´

3´

3´

5´3´ 5´

5´


39

nucleotide degradation. The alkaline phosphatases showed a lower efficiency for

degradation of nucleotides because of the strong inhibition (competitive) byphosphate, which is produced as a by-product. Although apyrase is a very efficient

nucleotide degrading enzyme it can not degrade the PPi produced in the PCR. This isin contrast to alkaline phosphatase, which degrades not only nucleoside tri- and

diphosphates, but also nucleoside monophosphates and PPi. However, when apyrase

is used in combination with enzymes such as inorganic pyrophosphatase or ATPsulfurylase, PPi can be efficiently removed. ATP sulfurylase converts PPi to ATP,

which is subsequently hydrolyzed by apyrase.The remaining PCR primers can be removed by the enzyme exonuclease I.

Exonuclease I specifically degrade ssDNA with 3’ to 5’ polarity. One drawback with

using exonuclease I is the low catalytic rate and termination in presence of primer-dimers and loop structures. Nevertheless, these problem were efficiently solved by

using SSB (and DMSO) together with exonuclease I.

After enzymatic treatment the sample is heated to 96°C to inactivate the enzymes,especially exonuclease I, which otherwise could degrade the sequencing primer. After

the enzymatic inactivation step, a sequence primer is hybridized to the dsDNAtemplate. To allow the primer to hybridize to the DNA, DNA should be first

denaturated. DNA can be denaturated with alkali treatment or by high temperature.

The alkali denaturation has been preferred in the ssDNA template preparation method,but high temperature denaturation is preferred for dsDNA preparation. The critical

moment for efficient primer hybridization, after dsDNA denaturation, is to avoid re-annealing of the two complementary strands (Chen et al., 1997). To delay the re-

association of DNA strands and favor hybridization of shorter oligonucleotides, rapid

cooling, is efficient (Smith, 1979). In most applications dry ice is used for rapidcooling while others recommend even faster cooling at lower temperatures (Brody et

al., 1986; Wetmur, 1991; Jung et al., 1992). In this work, more moderate temperatureshave been applied of practical reasons. Rapid cooling was performed at 0°C when one

of the PCR primers was used as sequencing primer, and at –20°C, when an inner

sequence primer was used. In addition, different types of additives can be used for themaintenance of single strands after denaturation, such as DMSO, SSB and different

detergents (Casanova et al., 1990).

Nader Nourizad

40

High quality sequence data was obtained on DNA of variable lengths (50 to 2000

bp) and GC content. The method was applied on templates from different sources,such as bacterial 16SRNA, Bacillus antrach, human p53 gene, a cDNA library and

plasmids.

Figure 14. A schematic illustration of the double-strand template preparation method utilized for thePyrosequencing technology.

The second double-strand method is based on using blocking primers (Nordstromet al., 2002). The principle behind this approach is to prevent the re-annealing of the

PCR primers to the amplified DNA. This could be carried out either by utilizingcomplementary blocking primers hybridizing to the PCR primers or using non-

extendable primers, with the same sequence as the PCR primers.

PCR reaction

Heating and annealing ofsequencing primer

Enzymatic degradation ofdNTP, PPi and PCR primers

5´5´3´

3´

PiPi Pi

Pi

Pi

Pi

dNMP

dNMP

dNMPdNMPdNMP

PPiPPi

PPi

PPiPPi

PPi

dNTP

dNTP dNTPdNTP

dNTP5´

5´3´

3´

5´5´3´

3´

5´3´5´

3´


41

6.3. Recombinant ATP sulfurylase (IV)In this part a method for production and purification of a recombinant ATP

sulfurylase from S. cerevisiae is presented. The gene for ATP sulfurylase (MET 3)

was cloned into a plasmid carrying the lux regulatory system, which directs thesynthesis of ATP sulfurylase to the cytosol of E. coli. The highest production level of

soluble and biologically active ATP sulfurylase was obtained at 18°C and in the XL1-blue strain of E. coli. The ATP sulfurylase activity during production and purification

was followed using a real time assay for ATP sulfurylase.

ATP sulfurylase was purified to electrophoretic homogeneity by ion exchange andgel filtration chromatography (Fig. 15). A recovery of approximately 80% was

obtained. The specific activity was shown to be high (140 U/mg) in comparison withthe commercial preparation (9 U/mg). Furthermore, the purified enzyme was free

from contaminating NTP kinase (Karamohamed et al., 1999) (Fig. 16).

Figure 15. SDS-PAGE analysis of different steps in the purification of recombinant ATP sulfurylasefrom E. coli. The protein bands were stained by Coomassie blue. Lane 1, standard low molecularweight markers; Lane 2, 300 mU ATP sulfurylase from E. coli cell lysate; Lane 3, 300 mU from thepellet after ammonium sulfate fractionation; Lane 4, 420 mU from the pooled fractions after High-QSepharose fractionation; Lane 5, 300 mU from pooled fractions after Superdex 200 fractionation; Lane6, 30 mU of commercial ATP sulfurylase.

6 5 4 3 2 1

Nader Nourizad

42

Figure 16. A typical trace obtained from real-time monitoring of NDP kinase activity of commercial(Co.Sulf.) and recombinant ATP sulfurylase (R.Sulf.). The trace shows that the recombinant ATPsulfurylase is kinase-free, while the commercial enzyme is not.

6.4. DNA polymerases in Pyrosequencing technology (V)A DNA polymerase used in the Pyrosequencing reaction should fulfill a number

of characteristics if high quality data should be obtained. The DNA polymerase mustbe 3'-5' exonuclease-deficient in order to avoid degradation of the sequencing primer

annealed to the template. The processivity must be reasonable high to achieve full

incorporation of nucleotides in each step. Moreover, the DNA polymerase must beable to use modified nucleotides (such as dATPaS and c7dATP) and to incorporate

such nucleotides with high efficiency, especially across homopolymeric T-regions.

Furthermore, it is a clear advantage if primer-dimers and loop-structures cannot beused as substrates. It is also desirable that the polymerase has an efficient strand-

displacement activity.

Since the exonuclease-deficient form of DNA polymerase I large fragment, alsoknown as Klenow fragment and related here as Klenow polymerase, displays many of

the above described features, we decided to produce a 3'-5' exonuclease deficient

Klenow polymerase. The Klenow DNA polymerase exo (+) was muted at two points(Asp355-Ala) and (Glu357-Ala) in order to remove the 3'-5' exonuclease activity. The 3'-

5' exonuclease deficient variant was produced by the T7 promoter system in E. coli


43

(data not shown). This enzyme has worked well for most Pyrosequencing applications

so far.Although the 3'-5' exonuclease deficient Klenow polymerase has traditionally

been used in the Pyrosequencing method, sequencing problems due to inefficientincorporation of nucleotide dATPaS in homopolymeric T-regions and extension of

mispairs formed by unspecific hybridization events have occasionally been

encountered. For example, sequencing of templates containing regions with 4 to 5 T

with Klenow polymerase resulted in unsynchronized sequence signals. Further,primer-dimers and 3’-end loops gave increased background signals. Therefore, in

order to improve the performance of the Pyrosequencing technology a modified T7

polymerase (exonuclease deficient T7 DNA polymerase), Sequenase (Tabor andRichardson, 1989), was tested.

The effect of Sequenase on sequencing performance on poly (T)-rich templateswas evaluated in parallel with Klenow DNA polymerase. Sequenase demonstrated far

better catalytic efficiency for all homopolymeric T-regions tested. Synchronized

extension was observed on homopolymeric templates containing regions with up to 8T (Fig. 17(b)). It was also found that both Klenow and Sequenase incorporated all the

other nucleotides (G, T, C) with good efficiency.

Nader Nourizad

44

Figure 17. Sequencing performance by two different DNA polymerases. The Pyrosequencing reactionwas performed on a PCR fragment, containing a poly-T track of seven T, in the presence of (a)Klenow, and (b) Sequenase. Note the low T and high A signal peaks obtained (filled and dotted arrows,respectively) when Klenow was applied. When Sequenase was used the sequence could be easily readand the T and A signal peaks were close to the expected levels. The order of nucleotide addition isindicated on the bottom of the traces. The sequence obtained is indicated above trace b.

