Rehan Sadiq Sheikh's Ph.D Thesis

GENOTYPE/PHENOTYPE CORRELATION FOR

HEREDITARY HEARING IMPAIRMENT LOCI

A THESIS SUBMITTED

TO

UNIVERSITY OF THE PUNJAB

IN THE COMPLETE FULFILLMENT OF THE

REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

IN

MOLECULAR BIOLOGY

BY

REHAN SADIQ SHAIKH

Supervisors:

DR. SHAHEEN. N. KHAN

&

DR. SHEIKH RIAZUDDIN

CENTRE OF EXCELLENCE IN MOLECULAR BIOLOGY,

UNIVERSITY OF THE PUNJAB, LAHORE, PAKISTAN

(2006)

In the name of ALLAH the most merciful & compassionate the most gracious and beneficent whose help and guidance always

solicit at every step, at every moment

CERTIFICATE

It is certified that the research work described in this thesis is the original work of the

author and has been carried out under our direct supervision. We have personally gone through

all the data reported in the manuscript and certify their correctness/authenticity. It is further

certified that the material included in this thesis have not been used in part or full in a manuscript

already submitted or in the process of submission in partial/complete fulfillment of the award of

any other degree from any other institution. It is also certified that the thesis has been prepared

under our supervision according to the prescribed format and we endorse its evaluation for the

award of Ph.D. degree through the official procedures of the University.

In accordance with the rules of the Centre, data book # 352, 415, M-18, and 558 is declared as

unexpendable document that will be kept in the registry of the Centre for a minimum of three

years from the date of the thesis defense examination.

Name of Supervisor: Dr. Shaheen. N. Khan

Principal Scientific Officer, Punjab University, Lahore.

Name of Supervisor: Dr. Sheikh Riazuddin

Director, CEMB, Punjab University, Lahore.

(i)

INDEX

List of Figure......................................................................................................................v

List of Table.......................................................................................................................vi

Summary ..........................................................................................................................vii

Acknowledgments .............................................................................................................ix

Abbrevations.......................................................................................................................x

INTRODUCTION..............................................................................................................1

CHAPTER- I

REVIEW OF LITERATURE ............................................................................................5

SECTION-I-INTRICACY OF AUDITORY SYSTEM........................................................ 6 ANATOMY OF AUDITORY SYSTEM..............................................................................................7

THE EXTERNAL EAR ..............................................................................................................7 The Pinna................................................................................................................................7 The Auditory Canal (Auditory Meatus)..................................................................................7 Tympanic Membrane (Ear Drum) ..........................................................................................7

THE MIDDLE EAR (TYMPANIC CAVITY) ...........................................................................8 Auditory Ossicles....................................................................................................................8 Eustachian Tube .....................................................................................................................8 Oval and Round Windows......................................................................................................8

THE INNER EAR.....................................................................................................................10 Osseous Labyrinth ................................................................................................................10

Vestibule ..........................................................................................................................10 Semicircular canals ..........................................................................................................11 Cochlea ............................................................................................................................11

Membranous Labyrinth.........................................................................................................11 Neurosensory epithelia (Mechanotransducers) ................................................................11 Ion Transporting Epithelia ...............................................................................................12 Less Specialized Epithelia ...............................................................................................12

VESTIBULAR SYSTEM .........................................................................................................12 COCHLEAR SYSTEM.............................................................................................................12

Organ Of Corti......................................................................................................................13 Outer Hair Cells: (OHCs) ................................................................................................13 Inner hair cells: (IHCs) ....................................................................................................13 Hair Cell stereocilia and links..........................................................................................14

PHYSIOLOGY OF EAR....................................................................................................................16 EVENTS IN THE HEARING OF SOUND WAVES...............................................................16

Conductive Hearing..............................................................................................................16 Sensory Hearing ...................................................................................................................16 Neural Hearing .....................................................................................................................17

MOLECULAR BASIS OF MECHANOSENSORY TRANSDUCTION AND ADAPTATION

MECHANISMS ........................................................................................................................17 Transducer Channel Model...................................................................................................18 Adaptation Motor Model ......................................................................................................18

SECTION-II-GENETICS OF DEAFNESS ......................................................................... 21 DEAFNESS ........................................................................................................................................22

A BRIEF HISTORY .................................................................................................................22 GENETIC EPIDEMIOLOGY...................................................................................................25

MOLECUALR GENETIC OF DEAFNESS.......................................................................................25 HEARING LOSS/DEAFNESS LOCI .......................................................................................25

Page

(ii)

NONSYNDROMIC HEARING LOSS (NSHL) ..................................................................25 Nonsyndromic Autosomal Dominant Hearing Loss.........................................................25 Nonsyndromic Autosomal Recessive Hearing Loss.........................................................26

SYNDROMIC HEARING LOSS.........................................................................................26 Syndromic Autosomal Dominant Loci.............................................................................26 Syndromic Autosomal Recessive Loci.............................................................................27

PREVALENT SYNDROMIC AND NONSYNDROMIC LOCI/GENES IN PAKISTANI

POPULATION ..............................................................................................................................36 DFNB1/DFNA3/CX26/GJB2/CX30/GJB6...............................................................................36 DFNB2/DFNA11/USH1B/MYO7A .........................................................................................37 DFNB3/MYO15A.....................................................................................................................39 DFNB4/PENDRED SYNDROME/SLC26A4 ..........................................................................40 DFNB6/TMIE ...........................................................................................................................41 DFNB7/11/DFNA36/TMC1 .....................................................................................................42 DFNB8/B10/TMPRSS3............................................................................................................42 DFNB12/USH1D/CDH23.........................................................................................................43 DFNB18/USH1C ......................................................................................................................44 DFNB21/ DFNA8/A12/TECTA ...............................................................................................44 DFNB23/USH1F/PCDH15 .......................................................................................................45 DFNB26 ....................................................................................................................................45 DFNB29/CLDN14 ....................................................................................................................45 DFNB35 ....................................................................................................................................46 DFNB36/ESPN .........................................................................................................................46 DFNB37/DFNA22/MYO6........................................................................................................46 DFNB38 ....................................................................................................................................47 DFNB39 ....................................................................................................................................47 DFNB42 ....................................................................................................................................47 DFNB44 ....................................................................................................................................47 DFNB46 ....................................................................................................................................47 DFNB48 ....................................................................................................................................47 DFNB49 ....................................................................................................................................47 DFNB51 ....................................................................................................................................47 DFNB56 ....................................................................................................................................48

MOLECULAR ARCHITECTURE OF THE INNER EAR HAIR CELLS AND HAIR BUNDLE

STEREOCILIA...................................................................................................................................51 CORE OF STEREOCILIA...................................................................................................51 Shaping the stereocilium from tip to taper............................................................................52 Arrangement of stereocilia in the hair bundle.......................................................................54 Programmed elongation of stereocilia ..................................................................................55 Stereociliary links .................................................................................................................56

HAIR BUNDLE MORPHOGEENSIS AND MACROMOLECULAR COMPLEX OF USH1

PROTEINS................................................................................................................................57 SUPPORTING CELLS .............................................................................................................60 THE BASILAR MEMBRANE .................................................................................................60 TECTORIAL MEMBRANE.....................................................................................................61 STRIA VASCULARIS..............................................................................................................61 CONCLUSION .........................................................................................................................62

SECTION-III-LINKAGE ANALYSIS-A TOOL FOR MAPPING DISEASE CAUSING

GENES..................................................................................................................................... 63 RECOMBINATION FRACTION REFLECTS GENETIC DISTANCE..................................65 SCORE METHOD....................................................................................................................65 MULTIPOINT MAPPING .......................................................................................................65 DNA POLYMORPHISM AS A TOOL FOR LINKAGE ANALYSIS.....................................66

CHAPTER-II

MATERIAL AND METHODS........................................................................................67

(iii)

FIELD WORK ...............................................................................................................................68 INSTITUTIONAL REVIEW BOARD (IRB)...........................................................................68 IDENTIFICATION AND ENROLLMENT OF FAMILIES ....................................................68 CLINICAL EVALUATION......................................................................................................69

AUDIOLOGICAL EVALUAION........................................................................................69 Audiometry ......................................................................................................................69 Tympanometry.................................................................................................................70 Otoacoustic Emission (OAE)...........................................................................................70

VESTIBULAR EVALUATION...........................................................................................72 Romberg and Tandem Gait Test ......................................................................................72 Electronystagmography Test (ENG)................................................................................72

RETINITIS PIGMENTOSA ................................................................................................72 Funduscopy or Opthalmoscopy........................................................................................73 Electroretinogram Test (ERG).........................................................................................73

BENCH WORK.............................................................................................................................75 DNA EXTRACTION................................................................................................................75

From Blood Samples ............................................................................................................75 From Buccal Swabs ..............................................................................................................75 Preparation of Replica Plates................................................................................................76

LINKAGE ANALYSIS FOR ALREADY REPORTED DFNB LOCI .....................................77 Genotyping By Using Polymerase Chain Reaction (PCR) and STR Markers ......................77

GENOME WIDE SCAN...........................................................................................................78 SAMPLE PREPARATION FOR ABI 3100 GENETIC ANALYZER .....................................81

Principle Of Automated Fluorescent Genotyping.................................................................81 HAPLOTYPE ANALYSIS ..................................................................................................83

GENOME SCAN DATA ORGANIZATION AND ANALYSIS .............................................83 How to Run the Macro .........................................................................................................83

Modules ...........................................................................................................................83 LOD SCORE CALCULATIONS.........................................................................................85

DNA SEQUENCING................................................................................................................85 Amplification of PCR Fragments .........................................................................................86 Agarose Gel Electrophoresis and EXO-SAP Treatment.......................................................86 Sequencing Reaction ............................................................................................................86 Sequencing Product Precipitation and Loading on ABI 3100 Sequencer.............................87 Analysis of DNA Sequences.................................................................................................88

CHAPTER-III

RESULTS AND DISCUSSION ......................................................................................89

SECTION-I A MUTATION SPECTRUM OF MYO7A ASSOCIATED WITH USH1B AND

EVIDENCE FOR THE EXISTENCE OF DFNB2 ............................................................. 90 PREAMBLE ..................................................................................................................................91 FAMLIES LINKED TO USHER TYPE 1B..................................................................................92

PKDF008 ..................................................................................................................................92 PKDF161 ..................................................................................................................................93

Missense Mutation (G214R) in MYO7A causes USH1B ......................................................93 PKDF189 ..................................................................................................................................93 PKB1.........................................................................................................................................95

In-frame Deletion Mutation (495delG) in MYO7A causes USH1B ......................................95 PKDF148 ..................................................................................................................................95

Frame shift Mutation (L1046fsX1054) in MYO7A causes USH1B ......................................95 PKDF137 ..................................................................................................................................97

Nonsense Mutation (Q531X) in MYO7A causes USH1B .....................................................97 PKDF164 ..................................................................................................................................97

Nonsense Mutation (R972X) in MYO7A causes USH1B......................................................97

PKDF142 ..................................................................................................................................98 Missense Mutation (D437N) in MYO7A causes USH1B ......................................................98

(iv)

PKDF290 ..................................................................................................................................98 Splice site Mutation (IVS16 +1G>A) in MYO7A causes USH1B.......................................101

PKDF426 ................................................................................................................................101 Splice site Mutation (IVS39 +1 G>A) in MYO7A causes USH1B......................................101

FAMLIY LINKED TO DFNB2...................................................................................................102 PKDF034 ................................................................................................................................102

Deletion Mutation (5146_5148 delGAG) in MYO7A causes DFNB2 ................................102 HAPLOTYPE ANALYSIS AND MYO7A ALLELES SEGREGATING IN MORE THAN ONE

FAMILY..................................................................................................................................105 DISCUSSION ..............................................................................................................................107

SECTION-II-EXCLUSION STUDIES FOR KNOWN DEAFNESS LOCI AND MAPPING

OF TWO NOVEL DEAFNESS LOCI DFNB51 & DFNB56 ........................................... 111 PREMABLE ................................................................................................................................112

RESULTS OF EXCULSION STUDIES ..........................................................................................113 FAMILIES LINKED TO DFNB4 ................................................................................................113

PKDF278 ................................................................................................................................113 Mutational Analysis .......................................................................................................114

PKDF453 ................................................................................................................................114 Mutational Analysis .......................................................................................................114

FAMILIES LINKED TO DFNB12 ..............................................................................................118 PKDF176 ................................................................................................................................118 PKDF177 ................................................................................................................................118

RESULTS OF GENOME WIDE SCAN ..........................................................................................120 DFNB51, MAPS TO CHROMOSOME 11P13-P12....................................................................120

PKDF240 ................................................................................................................................120 Haplotype Analysis ........................................................................................................122


SEQUENCING OF SOME OF THE IMPORTANT CANDIDATE GENES OF DFNB51 ...125 DFNB56, MAPS TO CHROMOSOME 3Q13.31-Q21.1.............................................................127

PKDF637............................................................................................................................127 Haplotype Analysis ........................................................................................................127


DISCUSSION ..............................................................................................................................132 MAPPING OF NEW LOCUS DFNB51 .................................................................................133 MAPPING OF NEW LOCUS DFNB56 .................................................................................134

CHAPTER-IV

REFERENCES..............................................................................................................137

(v)

LIST OF FIGURES

Figuer Number............................................................................................................ Page

Fig 1.1 Structure of Human Ear ................................................................................................. 9

Fig 1.2 Structure of Inner Ear..................................................................................................... 9

Fig 1.3 Cross section of Membranous Labyrinth and Organ of Corti ........................................ 15

Fig 1.4 Events in the Hearing of Sound Waves.......................................................................... 19

Fig 1.5 Deflection of hair cells and production of action potential ............................................ 19

Fig 1.6 Adaptation-motor model for the role of Myo1c in adaptation in the Hair cell............... 20

Fig 1.7 Cytogenetic map positions of Human Nonsyndromic Deafness Loci ............................ 24

Fig 1.8 Adhesion in the Hair bundle .......................................................................................... 53

Fig 1.9 Drawings of an organ of Corti outer Hair cell and stereocilia........................................ 57

Fig 1.10 Recombination Event ..................................................................................................... 64

Fig 2.1 Chart representing severity of Hearing Loss .................................................................. 71

Fig 2.2 Representative Audiogram of a normal and profound hearing loss ............................... 71

Fig 2.3 Picture of normal retina and retina with retinitis pigmentosa......................................... 74

Fig 2.4 Thermocycling Profiles for amplification of markers .................................................... 78

Fig 2.5 Electropherogram representing Alleles .......................................................................... 82

Fig 2.6 Representing the procedure to run Macro ...................................................................... 84

Fig 2.7 Thermocycling Profiles for Exon amplification and Sequencing................................... 87

Fig 3.1 Pedigree drawing of PKDF008 and PKDF161 .............................................................. 94

Fig 3.2 Pedigree drawing of PKDF189 and PKB1..................................................................... 96




Fig 3.6 Pedigree drawing of PKDF034 ...................................................................................... 104

Fig 3.7 Graphical presentation of different mutations found in DFNB2/USH1B families.......... 109

Fig 3.8 ERG and Audiograms of deaf individuals from PKDF034 and PKDF008.................... 110

Fig 3.9 Schematic representation of the ABI PRISM®

Linkage Mapping Set............................ 116



Fig 3.12 Pedigrees of families PKDF240 and PKDF407 segregating DFNB51 .......................... 121

Fig 3.13 Audiograms of PKDF240 and PKDF407 affected individuals ...................................... 123

Fig 3.14 Schematic presentation of DFNB51 interval on 11p13-p12........................................... 124

Fig 3.15 Pedigrees of families PKDF637 and PKDF223 segregating DFNB56 .......................... 128

Fig 3.16 Audiogram of PKDF223 affected individual ................................................................. 130

Fig 3.17 Schematic presentation of DFNB56 interval on 3q13.31-q21.1..................................... 131

(vi)

LIST OF TABLES

Table Number.............................................................................................................. Page

Table 1.1 Loci for Nonsyndromic Autosomal Recessive Deafness................................................ 29

Table 1.2 Summary of the loci and genes for syndromes involving hearing loss........................... 30-35

Table 1.3 Summary of the mutations of MYO7A. .......................................................................... 49-50

Table 2.1 Genome Wide Panels Sets for Multiplex PCR............................................................... 79-80

Table 3.1 Haplotype and Mutations of DFNB2/ USH1B families.................................................. 106

Table 3.2 Comparative clinical findings of DFNB2 linked families .............................................. 109

Table 3.3 Two-Point Lod Scores of DFNB51 linked families ....................................................... 123

Table 3.4 SNP’s identified in SLC1A2, TRAF6, and RAMP .......................................................... 125

Table 3.5 Primer sequences for SLC1A2 exons ............................................................................. 126

Table 3.6 Primer sequences for TRAF6 exons ............................................................................... 126

Table 3.7 Primer sequences for RAMP exons ................................................................................ 126

Table 3.8 Two-Point Lod Scores of DFNB56 linked families ....................................................... 130

(vii)

SUMMARY

Deafness, the lack of ability to hear, is the most prevalent sensory deficit in human

populations (McKusick, 1992). It can be divided into two groups; namely syndromic and

nonsyndromic on the basis of associated phenotype other than deafness. To date, 123 loci

and 37 of the corresponding genes for nonsyndromic deafness have been identified.

Recessive and dominant mutant alleles of above 14 genes have been reported to cause both

syndromic and nonsyndromic deafness. Considering the intricacy of hearing process, it has

been estimated that at least 300 human genes are involved in the hearing process (Friedman

and Griffith 2003). Thus, search for new deafness loci/genes is indispensable for a better

understanding of genetic and molecular basis of auditory functions and allied syndromes.

The ratio of recessively inherited deafness is 1.6 per 1000 in the Pakistani population, which

is higher than world’s average due to high consanguinity (Hussain and Bittles 1998, Jaber et

al. 1998).

The present study has two basic objectives; firstly to determine genotype/phenotype

correlation for one of the prevalent loci, DFNB2/USH1B, and secondly to identify new

loci/genes involved in hearing impairment in Pakistani population. Fifty consanguineous

families segregating deafness were identified and enrolled from different cities of Pakistan

while twenty of them were selected for further molecular studies. All the families had three

or more deaf individuals and showed recessive mode of inheritance. Clinical histories were

obtained and pure tone audiometry tests for air and bone conduction were performed at

frequencies 250 to 8,000 Hz on affected and unaffected members of these families.

Vestibular function was evaluated by testing tandem gait ability, romberg test and

electronystagmography (ENG). Ocular funduscopy and electroretinography (ERG) was

performed to detect the presence of retinopathy. Written informed consents were obtained

and genomic DNA was isolated after collecting blood samples from affected, normal

individuals, their parents, grandparents if alive, and other family members of related

sibships.

Previously, recessive and dominant mutant alleles of MYO7A were reported to be

associated with both syndromic (USH1B) and nonsyndromic (DFNB2, DFNA11) deafness

(Liu et al. 1997a; Liu et al. 1997b; Weil et al. 1997). However, clinical re-evaluation of all

the reported DFNB2 families concluded that there is no published evidence of mutations of

(viii)

MYO7A associated with nonsyndromic deafness DFNB2 (Zina et al. 2001, Astuto et al.

2002). For the first objective and to eliminate the chaos about DFNB2, 270 families (20

enrolled + 250 families from CEMB repository) were screened for linkage to

DFNB2/USH1B markers and as a result 11 families were found linked. Mutational analysis

of DFNB2/USH1B linked families led to identification of 9 novel mutations in MYO7A gene.

Amongst them, a novel mutation E1716del of MYO7A was found to be associated with

DFNB2. This is the first clinically well documented example of MYO7A mutant allele

associated with nonsyndromic deafness DFNB2. Furthermore, it is the first report describing

mutation spectrum of MYO7A associated with USH1B and DFNB2 in Pakistani population.

The results of these studies are being written up for publication.

To study the second objective seventeen families (remaining of twenty families) were

analyzed for linkage by typing at least three STR markers for all the known recessive

deafness loci (except DFNB2/USH1B). Consequently, four families showed linkage to

DFNB4/PDS and DFNB12/USH1D while thirteen remained unlinked. Mutational studies of

SLC26A4 gene revealed a known mutation V239D (Park et al. 2003) and a novel mutation

Q446R in two families linked to DFNB4. The fact that a large number of families remained

unlinked to known loci further supports the notion that still a large number of loci/genes

remain undiscovered and instigate to identify more novel loci/genes associated with

deafness.

Genome wide scan was performed on seven selected unlinked families by using ABI

PRISM® Linkage Mapping Set version 2.5 having 411 fluorescent dye-labeled microsatellite

markers spaced at an average distance of 10 cM across the human genome. Genome wide

linkage analyses studies led to mapping of two novel nonsyndromic autosomal recessive

deafness loci “DFNB51” and “DFNB56” as designated by Human Genome Organization

(HUGO) committee. DFNB51 and DFNB56 were mapped to chromosome 11p13-p12 and

3q13.31-q21 on two set of families (PKDF240, PKDF407 and PKDF637, PKDF223)

segregating recessively inherited, profound congenital deafness respectively. Moreover,

sequencing of three candidate genes (SLC1A2, RAMP, and TRAF6) present in the critical

linked region of DFNB51 was done but no potentially causative variant was identified

(Shaikh et al. 2005). Localization of DFNB51 and DFNB56 is the first step towards the

identification of novel genes that will help to further reveal the genetics of deafness.

(ix)

ACKNOWLEDGMENTS

All praises and thanks for Almighty Allah who is the ultimate source of all

knowledge to mankind and for his endless blessings for humanity. Who made me reach at

present pedestal of knowledge with quality of doing something adventurous, novel, thrilling,

sensational, and path bearing. All respects are for Holy prophet Hazrat Muhammad (PBUH)

who is the symbol of guidance, fountain of knowledge.

My warmest and heartiest gratitude with a deep sense of obligation is to Professor

Dr. Sheikh Riazuddin, Director, Centre of Excellence in Molecular Biology, for his personal

interest, inspiring guidance, constructive criticism, and above all for providing necessary

laboratory facilities during the whole span of this research work.

I deem it my heartiest pleasure to express my profound sense of gratitude to Dr.

Shaheen N. Khan for her marvelous guidance, penetrating criticism, and affectionate

behavior throughout the progress of my research.

My special and sincere thanks are due to Dr. Zubair and Dr. Saima for thoughtful

discussions, sound advices, encouragement, and for the valuable suggestions in paper and

thesis writing. Thanks are also due to several researchers at NIDCD/NIH especially to Dr.

E.R. Wilcox, and Dr. T.B. Friedman.

I am highly obliged to Mr Pervaiz Iqbal Director (Admin) Ministry of Special

Education and the Principals of deaf schools all over Pakistan for their help in identifying

consanguineous families and blood collection. I am happy to acknowledge the assistance of

Mr. Ansar, Shahid, Kashif, Azhar, Abrar Hussain, and Naeem Chughtai in the collection of

blood samples while profound respect is due to Farooq Sabir, Awais, Fazal and last but not

the least Asad Riaz for their assistance in DNA sequencing lab. I would like to thank the

subjects who voluntarily participated in this study and provided me with the family histories

and clinical investigations that is so important. Special thanks to Mr. Ali Muhammad Warya

and his family members for their help during our stay in Sindh.

I am indebted to all my student colleagues, which are or were the part of CEMB, for

providing stimulating and fun environment to learn and grow and for giving useful

comments in my lab discussions. In this regard, I am passionately grateful to my dearest

friends Jamil Ahmad, Khushnooda Ramzan, Sabiha Nazli, Shahid Yar Khan, Imran Shabbir,

and Rashid Bhatti for their genial company, time devotion, synergistic help and cordial co-

operation during my research. No words can express my feelings about them I harbor.

