Regulatory role of LEF-1 in the Proliferation of Arbas ... · For Review Only Regulatory role of LEF-1 in the Proliferation of Arbas White Cashmere Goat Dermal Papilla Cells Fei Hao1,2,

For Review Only

Regulatory role of LEF-1 in the Proliferation of Arbas White

Cashmere Goat Dermal Papilla Cells

Journal: Canadian Journal of Animal Science

Manuscript ID CJAS-2017-0130.R3

Manuscript Type: Article

Date Submitted by the Author: 04-Feb-2018

Complete List of Authors: Hao, Fei; Experimental Animal Research Center, College of Life Sciences, Inner Mongolia University; Ulanqab Academy of Agricultural and Animal Husbandry Sciences Yan, Wei; Experimental Animal Research Center, College of Life Sciences, Inner Mongolia University Guo, Xiaodong; Experimental Animal Research Center, College of Life

Sciences, Inner Mongolia University Zhu, Bing; Experimental Animal Research Center, College of Life Sciences, Inner Mongolia University, Liu, Dongjun; Experimental Animal Research Center, College of Life Sciences, Inner Mongolia University

Keywords: Cashmere goat, Dermal papilla cell, LEF-1

https://mc.manuscriptcentral.com/cjas-pubs

Canadian Journal of Animal Science

For Review Only

Regulatory role of LEF-1 in the Proliferation of Arbas

White Cashmere Goat Dermal Papilla Cells

Fei Hao1,2, Wei Yan1, Xiaodong Guo1, Bing Zhu1, Dongjun Liu1,*

1Experimental Animal Research Center, College of Life Sciences, Inner Mongolia

University, Hohhot, China

2Ulanqab Academy of Agricultural and Animal Husbandry Sciences, Ulanqab, China

*Corresponding author

E-mail: [email protected]

Abstract

Cashmere, which has high economic value, is made from the secondary hair

follicles of cashmere goat skin. Dermal papilla cells (DPCs) are considered the center of

regulation of hair growth, which is closely related to hair follicle growth. We

constructed LEF-1 overexpression and interference experiment groups of goat DPCs to

investigate LEF-1 regulation of DPCs proliferation by Wnt signaling, and provide a

theoretical basis for improving cashmere yield. In primary DPCs, LEF-1, β-catenin,

C-myc, and cyclin D1 expression in the LEF-1 overexpression group was 9.25-, 1.27-,

1.74-, and 1.63-fold, respectively, that of the control. LEF-1, β-catenin, C-myc, and

cyclin D1 expression in the LEF-1 interference group was 0.20-, 0.75-, 0.38-, and

0.39-fold, respectively, that of the control. In secondary DPCs, LEF-1, β-catenin, C-myc,

and cyclin D1 expression in the LEF-1 overexpression group was 10.53-, 1.48-, 1.64-,

and 1.39-fold, respectively, that of the control. LEF-1, β-catenin, C-myc, and cyclin D1

Page 1 of 26



For Review Only

expression in the LEF-1 interference group was 0.21-, 0.71-, 0.40-, and 0.36-fold,

respectively, that of the control. Primary and secondary DPCs proliferation rates

changed with LEF-1 expression. Therefore, the LEF-1 regulation pattern of cell

proliferation through Wnt signaling is similar in both DPCs.

Keywords: Cashmere goat, Dermal papilla cell, LEF-1.

INTRODUCTION

The Cashmere goat skin hair follicle is classified into primary hair follicles and

secondary hair follicles based on their time of occurrence and structural characteristics.

Primary hair follicles develop to form wool while the secondary hair follicles develop to

form cashmere. (Ji et al. 2016; Qiao et al. 2016; Shi et al. 2016). The hair follicle is a

complex skin subsidiary organ that controls hair growth (Powell et al. 1992). The hair

follicle can be divided into two main parts, the portions that are part of the epithelium

and the dermis, and is composed of five segments: the hair ball, hair shaft, inner root

sheath, outer root sheath, and connective tissue sheath (Ji et al. 2016; Xing et al. 2011).