6.5. Fusion proteins (VI)In this paper, we designed constructs in which the firefly-luciferase was

genetically fused to a DNA binding protein (Klenow DNA polymerase or SSB) and to

a purification handle (Zbasic) that could be removed by enzymatic cleavage (Fig. 18).The fusion proteins were produced intracellularly in E. coli under control of the

T7 promoter in 500 ml shake flask cultivation. The proteins were released by

sonication, and the soluble fractions were purified. The first purification step for both

a

b

Klenow

Sequenase

A

7A

ACC AT

2T

GT2T

C


45

constructs were cation exchange chromatography in which the pH of the buffer was

adjusted to 7.5. The elution of the Zbasic-Klenow-luciferase was performed with alinear gradient and the Zbasic-SSB-luciferase with a step-wise protocol. The cation

exchange chromatography purifications step was efficient and resulted in high yieldof pure protein (with exception for the Zbasic-Klenow-luciferase preparation for which

a minor degradation product was observed). From 500 ml shake flask cultivations, 15

mg Zbasic-SSB-luciferase and 22 mg Zbasic-Klenow-luciferase of high purity wereobtained. The Zbasic tag was removed by enzymatic cleavage using 3C protease

(recombinant coxsackievirus 3C protease) and the target proteins were further purifiedby anion exchange chromatography. The purification yields for both target proteins

were showen to be high and of high purity.

In order to study the binding of the fusion proteins to DNA and the functionalityof the luciferase within the fusion proteins, they were analyzed by complete extension

of immobilized DNA templates, which was monitored by the Pyrosequencing

chemistry. Paramagnetic beads, with immobilized ssDNA and an annealed primer,were incubated in separate reactions with the fusion proteins, Zbasic-SSB-luciferase,

SSB-luciferase, Zbasic-Klenow-luciferase and Klenow-luciferase, respectively. Theproteins were incubated with the immobilized DNA for 30 min and thereafter, all free

unbound protein was washed out. A Pyrosequencing mixture without luciferase and

apyrase, and in the case of Klenow fusions without Klenow, was added to the washedbeads. Run-off reactions were performed in the presence of DNA polymerase and all

four nucleotides. The obtained light intensities were plotted over time and the resultsfrom these experiments are shown in (Fig. 19). All tested proteins were found to

bound selectively to the immobilized DNA and their enzymatic domains were active.

At the plateau point (steady state for light signal production) for Klenow-luciferaseand Zbasic- Klenow-luciferase, soluble Klenow polymerase were added to the reaction

mixtures, but no increase in the signals were observed, indicating that the DNA wassaturated with polymerase.

The Zbasic purification tag did not affect the reaction during these analyses,

therefore, the only necessary down-stream processing step could be a cation exchangechromatography step, which is very selective, efficient, mild, cost-effective and easy

to scale up. This shows that an easy cultivation and a single step purification

Nader Nourizad

46

procedure can be applied to obtain proteins of high purity that are functional in DNA

binding, as well as, polymerase and luciferase activity.

Figure 18. A schematic illustration of the fusion constructs: (A) Zbasic-Klenow-luciferse and (B) Zbasic-SSB-luciferse. The cleavage site for protease 3C is indicated above each construct.

Figure 19. Complete primer extension assay performed on DNA immobilized on magnetic beads byuse of the fusion proteins. The y axis denotes measured light signal in arbitrary units and the x axistime in seconds. (-) DNA curves parallel to the x axis are reactions where all four fusion proteins havebeen incubated with DNA-free beads. The vertical arrow marks time point for addition of 5 unitssoluble Klenow.

Klenow

pT7ZbasicII-Klenow-Luciferase

Zbasic

3c cleavage site

Luciferase

SSB

pT7ZbasicII-SSB-Luciferase

Zbasic

3c cleavage site

Luciferase

A

B


47

6.6. Clone checking (VII)As most DNA manipulation techniques can result in artifacts, methods that

facilitate quality control are important. For example, after cloning and/or mutagenesis

of a gene or specific DNA fragment, the new construct should be carefully checkedfor proper function. Clone checking is crucial to confirm that a DNA fragment has

been cloned in the correct frame and orientation within a vector. Moreover, it isrequired to check for undesired mutations that could have occurred during initial PCR

steps. In addition, the quality of oligonucleotides used during different procedures

(e.g., primers for PCR cloning) should also be considered.In this work, we combined the Pyrosequencing technology with a preprogrammed

nucleotide dispensation strategy to allow fast analysis of new DNA constructs. In thepreprogrammed nucleotide dispensation strategy, the nucleotide dispensation order is

predetermined according to the correct type consensus sequence of the clone. This is

in contrast to the general used cyclic nucleotide dispensation strategy where thenucleotides are repeatedly added in a cyclic order, e.g., A, C, G, T.

The new approach was applied to study plasmids constructed for the production ofrecombinant apyrase with a His (6) tag at the N-terminus. The strategy for

construction of the plasmid YpDC541-His (6)-apyrase, which was used for evaluation

of the new clone checking method, is schematically illustrated in (Fig. 20). We usedthe preprogrammed dispensation ability of the Pyrosequencing technique for clone

quality control with successful result. Mutations and deletions were easily observed in

the pyrogram sequence pattern as missing signal peaks. It is worth mentioning thatsingle-base mutations, insertions or deletions that occur in a context of similar bases,

are observed as alterations in signal peak heights within a homopolymeric region.Figure 21 shows three analyzed His (6)-apyrase clones: (i) one with no mutation in

the N-terminus region (Fig. 21a), (ii) one with one base deletion (Fig. 21b), and (iii)

one with a large deletion of 195 nucleotides (Fig. 21c). It is worth noting thatalthough a preprogrammed nucleotide dispensation strategy was used, the sequence

after the large deletion in figure 21c, could be identified. Thus, after the large deletionthe following sequence was obtained CCTATTGGCAACAATATTGAGTATTT-

TAT. This sequence is located 123 bases into the apyrase gene.

Nader Nourizad

48

The preprogrammed dispensation strategy introduce a new sequencing strategy for

clone checking, in which longer and faster reads can be obtained.

Figure 20. Schematic representation of the procedure for sub-cloning and cloning of the apyrase intothe plamids pFastBacHTa and YpDC541, respectively. Abbreviations used: Sig.P, alfa factor secretionsignal from S. cerevisiae; MCS, Multi Cloning Site.

SnaBI NotI

MCSSig. P

NotI

ApyraseHis(6)

EheI XbaI

pFastBacHTa

YpDC541

pUC19-Apyrase

EheI

XbaI

His(6)

ApyraseSig. P His(6)

pFastBacHTa-Apyrase

YpDC541-His (6)-Apyrase

MCS


49

Figure 21. Pyrogram, preprogrammed sequence information, from three of the apyrase clonesanalyzed. (a) one of the correct clones, (b) one of the clones with a one base deletion (the deletion isindicated with an arrow), and (c) a clone with a large deletion (the start position for the sequence afterthe deletion is indicated with an arrow). The correct sequence of a part of the region analyzed is shownabove trace (a). The nucleotides were added according to the correct sequence of the target DNA.

Plasmid seq ApyraseTGAAGCTTAC AGAGGATCGCATCACCATCACCATCACGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCGCC CAAATTCCATTGAGAAG5´

3´

a

b

c

T G G C A C A G A A T C G C A T C A A T C A A T C A C G A A C G A T A T C G A G T G T A C A C G

A2 T2 G2

A G A G G A C A A G T C A T

C2 C2 T2A2 C2

C3A4

C2

T4

G3 C3 A3

T2 C2 T2 A2

T3T2 A2

T G G C A T A C C T A G A G T A A T

A2

C3

T2 G2 A2 A2 T2

T4

Nader Nourizad

50

7. Concluding remarks and future trendsThe Pyrosequencing technology is based on real-time detection of DNA synthesis

monitored by bioluminescence. This technology is a versatile DNA sequencing

technology suitable for many applications, such as SNP genotying, bacteriagenotying, virus genotying, fungi genotying and tag sequencing. In this thesis we

have extended the application field of this technology by adding a method for dsDNAsequencing and a method for clone checking. In addition, to increase the efficiency of

the Pyrosequencing system, strategies for production and isolation of several of the

proteins involved in this system were developed. Production of the nucleotide-degrading enzyme (apyrase) in a bioreactor was optimized and a protocol for

production and purification of ATP sulfurylase was developed.In one study, a gene fusion strategy was used to enable immobilization of

luciferase (light producing enzyme) on the DNA template. Importantly, the ability to

attach luciferase to the DNA template enables future development of thePyrosequencing technology in a chip format.