I wish to thank my family for providing a loving environment; my brothers, and my

brothers-in-law who were always supportive in my endeavors. I owe immense feelings of

love to my sweet sister and fiancé for their constant love, care, encouragement and sincere

prayers to see me glittering high on the skies of success.

Lastly, the most important, I feel an immense admiration and humble obligation for

my parents, Muhammad Sadiq Shaikh and Tanweer Sadiq Shaikh, who raised me, taught

me, loved me and supported me, to accomplish my academic goal. I feel poor of words to

express my gratitude to them. Their prayers and love is my assets and my life. To them I

dedicate this thesis.

I have been supported by the Higher Education Commission (HEC) of Pakistan.

REHAN SADIQ SHAIKH

(x)

ABREVIATIONS

AA Amino Acid

ABR Auditory brain Stem response

bp Base pair

cM Centimorgan

dB decibels

DFNA Deafness, Autosomal Dominant

DFNB Deafness, Autosomal Recessive

dNTPs Deoxynucleotide phosphates

EDTA Ethylenediaminotetraacetic acid, disodium salt

Hz Hertz

Kb Kilobases

M Molar

MgCl2 Magnesium Chloride

min Minutes

mm Millimeter

µl Microlitre

µM Micromolar

ng Nanogram

pmole Pico moles

SDS Sodium dodecyl Sulphate

STR Short Tandem Repeat

TAMRA Carboxy tetramethyl rhodamine

USH Usher

Male

Female

Affected Male

Affected Female

Nonconsanguineous marriage

== Consanguineous marriage

Deceased

Genotype/Phenotype Correlation For Hereditary Hearing Impairment Loci

- 1 -


- 2 -

Absolute or partial defect in sense of hearing is called deafness. The phenotypic

spectrum of deafness is broad, ranging from simple deafness without other clinically

recognizable abnormalities (nonsyndromic-70%) to genetically determined syndrome

(30%) of a more pleiotropic nature. Over 400 syndromes associated with hearing loss

(HL) have been identified with common anomalies of the eye, kidney, muscle, nervous

system, and skin etc (Gorlin et al. 1995; Bergstorm et al. 1971). Deafness can appear at

any age with a variable degree of severity. It can be classified by the degree of severity

of the HL (mild, moderate, severe, profound) as well as by the site of the defect i.e.

conductive HL referring to external and/or middle ear defects, while sensorineural HL to

the other defects from the inner ear to the cortical auditory centers of the brain. A severe

hearing defect of congenital nature has a dramatic effect on speech acquisition and

literacy; while severe deafness of late onset seriously compromises the quality of life.

The etiology of HL is markedly diverse and involves many environmental and

genetic factors or a combination of both. Environmental factors include birth injury,

postnatal trauma, hypoxia, hypoglycaemia of the fetus, maternal diabetes, neonatal

jaundice, erythroblastosis fetalis, congenital viral infections such as rubella and

Cytomegalovirus, infectious diseases like meningitis, advancing age, iodine deficiency,

and ototoxic drug (Chen 1988). Approximately one in every 500 newborns receives a

diagnosis of congenital HL (Mehl and Thomson 1998; Mehl and Thomson 2002).

Moreover, one in 1000 children become severe to profound deaf before adulthood

(Morton 1991) and 50% of these prelingual deafness cases in developed countries are

attributable to genetic factors (Marazita et al. 1993; Rehm 2003). While the prevalence

of profound bilateral deafness is estimated to be 1.6 per 1000 individuals in Pakistan and

70% of the HL arises in consanguineous families (Elahi et al. 1998; Jaber et al. 1998).

To date 123 nonsyndromic hearing loss (NSHL) loci have been reserved

(Hereditary hearing loss homepage, http://dnalab-www.uia.ac.be/dnalab/hhh). The main

pattern of inheritance in severe childhood deafness is autosomal recessive (over 75%),

autosomal dominant (12-24%), while X linked (1-3%) and mitochondrial is also

involved (Morton 1991). Overall, recessive deafness tends to be more severe than

dominant deafness because it is generally profound, prelingual and fully penetrant

whereas dominant deafness is frequently progressive, post lingual and is often observed

clinically as the presence of unilateral or mild bilateral deafness (Fraser et al. 1976).


- 3 -

Taking the complextiy of hearing phenomena in view, it has been estimated that

~300 genes are involved in hearing (Friedman and Griffith 2003). Therefore,

identification of new deafness loci/genes is pivital for a better understanding of genetic

and molecular basis of auditory functions and allied syndromes. Although HL is

common world wide, extreme genetic heterogeneity, assortive matings, unavailability of

large consanguineous families, and limited clinical differentiation has presented serious

hindrance to chromosomal mapping and gene identification (Petit et al. 2001; Reardon

1992). Furthermore, as small quantity of specialized cells, necessary for sound

transduction are present in the cochlea, classical biochemical and physiological

approaches to characterize hearing processes in humans are often not feasible (Frolenkov

et al. 2004; Forge and Wright 2002; Petit et al. 2001). Thus, a genetic approach to

identify the molecular players in auditory processes seems to be an attractive alternative

and large consanguineous families with inherited hearing impairment have been a key to

the mapping and identification of the majority of the mutated genes associated with

deafness (Friedman and Griffith 2003). Pakistan has a unique socio-cultural set up and

consanguineous marriages are common. Approximately 60% of marriages are

consanguineous, of which more than 80% are between first cousins (Hussain and Bittles

1998). Thus, Pakistani population is an excellent genetic resource to identify the

loci/genes involved in deafness.

Genetic heterogeneity has also been observed to be associated with clinical

heterogeneity, when syndromic and nonsyndromic hearing impairment are caused by

different mutant alleles of the same gene, for example, recessive mutant allele of PDS are

responsible for both Pendred syndrome and DFNB4 (Li et al. 1998). Moreover, different

mutant alleles of the same gene may lead to variations of phenotypes e.g., mutation of

MYO7A can cause Usher syndrome type 1B (USH1B), dominant as well as recessively

inherited (DFNA11 and DFNB2 respectively) nonsyndromic deafness (Liu et al. 1997a;

Liu et al. 1997b; Weil et al. 1997). It has also been demonstrated that truncating, splice

site or misense mutations of the genes causing USH1D/DFNB12, USH1C/DFNB18, and

USH1F/DFNB23 are associated with deaf-blindness, where as only misense or leaky

splice site mutations are associated with nonsyndromic recessive hearing impairment

(Bork et al. 2001, Ahmed et al. 2002, Ahmed et al. 2003). Furthermore, recently it has

been recognized that both recessive and dominant mutation of ESPN can cause

nonsyndromic deafness (Naz et al. 2004, Donaudy et al. 2005).


- 4 -

This study was designed to determine genotype/phenotype correlation for one of

the most common locus DFNB2/USH1B, to identify families truly segregating DFNB2,

and to identify new loci/genes associated with deafness in Pakistani population. A total

of 50 families were enrolled through the deaf children schools present in Punjab, Sindh,

and Balochistan provinces while 20 families were selected for detailed studies. To

identify prevalent mutant alleles of MYO7A associated with DFNB2/USH1B in Pakistani

population, 270 families (20 enrolled + 250 from CEMB repository) were screened for

linkage to DFNB2/USH1B markers. Eleven families showed linkage to chromosomal

interval harbouring MYO7A. Mutational screening of the families linked to

DFNB2/USH1B helped in identification of 8 novel mutations associated with USH1B

while 1 novel mutant allele of MYO7A was found to be associated with nonsyndromic

deafness DFNB2.

In the second half of this study, the remaining 17 families were studied for

linkage to known loci; four families were found linked to DFNB4/PDS and

DFNB12/USH1D. Furtheron seven unlinked families were separated for a genome wide

linakge analysis studies and consequently two novel loci DFNB51 and DFNB56 were

mapped on two set of families. Novel locus DFNB51 was mapped to chromosome

11p13-p12 on two consanguineous families PKDF240 and PKDF407 (Shaikh et al.

2005), while a second novel locus, DFNB56, was mapped on chromosome 3q13.31-q21

on two consanguineous families PKDF637 and PKDF223, segregating recessively

inherited, profound congenital deafness. DNA samples of 250 additional Pakistani

families segregating HL were also available from the CEMB DNA repository and were

screened for both the loci (DFNB51 and DFNB56) but no additional family was found

linked to these loci.

This thesis reports the first clinically well defined example of MYO7A mutant

allele associated with nonsyndromic deafness DFNB2 and identification of two novel

loci, DFNB51 and DFNB56 in Pakistani popultaion.


- 5 -

CHAPTER-I


- 6 -

SECTION-I

INTRICACY OF AUDITORY

SYSTEM


- 7 -

ANATOMY OF AUDITORY SYSTEM Human auditory system is one of the most intricate, miraculous, and an ingenious

creation designed to transfer sound waves from environment to brain in an efficient

manner. The ear can be described as both an analytic microphone and a microcomputer,

sending sound impulses to the brain. Ear is capable of turning the tiniest disturbances to

a form that brain can understand and doing so instantaneously, over an enormous range

of pitch and loudness. Being extremely complicated organ, it performs dual function of

balancing and perceiving sound.

The auditory system is highly complex and composed of three anatomical

compartments, the external, middle and inner ear, which function as an entity. The

boundary between the external ear and the middle ear is the tympanic membrane. The

middle ear contains the auditory ossicles (malleus, incus, and stapes). The boundary

between the middle ear and the inner ear is the oval window (Fig. 1:1). The inner ear has

sensory receptors, which utilize the hair cell for sensory transduction.

THE EXTERNAL EAR

The external ear consists of three parts: the pinna (auricle or outer ear), the

external auditory canal (auditory meatus) and the eardrum (tympanic membrane).

THE PINNA

Pinna directs sound to auditory canal and composed of cartilaginous framework

of elastic connective tissues; attached to skull by ligaments and muscles (Fig 1.1).

THE AUDITORY CANAL (AUDITORY MEATUS)

Auditory meatus is a short canal (~ 1"), extending from the pinna to tympanic

membrane; carrying ceruminous glands in it. Cerumen (ear wax) excreted from

ceruminous glands keeps the tympanum soft, waterproof and prevents entry of foreign

objects, collectively with the hairs (Fig 1.1).

TYMPANIC MEMBRANE (EAR DRUM)

Eardrum is a thin, double-layered, epithelial partition (~1 cm in diameter)

between the auditory canal and the middle ear. It seals the delicate organs of the inner

parts of the auditory system to protect it from bacterial infections and foreign matter

which could clog the system (Fig 1.1). However, it is designed for efficient transmission

of sound.


- 8 -

THE MIDDLE EAR (TYMPANIC CAVITY)

The middle ear is a narrow air-filled cavity located in the temporal bones of the

skull and connects the outer ear to the inner ear. It is separated from the auditory meatus

by the tympanic membrane while is separated from the inner ear by a bony partition,

which contains two windows i.e. the oval window and the round window (Fig 1.1)

AUDITORY OSSICLES

Chain of three tiny, linked moveable bones, the auditory ossicles i.e. the malleus

(hammer), the anvil (incus) and the stapes (stirrup) are connected at one end by

ligaments to the tympanic membrane, and then ends with the oval window of the cochlea

(Fig 1.1). The function of the ossicles is to transmit and amplify sound waves across the

tympanic cavity from the tympanic membrane into the mechanical movements of oval

window. Geometrical organization of ossicles and surface area difference between

tympanic and oval window give 20 fold amplification of sound waves. Any limitation of

motion (impedance) will not transmit the original sound resulting in a loss of hearing.

EUSTACHIAN TUBE

Eustachian tube is a small tube connecting middle ear to nasopharynx of the

throat and it equalizes air pressure on both sides of the tympanic membrane. It allows

fresh air to be filled in the middle ear space periodically. Otitis media, infection of

middle ear occur if the eustachian tube is blocked due to any reason (Fig 1.1).

OVAL AND ROUND WINDOWS

These windows separate air filled tympanic cavity from fluid filled membranous

labyrinth. Oval window (Fenestra vestibuli) displacement occurs via movement of

tympanic membrane via ossicles, and causing fluid displacement in inner ear. Round

window (Fenestra cochlea) displacement is opposite that of oval window because of

incompressible nature of inner ear fluid (Fig 1.2).


- 9 -

Fig 1.1 Structure of Human ear representing Outer, Middle and Inner ear.

Fig 1.2 Structure of Inner Ear


- 10 -

THE INNER EAR

Inner ear regulates two sensory systems simultaneously i.e. the vestibular

system for spatial orientation and equilibrium and the cochlear/auditory system for

hearing. The inner labyrinth is exceptionally an intricate series of structures, and

consists of two parts; the osseous (or bony) labyrinth located within the temporal bone,

and the membranous labyrinth within the bony labyrinth with interconnected sacs and

tubes. The osseous labyrinth is lined with the periosteum and is filled with perilymph, a

fluid secreted by the cells lining the bony canals (Fig 1.2). Perilymph resembles cerebral

spinal fluid (CSF) and normal extracellular fluids in chemical composition i.e. low K+ and

high Na+

concentration. Since its osmolarity is similar to plasma; hence in osmotic

equilibrium with the blood. The tubular chambers of the membranous labyrinth (Fig

1.2) are filled with a second fluid, known as the endolymph, having an unusual

composition than perilymph i.e. high K+ concentration (~140 mM) and a very low Na

+.

In the cochlea, but not the vestibular system, endolymph has a high positive electrical

potential (~ +80 mV) depending on an active secretion of K+, which involves fibroblasts,

different support cells and the stria vascularis (Graham et al. 2000). These fluids provide

the media for vibrations involved in hearing and the maintenance of equilibrium and are

essential for the functioning of the sensory cells of the inner ear (Hudspeth et al. 1989).

An important feature of the endolymphatic space is that it is completely bounded by

tissues and there are no ducts or open connections between perilymph and endolymph.

The border between the two fluids lies at the level of the junctions between the epithelial

cells surrounding the endolymphatic spaces. Maintenance of this permeability barrier is

essential for function of the inner ear

OSSEOUS LABYRINTH

The osseous labyrinth consists of three structural and functional divisions,

vestibule, semicircular canals, and cochlea.

VESTIBULE

The vestibule is the central part of the bony labyrinth. The lateral wall of

vestibule contains the oval window (Fig 1.2) as a bean shaped white blotch between the

utricle and saccule.


- 11 -

SEMICIRCULAR CANALS

The three bony semicircular canals (superior, posterior, and lateral) are oriented

at right angles to each other and are positioned posteriorly (dorsally) to the vestibule. At

one end of each is a dilatation called ampulla which connects to the vestibule (Fig 1.2).

COCHLEA

The cochlea is a sense organ for hearing. Its purpose is to take the vibrations

from middle ear and transform them to nerve impulses, detected by the brain (Fig 1.2).

MEMBRANOUS LABYRINTH

A second series of tubes made out of delicate cellular structures called the

membranous labyrinth lies within the bony labyrinth. Structures of the membranous

labyrinth include: Utricle and saccule (within the vestibule), three semicircular ducts

and their ampulla (within semicircular canals), and cochlear duct (within the cochlea).

Three types of epithelium surround the membranous labyrinth endolymphatic

compartment, neurosensory epithelia, ion transporting epithelia and relatively

unspecialized epithelia.

NEUROSENSORY EPITHELIA (MECHANOTRANSDUCERS)

The neurosensory epithelial sheets responsible for sense of position and sound are

located in specific areas within the respective structures called as:

For Vestibular system

Maculae of the utricle and saccule

Three Crista ampullaris in the ampulla of each of the three semicircular ducts

For Cochlear system

Organ of Corti within the cochlear duct

Sensory epithelia are composed of sensory hair cells and accessory supporting

cells. Hair cells are surrounded by supporting cells so that no two hair cells contact each

other. They are called hair cells due to characteristic cuticular plate and tuft of

stereocilia bathing in the surrounding endolymph. The cell body itself is localized in the

perilymph compartment. There are 50-100 stereocilia/cell in vestibular system and inner

hair cells of cochlear system and 100-300 stereocilia/cell in outer hair cells of the

cochlear system. The sensory epithelium is covered by an acellular extracellular matrix

structure: the tectorial membrane in the cochlea, the otolithic membranes of macular

organs, and the cupulae of the cristae. Hair bundles deflection either caused by sound

waves or changes in head position modulates the opening/closing ion channels,


- 12 -

depending on direction of movement of stereocilia. Opening of ion channel result in

flow of K+ ions from endolymph through the hair cells, exciting the hair cell’s resting

electrical potentials and their cell activity. Hair cells are thus mechanotransducers

converting a mechanical stimulus (movement) into an electrical signal.

ION TRANSPORTING EPITHELIA

The ion transporting epithelia, the stria vascularis of the cochlea and the dark cell

regions of the vestibular system, are involved in active (energy consuming) ion transport

necessary to maintain the unusual endolymph composition (Fig 1.3A).

LESS SPECIALIZED EPITHELIA

The less specialized epithelia, Reissner’s membrane in the cochlea and the

epithelium of the roof of the saccule, utricle, ampullae of the semicircular canals form

permeability barriers separating the fluid spaces. It is expected that Rupturing of these

membranes would result in fluid mixing and physiological dysfunction (Fig 1.3A).

VESTIBULAR SYSTEM

There are five sensory receptor regions associated with the vestibular system, two

in the macula of utricle and saccule which contain receptors sensitive to gravity and

linear movements of the head and one in each of the three semicircular ducts, cristae

ampullaris of semicircular ducts which are sensitive to angular acceleration and

deceleration of the head as in rotational movement.

COCHLEAR SYSTEM

Cochlea is the core element of the inner ear responsible for hearing. Its name

come form its spiral structure mimicking a marine snail. The bony spiral makes roughly

2.5 revolutions around a central pillar of bone called the modiolus and is about 35 mm

long (range 28-40 mm) in humans. Uncoiled, the cochlea is divided along its length into

three fluid-filled compartments

Upper, scala vestibule, filled with perilymph

Middle triangular, scala media (cochlear duct), filled with endolymph

Lower, scala tympani, filled with perilymph

The cochlear duct is triangular in shape. Reissner's membrane (vestibular

membrane) divides the scala vestibuli from the scala media (cochlear duct) and the

basilar membrane divides the scala media from the scala tympani (Fig 1.3A). The oval

window is at the base of the cochlea in scala vestibuli while round window is at the base

of the cochlea in scala tympani. Perilymph bath both the scala tympani and vestibuli


- 13 -

which are continuous till the apex (or tip of the spiral) through the helicotrema while the

cochlear duct is filled with endolymph and terminates at the helicotrema. The cochlear

duct contains the sensory organ of hearing the Organ of Corti. Movement of perilymph

via oval window displacement causes movement of endolymph in cochlear duct which is

sensed by the organ of Corti.

ORGAN OF CORTI

The extraordinary ability of the mammalian cochlea to detect and distinguish

sounds over a wide range of frequencies depends on the precise organization of its highly

specialized neurosensory epithelium, known as the organ of Corti. It is seated on the

basilar membrane, covered by proteinacious tectorial membrane in the middle

compartment, scala media of the cochlea. (Fig 1.3). It is composed of the sensory cells,

called hair cells, the neurons, and several types of support cells.

On the morphological and physiological basis, there are two kinds of hair cells in

Organ of Corti; the inner hair cells (IHCs) and the outer hair cells (OHCs).

Schematically, both types of cells, IHCs and OHCs, differ by their shape and the pattern

of their stereocilia. In the human cochlea, there are about 12,000 OHCs and 3,500 IHCs.

This number is extremely low as compared to millions of photo-receptors in retina and

chemo-receptors in the nose! Moreover, hair cells share with neurons an inability to

proliferate once they are differentiated. This means that the final number of hair cells is

reached very early in development (around 10 weeks of fetal gestation); from this stage

on our cochlea can only lose hair cells.

OUTER HAIR CELLS: (OHCS)

12,000 OHCs are regularly arranged in most mammals within three or sometimes

four rows. They are shaped cylindrically, like a cane, and have ~100 stereocilia at the

top of the cell, and a nucleus at the bottom (Fig 1.3B). Their hair bundles form a

characteristic ‘W’-shape and contact the underside of the overlying tectorial membrane

in which impressions of the longest stereocilia from the OHC can be seen. Although

they are much greater in number than the IHCs, they receive only about 5% of the

innervations of the afferent nerve fibers from the acoustic portion of the VIII nerve and

80% of the efferent nerve innervations.

INNER HAIR CELLS: (IHCS)

There is only one row of approximately 3,500 IHCs, having ~ 50 stereocilia (Fig

1.3B). IHC are flask shaped and their hair bundles are in an approximately straight line


- 14 -

or wide ‘U’-shape. The hair bundles of the IHC do not appear to contact the overlying

tectorial membrane. These cells receive about 95% of the afferent innervations from the

nerve fibers from the acoustic portion of the VIII nerve and 20% of the efferent nerve

innervations. These cells have primary responsibility for producing our sensation of

hearing. When lost or damaged, a severe to profound HL usually occurs.

HAIR CELL STEREOCILIA AND LINKS

Hair cells are highly specialized mechanoreceptors having hair-like projections

on their apical surfaces that help to translate the mechanical stimuli (sound vibration)

into electrical signals, interpreted by the brain. These projections, known as stereocilia,

have mechanosensitive ion channels (Corey and Hudspeth 1979; Ohmori 1985) and

constitute the hair bundle which is formed of rows of stereocilia that increase in height in

one particular direction across the bundle. Stereocilia are generally arranged in three

rows of graded lengths and a single kinocilium located behind the row of longest

stereocilia. In the hair cells of the organ of Corti, the kinocilium is present only during

development, but as the cochlea matures it is reduced to remain as a basal body on one

side of the stereociliary bundle. The tallest stereocilia of outer hair cells directly contact

the tectorial membrane. The tip of each stereocilium is linked to the shaft of its neighbor

by thin tip links which are involved in the mechano-transduction process, stereocilia are

also attached by transverse (lateral) links, both in the same row and from row to row.

There are thought to be at least three different types of lateral links between stereocilia.

Ankle links which are absent from the hair cells of the organ of Corti, but present in the

hair bundles of mammalian vestibular organs connect stereocilia at their proximal ends.

Shaft connectors are present along the mid-region of the stereociliary shaft. Top-

connectors link stereocilia laterally just below the level of the tip-links.


- 15 -

Fig 1.3 A. Membranous Labyrinth: Showing Scala vestibuli with perilymph, Cochlear duct with

endolymph and organ of corti and Scala tympani with perilymph. B.Organ of Corti: Showing Inner hair

cells, Outer hair cells, Tectorial membrane, Basilar membrane, Stereocilia and Supporting cells.


- 16 -

PHYSIOLOGY OF EAR EVENTS IN THE HEARING OF SOUND WAVES

Sound creates vibrations in the air somewhat similar to the rippling waves created

when a stone is thrown into a pond. A young human ear can hear sounds in the

frequency range of 20 to 24,000 Hz, yet can distinguish between sounds that have only a

0.3% difference in frequency. The human ear can detect differences in sound intensity of

only 0.1 to 0.5 db. Hearing involves a complex chain reaction within the ear and can be

divided into three parts: Conductive, Sensory, and Neural.