A hair ball is composed of the dermal papilla and hair matrix. The dermal papilla cells

(DPCs) are located at the base of the hair follicle, and they secrete a variety of cytokines

to regulate the adjacent tissues, thereby regulating the growth and renewal of hair

(Jeong et al. 2015). Accordingly, the DPCs have been referred to as the “mesenchymal

command center” of the hair follicle (Morgan 2014). Thus, the primary and secondary

DPCs from cashmere goats may represent valuable cell models for studying hair follicle

growth and cyclical changes, including investigations of the regulatory mechanisms of

the various genes involved in hair follicle growth and development.

Page 2 of 26



For Review Only

The Wnt signaling pathway regulates cell proliferation, differentiation, and

apoptosis through signal transduction between cells and plays a key regulatory role in

mammalian embryonic development and organ formation. The Wnt signaling pathway

includes both classical and non-classical signaling pathways. The classical Wnt

signaling pathway triggers the transcription of β-catenin/TCF enhancers and upregulates

the expression of target genes through accumulation of β-catenin in the cytoplasm. The

non-classical signaling pathway does not depend on β-catenin, which is involved in the

cellular polarity signaling pathway and Wnt/Ca2+

pathway. However, the proliferation

and differentiation of hair follicles are mainly mediated through the classical Wnt

signaling pathway (Xiong et al. 2014). In mice, relevant studies on the growth and

development of hair follicles have been reported. For example, conditional knockout of

β-catenin in embryonic skin blocked the development of hair follicles resulting in no

new hair formation (Osada and Kobayashi 2000). In addition, specific knockout of the

β-catenin nuclear conjugate LEF-1 resulted in follicle development termination (Andl et

al. 2002). However, in transgenic mice stably expressing β-catenin, a large number of

nascent hair follicles appeared in the epithelium, which eventually led to the emergence

of hair follicle tumors (Gat et al. 1998; Lo Celso et al. 2004). Furthermore, LEF-1

overexpression could promote the growth of hair follicles (Amberg et al. 2016; Leiros et

al. 2017). Moreover, regeneration of new hair follicles at a wound site was found to

depend on the activation of the Wnt signaling pathway. However, to our knowledge, the

roles of LEF-1 and β-catenin have not yet been addressed in the DPCs of cashmere

goats. Therefore, it is necessary to clarify the mechanisms underlying the growth and

Page 3 of 26



For Review Only

periodic regulation of the hair follicle, which could provide breeding and genetic

strategies to improve wool and cashmere production.

In the present study, the primary and secondary DPCs of an Arbas White

Cashmere goat were used as cell models to provide experimental evidence for exploring

the mechanism of signal regulation related to the growth of the hair follicle.

MATERIALS AND METHODS

Culture of dermal papilla cells

The samples were collected from a cashmere goat of an Arbas White Cashmere goats

breeding farm in the Inner Mongolia Autonomous Region of China. Skin samples (1–2

cm2) were collected in September, which is the season of hair follicle growth, from a

2-year-old female Arbas White Cashmere goat. The primary and secondary dermal

papilla cells were isolated as described previously (Zhu et al. 2013). The separated cells

were cultured in Dulbecco’s modified Eagle medium/F12 containing 10% fetal bovine

serum in a 5% CO2, 37°C incubator.

Immunocytochemistry

Immunocytochemistry was carried out to confirm the identity of the isolated cells. The

second-generation primary and secondary DPCs were cultured on coverslips placed in

culture dishes. The cells were washed three times with 0.01 M phosphate-buffered

saline (PBS) and grown to 90% confluence. The cells were then incubated with 4%

paraformaldehyde at 4°C for 30 min, and the immobilized cells were treated with 0.5%

Page 4 of 26



For Review Only

Triton X-100 for 10 min at room temperature, washed three times with 0.01 M PBS,

and incubated with PBS containing 5% bovine serum albumin at room temperature for

60 min to minimize non-specific staining. The cells were incubated overnight at 4°C

with the primary antibody against alpha-smooth muscle actin (α-SMA; 1:100 diluted;

Boster Biotech) and CD133 (1:100 diluted; Boster Biotech), washed three times with

0.01 M PBS, and then incubated again for 60 min at 37°C with the secondary antibody,

goat anti-rabbit/mouse IgG (1:100 diluted; Boster Biotech). Finally, the cells were

stained with 1 mg/L 4ʹ,6ʹ-diamidino-2-phenylindole (DAPI; Boster Biotech) solution for

5 min after washing again with 0.01 M PBS. The fluorescence images were obtained

after inversion of the fluorescence microscope.