Further improvements of the Pyrosequencing technology, especially in read-

lenght, can be made by investigating proteins involved in the reaction. This thesis haspresented some strategies to improve the Pyrosequencing technology by improving

the quality of necessary protein components and diversifying its application. In thefuture, the enzymes involved in this method can be genetically improved to be able to

perform specific tasks, for example the DNA polymerase might be modified to be

able to perform the polymerization step with higher processivity and velocity,whereas ATP sulfurylase, luciferase and apyrase can be modified to increase their

thermostability, which will allow the Pyrosequencing reaction to be performed at hightemperature. The possibility to replace the present enzymes with a new and better set

from different native sources should also be explored.


51

Abbreviations

ADP adenosine diphosphate

AMP adenosine monophosphate

APS adenosine phosphosulfateATP adenosine triphosphate

bp base pairCCD charge-coupled device

cDNA complementary DNA

dATP deoxyadenosine triphosphatedATPaS deoxyadenosine alfa-thiotriphosphate

ddATP dideoxyadenosine triphosphate

ddCTP dideoxycytidine triphosphate

ddGTP dideoxyguanine triphosphateddNTP dideoxynucleoside triphosphate

ddTTP dideoxythymidine triphosphatedGTP deoxyguanine triphosphate

dNDP deoxynucleoside diphosphate

dNMP deoxynucleoside monophosphatedNTP deoxynucleoside triphosphate

ds double-strandeddTTP deoxythymidine triphosphate

DNA deoxyribonucleic acid

EDTA ethylenediamine tetraacetic acidkb kilobase

KF Klenow fragmentPCR polymerase chain reaction

PPi inorganic pyrophosphate

DEAE diethylaminoethylCM carboxymethyl

S sulfonate

Nader Nourizad

52

Q quaternary amino

SPA Staphylococcal protein ASPG Streptococcal protein G

GSA glutathione S transferaseMBP maltose binding protein

IMAC immobilized metal affinity chromatography

PAPS adenosine 3’-phosphoate 5’-phosphosulphateSSB single-strand DNA-binding protein

CAMW cauliflower mosaic virusb-IAA b-indoleacrylic acid

km Michaelis-Menten constantcDNA complementary DNA

SNP single nucleotide polymorphismTA Tris-acetate

DMSO dimethyl sulfoxide


53

AcknowledgementsBy experience from many years in KTH, I know that the acknowledgement is the first

part (sometimes the only part) to be explored by colleagues. So lets start. Do not worry; it is avery nice and positive acknowledgement.

First of all I take this opportunity to express my warm heart feeling (hjärtliga) to allpeople I know that have some positive input in my entire life. These pages are thanks givingpart and I start with the entire staff at the biotechnology department (three floors) forproductive collaborations. I would like to thank in particular:

Professor Pål Nyrén, my supervisor who accept me as diploma worker first and later as aPh.D student. I would like to thank him for his scientific guidance, for his respect to studentsand their integrity, for his great sense of humor, positive attitude and for his patience andhaving time to hear my crazy ideas här och där. His family, Maja, Aaron and Emma(vildbasarna) are also acknowledged for nice conversations during our Pyro-group parties.

I would like to thank Pål again for critical reading of this thesis.

Dr Mostafa Ronaghi, for great and supportive friendship, for his endless vision, andmost of all for his general generosity (My life in Stockholm started with 4 months living inhis apartment, thanks again for your generosity) and for your positive attitude.

Dr Baback Gharizadeh, a great friend with a lot of energy, colleague who made our laba hyperactive place for experiment and collaborations, for his good taste in music, for hisgood advises how I can bring up my children??, for all walking moment to Karlberg duringall these years and of course for his enormous knowledge about computer (my Mac guru).Thank you for all assistance, collaboration and interesting conversations. TommyNordström, a nice friend and colleague with a good sense of humor Jonas Eriksson, for allthe nice conversations and collaborations. Carlos Garcia and Samer Kara, the old membersof the group, for your friendship and collaboration, all diploma workers in the Pyromanklubben (Mattias, Marie, Sophia, Flora, Aman, Andres, Simon, Anders A).

Assoc. professor Sophia Hober and Assoc. professor Andres Veide for your expertguidance through the protein production and purification meeting and always taking yourtime with patience to have fruitful dialogues and scientific conversations.

Assoc. professor Sophia Hober again for your collaboration over three articles.

Professor Per Åke Nygren for all on line discussion about purification.

Assoc. professor Per Ljungdahl at Ludwig institute (Karolinska) for his hugeknowledge and interest for molecular biology, especially Baker’s yeast. Thanks for yourexpertis help during my time in the Karolinska.

Dr Emma Master (she is a Canadian-Persian girl) for her valuable comments on thisthesis and all other papers.

Dr Tor Björn Gräslund for his all expertise help in protein science.

Maria Ehn for her positive and nice collaborations over three papers.

Nader Nourizad

54

Reza Salmalian our fermentation expert for friendship during the last year and for allhelp, which have assisted me in my work.

Aman and Anders A (halv-Pyromaner) for their sense of humor.

Bahram Amini, fruitful collaborations and all sequencings work during years. Alwaysbeing ready to help.

Alphonsa Lourdudoss, Lotta Rosenfeldt (fick den här äran att ha dig som toast master)Anne Jifält, Marita Johnsson, Monica Ruck and Pia Ahnlén, for all excellent professionalassistance during the years Gunnila Applegren for your positive energy, and TommyÖstlund, our best technical person, for his technical assistance during all years.

Alphonsa Lourdudoss and Lotta Rosenfeldt, thanks again for all nice lunchconversations and all tårta–fika during years.

All the new and old members of the family floor 2: I start with room nr 1: ProfessorKarl Hult for your energy and knowledge in metabolism, Professor Tulla Terri for yourvision and hard working and of course some interest for different soup, Anna and Totte myfavorite forskar par (harmonic and positive researcher, for our conversation about plant celltransformation and many other things) (filmjölk specialister), Linda for your kindness ineverything, even for föreldrarlösa cats, Dr Harry for critical reading of my two papers (I,VII) and your sense of humor, the Belgian and Canadian room, Dr Kathleen thanks for allhelp for XET and your positive carma and I take this opportunity för att tacka Wald påSvenska for our music discussions, Assoc. Professor Mats Martinell for your interest inprotein production, especially lab course (you choose always me as a lab course ansvarig,thanks a lot), Anders for your relax attitude in the case of lab course and all scientificdiscussions (insulin), Cecilia M, a nice girl with bio-cathalic dance ambition (jätte bugg),Maria nice lady med humor, Eva another nice lady in that room, she is ranked nr 60 as atennis player in the Sweden (WOOOW!), I forgot almost Dr Fredrik for his discussion abouteverything (and nothing), computer questions (squash guru), Now we are nära to Bloody hellroom, Åsa vollybollstjärna (förlåt mig, beachvollystjärna) who always provide me with tipsand notes about patent and starts-up company, you are a positive and energetic girl. Ulla apositive girl who likes adrenalin-full adventures, she helped me to find a new talent in myself(Nader-Brandman), our Lab needs you for new adventures, Dr (soon) Henrik my Elvis (theonly copy in the world, who is better than the original), Soraya my venture cup partner andfor your positive attitude to the life. Assoc. Professor Per Berglund, a real scientist with apedantisk skött room, Dr Park, my south Korean brother, thanks for all help during writingthis thesis, I am still waiting for the final fight (you can choose place), Cecilia B, super girlwith super ambitions, Marianne, a good doktorand and a good mother who loves roller blade,diving etc, Dr Malin, my assisterande toast master, a generous, positive and happy girl (somälskar godis). Dr Joke-Hollendare with H2O ambition, a nice girl, happy, positive, etc(Nader ska jobba på Astra?? Eller hur Joke) and her kind man Dr DJ, Magnus (Matrix),utmanaren som byte sida, happy guy with a lot of energy (American football), a crazy guy in(min smak), Drs Martin and Christina for all discussion about crystallography, DrHongbin for all help for Äkta purification (you always have time for my questions, thanks alot). The UFO(R) room, Martin for your sense of humor and computer help (PC guru), Dr Qifor our lunch discussion about food-boxes, Anders en envis protein-dykare, Alex my brotherfrom India, who invite me and my family to his wedding (in India), thanks, we will come, DrLionel De Capprio for your sense of humor. And all dipolma worker, Anders, Mattias,Veronika, Maria, Peter for all nice lunch discussion. Old member at floor 2, Dr KristinaBlomqvist for all nice discussion and help about yeast transformation, Dr Stewart (mad cow)for your sense of humor and all antibody tips, and Dr Mats Holmquist for teaching me the


55

Pichia pastoris expression system. Kalle och Mike mina favorit studenter på protein reningkursen.