CONDUCTIVE HEARING

Sound waves result from the alternate compression and decompression of air

reaches the ear, are directed by the pinna into the external auditory canal. When the

waves strike the tympanic membrane and set it to vibrate. The central area of the

tympanic membrane is connected to the malleus, which in turn starts vibrating. These

vibrations are picked up by the incus, and transmitted to stapes. As the stapes moves

back and forth, it pushes the oval window in and out (Fig 1.4).

SENSORY HEARING

The movement of the oval window sets up waves in the perilymph of the scala

vestibuli. As the oval window bulges inward, it pushes the perilymph of the scala

vestibuli to produce pressure waves. The pressure waves moves through the perilymph

of the scala vestibule and pushes the reissner’s membrane inward increasing the pressure

of the endolymph inside the cochlear duct. As a result, the basilar membrane moves

slightly and bulges into the scala tympani. Thus pressure in the perilymph of the scala

vestibuli is transmitted through the basilar membrane eventually to the round window.

Following the compression that resulted in the above actions is a decompression that

causes the stapes to move toward the tympanic membrane and the above actions are

reversed. That is, the fluid moves in the opposite direction along the same pathway, and

the basilar membrane bulges into the cochlear duct. When the basilar membrane

vibrates, the hair cells of the Organ of Corti move against the tectorial membrane. This

shearing action causes the stereocilia to be deflected and tip links stretch and open the

mechanotransduction cationic channels located near the stereocilia tip, which let K+ ions

flow into the hair cells from the endolymph (Fig 1.5). K+ ions rush in because the

strongly negative potential of the hair cells attracts positive ions. This tends to neutralize


- 17 -

some of the negative charge, and brings the potential up towards zero, a process known

as depolarization.

NEURAL HEARING

As the depolarization takes place voltage sensitive calcium channels are activated

in IHCs and calcium triggers the release of neurotransmitters, which lead to the

generation of nerve impulses. The impulses are passed on to the cochlear branch of the

vestibulocochlear (VIII) nerve and then to the medulla. Within the medulla, most

impulses cross to the opposite side and then travel to the midbrain, to the thalamus, and

finally to the auditory area of the temporal lobe of the cerebral cortex. In the “resting”

position of stereocilia the transduction channels are partially open, leading to a small

release of transmitter. This, in turn, generates a spontaneous activity in the auditory

nerve and the ascending auditory pathways, even in the absence of sound. The cells are

thought to recover from the stimulus by pumping out the potassium through gap

junctions and voltage gated potassium channels (Petit 1996).

MOLECULAR BASIS OF MECHANOSENSORY TRANSDUCTION

AND ADAPTATION MECHANISMS

Sensory hair cells of the inner ear detect mechanical stimuli by deflections of the

hair bundle, which open tension-gated transduction channels in the cell membrane to

admit cations from the endolymph, resulting in alterations in the hair-cell membrane

potential and generation of electrical signals. The current is mostly composed of

potassium ions, but also includes a small quantity of calcium ions (Lumpkin et al. 1997).

A widely accepted, but unproven, model of the hair cell transduction channel

complex depicts tip links connected directly to the sound transduction channels at the

stereocilia's apices (Gillespie and Corey 1997; Steel and Kros 2001; Steel 2002;

Friedman and Griffith 2003). The tip link is assumed to be a spring, which is oriented

parallel with the axis of mechanosensitivity (Eatock 2000). Changes in tip-link tension

caused by hair bundle deflections are thought to modulate the opening probability of

associated channels (Pickles et al. 1984; Hudspeth 1989). Two adaptation mechanisms

are known to modify the transduction ionic current flowing through the transduction

channels of the hair bundles, causing it to decline with time (Howard and Hudspeth

1988; Wu et al. 1999; Holt and Corey 2000; Holt et al. 2002).


- 18 -

TRANSDUCER CHANNEL MODEL

A rapid process which can occur on a sub-millisecond

timescale is the

consequence of Ca2+

entering the hair bundle and binding directly to the transduction

channels (Fig. 1.5), making them more likely to close (Crawford et al. 1989).

ADAPTATION MOTOR MODEL

A second slower adaptation, which takes up to hundreds of milliseconds, is also

dependent on Ca2+

concentration, and is thought to be caused by the movement of

adaptation motors attached to the transduction channels, which adjusts the tension

that

gates them (Assad and Corey 1992; Hudspeth and Gillespie 1994; Shepherd and Corey

1994; Gillespie and Corey 1997). Although MyoVIIa has been proposed to anchor and

cause tension in transduction channels and tip links in auditory hair cells (Kros et al.,

2002), there is considerable evidence that Myo1c is the adaptation

motor. A complex

containing multiple molecules of MyoIc crosslinks the transduction channel to the actin

core of the stereocilia and mediates adaptation (Fig. 1.6). The complex regulates

the

resting tension in the tip link filament by moving up and down the actin bundle to

maximize the sensitivity of the hair cell (Assad and Corey 1992; Gillespie and Corey

1997; Holt et al. 2002). Myo1c possesses

structural and mechanical changes associated

with load-dependent ADP release mechanism to fulfill the mechanochemical attributes

that allow it to respond to increased or decreased strain (Batters et al. 2004).

Data suggest that in addition, the two adaptation processes may also act together

in a hair bundle and thus combine to provide an active amplifier (Wu et al. 1999; Holt

and Corey 2000; Vilfan and Duke 2003; Fettiplace and Ricci 2003). The closure of

channels occurs prior to a return of stereocilia to their initial position. These

mechanisms reduce the time constant of channel opening, thus allowing cycles of

mechano-transduction to occur in rapid succession i.e. at high frequencies (Hudspeth and

Gillespie 1994). The cells are thought to recover from the stimulus by pumping out the

K+ through gap junctions (Connexin channels) and voltage gated K

+ channels.

As clear from the above complexity of hearing process; a large ensemble of

proteins act in concert to orchestrate the function of the sensory cells in the cochlea,

through which we hear, and the vestibular apparatus of the inner ear, the organ that

senses gravity and acceleration. Defects in any one of these proteins results in

disturbance of the audiotory pathway which in turn can cause deafness. High

proportions of HL cases are due to outer hair cell abnormalities (Avarham 1998, Kossal


- 19 -

1997). Damage to the hair cells can be caused by a number of agents, including loud

sound (sustained high sound pressure levels above 90-dB), certain drugs (ototoxic

drugs), disease, and processes associated with aging resulting in permanent HL.

Mammalian cochlear hair cells do not regenerate and their loss or damage results in

irreversible deafness or hearing impairment and/or balance disorders.

Fig 1.4 Events in the Hearing of Sound Waves

Fig 1.5 Deflection of hair cells and production of action potential. Shearing force between the basilar

membrane and the tectorial membrane cause the stereocilia of the hair cells to bend. K+ ions depolarize the

membrane of hair cells. Ca+ ions closes the transduction channels.


- 20 -

Fig. 1.6 Schematic representation of Adaptation-motor model for the role of Myo1c in adaptation in the

hair cell. The model depict the nucleotide state of the Myo1c molecules in the adaptation motor complex at

rest (left), under positive deflection (middle) and under negative deflection (right). Red signifies Myo1c in

rigor (nucleotide-free); blue, Myo1c with ADP bound; yellow, Myo1c with ADP.Pi; and green, Myo1c

undergoing Pi release. The pointed ends of actin lie towards the bottom of the illustration. At rest, Po is

0.1. The tension in the tip links is balanced by force produced by the motors. Strain is maintained by

Myo1c in the ADP state. At positive deflection, Po approaches 1.0, the channels open and the tension in

the tip link causes detachment of the motor complex from the actin filament. The motor complex, still

attached to the deflecting membrane, ‘slips’ relative to its starting position on the actin filament toward the

minus end of the filament. During negative deflection, Po approaches 0. A reduction in tip link tension

reduces the strain on Myo1c allowing the motor molecules, some of which are expected to be in the

strained ADP state and some at the beginning of the power stroke, to complete the power stroke and move

up the filament to re-establish the resting state.


- 21 -

SECTION-II

GENETICS OF DEAFNESS


- 22 -

DEAFNESS Deafness is defined as partial or complete hearing loss (HL), which leads to an

impaired ability to develop speech, language and effective communication skills. Many

genetic and environmental causes have been recognized for hearing impairment. HL

present at birth is known as congenital deafness, while one that occurs after birth is

called adventitious deafness. Deafness can be classified in many ways, including the

mode of inheritance, the age of onset, audiologic characteristics (mild, moderate, severe,

profound), presence or absence of vestibular dysfunction, the location and/or identity of

the causative gene and by the site of the defect. Conductive HL refers to external and/or

middle ear defects, and sensorineural HL to the other defects anywhere from the inner

ear to cortical auditory centers of the brain (Petit et al. 2001).

A BRIEF HISTORY

Documentation of awareness about involvement of inheritance in hearing

impairment can be traced back to the sixteenth century. According to Goldstein (1933),

the earliest known author to have recognized that some forms of deafness may be

hereditary was Johannes Schenck (1531–1598) who noted a family in which several

children were born deaf. Stephens (1985) includes a pedigree drawing of a sixteenth

century family of the Spanish aristrocracy in which members in three generations were

documented deaf. In 1621 the papal physician Paolus Zacchias (1584–1659)

recommended that the deaf refrain from marriage because of evidence that their children

will also be deaf (Cranefield and Federn 1970), indicating his conviction that heredity is

important in deafness. Reardon (1990) ascribes to Sir William Wilde (1815–1876) the

awareness that deafness shows different patterns of inheritance, that consanguinity is a

relevant factor, and that there is an excess of males among the congenitally deaf. These

findings were confirmed by Hartmann (1881) who carried out extensive studies in

schools for the deaf in Germany. More recently, Konigsmark (1969), Konigsmark and

Gorlin (1976), and Fraser (1976) provided comprehensive reviews of hereditary hearing

impairment, and emphasized the pronounced heterogeneity. Several studies attempted to

estimate the number of loci for deafness in various populations (Stevenson and

Cheeseman 1956; Chung et al.1959; Sank 1963; Chung and Brown 1970; Costeff and

Dar 1980; Brownstein et al.1991) with the results ranging from less than ten to several

thousand. As far pattern of inheritance is concerned, the analysis of large collections of


- 23 -

family data suggests that, approximately 77–88% is transmitted as autosomal recessive

traits, 10–20 % as dominants, and 1–2% as X-linked traits (Rose et al. 1977). The

frequency of mitochondrial deafness is quite variable and can range from less than 1% to

more than 20% in some populations. Finally, in 20–30% of cases, there may be other

associated clinical findings that permit the diagnosis of a specific form of syndromic

deafness.

The phenotypic and genetic heterogeneity of deafness is underscored by Gorlin et

al. (1995) who list 427 forms of syndromic and nonsyndromic hereditary hearing

impairment. The earliest report of syndromal hearing loss is probably that of

mandibulofacial dysostosis by Thomas in 1846. Retinitis pigmentosa with HL was noted

by Von-Graefe in 1858. This syndrome was later referred as “Usher syndrome” after

Scottish ophthalmologist Charles Usher (1914). Combined euthyroid goiter and

congenital HL was described by Pendred in 1896 and its recessive pattern by Brain in

1927. The last decade of the 20th century has witnessed a rapid development and

extensive studies of the genetic and molecular basis of deafness due to availability of

large numbers of genetic markers. In the late 1980's a sex linked form of nonsyndromic

hearing deafness locus was mapped to Xq13-q21.1 in a Mauritian (Wallis et al. 1988)

and in a Dutch (Brunner et al. 1988) kindred. Four years later, an autosomal dominant

deafness locus was mapped to 5q31, in large Costa Rican kindred (Leon et al. 1992).

The third locus, a mitochondrial mutation was recognised in a large Arab-Israeli pedigree

(Prezant et al. 1993). In 1994 three types of autosomal early childhood deafness were

recognized as being linked to chromosomes. The first nonsyndromic recessive deafness

locus (DFNB1) was linked to chromosome 13 (Guilford et al. 1994a), the DFNB2 to

chromosome 11 (Guilford et al. 1994b) and the DFNB3 to chromosome 17 (Friedman et

al. 1995). Till 1996, no nonsyndromic genes had been cloned (Petit 1996); while as to

date, 54 autosomal dominant and 60 autosomal recessive and 8 X-linked loci of deafness

have been mapped and 22 genes involved in nonsyndromic autosomal recessive deafness

have been identified (Hereditary Heraing Loss Home Page:

http://www.uia.ac.be/dnalab/hhh.). The cytogenetic position of the nonsyndromic loci

and some of the syndromic loci, mapped to various chromosomes is depicted in Fig 1.7.


- 24 -

Fig 1.7 Cytogenetic map positions of human nonsyndromic deafness loci. A deafness locus is underlined

when the gene is known. Loci with published, statistically significant support for linkage are shown with a

solid black font. Shown with a gray font are loci for which there are reserved symbols but no published

data, or published loci lacking statistically significant support for linkage. DFN is the root of the locus

symbol for deafness. An A or B suffix indicates that the mutant allele is segregating as an autosomal

dominant or autosomal recessive, respectively. Sex-linked nonsyndromic hearing loss is designated with a

DFN symbol and a numerical suffix. DFNM1 on chromosome 1q24 is a dominant modifier of DFNB26

on chromosome 4q31.


- 25 -

GENETIC EPIDEMIOLOGY

Prevalence estimates of congenital and early childhood deafness vary, and in

many cases are underestimated. Figures based on universal neonatal screening programs

are perhaps the most accurate. Mason and Herrmann have reported bilateral HL of >35

dB in 1.4:1000 live births in Hawaii (Mason et al. 1998); other US studies have shown

rates of 2.2:1000 and 3:1000 live births (Mhatre et al.1996, White et al.1993). European

rates, mainly obtained from retrospective studies, are similar with ranges 1.4–2.1:1000

live births (Parving 1996, Parving 1999, Das 1996). More than 50% of these cases are

estimated to be inherited (Marres 1998). Likewise, estimated prevalence of profound

bilateral HL is 1.6:1000 individuals in Pakistan and 70% of these cases arise in

consanguineous families (Elahi et al. 1998; Jaber et al. 1998).

MOLECUALR GENETIC OF DEAFNESS HEARING LOSS/DEAFNESS LOCI

Hereditary HL is genetically heterogeneous and over 300 genes are predicted to

cause this disorder in humans (Friedman and Griffith 2003). Syndromic deafness,

associated with other recognizable phenotypic traits, is found in approximately 30% of

the subjects and may be conductive, sensorineural or mixed, while nonsyndromic

deafness, in which inner ear abnormalities are the only clinical feature, is found among

the other 70% of the cases and is almost exclusively sensorineural (Gorlin et al. 1995).

NONSYNDROMIC HEARING LOSS (NSHL)

NSHL is the kind of deafness with no other associated symptoms except deafness

and is more prevalent mode of HL than syndromic deafness. It seems to account for

70% of all the genetically determined cases of deafness.

NONSYNDROMIC AUTOSOMAL DOMINANT HEARING LOSS

54 loci for autosomal dominant deafness have been mapped (Hereditary hearing

loss homepage). Mapped loci for nonsyndromic autosomal dominant hearing

impairment are symbolized as DFNA1, DFNA2 and so on in the order in which they are

reported or reserved. Some of the DFNA and DFNB loci share the same chromosomal

localizations (Petit et al. 2001) and once all deafness genes have been identified many

more dominant and recessive loci might be found to be allelic forms of each other.


- 26 -

NONSYNDROMIC AUTOSOMAL RECESSIVE HEARING LOSS

Various loci for nonsyndromic autosomal recessive HL are symbolized as

DFNB1, DFNB2 and so on in the order in which they are first reported or reserved. To

date, 60 nonsyndromic recessive deafness loci have been mapped (Table 1.1). Some of

the loci prevalent in Pakistan will be discussed ahead

SYNDROMIC HEARING LOSS

London dysmorphology database has identified over 400 syndromes associated

with deafness and musculoskeletal, cardiovascular, urogenital, nervous, endocrine,

digestive or integumentary systems (Gorlin et al.1995). It may accounts for 30% of all

genetically determined deafness cases. Syndromic deafness can be either dominant

(Wardenberg syndrome, Branchio-oto-renal syndrome and Stickler syndrome), recessive

(Usher syndrome and Pendred syndrome), X-linked (Alport syndrome and Nance

syndrome) or mitochondrial. Some of the syndromes of deafness are listed in Table 1.2.

SYNDROMIC AUTOSOMAL DOMINANT LOCI

Some of the common autosomal dominant syndromes are as under:

Waardenburg Syndrome is the most common type of autosomal dominant

syndromic HL with an incidence of 1 in 4000 live births, and a total of 2.3% of children

with congenital HL are suspected to have the syndrome (Tomaski and Grundfast, 1999)

It was named after Petrus Johannes Waardenburg, a Dutch ophthalmologist (1886-1979)

who was the first to notice that people with two different colored eyes frequently had

hearing problems. The clinical features usually include dystopia canthorum, meaning the

lateral displacement of the inner canthus of the eyes to give an appearance of a widened

nasal bridge, pigmentory abnormalities of the skin, iris, and hair, and sensorineural HL.

Waardenburg syndrome is both clinically and genetically heterogenous, four subtypes of

Waardenburg syndrome Type 1, Type 2, Type 3 and Type 4 are known. Mutations of

PAX3 gene have been indicated to be associated with type 1 and type3 phenotypes, while

Type 2 has been linked to MITF and SLUG gene mutations. Three genes EDN3,

EDNRB, and SOX10 have been reported to be associated with type 4 phenotypes

(Friedman et al. 2003a)

Branchial-oto-renal syndrome (BOR) is an autosomal dominant disorder that

affects branchial, ear, and kidney structures. Branchial anomalies include branchial cysts

and fistulas and preauricular pits; renal abnormalities are remarkably varied, ranging

from mild hypoplasia to bilateral aplasia, even in the same family. Hearing is most often


- 27 -

affected, with ~80% penetrance. It is mixed -50% of the time, pure conductive loss

being more common (30%) than pure sensorineural (20%). The prevalence of BOR is

estimated at 1 in 40,000, or 2% of all children with profound HL. The EYA1 gene, the

human homologue of the Drosophila eye absent gene (eya) located at 8q13.3 has been

identified as the responsible gene for BOR. A recently described EYAl knockout mice

reveals the absence of ears and kidneys from apoptotic regression of the organ primordia

implicating EYAl as the early inductive tissue interaction signal specifically involved in

ear and kidney formation. It has been noted that 70% of families with the BOR

phenotype have no mutations in the coding sequence of EYA1. This is not surprising,

and provides an opportunity to identify new genes and to further elucidate the

pathophysiology of BOR (Tseng and Lalwani, 2000).

SYNDROMIC AUTOSOMAL RECESSIVE LOCI

Two most common autosomal recessive syndromes having deafness as one of the

phenotype in Pakistan are Pendred syndrome and Usher syndrome.

Pendred Syndrome is an autosomal recessive disorder comprised of HL and a

thyroid hormone organification defect, resulting in a euthyroid goiter (Pendred, 1896). It

is estimated that Pendred syndrome (PDS) is responsible for 4 to 10% of hereditary

prelingual deafness worldwide (Park et al. 2003). An enlargement of the vestibule is

found nearly in all patients. HL is characteristically prelingual (though not necessarily

congenital), sensorineural or, rarely, mixed, and severe to profound (Cremers et al. 1998;

Fraser, 1976; Phelps et al. 1998). Mutations of gene SLC26A4 are known to cause

Pendred syndrome (Everett et al. 1997). Approximately 80 pathogenic mutations of

PDS are known till to date. Defects in the same gene (SLC26A4) underlie nonsyndromic

deafness DFNB4 and many cases of enlarged vestibular aqueduct syndrome (Li et al.

1998). SLC26A4 encodes pendrin, an anion transporter found in the inner ear, thyroid,

and kidney (Everett et al. 1997; Scott and Karniski, 2000).

Usher Syndrome is an autosomal recessive disorder characterized by bilateral

sensorineural deafness associated with loss of vision due to retinitis pigmentosa. Usher

syndrome is estimated to be responsible for more than 50% of deaf and blind individuals

and 8-33% of patients with retinitis pigmentosa and 3-6% of congenitally deaf

individuals (Vernon 1969, Boughman et al.1983). Its prevalence is between 1/16,000

and 1/50,000 based on studies of Scandinavian, Columbian, British and American

populations (Grondahl 1987, Tamayo et al.1991, Hope et al.1997, Boughman et


- 28 -

al.1983). Usher syndrome varies in the severity and onset of deafness, retinitis

pigmentosa and vestibular dysfunction. Various classifications were proposed due to

clinical heterogeneity (Hammersschlag 1907, Hallgren 1959, Merin et al.1974).

However, it is classified into three main clinical subtypes i.e. Type1, Type2 and Type3

on the basis of variability in the onset of RP and on the presence or absence of areflexia

(Davenport and Omenn 1977).

Twelve loci have been mapped for Usher syndrome (Table 1.2) and there is

unpublished genetic data in our laboratory for at least one additional usher locus. At

least seven distinct genetic loci for Usher syndrome type 1 (USH1A-1G), three for Usher

syndrome type2 (USH2A-2C), and two for Usher syndrome type3 have been mapped to

different chromosomes. Genes for seven usher syndrome loci have been identified as

unconventional myosin VIIa encoded by MYO7A (USH1B, Weil et al.1995), harmonin

encoded by USH1C (Bitner-Glindzicz et al.2000, Verpy et al.2000), cadherin23 encoded

by CDH23 (USH1D, Bork et al.2001, Bolz et al.2001), protocadherin 15 encoded by

PCDH15 (USH1F, Ahmed et al.2001, Alagramam et al.2001), SANS encoded by SANS

(USH1G, Weil et al.2003), Userin encoded by USH2A (Eudy et al.1998) and USH3

encoded by USH3 (Joensuu et al.2001). Six of the known usher loci co-localize to

overlapping chromosomal intervals with one of six nonsyndromic deafness loci

DFNB2/DFNA11, DFNB18, DFNB12, DFNB23, DFNB6 and DFNA20/DFNA26; some

of them will be discussed in detail ahead.