Plasmid construction and transient transfections

The amplified LEF-1 gene coding sequence and cytomegalovirus promoter were added

to the pDsRed2-1 skeleton plasmid through an experimental molecular biology

technique to achieve the overexpression vector named pDsRed2-LEF-1. The RNA

interference vector of LEF-1 was constructed with pSIREN-RetroQ-ZsGreen as the

backbone. The interfering RNA sequence of the LEF-1 gene design was

5ʹ-GGACCCTCTTATTCGAGTT-3ʹ. The constructed vector was confirmed by

sequencing, and the primary and secondary DPCs were transfected with Lipofectamine

2000 (Invitrogen) according to the manufacturer's protocol. After 48 h of transfection,

the cells were harvested for subsequent real-time polymerase chain reaction (PCR) and

western blotting analyses.

Page 5 of 26



For Review Only

Growth curve of dermal papilla cells

The cells at a good growth state were digested with trypsin, and then the cell number in

the suspension was counted in new medium using a hemocytometer. Based on the cell

count results, the cells were subcultured at a density of 5 × 104

cells/mL. After 24 h of

incubation, cell counting was initiated to construct the growth curve. The counting

process was performed every 24 h for 7 consecutive days. Three groups of the same

cultured cells were counted at each time point, and the mean value was calculated and

used to plot the growth curve, with cell number on the vertical axis and time on the

horizontal axis.

EdU incorporation assay

The proliferation of DPCs was examined via the 5-ethynyl-2′-deoxyuridine (EdU)

incorporation assay using the EdU Assay Kit (Ribobio, Guangzhou,China) according to

the manufacturer's instructions. DPCs were seeded in 24-well cell culture plates at 2 ×

104

cells per well and cultured for 48 h at 37 °C. The cells were further incubated with

50 µM EdU medium for 3 h at 37°C. The cells were fixed with 4% paraformaldehyde

for 30 min at room temperature and treated with 0.5% Triton X-100 for 10 min at room

temperature. After washing the cells three times with PBS, 1× Apollo® staining

reaction solution was added, and the cells were incubated at room temperature for 30

min. Finally, the cells were treated with Hoechst 33342 for 30 min. The fluorescence

images were obtained after inversion of the fluorescence microscope. EdU-positive cells

(red cells) and Hoechst 33342-positive cells (blue cells) were counted by using Image J

Page 6 of 26



For Review Only

software (National Institutes of Health, USA), and the EdU incorporation rate was

calculated. The EdU incorporation rate is the ratio of the number of EdU-positive cells

to the number of Hoechst 33342-positive cells. All experiments were performed in

triplicate, with three independent replicates.

Real-time PCR

Total RNA was extracted from the lysates of the cells in each experimental group

(LEF-1-overexpressing, LEF-1-interference, and control) using RNAiso Plus reagent

(TaKaRa Biotechnology, Dalian, China). The genomic DNA was then removed by

treatment with gDNA Eraser to reduce its influence on the experimental results. Equal

amounts of each RNA sample were used to synthesize cDNA by using the PrimeScript

RT reagent Kit (TaKaRa Biotechnology) according to the manufacturer’s instructions.

The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as the

internal reference gene. The primers for amplifying LEF-1, β-catenin, C-myc, cyclin D1,

and GAPDH were designed and are shown in Table 1.

Real-time PCR was performed using the iQ5 system (Bio-Rad, Hercules, CA, USA)

with SYBR Premix Ex Taq (TaKaRa) as directed by the manufacturer. The real-time

PCR cycling conditions were 95°C for 3 min, followed by 40 cycles of 95°C for 5 s and

60°C for 1 min. The specificity of each primer was determined by the melting curve of

the real-time PCR. The results were obtained after three independent experiments with

three replicates each. The relative quantitative analysis of each gene was performed by

using the comparative cycle threshold (Ct) value method. The relative expression level

Page 7 of 26



For Review Only

of each gene was calculated by using the 2−△△Ct

method.