From first floor: Dr Mehmedalija (Bato) (fermentaion expert) for all nice discussions,Maria B (an active and + girl), Maga (DNA chip expert), Ella (Bradford expert) for all helpand scientific discussions during years.

The microbiology group; Professor Gunnel Dalhamar for your interest to be member inthe blowing club, Pelle a real scout leader, Kaj my Finish brother for all scanning work andyour interest for allt annat utom jorden. Peter Komlos and his wife Marita for nicediscussions, Jaky-Foo a nice arbetskamrat with vision outside the Sweden (oooh you arecoming to my party!!), Lydia and Seyoum, for nice discussion, Karin för att du alltidkommer ihåg din disk-vecka, Anna som kommer alltid och endast på tårt-möte.

The staff at Pyrosequencing AB for technical assistance and expertise, particularlyBjörn Ekström, Dr Maria Murby, Dr Björn Ingemarsson, Dr Anders Alderborn, D rNigel Tooke, Peter Hagerlid, Peter Lindqvist, Christina Johansson, Jenny Dunker,Kristin Hellman, Dr Annika Tallsjö and Per-Johan Ulfendahl.

All teachers at the university of Kalmar who make this university to be the bestHögskolan in the Sweden after KTH. Special thanks to Anki Koch-Schmidt for your visionand energy.

All teachers and kitchen personal at the Folkhögskolan in Nässjö, Special thanks toMathematic and physic teacher Mats Johansson for your pedagogic teaching.

All members in our football team (Tehran-united), Abbas, Davood, Daryosh, Shervin.

All members in the GTM (Jalal, Davood, Abbas, Saeed) for the future collaboration.

I would also like to express my deepest appreciation and gratitude to all my friends fortheir friendship: Jalal and his family (Åsa, Daniel, David) Reza Khiabani, FredrickLekarp, Nader Pourmand and his family (Soheila, Arvin, Ayda), Bahram Amini and hisfamily (Parisa, Anahita), Afshin Ahmadian and his family (Mojgan, Jasmine), Mehran,Virginija and her family, Farshid and his family (Lena, Daniel and Farideh), Morteza andFarideh (Azadeh, Mehdi)

Kim Nouria for your vision and energy and future collaboration.

My nice and crazy friends in the family; Shahnavaz+Lundberg (Shervin, Anna, andmy nice God-son Viggo and God-daughter Lo) for nice hospitality, help, discussions andall parties over years.

Ramin, Abbas, Davood, Jalal, Daryoosh, Shervin, Afshin S, Baback, Reza, Hadi,Amene my best friends. You have been nice and true friends through all years.

My parent(s), my sisters and their families, Zoya, Soheila (Armin), Nahid and Hossein(Ali, Arash, Shahrzad, Aria) for their constant love and support. Dear Shahrzad, my sisterdoughter with a lot of good ambitions and her nice husband, Shab.

My Swedish relatives; familjen Karlsson 1 (Kjell, Gittan, Emma), familjen Karlsson 2(Roger, Carina, Erica, Robin), familjen Karlsson 3 (Fredrik, Maria) for their hospitalityduring all these years.

My family; Ann Britt my love and my source of joy, happiness and energy (bakom varjeframgångsrik man står en kvinna), my beloved daughter (Sarah) and my beloved son (Sam),vildbasarna som väcker mina barnliga sidor varje dag.I am sure that I have forgot some friends in this acknowledgement. By this I say: Tack allesammans!

Nader Nourizad

56

ReferencesAltmann, F., Staudacher, E., Wilson, I.B. and Marz, L.: Insect cells as hosts for the expression ofrecombinant glycoproteins. Glycoconj J 16 (1999) 109-23.

Ball, J.K. and Desselberger, U.: Incorporation of single-stranded DNA binding protein early inpolymerase chain reaction product sequencing reactions prevents enzyme pausing. Anal Biochem 207(1992) 349-51.

Bedford, E., Tabor, S. and Richardson, C.C.: The thioredoxin binding domain of bacteriophage T7DNA polymerase confers processivity on Escherichia coli DNA polymerase I. Proc Natl Acad Sci U SA 94 (1997) 479-84.

Bernard, H.U., Remaut, E., Hershfield, M.V., Das, H.K., Helinski, D.R., Yanofsky, C. and Franklin,N.: Construction of plasmid cloning vehicles that promote gene expression from the bacteriophagelambda pL promoter. Gene 5 (1979) 59-76.

Blattner, F.R., Plunkett, G., 3rd, Bloch, C.A., Perna, N.T., Burland, V., Riley, M., Collado-Vides, J.,Glasner, J.D., Rode, C.K., Mayhew, G.F., et al.: The complete genome sequence of Escherichia coli K-12. Science 277 (1997) 1453-74.

Blight, M.A., Chervaux, C. and Holland, I.B.: Protein secretion pathway in Escherichia coli. Curr OpinBiotechnol 5 (1994) 468-74.

Boeck, C.R., Sarkis, J.J. and Vendite, D.: Kinetic characterization and immunodetection of ecto-ATPdiphosphohydrolase (EC 3.6.1.5) in cultured hippocampal neurons. Neurochem Int 40 (2002) 449-53.

Bollag, D.M.: Gel-filtration chromatography. Methods Mol Biol 36 (1994a) 1-9.

Bollag, D.M.: Ion-exchange chromatography. Methods Mol Biol 36 (1994b) 11-22.

Borisjuk, N.V., Borisjuk, L.G., Logendra, S., Petersen, F., Gleba, Y. and Raskin, I.: Production ofrecombinant proteins in plant root exudates. Nat Biotechnol 17 (1999) 466-9.

Branchini, B.R., Magyar, R.A., Murtiashaw, M.H., Anderson, S.M., Helgerson, L.C. and Zimmer, M.:Site-directed mutagenesis of firefly luciferase active site amino acids: a proposed model forbioluminescence color. Biochemistry 38 (1999) 13223-30.

Branchini, B.R., Magyar, R.A., Murtiashaw, M.H., Anderson, S.M. and Zimmer, M.: Site-directedmutagenesis of histidine 245 in firefly luciferase: a proposed model of the active site. Biochemistry 37(1998) 15311-9.

Brandan, E. and Hirschberg, C.B.: Purification of rat liver N-heparan-sulfate sulfotransferase. J BiolChem 263 (1988) 2417-22.

Bretthauer, R.K. and Castellino, F.J.: Glycosylation of Pichia pastoris-derived proteins. BiotechnolAppl Biochem 30 ( Pt 3) (1999) 193-200.

Brill, S.J. and Stillman, B.: Replication factor-A from Saccharomyces cerevisiae is encoded by threeessential genes coordinately expressed at S phase. Genes Dev 5 (1991) 1589-600.

Brizzard, B.L., Chubet, R.G. and Vizard, D.L.: Immunoaffinity purification of FLAG epitope-taggedbacterial alkaline phosphatase using a novel monoclonal antibody and peptide elution. Biotechniques16 (1994) 730-5.

Brody, R.S., Doherty, K.G. and Zimmerman, P.D.: Processivity and kinetics of the reaction ofexonuclease I from Escherichia coli with polydeoxyribonucleotides. J Biol Chem 261 (1986) 7136-43.


57

Brutlag, D. and Kornberg, A.: Enzymatic synthesis of deoxyribonucleic acid. 36. A proofreadingfunction for the 3' leads to 5' exonuclease activity in deoxyribonucleic acid polymerases. J Biol Chem247 (1972) 241-8.

Buchner, J. and Rudolph, R.: Renaturation, purification and characterization of recombinant Fab-fragments produced in Escherichia coli. Biotechnology (N Y) 9 (1991) 157-62.

Casanova, J.L., Pannetier, C., Jaulin, C. and Kourilsky, P.: Optimal conditions for directly sequencingdouble-stranded PCR products with sequenase. Nucleic Acids Res 18 (1990) 4028.

Cereghino, G.P., Cereghino, J.L., Ilgen, C. and Cregg, J.M.: Production of recombinant proteins infermenter cultures of the yeast Pichia pastoris. Curr Opin Biotechnol 13 (2002) 329-32.

Cereghino, J.L. and Cregg, J.M.: Heterologous protein expression in the methylotrophic yeast Pichiapastoris. FEMS Microbiol Rev 24 (2000) 45-66.