- 29 -

Table 1.1 Loci for Nonsyndromic Autosomal Recessive Deafness

Locus Location Gene Screening Markers References DFNB1 13q12 GJB2 D13S143, D13S175, D13S292 Guilford et al. 1994, Kelsell et al. 1997

DFNB2 11q13.5 MYO7A D11S911, D11S527, D11S937 Guilford et al. 1994, Liu et al. 1997

DFNB3 17p11.2 MYO15 D17S122, D17S805, D17S842 Friedman et al. 1995, Wang et al. 1998

DFNB4 7q31 SLC26A4 D7S501, D7S496, D7S523 Baldwin et al. 1995, Li et al. 1998

DFNB5 14q12 unknown D14S79, D14S253, D14S286 Fukushima et al. 1995

DFNB6 3p14-p21 TMIE D3S1767, D3S1289, D3S1582 Fukushima et al. 1995, Naz et al, 2002

DFNB7 9q13-q21 TMC1 D9S50, D9S301, D9S166 Jain et al. 1995, Kurima et al. 2002

DFNB8 21q22 TMPRSS3 D21S212, D21S1225, D21S1575 Veske et al. 1996, Scott et al. 2001

DFNB9 2p22-p23 OTOF D2S144, D2S171, D2S158, D2S174 Chaib et al. 1996, Yasunaga et al. 1999

DFNB10 21q22.3 TMPRSS3 D21S168, D21S1260, D21S1259 Bonné-Tamir et al. 1996, Scott et al. 2001

DFNB11 9q13-q21 TMC1 See DFNB7 Scott et al. 1996, Kurima et al. 2002

DFNB12 10q21-q22 CDH23 D10S168, D10S535, D10S580 Chaib et al. 1996, Bork et al. 2001

DFNB13 7q34-36 unknown D7S661, D7S498 Mustapha et al. 1998

DFNB14 7q31 unknown D7S527, D7S3074 Mustapha et al. 1998

DFNB15 3q21-q25, 19p13 unknown D3S1309, D3S1593, D3S1553, D19S591 Chen et al. 1997

DFNB16 15q21-q22 STRC THBS1, D15S132, D15S123 Campbell et al. 1997; Verpy et al. 2001

DFNB17 7q31 unknown D7S2487, D7S655, D7S480 Greinwald et al. 1998

DFNB18 11p14-15.1 USH1C D11S902, D11S921, D11S861 Jain et al. 1998;. Ahmed et al, 2002

DFNB19 18p11 unknown D18S62, D18S843, D18S378 Deafness meeting Bethesda, October 8-11,

1998 (Green et al. abstract 108)

DFNB20 11q25-qter unknown D11S969, D11S439 Moynihan et al. 1999

DFNB21 11q TECTA D11S4111, D11S925, D11S934 Mustapha et al. 1999

DFNB22 16p12.2 OTOA D16S490, D16S403, D16S3113 Zwaenepoel et al. 2002

DFNB23 10p11.2-q21 PCDH15 D10S220, D10S1762, D10S1652 Ahmed et al, 2003

DFNB24 11q23 unknown D11S2017,D11S1986, D11S1992 Richard Smith, unpublished

DFNB25 4p15.3-q12 unknown D4S1632, D4S405, D4S428 Richard Smith, unpublished

DFNB26 4q31 unknown D4S424, D4S1604, D1S1153, D1S1679 Riazuddin et al. 2000

DFNB27 2q23-q31 unknown D2S326, D2S2257, D2S2273 Pulleyn et al. 2000

DFNB28 22q13 unknown D22S283, D22S423, D22S274 Walsh et al. 2000

DFNB29 21q22 CLDN14 D21S2078, D21S2079, D21S1252 Wilcox et al. 2001

DFNB30 10p12.1 MYO3A D10S1160, D10S1775 D10S197 Walsh et al. 2002

DFNB31 9q32-q34 WHRN Mustapha et al, 2002 Mburu et al, 2003

DFNB32 1p13.3-22.1 unknown D1S2739, D1S206 Masmoudi et al, 2003

FNB33 9q34.3 unknown D9S1826, D9S1838 Medlej-Hashim et al, 2002

DFNB34 Reserved

DFNB35 14q24.1-24.3 D14S77, D14S76, D14S53 Ansar et al, 2003

DFNB36 1p36.3 ESPN D1S2870, D1S3774, D1S214 Naz et al, 2004

DFNB37 6q13 MYO6 D6S1031, D6S1589, D6S286 Ahmed et al, 2003

DFNB38 6q26-q27 unknown D6S1599, D6S1277 Ansar et al, 2003

DFNB39 7q11.22-q21.12 unknown D7S2204, D7S660, D7S2540 Wajid et al, 2003

DFNB40 22q11.21-12.1 unknown D22S686, D22S1174, D22S1124 Delmaghani et al, 2003

DFNB41 Reserved

DFNB42 3p13.31-q22.3 unknown Aslam et al. 2005

DFNB43 Reserved

DFNB44 7p14.1-q11.22 Ansar et al. 2004

DFNB45 Reserved

DFNB46 18p11.32-p11.31 unknown Mir et al. 2005

DFNB47 Reserved

DFNB48 15q23-q25.1 unknown D15S973, D15S1027, D15S1005 Ahmad et al, 2005

DFNB49 5q12.3-q14.1 unknown D5S2055, D5S424 Ramzan et al. 2005

DFNB50 12q23 unknown

DFNB51 11p13-p12 unknown D11S935,D11S4102,D11S4200 Shaikh et al.2005

DFNB52 Reserved

DFNB53 6p21.3 COL11A2 D6S276,D6S1610 Chen et al. 2005

DFNB54 Reserved

DFNB55 4q12-q13.2 D4S2978, D4S2367 Irshad et al. 2005

DFNB56 3q13.31-q21.1 D3S2460,D3S1303,D3S4523,D3S1267 This Study

DFNB57 Reserved

DFNB58 Reserved

DFNB59 Reserved

DFNB60 5q22-q31 unknown D5S404, D5S1979 R. Smith unpublished


- 30 -

Syndrome OMIM Inher. Location Gene

(Locus) Gene Product

Protein

Function

Auditory

Phenotype Associated Pathology

Adrenoleukodystrophy 300100 XLR Xq28 ABCD1 ATP-binding cassette, sub-family D, member 1

Peroxisome membrane transporter

Progressive SNHL Progressive central nervous system demyelination; blindness

Albinism-deafness Syndrome

300700 XLR Xq26.3-q27.1 (ADFN) Congenital SNHL Pigmentation abnormalities

301050 XLD Xq22 COL4A5 Collagen α5(IV)

Alport syndrome 203780,

104200 AR, AD 2q35-q37

COL4A3,

COL4A4

Collagen α 3(IV),

α 4(IV)-basement

membrane

Basement membrane

component

Progressive SNHL

(cochlear); inconsistent

cochlear histopathology

Progressive nephritis; lens abnormalities

Alstrom syndrome 203800 AR 2p14-p13 ALMS1 ALMS1 Progressive SNHL

(cochlear) Pigmentary retinopathy, diabetes mellitus, obesity

Apert syndrome 101200 AD, usually spor.

10q26 FGFR2 Fibroblast growth factor receptor 2

Fibroblast growth factor receptor

Congenital conductive

HL, usually stapedial

footplate fixation

Premature fusion of cranial sutures with craniofacial deformities; digital deformities; mental retardation

Aspartylglucosaminuria 208400 AR 4q32-q33 AGA N-aspartyl

β-glucosaminidase Lysosomal enzyme CHL and/or SNHL

Mild bone abnormalities; progressive mental retardation; coarse

facies

Beta mannosidosis 248510 AR 4q22-q25 MANBA Beta-mannosidase Lysosomal enzyme Mild-mod. SNHL Severe developmental delay, coarse facies

Biotinidase deficiency 253260 AR 3p25 BTD Biotinidase Biotin metabolism SNHL or MHL Metabolic acidosis, dermatologic and central nervous system

abnormalities

Bjornstad syndrome 262000 AR 2q34-q36 (BJS/PTD) Congenital severe

profound SNHL Pili torti (flat, twisted hair

Branchio-oto-renal

(BOR) dysplasia 113650 AD 8q13.3 EYA1 Preauricular pits; branchial fistulas; renal abnormalities

Branchio-otic (BO)

Syndrome 602588 AD 8q13.3 EYA1

Eyes absent 1: human

homolog of drosophila

“eyes-absent” gene

Transcription factor

External, middle, or

inner ear malformations;

CHL and/or SNHL Preauricular pits; branchial fistulas

Canavan disease 271900 AR 17pter-p13 ASPA Aspartoacylase

Catalyzes hydrolysis of

N-acetyl-aspartic acid to

aspartate and acetate

SNHL

Spongy degeneration of the brain. Onset in early infancy,

megalocephaly, severe progressive psychomotor retardation,

optic atrophy, hypotonia, death by 18 months on the average.

Charcot-Marie Tooth

(CMT) Disease, type 1A 118220 AD 17p11.2 PMP22

Peripheral myelin

protein-22

Structural protein of

peripheral myelin Progressive SNHL Motor and sensory neuropathy

CMT, Type 1B 118200 AD 1q22 MPZ Myelin protein zero Structural protein of

peripheral myelin Same as above Same as above

CMT, Type 2A 118210 AD 1p36-p35 K1F1B Kinesin family member

1B Same as above Same as above

CMT, Type 4A 214400 AR 8q13-q21.1 GDAP1

Ganglioside-induced

differentiation-

associated protein 1 Same as above Same as above

CMT, Type 4B 601382 AR 11q23 MTMR2 Myotubularin-related

protein 2 Same as above Same as above

Charcot-Marie Tooth

Peroneal Muscular

Atrophy

302800 XLD Xq13.1 GJB1 Connexin 32 Gap junction protein SNHL Same as above

Charcot-Marie Tooth Neuropathy

302801 XLR Xp22.2 (CMTX2) SNHL Same as above

Chondrodystrophy with Sensorineural deafness

215150 AR 6p21.3 COL11A2 Collagen α 2(XI) Fibrillar collagen-cartilage

Moderate-severe SNHL Skeletal and craniofacial abnormalities; myopia


- 31 -

Cleidocranial dysplasia 119600 AD 6p21 RUNX2

Runt-related

transcription

factor 2

Osteoblast-specific

transcription factor

Deformed ear canals or

ossicles; CHL or MHL Absent/abnormal clavicles; skeletal malformations

Cockayne syndrome

(CS), type I/A (classic

form)

216400 AR 5q12.1 CKN1 CKN1

WD repeat protein involved in RNA

polymerase II

transcription (?)

Juvenile-onset SNHL;

hair cell and cochlear

neuron loss

Defective DNA repair; growth failure; mental retardation; central

nervous system deterioration; photodermatitis; skeletal anomalies

CS, Type II/B

(congenital form) 133540 AR 10q11 ERCC6 ERCC6 DNA excision repair Same as above Same as above

Coffin-Lowry syndrome 303600 XLD Xp22.2-p22.1 CLS Ribosomal protein S6

Kinase

Mitogen-activated ser/thr

kinase

Occasional

moderatesevere SNHL Mental and somatic growth retardation; skeletal anomalies

Craniofacial-deafnesshand

Syndrome 122880 AD 2q35 PAX3

Paired-box DNA-binding

Protein Transcription factor SNHL Craniofacial and hand/skeletal abnormaltities

Craniometaphyseal

dysplasia, Jackson

type

123000 AD, AR 5p15.2-p14.1 (CMDJ) Progressive MHL;

auditory nerve problem

Craniofacial and skeletal abnormalities, occasional facial nerve

compression/palsy

Crouzon syndrome

123500 AD 10q26 FGFR2

Fibroblast growth factor

receptor 2


receptor

CHL in 55% of patients;

middle ear anomalies;

EAC atresia

Premature fusion of cranial sutures with craniofacial deformities;

occasional small or absent ear canal (15%)

188400 Spor., AD,

AR 22q11 (DGCR) Contiguous gene deletion

CHL and/or SNHL;

middle and/or inner

ear malformations

Aberrant development of thyroid and thymic glands; aortic

anomalies; craniofacial deformities DiGeorge sequence

601362 10p14-p13 (DGS2) Same as above

Ectrodactyly, ectodermal

dysplasia, and

cleft lip/palate (EEC)

syndrome, Type I

129900 Spor. (AD) 7q11.2-q21.3 (EEC1)

Variable CHL and/or

SNHL; ossicular and/or

inner ear anomalies;

possible vestibular

hypofunction

Absent fingers, absent lacrimal puncta, cleft lip +/- palate,

abnormal pigmentation of hair

EEC, Type II 602077 19p13.1-q13.1 (EEC2) Same as above Same as above

Fabry disease 301500 XLR Xq21.3-q22 GLA α -galactosidase A Lysosomal enzyme HL Cutaneous angiokeratomas; paresthesias; cataracts

Fanconi anemia (FA),

complementation

group A

607139 AR 16q24.3 FANCA FANCA Nucler protein complex

CHL, mild to severe;

outer and middle ear

deformities

Pancitopenia, cardiac, renal, and limb malformations,

dermal pigmentary changes, susceptibility to malignancy

FA, complementation

group B 227660 AR ? (FANCB) Same as above Same as above

FA, complementation

group C 227645 AR 9q22 FANCC FANCC Nucler protein complex Same as above Same as above

FA, complementation

group D1 605724 AR ? (FANCD1) Same as above Same as above

FA, complementation

group D2 227646 AR 3p FANCD2 FANCD2 Nucler protein complex Same as above Same as above

FA, complementation

group E 600901 AR 6p22-p21 FANCE FANCE Nucler protein complex Same as above Same as above

FA, complementation

group F 603467 AR 11p15 FANCE FANCE Nucler protein complex Same as above Same as above

FA, complementation

group G 602956 AR 9p13 FANCG FANCG Nucler protein complex Same as above Same as above

FG syndrome 305450 XLR Xq12-q21.31 (FGS1) SNHL in 35% of patients Mental retardation, facial dysmorphism, hypotonia,

imperforate anus

Friedreich ataxia, type I 229300 AR 9q13 FRDA1 Frataxin Mitochondrial protein;

iron homeostasis

Mild-mod. SNHL;

ABRs suggest brain stem, then CNVIII

involvement

Central and peripheral nervous system degeneration with loss of

myelinated nerve fibers

Gaucher type III 23100 AR 1q21 GBA Glucocerebroside Lysosomal enzyme SNHL Hepatosplenomegaly, CNS degeneration


- 32 -

Gustavson syndrome 309555 XL Xq26 (GUST) Severe SNHL Severe mental retardation, seizures, spasticity, optic atrophy

Hunter syndrome 309900 XLR Xq28 IDS Iduronate 2-sulfatase Lysosomal enzyme SNHL or MHL Central nervous system degeneration; mental retardation;

craniofacial dysmorphism; dysostosis

Hurler syndrome 252800 AR 4p16.3 IDUA α –L-iduronidase Lysosomal enzyme CHL or MHL Central nervous system degeneration; mental retardation;

craniofacial dysmorphism; dysostosis

Hypophosphatemia

(HYP) (Familial

hypophosphatemic rickets)

307800 XLD Xp22.2-p22.1 PHEX PHEX Phosphate regulation,

homology to

endopeptidases

Age-dependent SNHL;

sclerosis, thickening of

temporal bone, vestibular

hypofunction.

Vitamin-D resistant osteomalacia

HYP, Type II 307810 XLD, XLR Xp11.22 CLCN5 Chloride channel 5 Voltage-gated chloride

channel Same as above Same as above.

Jensen syndrome 311150 XLR Xq22 TIMM8A

Translocase of inner

mitochondrial membrane 8, homolog A

Import and insertion of

hydrophobic membrane

proteins into the

mitochondrial membrane

Congenital-prelingual

SNHL

Dementia, optic atrophy, skeletal muscle wasting, central nervous

system calcifications.

11p15.5 KCNQ1

Potassium voltage-gated

channel, KQT-like subfamily member 1 Jervell and Lange-

Nielsen syndrome 220400 AR

21q22.1-q22.2 KCNE1

Potassium voltage-gated channel, Isk-related,

family member 1

Delayed rectifier

potassium channel

Congenital profound

SNHL; cochleosaccular (Scheibe) dysplasia

Cardiac conduction abnormality; recurrent drop attacks; sudden

death

Kallmann syndrome 308700 XLR (AD) (AR)

Xp22.32 KAL1

Neural cell adhesion

molecule; axonal path

finding

Occasional mild SNHL

mod.-severe MHL;

malformed SCCs&IACs

Hypogonadism, anosmia

(agenesis of olfactory

lobes)

Keratitis-ichthyosis

deafness 148210 AD 13q12 GJB2 Connexin 26 Gap junction Congenital SNHL Skin and corneal abnormalities

Kniest dysplasia

(metatropic dysplasia, type

II) 156550

AD, usually

spor. 12q13.11-q13.2 COL2A1 Collagen α 1(II)

Fibrillar collagen-

cartilage CHL and/or SNHL Skeletal and epiphyseal dysplasia; cleft palate

Krabbe disease 245200 AR 14q31 GALC Galactosyl-ceramidae Lysosomal enzyme Progressive SNHL Central nervous system degeneration, optic atrophy

Marfan syndrome (MS),

type 1 154700 AD 15q21.1 FBN1 Fibrillin-1 Formation of microfibrils CHL or SNHL (rare) Skeletal, ocular, and cardiovascular anomalies

MS, type 2 154705 AD 3p24.2-p25 (MFS2)

Marshall syndrome 154780 AD 1p21 COL11A1 Collagen α 1 (XI) Fibrillar collagen-

cartilage Progressive SNHL

Skeletal and joint abnormalities; myopia; cataracts; craniofacial

dysmorphism

Mohr-Tranebjaerg

Syndrome 304700 XLR Xq22 TIMM8A

Translocase of inner

mitochondrial membrane

8, homolog A

Import and insertion of

hydrophobic membrane

proteins into the mitochondrial inner

membrane

Progressive SNHL Blindness, dystonia, mental deficiency, fractures

Multiple synostoses syndrome 1

186500 AD 17q22 NOG Noggin

Antagonist of bone

morphogenic protein

(BMP)

Progressive CHL;

ossicular malformations

and stapedial ankylosis

Premature joint fusions, skeletal abnormalities

Neurofibromatosis type2 101000 AD 22q12. NF2 Neurofibromin 2 Tumor suppressor

Progressive SNHL &

vestibular dysfunction

Schwannomas of other nerves; brain tumors; cataracts; caf´-au-

lait spots; subcutaneous neurofibromas

Niemann-Pick disease,

Type C 257220 AR 18q11-q12 NPC1 NPC1

Regulation of intracellular Cholesterol

trafficking

Progressive SNHL Progressive neurologic deterioration due to sphingomyelin

accumulation

Noonan syndrome 163950 AD 12q24.1 PTPN11

Protein tyrosine

phosphatase, non-

receptor type 11

Tyrosine phosphatase Progressive SNHL or

MHL

Skeletal and craniofacial anomalies; congenital heart defects;

mild mental retardation; hematologic abnormalities;

lymphangiomas, schwannomas

Norrie disease 310600 XLR Xp11.4 NDP Norrie disease protein

Homology to mucins;

possible role in

neuroectodermal cell-cell

interactions

Progressive SNHL strial

atrophy; hair cell and

cochlear neuron

degeneration

Congenital or progressive blindness; mental

deficiency


- 33 -

103470 Autos,digenic 3p14.1-p12.3 MITF

Microphthalmia-

associated transcription

factor Transcription factor SNHL Ocular albinism

Ocular albinism with

Sensorineural deafness

300650 XLR Xp22.3 (OASD) Late onset, progressive SNHL

Ocular albinism

Orofaciodigital

syndrome, type I 311200 XLD Xp22.3-p22.2 (OFD1)

Occasional CHL

(possibly due to otitis

media)

Midfacial clefting; hyperplasia of frenula; cleft tongue; hand

anomalies; polycystic kidneys

Osteogenesis imperfecta

(OI) (types I–IV) 166200 17q21.3 COL1A1 Collagen α 1(I)

OI –TypeI 166240 7q22.1 COL1A2 Collagen α 2(I)

Fibrillar collagen-bone,

tendon, skin

OI –TypeIi 166210

OI –TypeIII 259420

OI –TypeIV 166220

AD (AR)

Progressive CHL or

MHL; fixed, absent, or

soft stapes; ossicular

fracture; abnormal otic

capsule ossification

Brittle and deformed bones, hyperextensible joints; blue sclerae

Osteopetrosis (OPT)

(Albers-Schonberg

disease), Type I 259700 AR 11q13.4-q13.5 TCIRG1 T-cell immune regulator1 Vacuolar proton pump

MHL or CHL; temporal

bone otosclerosis Facial palsy, visual loss, generalized osteosclerosis

OPT, type II 166600 AD 16p13.3 CLCN7 Chloride channel 7 Chloride channel CHL; ossicular

anomalies. Facial palsy; generalized osteosclerosis

Otopalatodigital syndrome,

type I 311300 XL Xq28 (OPD1)

CHL; ossicular and

external ear anomalies Craniofacial and skeletal anomalies

167250 6p21.3 (PDB1)

602080 18q22.1 TNFRSF11A

Tumor necrosis factor

receptor superfamily,

member 11A

Activator of NFKB

601530 5q35 SQSTM1 Sequestosome 1 Ubiqutin-binding protein

Paget disease of bone

606263

AD

5q31 (PDB4)

Occasional CHL and/or

SNHL (cochlear);

demineralization of otic

capsule structures;

occasional vestibular dysfunction

Macrocephaly; bending of weight-bearing bones; neurologic

deficits

Pendred syndrome 274600 AR 7q31 SLC26A4 Solute carrier family 26,

member 4 Anion transporter

Prelingual SNHL;

vestibular dysfunction;

inner ear malformations

Thyroid organification defect

8p11.2-p11.1 FGFR1 Fibroblast growth factor receptor 1

Fibroblast growth factor receptor

10q26 FGFR2 Fibroblast growth factor

receptor 2


receptor Pfeiffer syndrome 101600 AD

4p16.3 FGFR3 Fibroblast growth factor

receptor 3


receptor

CHL Craniosynostosis; broad digits; syndactyly

Piebaldism 172800 AD 4q11-q12 KIT KIT

Mast/stem cell tyrosine kinase receptor,

protooncogene

Progressive SNHL Congenital piebaldism; ataxia; MR

Refsum disease 266500 AR 10p15.3-p12.2 PHYH Phytanoyl-CoA

hydroxylase

Peroxisomal enzyme,

metabolizes phytanic

acid

Progressive SNHL;

cochleosaccular atrophy

Retinitis pigmentosa; cerebellar ataxia; increased plasma

phytanic acid

Refsum disease,

infantile form 266510 AR 7q21-q22 PEX1

Peroxisome biogenesis

factor 1

Peroxisomal matrix

protein import Profound SNHL

Retinitis pigmentosa; mental retardation; craniofacial

dysmorphism; liver dysfunction; short stature

Resistance to thyroid

Hormone 190160 AD 3p24.3 THRB

Thyroid hormone

receptor, beta subunit Transcription factor Mild SNHL Hypothyroidism, short stature, neurocognitive deficits

7p21 TWIST TWIST Transcription factor

10q26 FGFR2 Fibroblast growth factor

receptor 2


receptor Saethre-Chotzen

Syndrome 101400 AD

4p16.3 FGFR3 Fibroblast growth factor

receptor 3


receptor

Occasional CHL or MHL Premature fusion of cranial sutures; digit abnormalities


- 34 -

Sialidosis 256550 AR 6p21.3 NEU1 Sialidase 1 Lysosomal enzyme CHL or MHL Central nervous system degeneration; vision loss; dysostosis;

unusual facies

Smith-Magenis

Syndrome 182290 Spor. 17p11.2 (SMCR)

Contiguous deletion

including MYO15

CHL (possibly assoc.

w/otitis media), occas.

SNHL

Growth retardation; mental deficiency; beharioral abnormalities;

nonspecific combinations of anomalies

Spondyloepiphyseal

dysplasia congenital 183900 AD 12q13.11-q13.2 COL2A1 Collagen α1(II)

Fibrillar collagen

cartilage

Occas. mod.-severe

highfreq. SNHL Skeletal abnormalities; cleft palate; short stature

Stickler syndrome

(STL), Type I 108300 AD 12q13.11-q13.2 COL2A1 Collagen α1(II) Same as above.