Western blot analysis

The proteins of the respective cell lines were extracted. Equal amounts of each protein

were transferred to the sodium dodecyl sulfate-polyacrylamide gel electrophoresis

protein membrane, and the membrane was incubated at 4°C with the primary antibody

against LEF-1 (1:500 dilution; Abcam,), C-myc (1:500 dilution; Abcam), cyclin D1

(1:500 dilution; Abcam), and β-catenin (1:500 dilution; Abcam); horseradish

peroxidase-tagged IgG antibody was used as the secondary antibody. A β-actin antibody

at 1:1,000 dilution was used as a loading control. The protein bands were visualized

using the Tanon-5200 image analysis system.

Statistical analysis

The data were obtained from three independent experiments, and each experiment was

performed with three replicates. The experimental data are presented in the form of

mean ± standard deviation, and were analyzed using Graphpad Prism 6 software. Data

between groups were compared with the t-test, and a P-value less than 0.05 was

considered to indicate a statistically significant difference.

RESULTS

In vitro culture and identification of Arbas White Cashmere goat dermal

papilla cells

Page 8 of 26



For Review Only

Upon in vitro culture, the primary and secondary DPCs of an Arbas White Cashmere

goat showed a spindle-shaped morphology, with adherent growth (Fig. 1A). The cells

showed agglutination growth in vitro for 5–7 days. The cells were positive for α-SMA

and CD133 markers (Fig. 2), confirming that they were indeed DPCs.

Plasmid transfection into the primary and secondary dermal papilla cells

The LEF-1-overexpression and -interference vectors were respectively transfected into

both the Arbas White Cashmere goat primary and secondary DPCs by using liposomes,

and the transfection efficiency was judged according to the intensity of red and green

fluorescence (Fig. 1B, C). The efficiency of the transfection of the overexpression and

interference LEF-1 vectors was then assessed via quantitative real-time PCR. Cells

transfected with no plasmid were included as a negative control. As shown in Fig. 3, the

LEF-1 expression level in the primary DPCs was 9.25-fold and 0.2-fold that of the

control in the overexpression and interference groups, respectively (p < 0.001). Similar

results were detected in the secondary DPCs, with LEF-1 expression levels in the

overexpression group and interference group being 10.53-fold and 0.21-fold,

respectively, that of the control (p < 0.001). These results confirmed that overexpression

and interference of LEF-1 in the Arbas White Cashmere goat DPCs were successfully

achieved.

LEF-1 activated the expression of the cyclin D1 and C-myc genes in the

primary and secondary dermal papilla cells

Real-time PCR showed the consistent expression patterns of LEF-1 and a series of

Page 9 of 26



For Review Only

genes related to hair follicle growth in the primary and secondary DPCs. Compared

with the negative control group, the mRNA expression levels of cyclin D1, C-myc, and

β-catenin were increased and decreased in the LEF-1-overexpression and interference

groups, respectively, to different extents (Fig. 3). Furthermore, western blot results

showed the same patterns in protein expression levels (Fig. 4). Therefore, our results

show that the expression levels of cyclin D1, C-myc, and β-catenin are positively

correlated with LEF-1 expression. Comparison of the gene expression levels between

the primary and secondary DPCs of the control group showed that LEF-1, β-catenin,

and cyclin D1 mRNA expression levels in the secondary DPCs were 1.28-, 2.19-, and

1.16-fold higher than those of the primary DPCs, respectively. By contrast, the mRNA

expression level of C-myc in the secondary DPCs was 0.37-fold that of the primary

DPCs (Fig. 5).

Effect of LEF-1 on the proliferation of dermal papilla cells

Analysis of the growth curve of the different cell lines showed that LEF-1

overexpression significantly increased the cell proliferation rate, especially as of the

third day, whereas the growth of the LEF-1 interference group was slower than that of

the control group (Fig. 6).

We also investigated the function of LEF-1 in promoting DPC proliferation via the EdU

incorporation assay. We obtained similar results in primary dermal papilla and

secondary DPCs (Fig. 7, 8). When LEF-1 was overexpressed, EdU-positive cells were

significantly increased relative to the control group. In primary and secondary DPCs,

Page 10 of 26



For Review Only

the proportion of EdU-positive cells increased by more than 30%. EdU-positive cells

were significantly reduced relative to the control group when LEF-1 was lowly

expressed. In both primary and secondary DPCs, the percentage of EdU-positive cells is

reduced by about 26%.

These results showed that overexpression of LEF-1 promoted the proliferation of DPCs,

while downregulation of LEF-1 decreased the proliferation of DPCs.