Chaga, G.S.: Twenty-five years of immobilized metal ion affinity chromatography: past, present andfuture. J Biochem Biophys Methods 49 (2001) 313-34.

Chen, X., Zehnbauer, B., Gnirke, A. and Kwok, P.Y.: Fluorescence energy transfer detection as ahomogeneous DNA diagnostic method. Proc Natl Acad Sci U S A 94 (1997) 10756-61.

Clare, J.J., Romanos, M.A., Rayment, F.B., Rowedder, J.E., Smith, M.A., Payne, M.M., Sreekrishna,K. and Henwood, C.A.: Production of mouse epidermal growth factor in yeast: high-level secretionusing Pichia pastoris strains containing multiple gene copies. Gene 105 (1991) 205-12.

Cline, J., Braman, J.C. and Hogrefe, H.H.: PCR fidelity of pfu DNA polymerase and otherthermostable DNA polymerases. Nucleic Acids Res 24 (1996) 3546-51.

Colosimo, A., Goncz, K.K., Holmes, A.R., Kunzelmann, K., Novelli, G., Malone, R.W., Bennett, M.J.and Gruenert, D.C.: Transfer and expression of foreign genes in mammalian cells. Biotechniques 29(2000) 314-8, 320-2, 324 passim.

Cornelis, P.: Expressing genes in different Escherichia coli compartments. Curr Opin Biotechnol 11(2000) 450-4.

Cregg, J.M., Cereghino, J.L., Shi, J. and Higgins, D.R.: Recombinant protein expression in Pichiapastoris. Mol Biotechnol 16 (2000) 23-52.

Dabrowski, S. and Kur, J.: Cloning, overexpression, and purification of the recombinant His-taggedSSB protein of Escherichia coli and use in polymerase chain reaction amplification. Protein Expr Purif16 (1999) 96-102.

Datar, R.V., Cartwright, T. and Rosen, C.G.: Process economics of animal cell and bacterialfermentations: a case study analysis of tissue plasminogen activator. Biotechnology (N Y) 11 (1993)349-57.

Day, R.B., McAlvin, C.B., Loh, J.T., Denny, R.L., Wood, T.C., Young, N.D. and Stacey, G.:Differential expression of two soybean apyrases, one of which is an early nodulin. Mol Plant MicrobeInteract 13 (2000) 1053-70.

de Wet, J.R., Wood, K.V., Helinski, D.R. and DeLuca, M.: Cloning firefly luciferase. MethodsEnzymol 133 (1986) 3-14.

Del Campo, G., Puente, J., Valenzuela, M.A., Traverso-Cori, A. and Cori, O.: Hydrolysis of syntheticpyrophosphoric esters by an isoenzyme of apyrase from Solanum tuberosum. Biochem J 167 (1977)525-9.

Nader Nourizad

58

Derbyshire, V., Freemont, P.S., Sanderson, M.R., Beese, L., Friedman, J.M., Joyce, C.M. and Steitz,T.A.: Genetic and crystallographic studies of the 3',5'-exonucleolytic site of DNA polymerase I.Science 240 (1988) 199-201.

di Guan, C., Li, P., Riggs, P.D. and Inouye, H.: Vectors that facilitate the expression and purification offoreign peptides in Escherichia coli by fusion to maltose-binding protein. Gene 67 (1988) 21-30.

Drmanac, R., Labat, I., Brukner, I. and Crkvenjakov, R.: Sequencing of megabase plus DNA byhybridization: theory of the method. Genomics 4 (1989) 114-28.

Dyck, M.K., Lacroix, D., Pothier, F. and Sirard, M.A.: Making recombinant proteins in animals--different systems, different applications. Trends Biotechnol 21 (2003) 394-9.

Einhauer, A. and Jungbauer, A.: The FLAG peptide, a versatile fusion tag for the purification ofrecombinant proteins. J Biochem Biophys Methods 49 (2001) 455-65.

el Rassi, Z., Lee, A.L. and Horvath, C.: Reversed-phase and hydrophobic interaction chromatographyof peptides and proteins. Bioprocess Technol 9 (1990) 447-94.

Eliasson, M., Olsson, A., Palmcrantz, E., Wiberg, K., Inganas, M., Guss, B., Lindberg, M. and Uhlen,M.: Chimeric IgG-binding receptors engineered from staphylococcal protein A and streptococcalprotein G. J Biol Chem 263 (1988) 4323-7.

Eriksson, J., Nordstrom, T. and Nyren, P.: Method enabling firefly luciferase-based bioluminometricassays at elevated temperatures. Anal Biochem 314 (2003) 158-61.

Etzler, M.E., Kalsi, G., Ewing, N.N., Roberts, N.J., Day, R.B. and Murphy, J.B.: A nod factor bindinglectin with apyrase activity from legume roots. Proc Natl Acad Sci U S A 96 (1999) 5856-61.

Eyestone, W.H.: Production and breeding of transgenic cattle using in vitro embryo productiontechnology. Theriogenology 51 (1999) 509-17.

Fabianek, R.A., Hennecke, H. and Thony-Meyer, L.: Periplasmic protein thiol:disulfideoxidoreductases of Escherichia coli. FEMS Microbiol Rev 24 (2000) 303-16.

Fischer, R. and Emans, N.: Molecular farming of pharmaceutical proteins. Transgenic Res 9 (2000)279-99; discussion 277.

Fischer, R., Vaquero-Martin, C., Sack, M., Drossard, J., Emans, N. and Commandeur, U.: Towardsmolecular farming in the future: transient protein expression in plants. Biotechnol Appl Biochem 30 ( Pt2) (1999) 113-6.

Gallez, F., Fadel, M., Scruel, O., Cantraine, F. and Courtois, P.: Salivary biomass assessed bybioluminescence ATP assay related to (bacterial and somatic) cell counts. Cell Biochem Funct 18(2000) 103-8.

Geiger, R. and Miska, W.: Bioluminescence enhanced enzyme immunoassay. New ultrasensitivedetection systems for enzyme immunoassays, II. J Clin Chem Clin Biochem 25 (1987) 31-8.

Gellissen, G.: Heterologous protein production in methylotrophic yeasts. Appl Microbiol Biotechnol 54(2000) 741-50.

Gellissen, G. and Hollenberg, C.P.: Application of yeasts in gene expression studies: a comparison ofSaccharomyces cerevisiae, Hansenula polymorpha and Kluyveromyces lactis -- a review. Gene 190(1997) 87-97.


59

Gendron, F.P., Halbfinger, E., Fischer, B. and Beaudoin, A.R.: Inhibitors of NTPDase: key players inthe metabolism of extracellular purines. Adv Exp Med Biol 486 (2000) 119-23.

Georgiou, G. and Valax, P.: Expression of correctly folded proteins in Escherichia coli. Curr OpinBiotechnol 7 (1996) 190-7.

Gold, L., O'Farrell, P.Z. and Russel, M.: Regulation of gene 32 expression during bacteriophage T4infection of Escherichia coli. J Biol Chem 251 (1976) 7251-62.

Gordon, J.W., Scangos, G.A., Plotkin, D.J., Barbosa, J.A. and Ruddle, F.H.: Genetic transformation ofmouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A 77 (1980) 7380-4.

Goswami, T. and Pande, S.V.: Radioisotopic assay of femtomole quantities of total adeninenucleotides, ATP plus ADP, and AMP. J Biochem Biophys Methods 9 (1984) 143-51.

Gottesman, S. and Maurizi, M.R.: Regulation by proteolysis: energy-dependent proteases and theirtargets. Microbiol Rev 56 (1992) 592-621.

Graslund, T., Ehn, M., Lundin, G., Hedhammar, M., Uhlen, M., Nygren, P.A. and Hober, S.: Strategyfor highly selective ion-exchange capture using a charge-polarizing fusion partner. J Chromatogr A942 (2002) 157-66.

Grinthal, A. and Guidotti, G.: Substitution of His59 converts CD39 apyrase into an ADPase in aquaternary structure dependent manner. Biochemistry 39 (2000) 9-16.

Guise, A.D., West, S.M. and Chaudhuri, J.B.: Protein folding in vivo and renaturation of recombinantproteins from inclusion bodies. Mol Biotechnol 6 (1996) 53-64.