Progressive SNHL,

occas. CHL

Skeletal and joint abnormalities; myopia; cataracts; craniofacial

dysmorphism

STL, Type II 120280 AD 1p21 COL11A1 Collagen α1(XI) Same as above. Same as above. Skeletal and joint abnormalities; myopia; cataracts; craniofacial

dysmorphism

STL, Type III 184840 AD 6p21.3 COL11A2 Collagen α2(XI) Same as above. Same as above. Skeletal and joint abnormalities; craniofacial dysmorphism

Symphalangism,

Proximal 185800 AD 17q21-q22 NOG Noggin

Antagonist of bone

morphogenic protein (BMP)

CHL; stapes ankylosis Fusion of extremity joints

Tay-Sachs disease 272800 AR 15q23-q24 HEXA Hexosaminidase A Degrades GM2

ganglioside SNHL Progressive mental/motor retardation; seizures; blindness

Tietz syndrome 103500 AD 3q14.1-p12.3 MITF

Microphthalmia-


factor

Transcription factor

Congenital profound

SNHL; normal vestibular

function

Skin / hair albinism

Townes-Brocks

Syndrome 107480 AD 16q12.1 SALL1

C2H2 zinc finger

transcription factor

Homology to sal, a

Drosophila homeotic

gene

SNHL; occas. ossicular

anomalies; malformed

external ears

Deformities of anus, digits, kidneys, and heart

Treacher Collins

Syndrome 154500 AD

5q31.3-

q33.1 TCOF1

Nucleolar

phosphoprotein

Nucleolar protein

trafficking

Variable CHL; middle,

external ear deformities Craniofacial anomalies; eyelid coloboma

Turner syndrome n.a. x 1 X chromosome SNHL

Short stature, gonadal dysgenesis,

webbed neck, shield chest, cardiac

and renal anomalies

Usher syndrome

(USH), Type Ia 276900 AR 14q32 (USH1A)

Congenital severe-

profound SNHL; absent

vestibular function

Onset of retinitis pigmentosa by 10 year

USH, Type Ib 276903 AR 11q13.5 MYO7A Type VII myosin

unconventional

Unconventional myosin

motor protein Same as above Same as above

USH, Type Ic 276904 AR 11p15.2-p14 USH1C Harmonin PDZ domain protein Same as above Same as above

USH, Type Id 601067 AR 10q21-q22 CDH23 Cadherin23 Cellular adhesion, PDZ

binding motif Same as above Same as above

USH, Type Ie 602097 AR 21q21 (USH1E) Same as above Same as above

USH, Type If 602083 AR 10q21-q22 PCDH15 Protocadherin 15 Cellular adhesion Same as above Same as above

USH, Type Ig 606943 AR 17q24-q25 USH1G SANS Ankyrin domains, PDZ binding motif

Same as above Same as above

USH, Type IIa 276901 AR 1q41 USH2A USHerin Laminin-EGF and fibronectin domains

Congential

moderatesevere

SNHL; normal

vestibular responses

Onset of retinitis pigmentosa in late teens/ early adulthood

USH, Type IIb 276905 AR 3p24.2-p23 (USH2B) Same as above Same as above

USH, Type IIc 605472 AR 5q14-q21 VLGR1 Same as above Same as above


- 35 -

USH, Type IIIa 606397 AR 3q21-q25 USH3A Clarin 1 Transmembrane protein

Progressive SNHL; normal or decreased

vestibular responses

Variable onset of retinitis pigmentosa

van Buchem disease 239100 AR 17q11.2 (VBCH) Mixed or SNHL Skeletal hyperostosis

Velocardiofacial (Shprintzen) syndrome

192430 AD 22q11 (VCFS) Frequent contiguous gene deletion

CHL due to OM; occas. SNHL

Heart anomalies; facial dysmorphism; cleft palate/dysfunction; mild mental retardation

Vohwinkel syndrome

with ichthyosis 604117 AD 1q21 LOR Loricrin

Structural component of

cell envelope of

epidermis

Congenital and/or

progressive SNHL Hyperkeratosis and skin anomalies

Waardenburg syndrome (WS), Type I

193500 AD 2q35-q37 PAX3 Paired-box gene 3 Transcription factor

Occas. congenital, variable SNHL, may be

asymmetric; vestibular

hypofunction; occas.

inner ear deformities;

organ of corti, stria,

and cochelar neuron atrophy

Craniofacial dysmorphism with dystopia canthorum; pigmentation abnormalities

WS, Type IIa 193510 AD 3p14.1-p12.3 MITF

Microphthalmia-


factor

Transcription factor Same as type I, SNHL

may be progressive

Craniofacial dysmorphism without dystopia

canthorum; pigmentation abnormalities

WS, Type IIb 602150 AD 8q11 SNAI2

(SLUG) SLUG Transcription factor Same as above Same as above

Type III (Klein-

Waardenburg) 148820 AD, AR 2q35-q37 PAX3 Paired-box gene 3 Transcription factor Same as above Same as type I / II ? with skeletal abnormalities

277580 AR 20q13.2-q13.3 EDN3 Endothelin-3 Ligand

131244 AR 13q22 EDNRB Endothelin receptor,

type B Endothelin receptor Type IV (Shah-

Waardenburg)

602229 AD 22q13 SOX10 SOX10 Transcription factor

Cochleosaccular

degeneration; atrophy

of organ of corti, stria,

cochlear neurons, vestibular sense organs

and nerves

Same as type II, with Hirschsprung disease (lack of autonomic

innervation to colon)

Wolfram syndrome 222300 AR 4p16.1 WFS1 Wolframin Transmembrane glycoprotein

Progressive SNHL (HF >LF)

Optic atrophy, diabetes mellitus, diabetes insipidus

Xeroderma pigmentosum,

group A 278700 AR 9q22.3-q31 XPA DNA excision repair

Progressive SNHL

(HF >LF)

Photosensitivity; cutaneous malignancies; neurologic

abnormalities

Table 1.2 Summary of the loci and genes for syndromes involving hearing loss.


- 36 -

PREVALENT SYNDROMIC AND NONSYNDROMIC

LOCI/GENES IN PAKISTANI POPULATION DFNB1/DFNA3/CX26/GJB2/CX30/GJB6

DFNB1, the first locus for nonsyndromic, recessive deafness was mapped to

chromosome 13q12 in two Tunisian families affected with profound prelingual deafness

(Guilford et al. 1994a). Subsequently, dominant form of deafness, DFNA3, was

localized to the same chromosomal region (Chaib et al.1994) and led the hypothesis that

Cx26/GJB2 is the causative gene for both deafness forms. Kelsell et al. (1997) identified

two distinct nonsense mutations in three consanguineous Pakistani DFNB1 families and

established that Cx26 is the causative gene. Moreover, it has been demonstrated that

Cx26 has a high level of expression in human cochlear cells, by immunohistochemical

staining. Finally, authentic missense mutations, W44C and C202F, were eventually

detected in two families, including the family described originally, thus establishing

Cx26 as the causative gene for DFNA3 (Denoyelle et al.1998, Morle et al.2000). Cx26

missense mutations have also been reported in two forms of dominant syndromic

deafness with skin anomalies (Heathcote et al.2000, Kelsell et al.2000, Maestrini et

al.1999). GJB2 and other members of the connexin gene family have simple genomic

structures composed of two exons: Exon 1 of GJB2 encodes the 5´ untranslated region

and exon 2 contains the entire open reading frame (680 bp) encoding 208 amino acids

long protein Cx26 (26-kDa) which greatly simplifies mutational analysis.

High prevalence of mutations at this locus became apparent once mutation in the

connexin26 (Cx26) gene was identified. Mutations in connexin 26 (Cx26) have been

found to be the most common cause of both familial and sporadic cases of deafness from

many parts of the world (Carrasquillo et al. 1997, Scott et al. 1998). Over 70 different

mutations within the Cx26 gene are known (Rabionet et al. 2000, Pandya et al.2003).

DFNB1 accounts for 20% in Japan (Abe et al. 2000, Kudo et al. 2000), 13.3% in India

(Maheshwari et al. 2003), 16.7% in Iran (Najmabadi et al.2005), while is less prevalent

in Pakistan as compared to India (Santos et al. 2005). In populations where DFNB1

deafness is common, a single prevalent founder mutation accounts for most mutant

alleles. There is also usually a relative high carrier frequency (>1%) for a single

predominant recessive mutation. This includes the 35delG (3-4%) in some non-Jewish

Caucasian populations (Estivill et al. 1998) and (3.4%) in the Czech Republic (Seeman

et al. 2004), 167delT (4%) in Ashkenazi Jews (Morell et al. 1998), and 235delC (1%) in


- 37 -

Asian-Japanese, German, and Chinese populations (Abe et al. 2000; Kudo et al. 2000;

Kupka et al. 2002; Liu et al. 2002). Recent analysis of published carrier frequencies of

the 35delG mutation in 27 populations for 6,628 unrelated individuals in Europe and in

the Middle East suggested that the mean carrier frequency of the mutation is 1.9% and

probable origin of 35delG mutation was in ancient Greece which was subsequently

propagated in other Mediterranean countries during recent historical times (Lucotte and

Dieterlen 2005). More information is available on the connexin deafness Web site.

It had been unclear that why a large fraction (10-42%) of patients with GJB2

mutations has only one mutant allele of GJB2, with the accompanying mutation

unidentified. This was partially clarified as in some populations like Spanish, Ashkenazi

Jews, and French the apparent excess of Cx26 heterozygotes has been associated with a

novel large 342 kb deletion that includes the closely linked Cx30 gene (GJB6) on the

other non-Cx26 mutation chromosome (del Castillo et al. 2002, Lerer et al. 2001),

thereby concluded that mutations in the complex DFNB1 locus, which contains 2 genes

(GJB2 and GJB6), can result in a monogenic or in a digenic pattern of inheritance of

prelingual deafness.

One model that postulate the pathophysiology of DFNB1, suggests Cx26 gap

junction system play a role in K+ recycling, facilitating the rapid transport of K

+ ions

through the supporting cell network to the stria vascularis, where the ions can be actively

pumped in to the endolymph through voltage-gated potassium channels thereby

maintaining the unique K+/Na

+ endolymph balance (Tekin et al. 2001). The genomic

knockout of connexin 26 is lethal in the mouse, (Gabriel et al. 1998) so to study gene

expression in vivo, a targeted, tissue-specific knockout of connexin 26 had to be created

that eliminated the expression in the epithelial cells of the inner ear (Cohen-Salmon et

al.2002) and concluded that Cx26-containing epithelial gap junctions are essential for

cochlear function and cell survival and that prevention of cell death in the sensory

epithelium is vital in restoring auditory function in DFNB1 patients.

DFNB2/DFNA11/USH1B/MYO7A

DFNB2, the second reported locus responsible for an autosomal recessive form of

deafness, was localized to 11q13.5 by linkage studies in a large consanguineous Tunisian

family (Guilford et al. 1994b), and it was noted that the region overlapped that of usher

syndrome 1B (USH1B) (Kimberling et al. 1992, Smith et al. 1992). Positional cloning

of sh-1 in the mouse led to the identification of a gene, MYO7A, predicted to encode an


- 38 -

unconventional myosin (myosin VIIA) (Gibson et al. 1995). Subsequently MYO7A gene

was tested and mutations were identified in individuals with Usher 1B (Weil et al. 1995)

and in two Chinese families linked to DFNB2 (Liu et al. 1997a), and in a DFNA11

family (Liu et al. 1997b). USH1B was found to account for about 75% of type I usher

syndrome patients (Weil et al.1995) and its relative abundance in a sampling of Pakistani

deaf children was found to be 42.9% (Ahmed et al. 2003a). Approximately 100 mutant

alleles of MYO7A have been described to be associated with DFNB2, USH1B and

DFNA11 (Table 1.3); these include nonsense, missense, insertions, deletion, and splice

site mutations (Weil et al.1995; Weston et al.1996; Levy et al.1997; Adato et al.1997;

Liu et al. 1997a; Liu et al. 1997b; Kumar et al. 2004; Ouyang et al.2005; Najera et al.

2002; Janecke et al.1999; Luijendijk et al.2004; Street et al.2004; Bolz et al.2004).

Ophthalmological reevaluation of original Tunisian DFNB2 family revealed mild

retinal degeneration and retinitis pigmentosa (Zina et al. 2001). Moreover, Astuto et al.

(2002) noted that there is no discernable difference between mutations that can cause

usher syndrome and those that are nonsyndromic, and questioned whether the cases of

DFNB2 are truly nonsyndromic as it is difficult to explain the absence of a retinal

phenotype. The predicted human protein encoded by MYO7A (49 exons) is a member of

the family of unconventional myosins, which do not assemble into filaments like

conventional myosins. Unconventional myosins are motor molecules with structurally

conserved heads that move along actin filaments using their actin-activated ATPase

activity. Myosin VIIA is expressed in a variety of tissues, is a common component of

motile and sensory cilia, and is distributed along the entire length of stereocilia of inner

ear hair cells (Hasson et al. 1995).

Myosin VIIA has also been implicated in endocytosis in hair cells. The inner

ears of wild-type mice take up aminoglycoside antibiotics, which are ototoxic. However,

homozygous sh1 mice are protected from gentamicin toxicity presumably because a step

in the endocytotic pathway is disrupted (Richardson et al. 1999). Moreover, myosin

VIIA participates in opsin transport through the connecting cilium to the outer segment

of the photoreceptor cell (Liu et al. 1999), which may be the critical cellular process

disrupted by USH1B mutations of MYO7A. Yet another proposed role for myosin VIIA

is in transduction channel adaptation of inner ear hair cells. A myosin motor has long

been favored as the source of the resting tension on the gating spring(s) of the

transduction channel. In mice homozygous for either of two hypomorphic alleles,


- 39 -

MYO7A6J

or MYO7A4626SB

, hair cell stereocilia bundles transduce a mechanical stimulus

(Richardson et al. 1997), but require a larger force than is necessary in the wild-type

bundles to open the transduction channel (Kros et al. 2002). Myosin VIIa may thus be a

component of the adaptation motor complex. Alternatively, myosin VIIA may provide

tension on the stereocilia plasma membrane and/or transport proteins to the stereocilia

that are required for transduction indirectly affecting adaptation (Boeda et al. 2002).

El-Amraoui et al. (1996) analyzed the expression of myosin VIIA in retinal and

cochlear cells during development in mouse and human. Analysis of myosin VIIA

distribution in mouse retina showed that the pigment epithelium cells expressed myosin

VIIA throughout murine development and post-natal life, while myosin VIIA is

expressed in the cochlear sensory hair cells during mouse embryonic development and

that myosin VIIA expression is restricted to sensory hair cells in the developing human

otic vesicle. They noted that this expression pattern correlated to the vestibular and

cochlear dysfunctions resulting in balance problems and hearing impairment observed in

both usher patients and shaker-1 mouse mutants.

It has been anticipated that the shaping of the hair bundle relies on a functional

unit composed of myosin VIIa , harmonin b, and cadherin23 and that the interaction of

these proteins ensures the cohesion of the stereocilia (Boeda et al.2002). Furthermore,

Adato et al. (2005) proposed that SANS via its binding to myosin VIIa and/or harmonin

controls the hair bundle cohesion and proper development by regulating the traffic of

USH1 proteins to the stereocilia. Interestingly, in the zebrafish myosin VIIa, five of

eight different circler mutants, designated mariner, segregate two missense and three

nonsense mutations. Mariner fish have inner ear hair cell abnormalities, lack accoustic

vibrational sensitivity and reduced or abolished microphonic potential (Ernest et al.2000)

and is likely to be a good model system to more fully explore the function of this

unconventional myosin in the auditory system of vertebrates. Thus, demonstrating the

striking conservation of the function of myosin VIIA throughout vertebrate evolution.

DFNB3/MYO15A

DFNB3 was identified on chromosome 17p11.2 for nonsyndromic recessive

deafness segregating in 2% of the 2,200 residents of Bengkala (Friedman et al.1995).

On the basis of conserved synteny, shaker 2 (sh2) was proposed as a mouse model of

DFNB3 (Liang et al. 1998). Affected mice exhibit no auditory brainstem responses to

sound pressure levels up to high levels, indicating profound deafness and associated


- 40 -

head-tossing and circling behavior due to vestibular defects. Families with deafness

linked to DFNB3 were then screened for mutations of MYO15A and missense and

nonsense mutations cosegregating with the hearing phenotype were found (Wang et al.

1998, Liburd et al. 2001).

The largest of several splice isoforms of MYO15A has 65 exons encoding 3530

amino acids (365-kDa). The tail of myosin XVA (Liang et al. 1999) has two MyTh4

domains, two FERM domains and a SH3 domain and resembles the myosin VIIA tail,

suggesting a common ancestral myosin (Thompson and Langford 2002). In situ

hybridization of MYO15A probes indicates that this gene is expressed in IHCs and

OHCs, as well as in particular cell types of the pituitary where it is associated with

secretary granules (Lloyd et al. 2001). Light and electron microscopic studies of sh2 and

2J mice inner ears show that hair cell stereocilia are present and properly positioned, but

they are approximately 1/10 of the length of wild-type stereocilia (Beyer et al. 2000;

Probst et al. 1998). Myosin XVa, an unconventional myosin is suggested to have a role

in the formation of stereocilia (Anderson et al. 2000). Absence of staircase organization

of sh2 mouse indicates that Myosin XVa is required for the elongation and formation of

the stereocilia-bundle staircase (Belyantseva et al. 2003a; Belyantseva et al. 2003b).

DFNB4/PENDRED SYNDROME/SLC26A4

Nonsyndromic deafness DFNB4 locus (7q21-34) was first described in a deaf

Israeli Druze family (Baldwin et al. 1995). When the Pendred syndrome (autosomal

recessive deafness with goiter) was subsequently assigned to the same chromosomal

region (Coyle et al. 1996; Sheffield et al. 1996), this family was clinically reexamined

and diagnosed with Pendred syndrome. Nonsyndromic deafness DFNB4 and Pendred

syndrome are allelic disorders caused by mutations of the SCL26A4 gene on

chromosome 7q22-31.1 (Everett et al. 1997, Li et al. 1998). Enlargement of the

endolymphatic duct (EVA) is a sensitive and fairly specific radiological marker for

Pendred syndrome or DFNB4 deafness (Phelps et al. 1998). Over 60 mutations have

been found in nearly every coding exon and protein domain throughout SLC26A4 and

account for as much as 10% of hereditary deafness in diverse populations that include

east and south Asians (Park et al. 2003). Each ethnic population has a different and

diverse mutant allele series, with one or a few prevalent founder mutations (Everett et al.

1997, Li et al. 1998, Coyle et al. 1998, Van Hauwe et al. 1998, Reardon et al. 2000,

Campbell et al. 2001, Park et al. 2003).


- 41 -

SLC26A4 is composed of 21 exons encoding an 86-kDa polypeptide called

Pendrin that is expressed in thyroid and kidney, as well as the cochlea (Everett et al.

1997). Pendrin is a multipass transmembrane protein predicted to have at least nine

membrane-spanning domains, but its topology has not been experimentally determined.

Recent studies by Scott et al. (2000), demonstrated that SLC26A4 mutations in

individuals with Pendred syndrome differ functionally from mutations in individuals

with NSHL. They found that mutations associated with pendred syndrome have a

complete loss of pendrin induced chloride and iodide transport, while alleles unique to

people with DFNB4 are able to transport both iodide and chloride, although at much

lower level than a wild type Pendrin.

A Pds-/- knockout mouse generated and characterized by Everett and coworkers

has provided fascinating insights into the function of pendrin in the inner ear and the

pathogenesis of HL in Pendred syndrome (Everett et al. 2001). Homozygous Pds-/- mice

manifest variable degrees of vestibular dysfunction as evidenced by gait unsteadiness,

circling behavior, head-tilting, and abnormal performance in rotarod balance testing.

Auditory brainstem response analyses demonstrated that Pds-/- mice are deaf, whereas

Pds+/- heterozygotes have normal hearing. The endolymphatic duct of Pds-/- mice is

anatomically normal until E15, which begin to enlarge in comparison to control mice

afterwards. Interestingly, no thyroid abnormalities have been detected in the Pds-/- mice.

Although serum thyroid function tests and macroscopic and histologic studies could

detect no abnormalities, it is possible that a subtle iodination defect is still present. Since

these phenotypic features are incompletely penetrant in human Pendred syndrome, and

since the auditory/ vestibular phenotype is very similar to that observed in human

patients, the pds knockout mouse should continue to provide an outstanding mouse

model for further studies of pendrin and HL in Pendred syndrome.

DFNB6/TMIE

DFNB6 was first localized by homozygosity mapping to chromosome 3q21 in a

consanguineous Indian family (Fukushima et al. 1995). Because of chromosomal

homology with the linked region, the mouse mutant spinner (sr) is a candidate for

DFNB6. The spinner mouse has deafness and vestibular dysfunction, and histologic

studies show abnormal maturation of the stereocilia of the cochlear hair cells. The casual

gene for spinner was found and named to be Tmie (transmembrane inner ear), a novel

gene which is predicted to encode a transmembrane protein with no sequence similarity


- 42 -

to other known proteins. Tmie mRNA is detectable by RT-PCR analysis in various

tissues, including the cochlea (Mitchem et al. 2002). Naz et al. (2002) cloned the human

TMIE ortholog and identified five different TMIE mutations cosegregating with DFNB6

deafness in five consanguineous families, including the original DFNB6 family.

DFNB7/11/DFNA36/TMC1

DFNB7and DFNB11, were mapped to chromosome 9q13-q21 in two

consanguineous Indian families and two inbred Israeli Bedouin kindreds, respectively

(Jain et al. 1995, Scott et al. 1996). DFNA36 was also mapped in a large five-generation

US family to same region, suggesting that these all might be allelic disorders of a same

gene. Eight different mutations were identified in a novel gene, transmembrane channel-

like gene 1 (TMC1), in the DFNA36 family and in 11 large families segregating

DFNB7/B11 deafness from Pakistan and India, including the original DFNB7 family

(Kurima et al. 2002). The function of TMC1 is unknown, but it is predicted to encode a

multipass transmembrane protein and it is likely to be involved in ion transport. TMC1

mutations were also identified in the recessive deafness (dn) and dominant Beethoven

(Bth) mouse mutant strains segregating HL and postnatal hair cell degeneration,

indicating that TMC1 is required for postnatal hair cell development or maintenance

(Kurima et al. 2002, Vreugde et al. 2002 ). Makishima et al (2004) recently identified a

novel mutation D572N in TMC1 gene associated with DFNA36. Furthermore, a novel

mutation 1165C>T and splice-site variant 19+5G>A in TMC1 gene was found to be

associated with DFNB7/11 (Meyer et al. 2005).

DFNB8/B10/TMPRSS3

DFNB8/B10, an autosomal recessive deafness locus, was independently mapped

in two consanguineous families from Palestine (DFNB10) and Pakistan (DFNB8) to

chromosome 21q22.3 (Bonne-Tamir et al. 1996, Veske et al. 1996). Haplotype and gene

sequence analyses of individuals in these two families led to the identification of

mutations in a gene encoding a serine protease, TMPRSS3 (Scott et al. 2001, Ben-Yosef

et al. 2001). TMPRSS3 is the only protease reported thus far to be involved in

nonsyndromic deafness. The TMPRSS3 gene, spanning approximately 24 kb on

chromosome 21, contains thirteen reported exons (Scott et al. 2001). In humans there

are alternatively spliced transcripts (TMPRSS3 a, b, c and d), encoding predicted

polypeptides of 454, 327, 327 and 344 amino acids, respectively (Scott et al. 2001). A

fifth isoform, TMPRSS3e, which has a longest open reading frame is recently identified,


- 43 -

it encodes 538 amino acid residues and is the only isoform of this gene with a predicted

signal sequence (Ahmed et al. 2004).

TMPRSS3 message is expressed in supporting cells of the organ of Corti, in the

stria vascularis and in the spiral ganglion cells of the cochlea (Guipponi et al. 2002).