DISCUSSION

The hair follicle is a complex sub-organ structure that continuously cycles through

growth, degenerative, and telogen phases for continuous hair renewal. Dermal papillae

interact with the cells of the bulge region toward the end of the telogen phase. By

activating the proliferation of stem cells, dermal papillae are pushed down and the

various hair follicle cells are differentiated to form new hair follicles (Kulessa et al.

2000; Stenn and Paus 2001). Therefore, DPCs are considered to be the center of hair

growth regulation. To improve cashmere quality from goat breeds, it is necessary to

elucidate the regulatory mechanisms underlying the proliferative effects if DPCs.

Therefore, this study was designed to investigate the role of LEF-1 in the regulation of

DPC proliferation via the Wnt signaling pathway.

Our experimental results showed that LEF-1, an important member of the Wnt

signaling pathway, is involved in the regulation of DPC proliferation. With the increase

of LEF-1 expression, DPCs proliferation increased. Moreover, when the expression of

LEF-1 was knocked down, the proliferation ability of DPCs was decreased. The Wnt

signaling pathway is closely associated with hair follicle growth and development, as

Page 11 of 26



For Review Only

well as cell cycle maintenance (Andl et al. 2002; Huelsken et al. 2001). Our results also

support this conclusion. In addition, we found that LEF-1 expression was correlated

with β-catenin expression. Some studies have reported that in mouse embryonic day 11

(E11), LEF-1 was expressed in the mesenchyme of the mouse tentacle (Liu et al. 2004).

During hair follicle development, LEF-1 levels in mesenchymal cells gradually

increased with the formation of the basal lamina, and appeared in the embryonic

epithelial cells. The TOP β-galactosidase (TOPGAL) activity of the Wnt reporter gene

was localized in the positive region of LEF-1 expression. At E16, the expression of

LEF-1 began to weaken in the epithelium and was concentrated in the hair matrix of the

hair bulb, hair shaft, and DPCs of mesenchymal origin. TOPGAL was expressed in both

the hair matrix and hair shaft (Liu et al. 2004; Zhou et al. 1995). These results show that

LEF-1 and β-catenin have similar expression patterns in the development of hair

follicles. Therefore, we hypothesize that the simultaneous changes of LEF-1 and

β-catenin expression alter the expression of downstream target genes in the Wnt

signaling pathway, thereby affecting the proliferation of DPCs.

As two target genes of the Wnt signaling pathway, cyclin D1 and C-myc are critical

genes involved in cell proliferation and differentiation (Pinto and Clevers 2005). C-myc

is an oncogenic transcription factor that plays an important role in the regulation of cell

proliferation, differentiation, and aging (Dang et al. 1999). The high expression of

C-myc positively regulates the activity of cyclin-dependent kinases (CDKs), which in

turn accelerates the progression of G1 phase; this cascade is crucial for cell proliferation.

Changes of C-myc expression mediated by the Wnt/β-catenin signaling pathway have

Page 12 of 26



For Review Only

been reported in several cell types, and these changes affected the cell proliferation rate

(Myant and Sansom 2011). In the present study, with the high expression of LEF-1, the

expression of C-myc in dermal papilla cells also increased, and the proliferation rate of

the cells increased. This suggests that the Wnt/β-catenin signaling pathway induces

proliferation in dermal papilla cells via C-myc. However, C-myc is not the only target

gene that regulates the proliferation of dermal papilla cells in the Wnt/β-catenin

signaling pathway; cyclin D1 is also a target gene in the signaling pathway. Cyclin D1

is an important cyclin protein that regulates cell proliferation from the G1 phase to the S

phase by mediating the functions of CDK4 and CDK6. In this study, we observed that

LEF-1 promoted the proliferation of dermal papilla cells and also detected

corresponding changes in cyclin D1 levels. This indicates that the proliferation of

dermal papilla cells can be induced through the target gene cyclin D1 in the Wnt

signaling pathway.

In this study, the expression levels of LEF-1 and β-catenin in primary dermal

papilla cells were lower than those in secondary dermal papilla cells, and we also found

that C-myc was more prominent in primary dermal papilla cells. It is speculated that the

secondary dermal papilla cells may have stronger Wnt/β-catenin/LEF-1 signaling ability

than primary dermal papilla cells, whereas signal-stabilized β-catenin can form

complexes with various binding proteins and activate the downstream genes. These

signal pathways are modified in different types of dermal papilla cells at different

intensities, which may affect the direction of the development of primary and secondary

hair follicles.