Guranowski, A., Galbas, M., Hartmann, R. and Justesen, J.: Selective degradation of 2'-adenylateddiadenosine tri- and tetraphosphates, Ap(3)A and Ap(4)A, by two specific human dinucleosidepolyphosphate hydrolases. Arch Biochem Biophys 373 (2000) 218-24.

Hammarstrom, M., Hellgren, N., van Den Berg, S., Berglund, H. and Hard, T.: Rapid screening forimproved solubility of small human proteins produced as fusion proteins in Escherichia coli. ProteinSci 11 (2002) 313-21.

Handa, M. and Guidotti, G.: Purification and cloning of a soluble ATP-diphosphohydrolase (apyrase)from potato tubers (Solanum tuberosum). Biochem Biophys Res Commun 218 (1996) 916-23.

Hasan, N. and Szybalski, W.: Construction of lacIts and lacIqts expression plasmids and evaluation ofthe thermosensitive lac repressor. Gene 163 (1995) 35-40.

Heine, P., Braun, N., Heilbronn, A. and Zimmermann, H.: Functional characterization of rat ecto-ATPase and ecto-ATP diphosphohydrolase after heterologous expression in CHO cells. Eur J Biochem262 (1999) 102-7.

Higgins, D.R. and Cregg, J.M.: Introduction to Pichia pastoris. Methods Mol Biol 103 (1998) 1-15.

Hockney, R.C.: Recent developments in heterologous protein production in Escherichia coli. TrendsBiotechnol 12 (1994) 456-63.

Hollenberg, C.P. and Gellissen, G.: Production of recombinant proteins by methylotrophic yeasts. CurrOpin Biotechnol 8 (1997) 554-60.

Hood, E.E., Woodard, S.L. and Horn, M.E.: Monoclonal antibody manufacturing in transgenic plants--myths and realities. Curr Opin Biotechnol 13 (2002) 630-5.

Nader Nourizad

60

Hsieh, H.L., Song, C.J. and Roux, S.J.: Regulation of a recombinant pea nuclear apyrase by calmodulinand casein kinase II. Biochim Biophys Acta 1494 (2000) 248-55.

Hutchison, C.A., 3rd, Phillips, S., Edgell, M.H., Gillam, S., Jahnke, P. and Smith, M.: Mutagenesis at aspecific position in a DNA sequence. J Biol Chem 253 (1978) 6551-60.

Issaq, H.J., Conrads, T.P., Janini, G.M. and Veenstra, T.D.: Methods for fractionation, separation andprofiling of proteins and peptides. Electrophoresis 23 (2002) 3048-61.

Jacobson, K.B., Arlinghaus, H.F., Buchanan, M.V., Chen, C.H., Glish, G.L., Hettich, R.L. andMcLuckey, S.A.: Applications of mass spectrometry to DNA sequencing. Genet Anal Tech Appl 8(1991) 223-9.

Johnson, I.S.: Human insulin from recombinant DNA technology. Science 219 (1983) 632-7.

Jonasson, P., Liljeqvist, S., Nygren, P.A. and Stahl, S.: Genetic design for facilitated production andrecovery of recombinant proteins in Escherichia coli. Biotechnol Appl Biochem 35 (2002) 91-105.

Jung, M., Dritschilo, A. and Kasid, U.: Reliable and efficient direct sequencing of PCR-amplifieddouble-stranded genomic DNA template. PCR Methods Appl 1 (1992) 171-4.

Kajiyama, N. and Nakano, E.: Thermostabilization of firefly luciferase by a single amino acidsubstitution at position 217. Biochemistry 32 (1993) 13795-9.

Karamohamed, S. and Guidotti, G.: Bioluminometric method for real-time detection of ATPaseactivity. Biotechniques 31 (2001) 420-5.

Karamohamed, S., Nordstrom, T. and Nyren, P.: Real-time bioluminometric method for detection ofnucleoside diphosphate kinase activity. Biotechniques 26 (1999) 728-34.

Kepka, C., Collet, E., Persson, J., Stahl, A., Lagerstedt, T., Tjerneld, F. and Veide, A.: Pilot-scaleextraction of an intracellular recombinant cutinase from E. coli cell homogenate using athermoseparating aqueous two-phase system. J Biotechnol 103 (2003) 165-81.

Kim, Y.T. and Richardson, C.C.: Bacteriophage T7 gene 2.5 protein: an essential protein for DNAreplication. Proc Natl Acad Sci U S A 90 (1993) 10173-7.

Klenow, H., Overgaard-Hansen, K. and Patkar, S.A.: Proteolytic cleavage fo native DNA polymeraseinto two different catalytic fragments. Influence of assay condtions on the change of exonucleaseactivity and polymerase activity accompanying cleavage. Eur J Biochem 22 (1971) 371-81.

Kobatake, E., Iwai, T., Ikariyama, Y. and Aizawa, M.: Bioluminescent immunoassay with a protein A-luciferase fusion protein. Anal Biochem 208 (1993) 300-5.

Komarnytsky, S., Borisjuk, N.V., Borisjuk, L.G., Alam, M.Z. and Raskin, I.: Production ofrecombinant proteins in tobacco guttation fluid. Plant Physiol 124 (2000) 927-34.

Komoszynski, M.A.: Comparative studies on animal and plant apyrases (ATP diphosphohydrolase EC3.6.1.5) with application of immunological techniques and various ATPase inhibitors. Comp BiochemPhysiol B Biochem Mol Biol 113 (1996) 581-91.

Kornberg, A.: DNA replication. J Biol Chem 263 (1988) 1-4.

Kornberg, R.D. and Lorch, Y.: Chromatin structure and transcription. Annu Rev Cell Biol 8 (1992) 563-87.


61

Kurkela, R., Herrala, A., Henttu, P., Nai, H. and Vihko, P.: Expression of active, secreted humanprostate-specific antigen by recombinant baculovirus-infected insect cells on a pilot-scale.Biotechnology (N Y) 13 (1995) 1230-4.

Lamphear, B.J., Streatfield, S.J., Jilka, J.M., Brooks, C.A., Barker, D.K., Turner, D.D., Delaney, D.E.,Garcia, M., Wiggins, B., Woodard, S.L., et al.: Delivery of subunit vaccines in maize seed. J ControlRelease 85 (2002) 169-80.

Langone, J.J.: Applications of immobilized protein A in immunochemical techniques. J ImmunolMethods 55 (1982) 277-96.

LaVallie, E.R., DiBlasio, E.A., Kovacic, S., Grant, K.L., Schendel, P.F. and McCoy, J.M.: Athioredoxin gene fusion expression system that circumvents inclusion body formation in the E. colicytoplasm. Biotechnology (N Y) 11 (1993) 187-93.

Leyh, T.S., Taylor, J.C. and Markham, G.D.: The sulfate activation locus of Escherichia coli K12:cloning, genetic, and enzymatic characterization. J Biol Chem 263 (1988) 2409-16.

Li, H., Deyrup, A., Mensch, J.R., Jr., Domowicz, M., Konstantinidis, A.K. and Schwartz, N.B.: Theisolation and characterization of cDNA encoding the mouse bifunctional ATP sulfurylase-adenosine 5'-phosphosulfate kinase. J Biol Chem 270 (1995) 29453-9.

Lilie, H., Schwarz, E. and Rudolph, R.: Advances in refolding of proteins produced in E. coli. CurrOpin Biotechnol 9 (1998) 497-501.

Linn, S. and Arber, W.: Host specificity of DNA produced by Escherichia coli, X. In vitro restriction ofphage fd replicative form. Proc Natl Acad Sci U S A 59 (1968) 1300-6.

Lofdahl, S., Guss, B., Uhlen, M., Philipson, L. and Lindberg, M.: Gene for staphylococcal protein A.Proc Natl Acad Sci U S A 80 (1983) 697-701.

Makrides, S.C.: Components of vectors for gene transfer and expression in mammalian cells. ProteinExpr Purif 17 (1999) 183-202.

Maurizi, M.R.: Proteases and protein degradation in Escherichia coli. Experientia 48 (1992) 178-201.

Maxam, A.M. and Gilbert, W.: A new method for sequencing DNA. Proc Natl Acad Sci U S A 74(1977) 560-4.

McCarroll, L. and King, L.A.: Stable insect cell cultures for recombinant protein production. CurrOpin Biotechnol 8 (1997) 590-4.

McClure, W.R. and Jovin, T.M.: The steady state kinetic parameters and non-processivity ofEscherichia coli deoxyribonucleic acid polymerase I. J Biol Chem 250 (1975) 4073-80.