Although the specific role of TMPRSS3 in the development and maintenance of the

audiosensory apparatus is still unknown, the reported mutant alleles of TMPRSS3

abolish catalytic activity of the serine protease, implying a proteolytic function during

the inner ear development (Guipponi et al. 2002; Lee et al. 2003). Although the in vivo

substrate (s) of TMPRSS3 have not been reported in the auditory system, TMPRSS3 is

thought to regulate the activity of the epithelial amiloride sensitive sodium channel

(ENaC) in vitro, which was suggested to control critical signaling pathway(s) in the inner

ear and may have a role in the maintenance of the low sodium concentration of

endolymph (Guipponi et al. 2002).

DFNB12/USH1D/CDH23

The nonsyndromic recessive deafness locus DFNB12 was mapped to

chromosome 10q21–q22 in consanguineous kindred from Syria (Chaib et al. 1996). The

Usher syndrome type 1D (USH1D) locus was subsequently mapped in Pakistani kindred

to 10q that colocalize DFNB12 interval (Wayne et al. 1996). Allelic mutations of

CDH23 encoding cadherin23 cause both nonsyndromic deafness DFNB12 and USH1D

(Bolz et al. 2001, Bork et al. 2001, Astuto et al. 2002a). A genotype-phenotype

relationship for USH1D and DFNB12 was proposed where some amino acid

substitutions in cadherin23 were presumed to be leaky or hypomorphs, causing partial

loss of function and nonsyndromic deafness, whereas more disabling mutations and

functional null alleles of CDH23 cause RP and vestibular dysfunction as well as deafness

(Bork et al. 2001, Astuto et al. 2002a). All reported CDH23 alleles identified in

nonsyndromic deafness patients are missense mutations (Bork et al. 2001, Astuto et al.

2002a) while nonsense mutations, insertions, deletions, splicing variants, and other

missense mutations of CDH23 were only identified in USH1 probands (Astuto et al.

2002a, Bolz et al. 2001, Bork et al. 2001). A 193delC mutation accounted for 26% of

CDH23 (USH1D) mutations, confirming its high frequency in UK and US populaltion

(Ouyang et al. 2005).

Cadherin23 is a member of cadherin superfamily of integral membrane proteins

(Jamora and Fuchs, 2002, Nelson and Nusse 2004). Homophilic interaction of these


- 44 -

proteins might form links that interconnect stereocilia within a bundle. Cadherin23 is

located at the tips of the bundle in frog and zebrafish hair cells and has been proposed as

an essential component of tip links (Siemens et al. 2004, Sollner et al. 2004). It is

suggested that CDH23 and PCDH15 play an essential long-term role in maintaining the

normal organization of the stereocilia bundles (Zheng et al. 2005).

DFNB18/USH1C

The DFNB18 locus was mapped in a consanguineous Indian family at

chromosome 11p15.1-p14 (Jain et al. 1998), overlapping within a region of USH1C

(Smith et al. 1992). Mutations in USH1C gene were identified as the primary defect in

USH1C patients (Verpy et al. 2000, Bitner-Glindzicz et al. 2000). USH1C has 20

primary and 8 alternatively spliced exons encoding several isoforms (Verpy et al.2000).

Depending upon the harmonin splice isoform, there are either two or three PDZ domains

and one or two coiled coil regions in the encoded protein. As postulated that DFNB18

and USH1C are allelic variants of the same gene, mutational analysis of harmonin in the

Indian family with DFNB18 revealed a homozygous intronic mutation that causes

skipping of exon 12 with a resulting framshift producing a stop codon in exon 13. This

should disrupt isoforms in the retina as well as the ear. However expression studies have

shown that normally spliced protein is also produced indicating that this is a “leaky”

mutation. It is possible that enough product is formed to sustain activity in the eye but

not in the ear (Ahmed et al. 2002). A splice-site mutation, 216G>A, in exon 3 of

USH1C is associated with Acadian Usher type IC and was reported to create an in-frame

deletion of 39 base pairs, resulting in an unstable transcript (Lentz et al. 2005).

DFNB21/ DFNA8/A12/TECTA

The DFNB21 locus was mapped in a Lebanese family to chromosome 11q23-25,

and mutation in TECTA gene was identified (Mustapha et al. 1999). Mutations in the

same gene (TECTA) were also found to be associated with both dominant DFNA8/A12

HL and provide an unusual robust correlation of auditory phenotype with TECTA

genotype. TECTA encode α-tectorin, a major noncollagenous glycoprotein component of

the tectorial membrane, which is an extracellular matrix that overlies the stereocilia of

the outer hair cells in the organ of Corti. Homozygosity for functional null alleles of

TECTA at the DFNB21 locus causes recessive, prelingual, severe-to-profound stable HL

with a flat or shallow U-shaped audiometric configuration (Naz et al. 2003). In contrast,

heterozygous carriers of missense mutations in TECTA at the DFNA8/A12 locus have


- 45 -

dominant HL with phenotypic features dependent on the type and location of the amino

acid substitution within TECTA (Balciuniene et al. 1999, Moreno-Pelayo et al. 2001,

Verhoeven et al. 1998, Iwasaki et al. 2002).

DFNB23/USH1F/PCDH15

DFNB23 was mapped to an interval of chromosome 10q21-22 that colocalizes

USH1F (Wayne et al. 1997). Recessive mutations in the human PCDH15 gene are

identified in the affected members of families segregating USH1F (Ahmed et al. 2001,

Alagramam et al. 2001, Ben-Yosef et al. 2003). PCDH15 mutant alleles were also

found to cause nonsyndromic HL (DFNB23) in three families from Pakistan (Ahmed et

al. 2003). A genotype-phenotype correlation was suggested, in which hypomorphic

alleles of PCDH15 are associated with nonsyndromic hearing loss DFNB23, while more

severe mutations of this gene result in USH1F (Ahmed et al. 2003). PCDH15 belongs to

the cadherin superfamily of calcium-dependent cell-cell adhesion molecules (Alagramam

et al. 2001). Precise cellular localization of protocadherin 15 showed its expression in

the retina of mouse, human and monkey and along the entire stereocilia length (Ahmed

et al. 2003). The R245X mutation of the PCDH15 gene was found to be the most

common cause of USH1 in the Ashkenazi Jewish population (Ben-Yosef et al. 2003). A

study showed that 5601-5603delAAC is a common mutation of PCDH15 (USH1F) in

US and UK deaf individuals and accounts for 33% of mutant alleles (Ouyang et al.

2005).

DFNB26

Riazuddin et al.reported the localization of a novel recessive nonsyndromic

deafness locus DFNB26 on chromosome 4q31 segregating in a large consanguineous

Pakistani family. The family defining DFNB26 is unique as a dominant modifier

DFNM1 is also present in some members that can suppress the expression of deafness in

its carriers (Riazuddin et al. 2000).

DFNB29/CLDN14

Wilcox and coworkers reported that mutations in the gene encoding tight junction

Claudin 14 causes autosomal recessive deafness DFNB29 and mapped on chromosome

21q22. Loss of claudin 14 in the inner ear was hypothesized to create a breach in the

paracellular barrier of the organ of Corti, compromising endolymph homeostasis.

Claudin 14 mRNA and protein were localized in both vestibular and auditory (hair cells


- 46 -

and supporting cells of the organ of Corti) sensory neuroepithelia of the inner ear and

(Wilcox et al. 2001). It is further precisely confirmed to be localized at the apical

junctions of hair cells and supporting cells. Cldn-14 null are deaf due to rapid

degeneration of cochlear OHCs during the second and third weeks of life, although there

is a normal endocochlear potential (Ben-Yosef et al. 2002). CLDN14 mutations are a

relatively infrequent cause of nonsyndromic recessive deafness in the Pakistani

population while the contribution of CLDN14 mutation to recessive deafness in other

populations is unknown, and may significantly differ from Pakistani population.

DFNB35

DFNB35 was mapped to chromosome 14q24.1-24.3 in large consanguineous

kindred from Pakistan (Ansar et al., 2003a).

DFNB36/ESPN

DFNB36 was mapped in two consanguineous Pakistani families segregating

recessively inherited deafness and vestibular areflexia (Naz et al. 2004). ESPN, a gene

in the DFNB36 critical interval at 1p36.3, was a good positional candidate because a

mutation of Espn is known to cause deafness and vestibular dysfunction in the jerker

mouse (Zheng et al. 2000). Mutation in ESPN, which encodes a calcium-insensitive

actin-bundling protein called espin were found to segregate with the deafness phenotype

in the both the families (Naz et al. 2004). PCR analysis of human fetal inner ear cDNA

revealed expression of ESPN in the inner ear. Moreover, espin has multiple sites for

protein-protein interactions, which may serve as a scaffold for assembly of

macromolecular complexes important for structure and function of the stereocilia (Naz et

al. 2004). Donaudy et al. (2005) recently demonstrated that dominant mutant allele of

ESPN is associated with nonsyndromic deafness.

DFNB37/DFNA22/MYO6

A novel nonsyndromic recessive deafness locus DFNB37 was mapped on

chromosome 6q13 in large consanguineous kindred from Pakistan. Mutational analysis

has shown three different mutations in MYO6 gene: a homozygous single-base-pair

insertion (36-37insT), a transition mutation, 3496C→T, and a transversion mutation,

647A→T segregated in families linked to DFNB37 (Ahmed et al. 2003b). Before this

dominantly inherited missense allele (C422Y) of MYO6 was found to be associated with

nonsyndromic, progressive HL in a single family defining the DFNA22 locus


- 47 -

(Melchionda et al. 2001) and two recessive null mutations of mouse MYO6 were known

to cause deafness and vestibular dysfunction in Snell's waltzer mice (Avraham et al.

1995).

DFNB38

DFNB38 was mapped on chromosome 6q26-q27 in large consanguineous family

from Pakistan (Ansar et al., 2003b).

DFNB39

A new autosomal recessive nonsyndromic deafness locus DFNB39 was mapped

on chromosome 7q11.22-q21.12 in consanguineous Pakistani family (Wajid et al. 2003).

DFNB42

A consanguineous family with NSHL, ascertained from Pakistan displayed

significant evidence of linkage to 3q13.31-q22.3 (Aslam et al., 2005).

DFNB44

DFNB44 was mapped to 20.9 cM interval on chromosome 7p14.1-q11.22 (Ansar

et al., 2004).

DFNB46

DFNB46 was mapped on chromosome 18p11.32-p11.31 in large consanguineous

kindred from Pakistan (Mir et al., 2005).

DFNB48

A novel autosomal recessive nonsyndromic deafness locus DFNB48 was mapped

to chromosome 15q23-q25.1 in five large consanguineous Pakistani families. (Ahmad et

al. 2005).

DFNB49


on chromosome 5q12.3-14.1 in two consanguineous families from Pakistan (Ramzan et

al. 2004).

DFNB51


on chromosome 11p13-p12 in two consanguineous families from Pakistan (Shaikh et al.

2005).


- 48 -

DFNB56

DFNB56, a novel locus for nonsyndromic recessive deafness is mapped on two

consanguineous families on chromosome 3q13.3-21.1 with a maximum two-point lod

score of 4.84 at recombination fraction θ=0 (This study).


- 49 -

Phenotype Mutation Domain References

DFNA11

DFNB2

USH1B

N458I

G722R

R853C

∆886-888

R244P

M599I

IVS3-2

IVS24-21

1199insT

1716delE

L16X

G25R

A26E

C31X

V67M

75delG

R90P

120delC

I134N

R150X

IVS5+1

166delG R212C

R212H

G214R

∆D218-I219

A226T

Q234X

R241S

R241C

R244P

269delAAG

R302H

E314X

Y333X

353delC

A397D

D437N E450Q

A457V

468+Q

P503L

G519D

IVS13-1

IVS13-8

521delC

Q531X

532delA

542insC

IVS16+1 C628X

R634X

R666X

Motor domain

Motor domain

IQ motif

Coiled coil

Motor domain

Motor domain

Motor domain

FERM domain

MyTH4

No known domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain

Motor domain


Motor domain


Motor domain

Motor domain

Luijendijk et al.2004

Street et al.2004

Bolz et al.2004

Liu et al.1997d

Liu et al.1997c

Weil et al.1997

Liu et al.1997c

Janecke et al.1999

Liu et al.1997c

This Study

Janecke et al.1999

Liu et al.1997a

Bharadwaj et al.2000

Weston et al.1996


Weston et al.1996


Weston et al.1996


Weil et al.1995

Adato et al.1997

This Study Weil et al.1995

Weil et al.1995

Adato et al.1997 & This Study

Weil et al.1995

Mena et al.2000

Weil et al.1995

Janecke et al.1999


Liu et al.1997c


Weston et al.1996

Weston et al.1996

Weston et al.1996

Liu et al.1997c

Adato et al.1997

This Study Weston et al.1996


Weston et al.1996

Weston et al.1996



Weston et al.1996

Liu et al.1997a




Weston et al.1998

Janecke et al.1999


- 50 -

Atypical

USH1B

R669X

724delC

IVS18+1

808delC

Q821X

A826T

IVS24-21

G955S

E960X

E968D

R972X

1046insC E1080X

IVS27-1

E1170K

IVS28+2

R1240E

R1240Q

IVS29+2

A1288P

Q1327K

R1343S

1346delTTC

T1566M

R1602Q

A1628S

Y1719C

R1743W

Q1798X

IVS39+1

L1858P

R1861X

IVS40-1

P1887L

2008delG

2065delC

2119-2215del2kb

G2137E

G2163S

G2167D

G2187D

L651P cpd. het.

w/R1602Q

Motor domain

Motor domain

Motor domain

IQ motif

IQ motif

IQ motif

Post coiled coil domain





MyTH4 domain MyTH4 domain

MyTH4 domain

MyTH4 domain

MyTH4 domain

MyTH4 domain

MyTH4 domain

Post MyTH4 domain

FERM domain

FERM domain

FERM domain

FERM domain

FERM domain

FERM domain

SH3 domain

Post SH3 domain

MyTH4 domain

MyTH4 domain

MyTH4 domain

Post MyTH4 domain

Post MyTH4 domain

Pre FERM domain

FERM domain

FERM domain

FERM domain

FERM domain

FERM domain

FERM domain

FERM domain

FERM domain

Motor domain & FERM

domain

Weston et al.1998

Weston et al.1998

Adato et al.1997

Liu et al.1998

Najera et al. 2002

Adato et al.1997

Janecke et al.1999

Levy et al.1997

Janecke et al.1999


This Study

This Study Cuevas et al.1999

Liu et al.1998

Cuevas et al.1999

Levy et al.1997

Janecke et al.1999


Weston et al.1998

Janecke et al.1999

Najera et al. 2002

Janecke et al.1999


Najera et al. 2002

Weston et al.1998

Weston et al.1998

Janecke et al.1999


Janecke et al.1999

This Study


Adato et al.1997




Adato et al.1997

Adato et al.1997

Levy et al.1997

Janecke et al.1999

Weston et al.1998


Liu et al.1998

Table 1.3 Summary of the mutations of MYO7A.


- 51 -

MOLECULAR ARCHITECTURE OF THE

INNER EAR The inner ear is structurally complex. Analysis of the structure and function of

the inner ear has lagged behind that of many other body tissues. This was due in part; to

the relative inaccessibility of the inner ear tissues and the small number of specialized

cells they contain (~104 hair cells in total in a single cochlea). However, our

understanding of the complexities of the architectural organization necessary for cochlear

and vestibular function has advanced from the use of contemporary methods of cell and

molecular biology, and from studies of ontogenetic development. The inner ear is

becoming a major model for post-genomic studies, the attempt to discover for what all

the genes identified in the human genome actually code.

Studies of hereditary hearing impairment and use of mice as models for the

human ear has allowed the identification of many critical and previously unknown,

molecular components of the auditory system and provided an insight in the process of

sound transduction. This has also helped to understand that how hair cells have adapted

the molecular mechanisms of intracellular motility and intercellular adhesion for the

morphogenesis of their apical surfaces. This work has provided new insights into how

the tissues of the inner ear are built to perform their tasks, and into the pathogenesis of a

range of inner ear disorders (Friedman and Griffith 2003; Rzadzinska et al. 2004;

Frolenkov et al. 2004; Adato et al. 2005).

HAIR CELLS AND HAIR BUNDLE STEREOCILIA

CORE OF STEREOCILIA

The hair bundle is composed of 20-300 rigid plasma membrane bound

projections, the hair cell stereocilia, which are specialized derivatives of actin-based

microvilli (DeRosier and Tilney 2000). Stereocilia are packed into rows of increasing

height to form an organized and uniformly oriented hair bundle (Fig 1.9a). The core of

stereocilia consists of parallel actin filaments closely packed in a hexagonally ordered

paracrystalline array (DeRosier et al. 1980) and are cross-linked by different sets of

actin-bundling proteins, such as espin and fimbrin/plastin. They distribute along the

entire stereocilium and are present both in the developing and the adult stereocilia

(Boeda et al. 2002). The filaments are unidirectionally aligned with their barbed end at

the site of high-affinity actin polymerization oriented away from the surface of the cell


- 52 -

(Tilney et al. 1980). Growth of stereocilia therefore occurs by the addition of new actin

monomers to their tips (Tyska et al. 2002; Schneider et al. 2002; Loomis et al. 2003).

The high density of actin filaments and the extensive cross-linking between them

imposes rigidity on the shaft of the stereocilium, which trapers at its proximal end. As a

few of the stereocilia actin filaments extend rootlets into the cuticular plate, a rigid

platform made of a dense meshwork of horizontal actin filaments located beneath the

apical cell surface, to which they are connected (Fig.1.8b) and is thought to provide

mechanical stability to the apex of the hair cell (Tilney et al. 1980).

Espin is an important structural element of the hair bundle of mammalian hair

cells, recessive mutations in the gene which encodes espin result in deafness in jerker

mouse and profound prelingual HL (DFNB36) and peripheral vestibular areflexia in

human (Naz et al. 2004). The deaf jerker mouse fails to accumulate detectable amounts

of espin in in the hair bundle, which leads to shortening, loss of mechanical stiffness and

eventual disintegration of stereocilia (Zheng et al. 2000a). This reveals the importance

of actin bundling and the maintenance of stereociliary rigidity to hair cell function.

γ-actin is found throughout the hair cell (Hofer et al. 1997), and could be

considered as a housekeeping gene product. Nevertheless, there are several dominant

missense alleles of ACTG1 that encode γ-actin that result in nonsyndromic, progressive,

sensorineural HL in humans (Morell et al. 2000; Zhu et al. 2003; van Wijk et al. 2003),

indicating a unique requirement for γ -actin, in hair cell stereocilia.

SHAPING THE STEREOCILIUM FROM TIP TO TAPER

To maintain the ultrastructure and morphology of stereocilium taper, tight control

of actin polymerization and depolymerization is required at both locations: the tip and

the taper. Several proteins have been implicated in the actin cytoskeleton dynamics of

stereocilia.

A mutation in a human homologue of the D. melanogaster gene diaphanous is

linked to DFNA1 locus (Lynch et al. 1997). Diaphanous belongs to the formin family

of proteins, which accelerate actin nucleation while interacting with the barbed end of

actin filament (Higashida et al. 2004). Although the localization of diaphanous in the

inner ear is unknown, its involvement in actin polymerization in the stereocilia was

proposed (Lynch et al. 1997).


- 53 -

Fig 1.8 Adhesion in the hair bundle. a Four known types of link between adjacent stereocilia. b

Schematized illustration of proteins that constitute adhesion complexes on the plasma membrane of

stereocilia. Experimentally demonstrated interactions between myosin VIIa, harmonin, cadherin 23, SANS

and vezatin are shown, as well as the interaction of myosin XVa with whirlin. c Interacting domains

among the proteins that are essential for stereocilia micromorphogenesis and function. These proteins were

identified through positional cloning of genes that underlie type 1 Usher syndrome. Ank, ankyrin repeat

domain that is thought to be involved in protein–protein interactions; CC, coiled coil domain that mediates

dimerization; EC, cadherin extracellular repeat; FERM, domain that is also known as the talin homology

domain, which is thought to be important for linking cytoskeletal proteins to the membrane; IQ, a motif

that serves as a binding site for myosin light chains; Motor, a domain that mediates actin binding, ATP

binding and hydrolysis, and force generation; MyTH4, a domain of unknown function in some myosin and

kinesin tails; PDZ, a domain that mediates interactions with other proteins that contain a PDZ ligand

sequence and that is thought to be important for targeting signalling molecules to sub-membranous sites;

PST, a proline, serine, and threonine-rich region; SAM, a sterile α-motif, a domain that is found in many

signalling proteins and that is thought to be involved in protein–protein interactions; SH3, a Src homology-

3 domain that is involved in protein–protein interactions.


- 54 -

Radixin, an actin-binding protein, was detected at the taper of the hair cell

stereocilium in the chick, frog, mouse and zebrafish (Pataky et al. 2004). Proteins of the

ezrin/radixin/moesin (ERM) family crosslink actin filaments to plasma membranes and

are involved in organizing the cortical cytoskeleton, especially in the formation of

microvilli (Tsukita et al. 1999). So far, there are no reports of hair-bundle abnormalities

associated with mutations of genes that encode ERM proteins. However, these proteins

might interact with unconventional myosins VIIa or XVa that have FERM (ezrin,

radixin, moesin) binding domains (Oliver et al. 1999) and are specifically expressed in

hair cells (Hasson et al. 1997; Belyantseva et al. 2005) and have mutant allele products,

known to disrupt formation of the hair bundle (Self et al. 1998; Probst et al. 1998).

Another unconventional myosin, myosin VI, is also involved in stereocilium

formation. Myosin VI is a ‘backward-stepping’ actin-based motor that moves towards

the pointed (minus) end of actin filaments (Wells et al. 1999). In humans, dominant and

recessive mutations of MYO6 (which encodes myosin VI) can cause HL (Melchionda et

al. 2001; Ahmed et al. 2003). In mammalian hair cells, myosin VI has not been

observed in stereocilia, but instead, is localized at the base of the hair bundle (Hasson et

al. 1997), within the cuticular plate, a rigid platform to provide mechanical stability to

the apex of the hair cell. The Snell's waltzer (sv) mouse is deaf and has no detectable

myosin VI protein in any tissues (Avraham et al. 1995). Stereocilia of the Myo6sv/sv

mouse are fused at their bases, (Fig 1.9c) indicating that myosin VI is required to tie the

apical plasma membrane to the base of stereocilia and/or anchor stereocilia rootlets and

when it is defective that membrane region becomes detached (Self et al. 1999; Altman et

al. 2004). Ultrastructural studies show numerous links between the apical plasma

membrane and the actin network of the cuticular plate (Hirokawa and Tilney 1982),

which might correspond to macromolecular complexes that contain myosin VI (Fig

1.8b). In addition to this potential anchoring function, the ‘backward’ movement of

myosin VI along the actin filaments might be essential for removing molecular

components that are released by actin treadmilling at the taper of the stereocilium.

ARRANGEMENT OF STEREOCILIA IN THE HAIR BUNDLE

In the mammalian cochlea, stereocilia are arranged into precise V or W shaped

arrays. It is thought that these configurations are stabilized by stereocilia rootlets that

project into a densely organized cortical cytoskeleton, the cuticular plate, at the apex of

the hair cell. The orientation and overall arrangement of the bundles indicate the


- 55 -

presence of a mechanism that stabilizes the overall orientation of the cuticular plate and

hair bundle as an integrated complex. T his mechanism might involve myosin VIIa,

which, anchored by vezatin to a cadherin–catenins complex, could link the cortical

cytoskeleton to the adhesion junctions between hair cells and neighboring supporting

cells (Kussel-Andermann et al. 2000). Consistent with this hypothesis, mutations in

myosin VIIa and a cadherin-related protein, cadherin 23, result in loss of the V/W

configuration and disorientation of the bundle respectively (Self et al. 1999; Di Palma et

al. 2001). The mouse mutant for MYO7A (Shaker 1) shows hair bundles in which groups

of stereocilia are separated from each other at the hair cell apex and the kinocilium is

misplaced (Fig 1.9d) suggesting an effect on maintenance of orientation and

interstereociliary stabilization.