Page 13 of 26



For Review Only

In summary, our experiments demonstrated that the overexpression of LEF-1 in

dermal papilla cells upregulated the expression of C-myc and cyclin D1, and

consequently promoted the proliferation of dermal papilla cells. Similarly, the

interference of LEF-1 in dermal papilla cells reduced the expression levels of the C-myc

and cyclin D1 genes, thereby decreasing the proliferation of dermal papilla cells.

Therefore, a positive correlation between LEF-1 and the C-myc and cyclin D1 genes in

dermal papilla cell proliferation was established. This is consistent with the classic Wnt

signal pathway regulation characteristics. Our results also suggest that different types of

Wnt signal modification will result in the formation of different hair follicle types, and

provide the basis for future research on the molecular mechanism of hair follicle growth

and development.

ACKNOWLEDGEMENTS

This work was supported by The National Genetically Modified Organisms Breeding

Major Projects (Grant No. 2014ZX08008-002).

REFERENCES

Amberg, N., Holcmann, M., Stulnig, G. and Sibilia, M. 2016. Effects of Imiquimod on Hair Follicle Stem

Cells and Hair Cycle Progression. J Invest Dermatol 136(11):2140-2149.

Andl, T., Reddy, S. T., Gaddapara, T. and Millar, S. E. 2002. WNT signals are required for the initiation of

hair follicle development. Dev Cell 2(5):643-53.

Asally, M. and Yoneda, Y. 2005. Beta-catenin can act as a nuclear import receptor for its partner

transcription factor, lymphocyte enhancer factor-1 (lef-1). Exp Cell Res 308(2):357-63.

Dang, C. V., Resar, L. M., Emison, E., Kim, S., Li, Q., Prescott, J. E., Wonsey, D. and Zeller, K. 1999.

Function of the c-Myc oncogenic transcription factor. Exp Cell Res 253(1):63-77.

Gat, U., DasGupta, R., Degenstein, L. and Fuchs, E. 1998. De Novo hair follicle morphogenesis and hair

tumors in mice expressing a truncated beta-catenin in skin. Cell 95(5):605-14.

Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G. and Birchmeier, W. 2001. beta-Catenin controls hair

follicle morphogenesis and stem cell differentiation in the skin. Cell 105(4):533-45.

Page 14 of 26



For Review Only

Jeong, K. H., Joo, H. J., Kim, J. E., Park, Y. M. and Kang, H. 2015. Effect of mycophenolic acid on

proliferation of dermal papilla cells and induction of anagen hair follicles. Clin Exp Dermatol

40(8):894-902.

Ji, X. Y., Wang, J. X., Liu, B., Zheng, Z. Q., Fu, S. Y., Tarekegn, G. M., Bai, X., Bai, Y. S., Li, H. and Zhang,

W. G. 2016. Comparative Transcriptome Analysis Reveals that a Ubiquitin-Mediated Proteolysis

Pathway Is Important for Primary and Secondary Hair Follicle Development in Cashmere Goats.

PLoS One 11(10):e0156124.

Koike, M., Kose, S., Furuta, M., Taniguchi, N., Yokoya, F., Yoneda, Y. and Imamoto, N. 2004.

beta-Catenin shows an overlapping sequence requirement but distinct molecular interactions

for its bidirectional passage through nuclear pores. J Biol Chem 279(32):34038-47.

Kulessa, H., Turk, G. and Hogan, B. L. 2000. Inhibition of Bmp signaling affects growth and

differentiation in the anagen hair follicle. EMBO J 19(24):6664-74.

Leiros, G. J., Ceruti, J. M., Castellanos, M. L., Kusinsky, A. G. and Balana, M. E. 2017. Androgens modify

Wnt agonists/antagonists expression balance in dermal papilla cells preventing hair follicle

stem cell differentiation in androgenetic alopecia. Mol Cell Endocrinol 439:26-34.

Li, Y. J., Wei, Z. M., Meng, Y. X. and Ji, X. R. 2005. Beta-catenin up-regulates the expression of cyclinD1,

c-myc and MMP-7 in human pancreatic cancer: relationships with carcinogenesis and

metastasis. World J Gastroenterol 11(14):2117-23.