McEntee, K., Weinstock, G.M. and Lehman, I.R.: recA protein-catalyzed strand assimilation:stimulation by Escherichia coli single-stranded DNA-binding protein. Proc Natl Acad Sci U S A 77(1980) 857-61.

Meselson, M. and Yuan, R.: DNA restriction enzyme from E. coli. Nature 217 (1968) 1110-4.

Meyer, R.R., Glassberg, J. and Kornberg, A.: An Escherichia coli mutant defective in single-strandbinding protein is defective in DNA replication. Proc Natl Acad Sci U S A 76 (1979) 1702-5.

Miska, W. and Geiger, R.: Synthesis and characterization of luciferin derivatives for use inbioluminescence enhanced enzyme immunoassays. New ultrasensitive detection systems for enzymeimmunoassays, I. J Clin Chem Clin Biochem 25 (1987) 23-30.

Nader Nourizad

62

Moks, T., Abrahmsen, L., Nilsson, B., Hellman, U., Sjoquist, J. and Uhlen, M.: Staphylococcal proteinA consists of five IgG-binding domains. Eur J Biochem 156 (1986) 637-43.

Mukhopadhyay, A.: Inclusion bodies and purification of proteins in biologically active forms. AdvBiochem Eng Biotechnol 56 (1997) 61-109.

Muller, M., Koch, H.G., Beck, K. and Schafer, U.: Protein traffic in bacteria: multiple routes from theribosome to and across the membrane. Prog Nucleic Acid Res Mol Biol 66 (2001) 107-57.

Mullis, K.B. and Faloona, F.A.: Specific synthesis of DNA in vitro via a polymerase-catalyzed chainreaction. Methods Enzymol 155 (1987) 335-50.

Murray, K.K.: DNA sequencing by mass spectrometry. J Mass Spectrom 31 (1996) 1203-15.

Nilsson, B. and Abrahmsen, L.: Fusions to staphylococcal protein A. Methods Enzymol 185 (1990)144-61.

Nilsson, B., Moks, T., Jansson, B., Abrahmsen, L., Elmblad, A., Holmgren, E., Henrichson, C., Jones,T.A. and Uhlen, M.: A synthetic IgG-binding domain based on staphylococcal protein A. Protein Eng1 (1987) 107-13.

Nilsson, J., Stahl, S., Lundeberg, J., Uhlen, M. and Nygren, P.A.: Affinity fusion strategies fordetection, purification, and immobilization of recombinant proteins. Protein Expr Purif 11 (1997) 1-16.

Niza-Riberio, J., Louzã, A.C., Santos, P. and Lima, M.: Monitoring the microbiological quality of rawmilk through the use of an ATP bioluminescence method. Food Control 11 (2000) 209-216.

Nordstrom, T., Alderborn, A. and Nyren, P.: Method for one-step preparation of double-stranded DNAtemplate applicable for use with Pyrosequencing technology. J Biochem Biophys Methods 52 (2002)71-82.

Nordstrom, T., Nourizad, K., Ronaghi, M. and Nyren, P.: Method enabling pyrosequencing on double-stranded DNA. Anal Biochem 282 (2000) 186-93.

Nygren, P.A., Eliasson, M., Abrahmsen, L., Uhlen, M. and Palmcrantz, E.: Analysis and use of theserum albumin binding domains of streptococcal protein G. J Mol Recognit 1 (1988) 69-74.

Nyrén, P.: Method for sequencing DNA based on the detection of the relese of pyrophosphate andenzymatic nucleotide degradation, US 6 258 568BI, WO98/28440, 2001.Nyren, P. and Lundin, A.: Enzymatic method for continuous monitoring of inorganic pyrophosphatesynthesis. Anal Biochem 151 (1985) 504-9.

Olivera, B.M. and Lehman, I.R.: Linkage of polynucleotides through phosphodiester bonds by anenzyme from Escherichia coli. Proc Natl Acad Sci U S A 57 (1967) 1426-33.

Olsson, T., Sandstedt, K., Holmberg, O. and Thore, A.: Extraction and determination of adenosine 5'-triphosphate in bovine milk by the firefly luciferase assay. Biotechnol Appl Biochem 8 (1986) 361-9.

Pfeifer, T.A.: Expression of heterologous proteins in stable insect cell culture. Curr Opin Biotechnol 9(1998) 518-21.

Pichuantes, S., Tien, . and Franzusoff, A.: Isolation of the human PC6 gene encoding the putative hostprotease for HIV-1 gp160 processing in CD4+ T lymphocytes. Proc Natl Acad Sci U S A 93 (1996)7695-700.

Plesner, L.: Ecto-ATPases: identities and functions. Int Rev Cytol 158 (1995) 141-214.


63

Porath, J., Carlsson, J., Olsson, I. and Belfrage, G.: Metal chelate affinity chromatography, a newapproach to protein fractionation. Nature 258 (1975) 598-9.

Punt, P.J., van Biezen, N., Conesa, A., Albers, A., Mangnus, J. and van den Hondel, C.: Filamentousfungi as cell factories for heterologous protein production. Trends Biotechnol 20 (2002) 200-6.

Queiroz, J.A., Tomaz, C.T. and Cabral, J.M.: Hydrophobic interaction chromatography of proteins. JBiotechnol 87 (2001) 143-59.

Raina, S. and Missiakas, D.: Making and breaking disulfide bonds. Annu Rev Microbiol 51 (1997) 179-202.

Ramanathan, S., Chary, K.V. and Rao, B.J.: Incoming nucleotide binds to Klenow ternary complexleading to stable physical sequestration of preceding dNTP on DNA. Nucleic Acids Res 29 (2001)2097-105.

Renosto, F., Patel, H.C., Martin, R.L., Thomassian, C., Zimmerman, G. and Segel, I.H.: ATPsulfurylase from higher plants: kinetic and structural characterization of the chloroplast and cytosolenzymes from spinach leaf. Arch Biochem Biophys 307 (1993) 272-85.

Robbins, P.W. and Lipmann, F.: Enzymatic synthesis of adenosine-5'-phosphosulfate. J Biol Chem 233(1958) 686-90.

Roberts, N.J., Brigham, J., Wu, B., Murphy, J.B., Volpin, H., Phillips, D.A. and Etzler, M.E.: A Nodfactor-binding lectin is a member of a distinct class of apyrases that may be unique to the legumes. MolGen Genet 262 (1999) 261-7.

Ronaghi, M.: Improved performance of pyrosequencing using single-stranded DNA-binding protein.Anal Biochem 286 (2000) 282-8.

Ronaghi, M., Uhlen, M. and Nyren, P.: A sequencing method based on real-time pyrophosphate.Science 281 (1998) 363, 365.

Rudolph, R. and Lilie, H.: In vitro folding of inclusion body proteins. Faseb J 10 (1996) 49-56.

Sala-Newby, G.B. and Campbell, A.K.: Stepwise removal of the C-terminal 12 amino acids of fireflyluciferase results in graded loss of activity. Biochim Biophys Acta 1206 (1994) 155-60.

Sala-Newby, G.B., Thomson, C.M. and Campbell, A.K.: Sequence and biochemical similaritiesbetween the luciferases of the glow-worm Lampyris noctiluca and the firefly Photinus pyralis. BiochemJ 313 ( Pt 3) (1996) 761-7.

Samuelsson, E., Jonasson, P., Viklund, F., Nilsson, B. and Uhlen, M.: Affinity-assisted in vivo foldingof a secreted human peptide hormone in Escherichia coli. Nat Biotechnol 14 (1996) 751-5.

Sanger, F., Air, G.M., Barrell, B.G., Brown, N.L., Coulson, A.R., Fiddes, C.A., Hutchison, C.A.,Slocombe, P.M. and Smith, M.: Nucliotide sequence of bacteriophage phi X174 DNA. Nature 265(1977a) 687-95.

Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. ProcNatl Acad Sci U S A 74 (1977b) 5463-7.

Schillberg, S., Fischer, R. and Emans, N.: Molecular farming of recombinant antibodies in plants. CellMol Life Sci 60 (2003) 433-45.

Schmidt, T.G., Koepke, J., Frank, R. and Skerra, A.: Molecular interaction between the Strep-tagaffinity peptide and its cognate target, streptavidin. J Mol Biol 255 (1996) 753-66.

Nader Nourizad

64

Schmidt, T.G. and Skerra, A.: The random peptide library-assisted engineering of a C-terminal affinitypeptide, useful for the detection and purification of a functional Ig Fv fragment. Protein Eng 6 (1993)109-22.