PROGRAMMED ELONGATION OF STEREOCILIA

The evolutionary conservation of a precise arrangement of stereocilia rows in a

staircase-like pattern (Fig 1.9) indicates that this unique organization is required for

mechanotransduction (Manley 2000). Mutations of MYO15A, which encodes

unconventional myosin XVa, cause DFNB3 as well as deafness and vestibular disorders

in the shaker-2 mouse (Probst et al. 1998; Friedman et al. 1995; Wang et al. 1998). Hair

cell stereocilia in homozygous shaker-2 mice are present and properly positioned, but are

much shorter than wild-type stereocilia (Probst et al. 1998). In the shaker-2 mouse, all

stereocilia within a bundle are approximately the same length and there is no staircase

organization of the mature hair bundle (Fig 1.9e). Myosin XVa is discretely located at

the tip of every stereocilium in wild-type auditory and vestibular hair cells, where it

appears just before the staircase emerges, indicating that it is required for the elongation,

formation and maintenance of the stereocilia-bundle staircase (Belyantseva et al. 2003b).

Localization of myosin XVa to the extreme tips of stereocilia raises the

possibility that it is tethered there by integral membrane proteins (Belyantseva et al.

2003a). Although the proteins that interact with myosin XVa are not known, it has two

predicted FERM domains that could mediate interactions with ERM proteins. Perhaps

more interestingly, myosin XVa has a PDZ ligand sequence that could interact with PDZ

domain-containing proteins to coordinate a macromolecular complex at the tips of

stereocilia. PDZ scaffold proteins serve as organizing centres of macromolecular

functional complexes (Harris and Lim 2001). One such PDZ protein, whirlin, has

recently been described. Recessive mutations in WHRN and Whrn (which encode


- 56 -

whirlin) cause deafness in humans (DFNB31) and in whirler mice, respectively.

Stereocilia of whirler mice are abnormally short and arrayed in a near-normal

configuration on the apical hair cell surface (Mburu et al., 2003). The overall inner ear

phenotype of whirler mice is strikingly similar to that of shaker-2 mice, raising the

possibility that whirlin and myosin XVa interact physically within a macromolecular

complex (Fig 1.8) that is responsible for programmed stereocilia elongation (Belyantseva

et al. 2003b; Delpart et al. 2005). Whirlin also has a C-terminal PDZ ligand sequence

that could interact with one of the PDZ domains of another whirlin protein to organize

their multimerization into a higher-order structure (Frolenkov et al. 2004).

STEREOCILIARY LINKS

The stereocilia in an individual hair bundle are connected by a variety of fibrillar

extracellular cross-links, the tip-links which are believed to be crucial in

mechanotransduction (Pickles et al. 1984; Assad et al. 1991) and lateral links which

connect the shaft of one stereocilium to its neighbors at different stages of the

development of cochlear hair cells (Fig 1.8a).

High-resolution imaging has suggested that the tip-link is formed of coiled

filaments (Kachar et al. 2000). Myosin 1c localizes to the region near the upper

insertion point of the tip-link (on the shaft of the longer stereocilium) and is thought to

be involved in an adaptation motor that closes the transduction channel when the

stereocilium is exposed to a sustained excitatory deflection, thereby restoring sensitivity

to further stimulation (Holt et al. 2002; Steyger et al. 1998). Myosin 7a may also play a

role in controlling tip-link tension. Defects in myosin 7a cause a large decrease in the

sensitivity of transduction channel opening to stereociliary deflection suggesting that in

the absence of functional myosin 7a the channels are generally closed and that tension

on the gating spring is significantly reduced (Kros et al. 2002).

Shaft connectors may play a role in keeping the stereocilia spaced apart, fusion

of stereocilia is frequently observed in the IHC hair bundles of Ptprq null mutant mice,

also the stereocilia of the OHC bundles are shorter than those in age matched controls,

suggesting inositol lipid phosphatase, Ptprq may be involved in the growth or resorption

of stereocilia (Goodyear et al. 2003).

At the base of stereocilium, myosin VIIa interacts with a novel transmembrane

protein, vezatin, and could comprise part of an adhesion complex (Fig. 1.8) that is

associated with ankle-links (Kussel-Andermann et al. 2000). Vezatin expression


- 57 -

diminishes as the mouse cochlear hair bundles mature; its expression therefore correlates

fairly well the transient existence of the ankle links (Goodyear et al. 2005).

Fig 1.9 Drawings of an organ of Corti outer hair cell and stereocilia. Stereocilia are graded in height and

range in length up to 10 µm. The mammalian organ of Corti hair cell bundle has about 50 to 100

stereocilia. Panels A and B illustrate a wild-type outer hair cell and show tip links (arrow head) and points

of abutment of adjacent stereocilia (arrow). Panels C, D, and E illustrate different abnormal morphologies

of stereocilia from three different deaf strains of mice. C At P7 sv homozygotes deficient for myosin VI

have stereocilia that are beginning to fuse with one another. D At P15 in homozygous shaker 1 mice

(Myo7a6J

) stereocilia are disorganized. E Homozygous shaker 2 mice expressing defective myosin XVA

have numerous short stereocilia without tip links.

HAIR BUNDLE MORPHOGEENSIS AND MACROMOLECULAR

COMPLEX OF USH1 PROTEINS

Mutant alleles of myosin VIIa (MYO7A) (Weil et al. 1995), harmonin (USH1C)

(Bitner-Glindzicz et al. 2000; Verpy et al. 2000), cadherin 23 (CDH23) (Di Palma et al.

2001; Bork et al. 2001; Bolz et al. 2001), protocadherin 15 (PCDH15) (Ahmed et al.

2001; Alagramam et al. 2001) and SANS (Weil et al. 2003) had been found to underlie

NSHL and USH1. There are corresponding mutant mouse models: shaker-1 (sh1) for

myosin VIIa (Gibson et al. 1995; Self et al. 1998), deaf circler (dfcr) for harmonin

(Johnson et al. 2003), waltzer (v) for cadherin23 (Di Palma et al. 2001, Wilson et al.

2001), Ames waltzer (av) for protocadherin 15 (Alagramam et al. 2001a, Raphael et al.


- 58 -

2001; Hampton et al. 2003) and Jackson shaker (js) for sans (Kikkawa et al. 2003). All

these mutant phenotypes are characterized by deafness, vestibular dysfunction and

similar morphological abnormalities in the development of hair bundles resulting in the

disorganized, splayed stereocilia in homozygous mice. On the basis of similar mutant

phenotypes, as well as in vitro protein-interaction studies, it had been suggested that the

protein products of these genes form a macromolecular complex (Fig 1.8) that provides

cohesiveness to the stereocilia bundles during bundle morphogenesis and some of them

also thereafter in mature hair bundles (Boeda et al. 2002; Siemens et al. 2002; Weil et al.

2003; Frolenkov et al. 2004; Adato et al. 2005; Goodyear et al. 2005).

Harmonin has PDZ domains (postsynaptic density, disc large, zonula

occludens), modules known as organizers of submembranous protein complexes (Sheng

and Sala 2001). Alternatively spliced USH1C transcripts (Verpy et al. 2000) predict at

least 10 protein isoforms which can be grouped into three subclasses, referred to as

harmonin a, b, and c, and collectively as harmonin (Fig. 1.8c). The similar spatio-

temporal distributions of harmonin b (F-actin-bundling protein), cadherin 23 and

myosin VIIa within the growing stereocilia, the direct interaction of harmonin with

cadherin 23 and myosin VIIa and the absence of harmonin b, an F-actin binding isoform,

from stereocilia in sh1 mouse mutants, made the bases to suggest that myosin VIIa is

necessary for harmonin b targeting towards its stereocilia location, where harmonin b

anchors cadherin 23 to the stereocilia actin core (Boeda et al. 2002, Frolenkov et al.

2004, Adato et al. 2005). This proposal is supported by the phenotypes of two recently

characterized dfcr mouse mutants. Although one mutant dfcr is defective in all harmonin

isoforms (a, b and c) and the other mutant dfcr 2J is defective only in harmonin b

isoforms, both the mouse mutants exhibit the same hair bundle disorganization, also

similar to the hair bundle phenotype observed in sh1 and v mutants (Johnson et al. 2003).

Furthermore, second coiled coil region of harmonin b (CC2 domain) can bind to all the

three harmonin isoforms groups through their PDZ1 and PDZ2 domains.

PDZ1 domain of harmonin directly interacts with MyTH4 and FERM domains of

myosin VIIa (Fig. 1.8) (Boeda et al. 2002; Siemens et al. 2002). Cadherin 23 and

harmonin b concomitantly appear in the emerging stereocilia and disappear from the hair

bundles of adult mice (Boeda et al. 2002; Lagziel et al. 2005). Similarly protocadherin

15 is detected all along the stereocilia as soon as these become distinguishable at the

apical surface of hair cells (Ahmed et al. 2003). There can be possible interaction of


- 59 -

harmonin’s PDZ domain to the cytoplasmic tail of cadherin 23 and protocadherin 15.

Cadherin 23 and protocadherin 15 are, therefore, good candidates for proteins of which

stereociliary lateral links that are anchored to the actin core by harmonin b are formed

(Boeda et al. 2002; Lagziel et al. 2005; Ahmed et al. 2003). Protocadherin 15 is also

expressed in mature IHC and OHC bundles and may play a role in the development or

maintenance of the stereociliary cross links that persist till maturity (Ahmed et al., 2003).

Study of the distribution of sans in the mouse inner ear during hair bundle

differentiation showed that sans is absent from the hair bundle (Adato et al. 2005), unlike

all other USH1 proteins which are present in the growing stereocilia (Johnson et al.

2003; Boeda et al. 2002; Ahmed et al. 2003; Lagziel et al. 2005). However, like myosin

VIIa, harmonin and protocadherin 15, sans is concentrated beneath the stereocilia, in the

apical part of inner ear hair cell’s bodies (Fig. 1.8) (Hasson et al. 1997; Boeda et al.

2002; Adato et al. 2005). Sans is a putative scaffolding protein containing three ankyrin

(ANK) repeats, a SAM domain and a C-terminal class I PDZ-binding consensus motif

(Weil et al. 2003; Kikkawa et al. 2003). Sans molecules can form homomers through

their central region, and that sans directly interacts with the MyTH4–FERM domains of

myosin VIIa and with harmonin’s PDZ1 and/or PDZ3 domains via its central and SAM

domains, respectively (Fig. 1.8c). Based on sans sub-cellular localization and on its

molecular interactions with myosin VIIa and/or harmonin, as well as on the Jackson

shaker (js) phenotype, it is proposed that sans may directly or indirectly regulate the

trafficking of USH1 proteins in their route to the stereocilia and contributes to the hair

bundle cohesion via an activity exerted underneath the hair bundle (Adato et al. 2005).

At least some hair-bundle adhesion complexes seem to be linked by

unconventional myosin VIIa to the actin core at sites of links between stereocilia (Fig

1.8b). At the lateral surface, myosin VIIa probably links USH1 macromolecular

complexes to the actin filaments during hair-bundle maturation (Weil et al. 2003; Boeda

et al. 2002; Siemens et al. 2002). At the base of the stereocilium, myosin VIIa interacts

with vezatin, and could comprise part of an adhesion complex (Fig. 1.8b) that is

associated with ankle-links (Kussel-Andermann et al. 2000).

The emerging picture of proteins interactions reveals that every USH1 protein

can bind to at least one other USH1 protein. Harmonin and SANS plays a pivital role in

USH1 proteins network and thus might act as cytoplasmic scaffold organizer of proteins

that are involved in maintaining the molecular architecture of stereocilia during hair cell


- 60 -

growth and differentiation. However, the crucial role of any of the USH1 proteins in the

cohesion of adult hair bundle is yet unknown (Frolenkov et al. 2004; Adato et al. 2005).

SUPPORTING CELLS

The supporting cells posses a fairly extensive cytoskeletal system that is

particularly well developed in the supporting cells of the organ of Corti, thus provide

mechanical support to the epithelium and the hair cells. In the apical cytoplasm, there

are cytoskeletal assemblies containing the β-form of actin and intermediate filaments,

cytoskeletal proteins, mainly several different isotypes of cytokeratins and vimentin.

Vimentin provides rigidity; its presence in supporting cells may be a reflection of the

role in providing a rigid structural support to hair cells that these cells play (Kuijpers et

al. 1991; Schulte et al.1989).

Supporting cells are coupled to each other by large numbers of gap junctions

which are sites of direct communication between adjacent cells where clusters of

channels in the membrane of one cell are in direct register with clusters of channels in

the membrane of its neighbour to form continuous aqueous pores connecting the

cytoplasms of the adjacent cells (Forge et al. 1999; Kikuchi et al. 1995). The protein

sub-units that form gap junction channels are members of the connexin protein family.

At least 20 different types, or isoforms, of connexin have been identified. The gap

junctions on the organ of Corti and in vestibular sensory epithelia in mammals contain

two connexin isoforms, cx26 and cx30. Mutations in the genes for at least three different

connexins, connexin 26 (Cx26), Cx30 and Cx31, have been identified as causes of

hereditary sensorineural HL. Mutations in the Cx26 gene are the most common cause of

nonsyndromic hereditary deafness. However, connexin mutations do not appear to cause

balance dysfunction. One role for supporting cells is thought to be to remove K+ ions

from the intercellular spaces of the sensory epithelium as they flow through hair cells

and thereby maintain the low K+ environment around the body of the hair cell necessary

for transduction and sensitivity to stimulation. It has been proposed that the gap

junctions provide a means to ferry the K+ away preventing local accumulation.

THE BASILAR MEMBRANE

The basilar membrane, upon which the organ of Corti sits, is a sheet of

predominantly extracellular matrix structure composed of filaments within a ground


- 61 -

substance (Slepecky et al. 1996). The fibrils of the basilar membrane run predominantly

radially, and are composed of collagen, mostly collagen type IV αααα1-αααα5 chains

(Cosgrove et al. 1996b). In addition, fibronectin and laminin type 11, adhesive-type

molecules common to extracellular matrices are localized to the basilar membrane and

presumably compose the ground substance in which the collagen fibrils reside (Cosgrove

et al. 1996a; Rodgers et al. 2001). A novel extracellular matrix protein-usherin has been

identified through the genetic mutation that is associated with Usher’s syndrome type

IIa, in which there is high frequency HL (Bhattacharya et al. 2002). Mutations in the

genes for the proteins composing the basilar membrane might be expected to affect the

mechanical responses of the organ of Corti in response to sound and thereby cause

hearing impairment. X-linked Alport’s syndrome has been attributed to mutations in the

gene for the COL4A5 gene (Harvey et al. 2001). It has been suggested that the loss of

this protein from the basilar membrane affects the ability to create tension through

interactions with the tension fibrocytes in the cochlear lateral wall resulting in the high

frequency HL associated with this condition.

TECTORIAL MEMBRANE

The tectorial membrane is a structured sheet of extracellular matrix material that

overlies the auditory neuroepithelium organ of Corti and deflects hair bundles in

response to sound. The body of the tectorial membrane is formed of fibre bundles

running approximately radially, embedded within a matrix composed of striated sheets

formed of fine cross-linked fibrils (Hasko et al. 1988). The fibre bundles are formed of

collagen types II, V and IX which are different types from those in the basilar

membrane (Richardson et al. 1987; Richardson et al. 1992). Associated with the

collagen bundles is a glycoprotein unique to the inner ear, otogelin (Cohen-Salmon et al.

1997), defects in which result in the ‘Twister’ mouse phenotype (Simmler et al. 2000).

The matrix of the tectorial membrane also is composed of glycoproteins that are unique

to the inner ear, αααα and ββββ tectorin (Legan et al. 1997; 2000). Consequently, mutations in

the genes for these proteins are associated with NSHL in humans (Cohen-Salmon et al.

1997; Verhoeven et al. 1998).

STRIA VASCULARIS

The stria vascularis lines the lateral wall of the scala media. It is responsible for

the production and maintenance of both the high endolymphatic K+

concentration and the


- 62 -

endocochlear potential. The marginal cells of the stria vascularis and vestibular dark

cells are primarily involved with the transport of K+. Their basolateral membranes are

extensively infolded, enclosing numerous large mitochondria and they contain high

levels of Na+/K

+-ATPase, both α and β isoforms, which transport K

+ into the cell in

exchange for Na+. The infoldings provide a large surface area over which ion exchange

can occur and the numerous large mitochondria enclosed within them provides the

energy source (ATP) for the active ion transport. The basolateral membranes contain in

addition a Na+/K

+/Cl

--co-transporter (NKCC1) that transports the three ions into the cell

(Crouch et al. 1997). The uptake of Na+ enhances ATPase activity by stimulating the

outward transport of Na+ and, thus, the inward transport of K

+.

The apical membranes of the marginal cells and the dark cells contain a K+

channel, which is formed of two subunits, the KCNE1 regulatory protein and the

KCNQ1 channel proteins (these subunits were formally named IsK and KvQLT1,

respectively). This channel provides the pathway through which K+ is secreted into

endolymph (Sunose et al, 1997). Mutations in the KCNE1 gene disrupt endolymph

production leading, in the cochlea, to collapse of Reissner’s membrane and deafness, and

in the vestibular system to collapse of the epithelia of the roof of the utricle, saccule and

ampullae and shaker/waltzer-type behaviors in mice indicating dysfunction of the

vestibular sensory organs. Recessive mutations can in these genes are known to cause

Jervell and Lange-Nielsen syndrome.

CONCLUSION

Several developmental themes have emerged from the identification of genes that

are required for the morphogenesis of the hair cell bundle. Hair cells have adapted

integrated mechanisms of cell-to-cell adhesion and intracellular motility to generate their

precisely organized hair bundles. However, it is clear that there are still crucial genes

and pathways that remain to be determined, indicating that the genetic investigation of

hair-bundle morphogenesis is incomplete. It is prudent to continue positional cloning of

genes that underlie hearing or balance disorders in humans and mice, especially genes

that are expressed at low levels that elude detection by other screening methods. An

integrated approach should be followed to encompass a comprehensive understanding of

hair-bundle morphogenesis and insights into the pathogenesis of HL and balance

disorders, as well as strategies for their prevention and treatment.


- 63 -

SECTION-III

LINKAGE ANALYSIS-A

TOOL FOR MAPPING

DISEASE CAUSING GENES


- 64 -

The human genome is very large and complex containing thousands of genes.

Therefore, finding a particular gene or genes responsible for any human disease has

always been tricky, literally like finding a needle in a haystack. Traditionally, the search

for a disease gene begins with linkage analysis. Linkage analysis is a technique of

developing a relationship between the loci; i.e. two loci on the same chromosome are

said to be linked if the phenomenon of crossing over does not separate them. Actually at

the stage of meiosis homologous chromosomes exchange segments as the basis for

crossing over or recombination. The original arrangements of alleles on the two

chromosomes are called the parental combinations whereas the new combinations that

are formed due to crossing over are known as recombinants (Fig 1.10). If two loci are

physically close to each other on the same chromosome then there are rare chances that

they will be separated by a recombination event. Sets of alleles for different markers or

genes on the same chromosome are termed as haplotypes. Alleles on the same haplotype

are passed on in pedigrees as a block. These blocks are only broken by a cross over.

The term linkage refers to the loci, not to specific alleles at these loci. The most

common application of linkage analysis is to try and find the location, in the genome, for

a gene responsible for a certain mendelianly-inherited disease (Ott 1991).

Fig 1.10 Recombination event


- 65 -

RECOMBINATION FRACTION REFLECTS GENETIC DISTANCE

Alleles at loci on same chromosome for different genes co-segregate at a rate that

is associated to the physical distance between them on the chromosome. This rate is the

probability or recombination fraction (θ), of a recombination event occurring between

two loci. Two loci are said to be genetically linked when recombination fraction is less

than 0.5. One of these loci is the disease locus while the other is a polymorphic marker

like micro satellite repeats (Strachan and Read, 1996). The recombination fraction

ranges from θ = 0 for loci right next to each other through θ = 0.5 for loci apart (or on

different chromosomes), so that it can be taken as a measure of the genetic distance or

map distance between gene loci. Two loci which show 1% recombination are defined as

being 1 centiMorgan (cM) apart on the genetic map. And a genetic distance of 1 cM

represents 0.9 Mbp on the sex averaged physical map (Foroud, 1997).

SCORE METHOD

When parametric linkage analysis methods are used, a quantity known as lod

score (logarithm of the odds) is typically calculated. The score provides the strength of

evidence in favour of linkage.

Log10 X Probability of the data if disease and marker are linked

Probability of data if disease and marker are unlinked

In a lod score calculation the numerator is the probability of data in the family if

the disease and marker are linked and therefore not segregating independently and the

denominator is the probability if the disease and the marker are unlinked and therefore

segregating independently (null hypothesis). If the marker and the disease gene are

unlinked then the numerator is no more than the denominator and the ratio will be less

than or equal to 1. However, when the marker and the disease gene are linked, the

numerator will be greater than the denominator and the ratio will be greater than 1. A

score of +3 or a positive score is an indication of linkage while a score of –2 or a

negative score denotes absence of linkage. It is carried out by various computer

programs (Ott, 1991; Terwillger and Ott, 1994).

MULTIPOINT MAPPING

Linkage analysis can be more efficient if the data for more than two loci are

analysed simultaneously. Multipoint mapping is particularly useful for finding the

chromosomal order of a set of linked markers. Usually the starting point in mapping a

Lod score =


- 66 -

disease locus is to find a two point score which gives linkage between a specific marker

and a disease locus. A multipoint score is calculated to find the location of disease gene

between two or more markers.

DNA POLYMORPHISM AS A TOOL FOR LINKAGE ANALYSIS

It is necessary to have polymorphic markers, which can be checked for

inheritance with the disease locus in question for linkage analysis. Genotyping is carried

out by a genetic marker defined as an observable polymorphism within the population.

Prior to 1960s a limited source of genetic markers was obtained from blood group

antigens (Conneally and Rivas, 1980). After 1980s restriction fragment length

polymorphism (RFLPs) were introduced as a new class of genetic markers (Botstein et

al. 1980). The RFLPs detect genome sequence differences that results in the presence or

absence of a restriction enzyme cutting site. Subsequently, variable number of tandem

repeats (VNTRs) and short tandem repeat polymorphisms (STRPs) were identified as a

new source for genetic markers; furthermore after publishing of human draft sequences

single necleotide polymorphisms (SNPs) were also recognized as a major tool for

linkage mapping. The most useful class of polymorphisms for the purpose of fine

genetic mapping are STRPs and SNPs which can be analysed either by PCR or array.

The main advantage of STRPs and SNPs is there ubiquitous presence across the genome

and a small amount of DNA is required for analysis as compared to RFLPs or VNTRs.

Moreover RFLP and VNTR analysis are not commonly performed since they are

laborious techniques involving restriction enzyme digestion and the subsequent

performance and anlysis of southern blots.