Liu, X., Driskell, R. R., Luo, M., Abbott, D., Filali, M., Cheng, N., Sigmund, C. D. and Engelhardt, J. F.

2004. Characterization of Lef-1 promoter segments that facilitate inductive developmental

expression in skin. J Invest Dermatol 123(2):264-74.

Lo Celso, C., Prowse, D. M. and Watt, F. M. 2004. Transient activation of beta-catenin signalling in adult

mouse epidermis is sufficient to induce new hair follicles but continuous activation is required

to maintain hair follicle tumours. Development 131(8):1787-99.

Morgan, B. A. 2014. The dermal papilla: an instructive niche for epithelial stem and progenitor cells in

development and regeneration of the hair follicle. Cold Spring Harb Perspect Med

4(7):a015180.

Myant, K. and Sansom, O. J. 2011. Wnt/Myc interactions in intestinal cancer: partners in crime. Exp Cell

Res 317(19):2725-31.

Niemann, C., Owens, D. M., Hulsken, J., Birchmeier, W. and Watt, F. M. 2002. Expression of DeltaNLef1

in mouse epidermis results in differentiation of hair follicles into squamous epidermal cysts and

formation of skin tumours. Development 129(1):95-109.

Osada, A. and Kobayashi, K. 2000. Appearance of hair follicle-inducible mesenchymal cells in the rat

embryo. Dev Growth Differ 42(1):19-27.

Pinto, D. and Clevers, H. 2005. Wnt, stem cells and cancer in the intestine. Biol Cell 97(3):185-96.

Powell, B., Crocker, L. and Rogers, G. 1992. Hair follicle differentiation: expression, structure and

evolutionary conservation of the hair type II keratin intermediate filament gene family.

Development 114(2):417-33.

Qiao, X., Wu, J. H., Wu, R. B., Su, R., Li, C., Zhang, Y. J., Wang, R. J., Zhao, Y. H., Fan, Y. X., Zhang, W. G.

and others. 2016. Discovery of differentially expressed genes in cashmere goat (Capra hircus)

hair follicles by RNA sequencing. Genet Mol Res 15(3).

Shi, B., Ding, Q., He, X., Zhu, H., Niu, Y., Cai, B., Cai, J., Lei, A., Kang, D., Yan, H. and others. 2016.

Tbeta4-overexpression based on the piggyBac transposon system in cashmere goats alters hair

fiber characteristics. Transgenic Res.

Page 15 of 26



For Review Only

Stenn, K. S. and Paus, R. 2001. Controls of hair follicle cycling. Physiol Rev 81(1):449-494.

Xing, Y., Xu, W., Yang, K., Lian, X. and Yang, T. 2011. Immunolocalization of Wnt5a during the hair cycle

and its role in hair shaft growth in mice. Acta Histochem 113(6):608-12.

Xiong, Y., Liu, Y., Song, Z., Hao, F. and Yang, X. 2014. Identification of Wnt/beta-catenin signaling

pathway in dermal papilla cells of human scalp hair follicles: TCF4 regulates the proliferation

and secretory activity of dermal papilla cell. J Dermatol 41(1):84-91.

Zhou, P., Byrne, C., Jacobs, J. and Fuchs, E. 1995. Lymphoid enhancer factor 1 directs hair follicle

patterning and epithelial cell fate. Genes Dev 9(6):700-13.

Zhu, B., Xu, T., Yuan, J., Guo, X. and Liu, D. 2013. Transcriptome sequencing reveals differences

between primary and secondary hair follicle-derived dermal papilla cells of the Cashmere goat

(Capra hircus). PLoS One 8(9):e76282.

Page 16 of 26



For Review Only

Fig. 1. Plasmids were transfected into Cashmere goat DPCs. (A) No plasmid transfected DPCs (B)

DPCs transfected with the LEF-1-overexpressing vector. (C) DPCs transfected with the

LEF-1-interference vector. Scale bar = 100 μm. DPC, dermal papilla cells; PHF, primary hair follicle;

SHF, secondary hair follicle.

Fig. 2. Identification of Cashmere goat DPCs. The expression of α-SMA and CD133 was detected by

using fluorescence microscopy; the nuclei were stained with DAPI. Scale bar = 100 μm.