Segel, I.H., Renosto, F. and Seubert, P.A.: Sulfate-activating enzymes. Methods Enzymol 143 (1987)334-49.

Shoji, I., Aizaki, H., Tani, H., Ishii, K., Chiba, T., Saito, I., Miyamura, T. and Matsuura, Y.: Efficientgene transfer into various mammalian cells, including non-hepatic cells, by baculovirus vectors. J GenVirol 78 ( Pt 10) (1997) 2657-64.

Simonsen, C.C. and McGrogan, M.: The molecular biology of production cell lines. Biologicals 22(1994) 85-94.

Smith, A.J.: The use of exonuclease III for preparing single stranded DNA for use as a template in thechain terminator sequencing method. Nucleic Acids Res 6 (1979) 831-48.

Smith, D.B. and Johnson, K.S.: Single-step purification of polypeptides expressed in Escherichia colias fusions with glutathione S-transferase. Gene 67 (1988) 31-40.

Smith, J.C., Derbyshire, R.B., Cook, E., Dunthorne, L., Viney, J., Brewer, S.J., Sassenfeld, H.M. andBell, L.D.: Chemical synthesis and cloning of a poly(arginine)-coding gene fragment designed to aidpolypeptide purification. Gene 32 (1984) 321-7.

Stahl, S. and Nygren, P.A.: The use of gene fusions to protein A and protein G in immunology andbiotechnology. Pathol Biol (Paris) 45 (1997) 66-76.

Stahl, S., Nygren, P.A. and Uhlen, M.: Strategies for gene fusions. Methods Mol Biol 62 (1997) 37-54.

Stratton, J., Chiruvolu, V. and Meagher, M.: High cell-density fermentation. Methods Mol Biol 103(1998) 107-20.

Studier, F.W.: Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. J MolBiol 219 (1991) 37-44.

Studier, F.W. and Moffatt, B.A.: Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189 (1986) 113-30.

Tabor, S. and Richardson, C.C.: Selective oxidation of the exonuclease domain of bacteriophage T7DNA polymerase. J Biol Chem 262 (1987) 15330-3.

Tabor, S. and Richardson, C.C.: Selective inactivation of the exonuclease activity of bacteriophage T7DNA polymerase by in vitro mutagenesis. J Biol Chem 264 (1989) 6447-58.

Thomas, C., Rajagopal, A., Windsor, B., Dudler, R., Lloyd, A. and Roux, S.J.: A role forectophosphatase in xenobiotic resistance. Plant Cell 12 (2000) 519-33.

Thomas, C., Sun, Y., Naus, K., Lloyd, A. and Roux, S.: Apyrase functions in plant phosphate nutritionand mobilizes phosphate from extracellular ATP. Plant Physiol 119 (1999) 543-52.

Thompson, J.F., Geoghegan, K.F., Lloyd, D.B., Lanzetti, A.J., Magyar, R.A., Anderson, S.M. andBranchini, B.R.: Mutation of a protease-sensitive region in firefly luciferase alters light emissionproperties. J Biol Chem 272 (1997) 18766-71.

Thore, A., Ansehn, S., Lundin, A. and Bergman, S.: Detection of bacteriuria by luciferase assay ofadenosine triphosphate. J Clin Microbiol 1 (1975) 1-8.


65

Timothy, J., Sofat, A., Sharr, M. and Doshi, B.: Unusual presentation of a germ cell neoplasm. JNeurol Neurosurg Psychiatry 57 (1994) 1278-9.

Tognoli, L. and Marre, E.: Purification and characterization of a divalent cation-activated ATP-ADPasefrom pea stem microsomes. Biochim Biophys Acta 642 (1981) 1-14.

Traverso-Cori, A., Chaimovich, H. and Cori, O.: Kinetic Studies and Properties of Potato Apyrase.Arch Biochem Biophys 109 (1965) 173-84.

Traverso-Cori, A., Traverso, S. and Reyes, H.: Different molecular forms of potato apyrase. ArchBiochem Biophys 137 (1970) 133-42.

Tschopp, J.F., Brust, P.F., Cregg, J.M., Stillman, C.A. and Gingeras, T.R.: Expression of the lacZ genefrom two methanol-regulated promoters in Pichia pastoris. Nucleic Acids Res 15 (1987) 3859-76.

Twyman, R.M., Stoger, E., Schillberg, S., Christou, P. and Fischer, R.: Molecular farming in plants:host systems and expression technology. Trends Biotechnol 21 (2003) 570-8.

Urlaub, G. and Chasin, L.A.: Isolation of Chinese hamster cell mutants deficient in dihydrofolatereductase activity. Proc Natl Acad Sci U S A 77 (1980) 4216-20.

Valenzuela, J.G., Charlab, R., Galperin, M.Y. and Ribeiro, J.M.: Purification, cloning, and expressionof an apyrase from the bed bug Cimex lectularius. A new type of nucleotide-binding enzyme. J BiolChem 273 (1998) 30583-90.

Valenzuela, M.A., Lopez, J., Depix, M., Mancilla, M., Kettlun, A.M., Catalan, L., Chiong, M., Garrido,J. and Traverso-Cori, A.: Comparative subcellular distribution of apyrase from animal and plantsources. Characterization of microsomal apyrase. Comp Biochem Physiol B 93 (1989) 911-9.

van den Hombergh, J.P., Sollewijn Gelpke, M.D., van de Vondervoort, P.J., Buxton, F.P. and Visser,J.: Disruption of three acid proteases in Aspergillus niger--effects on protease spectrum, intracellularproteolysis, and degradation of target proteins. Eur J Biochem 247 (1997) 605-13.

Vara, F. and Serrano, R.: Purification and characterization of a membrane-bound ATPdiphosphohydrolase from Cicer arietinum (chick-pea)roots. Biochem J 197 (1981) 637-43.

Wang, T.F., Ou, Y. and Guidotti, G.: The transmembrane domains of ectoapyrase (CD39) affect itsenzymatic activity and quaternary structure. J Biol Chem 273 (1998) 24814-21.

Ward, M., Wilson, L.J., Kodama, K.H., Rey, M.W. and Berka, R.M.: Improved production ofchymosin in Aspergillus by expression as a glucoamylase-chymosin fusion. Biotechnology (N Y) 8(1990) 435-40.

Waterham, H.R., Digan, M.E., Koutz, P.J., Lair, S.V. and Cregg, J.M.: Isolation of the Pichia pastorisglyceraldehyde-3-phosphate dehydrogenase gene and regulation and use of its promoter. Gene 186(1997) 37-44.

Wetmur, J.G.: DNA probes: applications of the principles of nucleic acid hybridization. Crit RevBiochem Mol Biol 26 (1991) 227-59.

White, P.J., Squirrell, D.J., Arnaud, P., Lowe, C.R. and Murray, J.A.: Improved thermostability of theNorth American firefly luciferase: saturation mutagenesis at position 354. Biochem J 319 ( Pt 2) (1996)343-50.

Wibom, R., Lundin, A. and Hultman, E.: A sensitive method for measuring ATP-formation in ratmuscle mitochondria. Scand J Clin Lab Invest 50 (1990) 143-52.

Nader Nourizad

66

Wood, K.V., Lam, Y.A., Seliger, H.H. and McElroy, W.D.: Complementary DNA coding click beetleluciferases can elicit bioluminescence of different colors. Science 244 (1989) 700-2.

Wulfing, C. and Pluckthun, A.: Protein folding in the periplasm of Escherichia coli. Mol Microbiol 12(1994) 685-92.

Yansura, D.G. and Henner, D.J.: Use of Escherichia coli trp promoter for direct expression of proteins.Methods Enzymol 185 (1990) 54-60.

Zimmerman, S.B., Little, J.W., Oshinsky, C.K. and Gellert, M.: Enzymatic joining of DNA strands: anovel reaction of diphosphopyridine nucleotide. Proc Natl Acad Sci U S A 57 (1967) 1841-8.

Zimmermann, H., Braun, N., Kegel, B. and Heine, P.: New insights into molecular structure andfunction of ectonucleotidases in the nervous system. Neurochem Int 32 (1998) 421-5.

Documents

Recombinant Enzymes in Pyrosequencing …9615/FULLTEXT01.pdfRecombinant Enzymes in Pyrosequencing Technology 1 1. Introduction The discovery of more than 30 years ago, of restriction