Fig. 3. LEF-1 activated the expression of the cyclin D1, C-myc, and β-catenin genes in DPCs. The

mRNA expression levels of LEF-1, cyclin D1, C-myc, and β-catenin were detected with quantitative

real-time PCR. Green, No plasmid transfected DPCs; red, DPCs transfected with the

LEF-1-overexpressing vector; yellow, DPCs transfected with the LEF-1-interference vector. Data are

the means ± SD from three independent experiments. **P < 0.01; ***P < 0.001; ****P < 0.0001.

Fig. 4. Western blot. Lane 1, No plasmid transfected DPCs; Lane 2, DPCs transfected with the

LEF-1-overexpressing vector; Lane 3, DPCs transfected with the LEF-1-interference vector.

Fig. 5. The mRNA expression levels of LEF-1, ββββ-catenin, cyclin D1, and C-myc genes in primary

(blue) and secondary (purple) DPCs. Data are means ± SD from three independent experiments. *P

< 0.05; ****P < 0.0001.

Fig. 6. The growth curves of DPCs. Green, No plasmid transfected DPCs; red, DPCs transfected with

the LEF-1-overexpressing vector; yellow, DPCs transfected with the LEF-1-interference vector.

Fig. 7. EdU incorporation assay. Proliferating cells were stained with EdU (red); the nuclei were

stained with Hoechst 33342 (blue). Scale bar = 100 μm.

Fig. 8. The EdU incorporation rate was expressed as the ratio of EdU-positive cells to total Hoechst

33342-positive cells. Green, No plasmid transfected DPCs; red, DPCs transfected with the

LEF-1-overexpressing vector; yellow, DPCs transfected with the LEF-1-interference vector. Data are

the means ± SD from three independent experiments. **P < 0.01; ***P < 0.001.

Page 17 of 26



For Review Only

Table 1. Primers used for real-time PCR.

Target Primer sequences (5′′′′–3′′′′) Product size (bp)

β-Catenin

F: GTGCTGAAGGTGCTGTCTGTGTGCTCT

363

R: AGGCTCGGTGATGTCTTCCCTGTCCCC

C-myc

F: GTGGTCTTCCCCTACCCGCTCAACGA

322

R: ATCTCTTTAGGACCAACGGGCTGTGA

Cyclin D1

F: CTACCTGGACCGCTTCCTGTCGCTG

213

R: GCCGCCAGGTTCCACTTGAGTTTGT

LEF-1

F: CCCCACCTCTTGGCTGGTTTTCTCA

177

R: TTGGCTCCTGCTCCTTTCTCTGTTC

GAPDH

F: CCATCACTGCCACCCAGAAGACT

337

R: GAGTGAGTGTCGCTGTTGAAGTCG

Page 18 of 26



For Review Only

Fig. 1. Plasmids were transfected into Cashmere goat DPCs.

120x142mm (220 x 220 DPI)

Page 19 of 26



For Review Only

Fig. 2. Identification of Cashmere goat DPCs.

147x106mm (220 x 220 DPI)

Page 20 of 26



For Review Only

Fig. 3. LEF-1 activated the expression of the cyclin D1, C-myc, and β-catenin genes in DPCs.

146x51mm (220 x 220 DPI)

Page 21 of 26



For Review Only

Fig. 4. Western blot.

150x100mm (100 x 100 DPI)

Page 22 of 26



For Review Only

Fig. 5. The mRNA expression levels of LEF-1, β-catenin, cyclin D1, and C-myc genes in primary (blue) and secondary (purple) DPCs.

146x90mm (220 x 220 DPI)

Page 23 of 26



For Review Only

Fig. 6. The growth curves of DPCs.

146x49mm (220 x 220 DPI)

Page 24 of 26



For Review Only

Fig. 7. EdU incorporation assay.

146x85mm (220 x 220 DPI)

Page 25 of 26



For Review Only

Fig. 8. The EdU incorporation rate was expressed as the ratio of EdU-positive cells to total Hoechst 33342-positive cells.

146x48mm (220 x 220 DPI)

Page 26 of 26



Documents

Regulatory role of LEF-1 in the Proliferation of Arbas ... · For Review Only Regulatory role of LEF-1 in the Proliferation of Arbas White Cashmere Goat Dermal Papilla Cells Fei Hao1,2,