The short tandem repeat polymorphisms are also known as microsatellite and

have revolutionised the world of genotyping. STRPs are hyper variable tandem

sequence repeats, which consist of di-tri-, or tetra-nucleotide repeats. The most widely

used STRPs for genotyping are the simple (CA)n and (GT)n dinucleotide repeats. The

(CA)n repeats are extremely abundant and can be found, on average, once every 30-60

kb. (CA)n repeats are generally polymorphic if the repeat length is greater than 10. By

isolating and sequencing DNA fragments containing the microsatellite, PCR primers that

flanked the STRPs can be created and used to amplify it.


- 67 -

CHAPTER-II


- 68 -

Study of the Genetic and Molecular Basis of Hereditary Deafness

Field Work Bench Work

Approval of study from IRB at CEMB & NINDS/NIDCD

Identification of families with three or more deafness affected individuals

Enrollment of identified families and collection of blood samples

Clinical evaluation of enrolled families

DNA extraction

Genotyping & Linkage analysis for known DFNB loci

Genome Wide Scan of Unlinked families

Sequencing of genes

To study the genetic and molecular basis of hereditary deafness, the work plan

can be essentially divided into two phases which are further sub divided as depicted

below:

FIELD WORK INSTITUTIONAL REVIEW BOARD (IRB)

Approval for this study was obtained from the Institutional Review Board (IRB)

at the National Centre of Excellence in Molecular Biology, Lahore, Pakistan

(FWA00001758) and the NINDS/NIDCD IRB at the National Institutes of Health, USA

(OH-93-N-016). Informed consent document had been designed containing facts, risks,

and discomforts that might be expected to influence an individual’s decision to willingly

participate as a volunteer in a research project.

IDENTIFICATION AND ENROLLMENT OF FAMILIES

Families segregating sensorineural HL (either syndromic or nonsyndromic) with

three or more deafness affected individuals were identified through special education

schools and centre present in different cities of Pakistan. Principals were contacted and

briefed about the research program on deafness and a specially designed performa in

Urdu was provided to them in order to obtain information about the history of deafness

and number of affected in the family of each student. Families were visited and multiple

family members were interviewed for confirmation of consanguineous sibships and

pedigree drawing. Once the recessive mode of inheritance of deafness is evident from

the family structure, blood samples from all participants were obtained after proper

signing of informed consent. If a family had other affected relatives with HL, they were

also included in the study depending upon their willingness and availability. Detailed


- 69 -

history was taken from each family by questioning about skin pigmentation, hair

pigmentation, problems relating to balance, vision, night blindness, thyroid, kidneys,

diabetes, heart, and infectious diseases like meningitis, antibiotic usage, injury, and

typhoid, to minimize the presence of enviormental causes and to have a detailed view of

syndromic nature of the familiy, if any. CYRILLIC®

3.1 and Macromedia® FreeHand

®

MX Software’s were used to draw pedigrees structures of the enrolled families.

CLINICAL EVALUATION

Detailed clinical histories were obtained for all of the individuals of the enrolled

families to investigate the presence of other clinical abnormalities segregating with

deafness and environmental causes for HL. Families were questioned regarding skin

pigmentation, hair pigmentation, and problems relating to balance, vision, night

blindness, thyroid, kidneys, heart, diabetes, and infectious diseases like meningitis,

typhoid, mumps, rubella, injury, chronic otitis media and, antibiotic/ototoxic drug usage.

Parents as well as other members of the family were asked about the onset of deafness

for each affected individual to confirm that deafness was congenital. Pure tone

audiometry tests for air and bone conduction were performed at frequencies 250 to 8,000

Hz on many affected and unaffected members of these families. Ocular funduscopy and

electroretinography (ERG) was performed to detect the presence of retinopathy.

Vestibular function was evaluated by testing tandem gait ability, Romberg test, and

Electronystagmography Test (ENG) while goiter was observed physically in case of

Pendred syndrome.

AUDIOLOGICAL EVALUAION

AUDIOMETRY

Audiometry is a method used to determine the degree of HL as it provides means

to classify deafness according to the scale of severity shown in Fig 2.1 (Mazeas and

Bourguet 1975). Hearing sensitivity using air borne pure tones and bone conducted pure

tones were measured by Siemens SD 28 Audiometer. Audiometric studies were carried

out on deaf individuals and their normal hearing relatives. The results of representative

audiograms from an affected individual and normal individual are presented in Fig 2.2.

The affected individuals of all the families included in the present study had severe to

profound HL at sound frequencies from 250 Hz to 8000 Hz. Normal individuals had

hearing 25-30 dB from 250 Hz to 8000 Hz, which is considered as normal hearing.


- 70 -

1. THRESHOLD SENSITIVITY USING AIR BORNE PURE TONES

Threshold sensitivity was measured by using right and left earphones, allowing

each ear to be examined independently. Tones were reduced in intensity until a just

detectable threshold of hearing was determined. This was repeated at frequencies from

250 to 8000 Hz within the audible range and the results were plotted as an audiogram.

The shape of the curve is a measure of the frequency sensitivity of both the middle and

inner ear. To differentiate between the middle ear (conductive) and inner ear

(sensorineural) components, additional tests were conducted.

2. THRESHOLD SENSITIVITY USING BONE CONDUCTED PURE TONES

In this method, testing was done by means of a vibrator which was placed

somewhere on the skull, usually the mastoid bone. The testing and plotting procedures

were same as with air conduction testing. Sound at various frequencies and sound

pressure leads directly to the cochlea via bone conduction bypassing the middle ear.

Audiograms obtained using bone and air conducted sounds provide information about

the integrity of both the middle and inner ears.

TYMPANOMETRY

Tympanometry, a method to measure mobility and compliance of the tympanic

membrane which provides information about the function of the middle ear including the

tympanic membrane, ossicles and the eustachian tube. The instrument used is known as

tympanometer.

OTOACOUSTIC EMISSION (OAE)

Otoacoustic emissions are widely used in human and animals to study the

cochlear function. The origin of OAE is ascribed to the process associated with the

mechanical motion of the outer hair cells. Thus the OAEs are the sounds that the activity

of the outer hair cell generate and can be measured with a microphone. A probe

containing both a speaker and a microphone is sealed in the ear canal and a stimulus

(sound of two different frequencies) is provided to the ear and the emissions produced by

the outer hair cell in response to the stimulus are recorded.


- 71 -

Fig 2.1 Showing the Severity of Hearing Loss.

Fig 2.2 Representative audiogram showing a normal hearing and a profound hearing loss.


- 72 -

VESTIBULAR EVALUATION

Body orientation is controlled by the vestibular system, which consists of three

semi-circular canals, the utricle and saccule. Each of these semi-circular canals lie

automatically in a different plane. Each plane is at a right angle to the other and deals

with different movement up and down, side-to-side and tilting from one side to the other.

As the head moves, hair cells in the semicircular canals send nerve impulses to the brain

by way of the vestibular portion of the acoustic nerve. Vestibular testing is used to

determine the vestibular apparatus of the inner ear. In this regard, tandem gait ability,

Romberg test, and ENG test are usually performed on the affected individuals.

ROMBERG AND TANDEM GAIT TEST

The Romberg test is a physical examination in which the patient is asked to stand

with their feet together (touching each other) and to close their eyes. Observer should

remains close to the patient, if the patient begins to fall. With closed eyes, visual input is

removed and instability can be apparent. If there is a more severe vestibular lesion, or a

midline cerebellar lesion, the patient will be unable to maintain this position even with

their eyes open and may fall (Blumenfeld, 2001).

In case of tandem gait test, the patient is asked to walk with their hand attached

with the body, each foot has to place adjacent with the other foot and have to walk. If

there is any problem with in the vestibular system, the person can not walk properly.

ELECTRONYSTAGMOGRAPHY TEST (ENG)

Electronystagmography (ENG) is another clinical test used to evaluate patients

with dizziness and balance problems. It is a graphic recording of eye movements. ENG

consists of an oculomotor evaluation, positioning testing, and caloric stimulation of the

vestibular system. Comparison of results obtained from various subtests of ENG tests

assist in determining whether a disorder is central or peripheral. In peripheral vestibular

disorders, the lesion can be inferred from results of caloric stimulation and, to some

degree, from positional findings (Levy and Arts 1996).

RETINITIS PIGMENTOSA

Retinitis pigmentosa is a progressive retinal degeneration (Fig 2.3) that begins

with loss of peripheral vision and night blindness, and often leads to total blindness in

later life. Two tests were performed on the affected individuals of each family for the

diagnosis of retinitis pigmentosa.


- 73 -

FUNDUSCOPY OR OPTHALMOSCOPY

An ophthalmoscope or slit lamp is used to examine the retina, optic disc,

choroids, and blood vessels. Ophthalmoscopy is performed by dilating the pupils for

obtaining the best view inside the eye. An ophthalmoscope is an instrument that gives a

wide-field view of the sensory portion of vitreous and retina. A light source is directed

into the eye by an adjustable mirror and the reflected light is gathered by a condensing

lens to form a virtual inverted image of the retina. Opthalmoscopy of the retina in

individuals with advanced RP is characterized by the presence of intra retinal clumps of

black pigment, markedly attenuated retinal vessels, loss of retinal pigment epithelium

(RPE), and pallor of the optic nerve (Fig 2.3). These changes reflect long-standing

retinal degeneration and need not be present to make the diagnosis of RP. The fundus

findings are, however, instrumental in distinguishing RP from other retinal dystrophies

that have similar clinical findings but distinctive retinal changes.

ELECTRORETINOGRAM TEST (ERG)

Electroretinogram (ERG) is considered the gold standard and the most decisive

diagnostic test for RP because it provides an objective measure of rod and cone function

across the retina. The ERG measures the retinal response to a stimulus of light using a

corneal electrode and neutral electrodes placed on the skin around the eye. The corneal

electrode is placed gently behind the lower eyelid and contacts the cornea. A flash of

light is shown to the patient and the electrodes record the retinal potentials, which

develop as a response to the flash. The ERG is usually abnormal in infancy or early

childhood, except for some of the very mild and regional forms of RP. This diagnostic

procedure is also useful in distinguishing between a variety of retinal disorders such as

cone or rod dystrophy and retinitis pigmentosa.


- 74 -

Fig 2.3 Picture of normal human retina and retina with retinitis pigmentosa.


- 75 -

BENCH WORK DNA EXTRACTION

FROM BLOOD SAMPLES

White blood cells (WBC) are the only nucleated cell present in the blood and an

easily source to extract genmomic DNA of individuals. Genomic DNA was extracted

from the blood samples following a non-organic method (Grimberg et al 1989) as under:

Ten milliliters of venous blood samples were collected in 50 ml Sterilin® falcon

tubes containing 400 µl of 0.5 M EDTA. Till the commencement of DNA extraction,

blood samples were kept frozen either at -70°C for 20-30 min or at -20°C for long term

storage. Blood samples were thawed for the red blood cells (RBC) lyses. 35 ml of TE

buffer (10 mM Tris HCl, 2 mM EDTA, pH 8.0) was added for washing of blood

samples. Samples were centrifuged at 3000 rpm for 20 min and supernatant was

discarded to wash out the lysed RBC. Washing was repeated for three to four times till

the WBC pellet is free of hemoglobin.

Digestion of proteins in the pellets of WBC was carried out by adding 0.5 mg of

proteinase K along with 200 µl of 10% SDS in the presence of 6 ml TNE buffer (10 mM

Tris HCl, 2 mM EDTA, 400 mM NaCl). Samples were left overnight in an incubating

shaker at a temperature of 37oC and a speed of 250 rpm.

Proteins were precipitated by adding 1ml of super saturated NaCl, followed by

vigorous shaking and chilling on ice for 15 min before centrifugation at 2400 rpm.

Supernatant is shifted to another Sterilin®

falcon tube and DNA was extracted from the

supernatant by adding equal volume of Isopropanol. After washing the DNA pellet with

70% ethanol, DNA was dissolved in TE buffer (10 mM Tris HCl, 0.2 mM EDTA) and

heated at 70oC in a water bath for 1 h to inactivate any remaining nucleases. Further the

DNA was kept at -20°C for long storage.

FROM BUCCAL SWABS

In case of elderly people or very young children where it was difficult to obtain

blood sample buccal swabs were collected, as it is simple and noninvasive technique for

obtaining buccal cell DNA. Cheek cells were obtained by means of MasterAmpTM

Buccal Swab Brushes (EPICENTRE®

Biotechnologies WI, Medical Package Co-

operation, CA, USA). Subjects were asked to refrain from smoking, drinking, or eating

for 1 h before sample collection to reduce the possibility that food particles or other


- 76 -

exogenous materials would compromise the sample and they were instructed to

thoroughly rinse their mouth with water. Two swabs were taken from an individual by

swirling each brush firmly on the oral mucosa for 30 sec, air dried and then stored in the

original packaging at room temperature. DNA was extracted from these buccal cells

using MasterAmpTM

DNA Extraction Solution from EPICENTRE®

Biotechnologies

(Walker et al. 1999).

1) 500µl of the MasterAmpTM

DNA Extraction Solution was added into an

appropriate number of 1.5 ml ependroff tubes and placed them on ice

2) Buccal brush was placed into a tube containing DNA extraction solution and

was rotated a minimum of 20 times. The brush was pressed against the side of the tube

and rotated while removing it from the tube to ensure most of the liquid remains in the

tube.

3) The cap was closed on the tube tightly, vortex for 10 seconds and was

incubated at 60°C for 30 minutes.

4) Vortex mixed for 15 seconds. The tube was transferred to 98°C and incubated

for 8 minutes.

5) Vortex mixed for 15 seconds. The tube was returned to 98°C and incubated

for an additional 8 minutes. Again vortex mixed for 15 seconds.

6) Chilled the tube on ice briefly to reduce the temperature and cellular debris

was pellet down by centrifugation at 4°C for 5 minutes at 14000 rpm.

7) The supernatant containing the DNA was transferred carefully to a sterilized

properly labeled screw tube without including any of the beads.

8) The yields of the DNA are usually 2-8 ng/µl and were kept at -20°C, or at -

70°C for longer term storage.

PREPARATION OF REPLICA PLATES

Concentration of the DNA was obtained by measuring the optical density (OD) at

260 nm and 280 nm. DNA was diluted in low TE Buffer (10 mM Tris HCl pH 8.0, 0.1

mM EDTA) and working DNA dilutions concentration were kept at 25 ng/µl and 100

ng/µl for single marker and multiplex PCR amplification, respectively. For the purpose

of automated fluorescent genotyping; initially a 96 well master plate was designed and

DNA samples of set of particular families were assigned to each of the wells. Plate map

was designed that consist of at least 3 affected with a parent and normal sibling from

each family. Replicates of the designed master plate were made with 50ng of DNA for


- 77 -

exclusion studies and 200ng for genome wide scan dispensed into each well overlaid

with a 10 µl mineral oil.

LINKAGE ANALYSIS FOR ALREADY REPORTED DFNB LOCI

Three or four short tandem repeat (STR) markers were genotyped for all the

known recessive deafness loci (Table 1.1) as preliminary exclusion studies. DNA

templates were amplified by PCR; using fluorescently labeled primers (forward primers

labeled with one of the fluorescent dyes, FAM, NED, VIC). The markers used for

linkage analysis encompassed the chromosomal locations as mentioned by hereditary

hearing loss homepage (http://dnalab-www.uia.ac.be/dnalab/hhh) and were obtained

commercially from either Applied Biosystems (ABI) or Integrated DNA Technologies

(IDT). The labeling dyes of the primers were assigned in a manner that a single locus

could be pooled at one time.

GENOTYPING BY USING POLYMERASE CHAIN REACTION (PCR) AND

STR MARKERS

PCR fragments were amplified from 50ng of genomic DNA in 10 µl reaction

using replica plates.

REACTION MIXTURE FOR AMPLIFICATION OF STR MARKERS

Ingredients Final Conc.Stock Required

Genomic DNA 50 ng 25 ng/µl 2 µl

Primer Forward 2.4 pM 8.0 pM 0.3 µl

Reverse 2.4 pM 8.0 pM 0.3 µl

dNTPs

(dATP, dTTP, dCTP, dGTP) 200µM 1.25 mM 0.8 µl

PCR Buffer* 1X 10X 1 µl

Taq Polymerase 0.5 units 2 units/µl 0.05 µl

dH2O q.s to 10 µl

* 10X PCR buffer (100 mM Tris HCl pH 8.4, 500 mM KCl, 15-25 mM MgCl2

and 1% Triton)

The microsatellite markers were amplified on an ABI 2700 or ABI 9700

thermocycler. The thermo cycling programs used for amplification of single markers

were touch down programs of either 67°C→57°C or 64°C→54°C and for amplification


- 78 -

25 C

95 C96 C

67 C72 C

95 C

57 C

72 C 72 C4.00 Min

0.45Sec

0.45Sec

1.00 Min

0.45Sec

0.45Sec

1.00 Min

10.0 Min

.............

.............

.............

10 Cycles 30 Cycles1 Hld.

2 Hld.

3 Tmp 3 Tmp

25 C

95 C96 C

64 C72 C

95 C

54 C

72 C 72 C4.00 Min

0.45Sec

0.45Sec

1.00 Min

0.45Sec

0.45Sec

1.00 Min

10.0 Min

.............

.............

.............

10 Cycles 30 Cycles1 Hld.

2 Hld.

3 Tmp 3 Tmp

25 C

94 C95 C

54 C65 C5.00

Min0.30Sec

0.30Sec

2.00 Min

.............

36 Cycles1 Hld.

2 Hld.

3 Tmp

.............

70 C

10.0 Min

of primers in form a multiplex annealing of 54°C along with extension of 2 min was used

as shown in Fig 2.4.

Fig 2.4s Thermocycling profiles used for the amplification of markers. A. Thermocycler programme

touch down 67°C→57°C, B. Thermocycler programme, touch down 64°C→54°C, C. Thermocycler

programme for amplifying multiplex PCR reaction.

GENOME WIDE SCAN

Selected families which remained unlinked to known DFNB loci were subjected

to genome wide search. Genome wide scan was carried out with ABI PRISM®

Linkage

Mapping Set version 2.5 MD10 having 411 microsatellite markers (28 panels) spaced at

~10 cM intervals across the whole human genome (Fig 3.2), to map new loci on families

which remained unlinked to known loci. Multiplex PCR were standardized for the 388

markers of first 27 panels (covering autosomes) by dividing them into appropriate sets by

taking in account their dyes and sizes of amplified products (Table 2.1). PCR fragments

were amplified from 200 ng of genomic DNA in 5µl reaction containing 0.04-0.08 pM of

each primer, 200µM of dATP, dTTP, dCTP and dGTP, 0.8 units of Taq polymerase, .0.5

µl of 10 X PCR reaction buffer (750 mM KCl; 100 mM Tris HCl PH: 8.3. 25 mM

MgCl2) and 10µl overlay of mineral oil. PCR cycle is same as above (Fig 2.4C).


- 79 -

Set PANEL 1 Amount

A D1S2797, D1S2800, D1S234, D1S255, D1S2785, D1S2890, D1S484 0.1µl

B D1S2878, D1S206, D1S2842, D1S2726 0.1µl

C D1S249, D1S450, D1S2667, D1S196, D1S2836 0.1µl

Set PANEL 2 Amount

A D1S207 (0.15), D1S413 (0.15), D1S2866, D1S438, D1S2841D1S2697, D1S468,

D1S498 0.1µl

B D1S199, D1S252, D1S230, D1S214, D1S218, D1S425 0.1µl

Set PANEL 3 Amount

A D2S286, D2S165, D2S160, D2S2211, D2S367, D2S125, D2S325, D2S337 0.1µl

B D2S2333, D2S126, D2S364 0.1µl

C D2S206, D2S117, D2S142 0.15µl

Set PANEL 4 Amount

A D2S319, D2S2382, D2S335, D2S162, D2S338 0.1µl

B D2S112, D2S2330, D2S2216, D2S347, D2S2259, D2S168, D2S151, D2S2368,

D2S391, D2S396, D2S305 0.1µl

Set PANEL 5 Amount

A D4S392, D3S1311, D3S1565, D4S1575, D4S405, D4S1534, D3S1263, D3S1285,

D4S1597 0.1µl

B D3S1271 (0.075), D3S3681 (0.075), D4S406 (0.15), D4S414, D3S1614 0.1µl

Set PANEL 6 Amount

A D4S2935, D3S1304, D3S1601, D4S415 0.1µl

B D3S1262, D4S1572, D4S413, D4S426, D4S391 0.1µl

C D3S1569, D3S1300, D4S1592, D3S1292, D3S1297, D4S419 0.1µl

Set PANEL 7 Amount


B D3S1580, D3S2338, D4S2964, D4S412 0.1µl

C D4S424, D3S1278, D3S1267, D3S1566, D4S1535 0.1µl

Set PANEL 8 Amount

A D5S407 (0.15), D6S281 (0.15), D5S406, D5S400, D5S422, D5S433, D5S419,

D5S644, D6S422, D6S289, D5S424 0.1µl

B D6S1581 (0.1), D6S262, D6S309, D5S406 0.15µl

Set PANEL 9 Amount


B D6S1574, D6S287, D6S292, D5S426, D6S446 0.1µl

Set PANEL 10 Amount


B D5S2027, D6S460, D5S428, D5S471 0.15µl

C D5S410, D5S418, D5S416 0.15µl

Set PANEL 11 Amount

A D7S530 (0.15), D7S517 (0.15), D7S484, D8S264, D8S549, D8S258, D7S669 0.1µl

B D7S516 (0.15), D7S510 (0.15), D8S272, D7S502, D7S630, D7S640, D7S513,

D8S514, D7S657 0.1µl

C D8S260, D8S1784, D7S2465, D8S1771 0.15µl

Set PANEL 12 Amount

A D7S507, D7S515, D7S486, D7S519, D7S661, D8S277 0.1µl

B D8S284, D7S684, D8S270 0.1µl

C D7S798, D8S505, D7S636 0.1µl

D D7S493, D8S550, D7S531, D8S285 0.1µl

Set PANEL 13 Amount


D9S171, D9S273, D10S192 0.1µl

B D11S4175, D9S285, D11S987, D11S1314 0.1µl

Set PANEL 14 Amount

A D10S197, D10S1653, D9S161, D11S901, D10S1686 0.15µl

B D10S185, D9S175, D10S212, D9S287, D9S1597, D9S167, D9S288 0.15µl


- 80 -

Set PANEL 15 Amount

A D9S286, D9S1690, D11S1320, D11S968, D9S1776, D11S1338, D10S591,

D10S587, D10S189 0.1µl

B D9S164, D11S4151, D11S4191, D10S537, D11S925 0.1µl

Set PANEL 16 Amount

A D10S548, D9S1826, D9S1682, D11S908, D10S1693, D9S290 (0.2), D10S597

(O.2), D10S1652 (0.2) 0.15µl

B D11S898, D10S196, D10S217, D9S283 (0.15), D10S165 (0.15) 0.1µl

C D9S1817, D9S158 0.15µl

Set PANEL 17 Amount


D12S1617 0.1µl

B D12S83, D13S285, D13S170, D13S263 0.1µl

Set PANEL 18 Amount

A D12S85, D12S351, D12S368, D13S1265, D12S79 0.1µl

B D12S345, D12S99, D12S87, D13S156, D12S336 0.1µl

Set PANEL 19 Amount


B D13S159, D13S265, D12S310, D13S153 0.1µl

Set PANEL 20 Amount


B D14S292, D14S74, D14S288, D14S261, D14S68, D14S63 0.15µl

Set PANEL 21 Amount


D16S3091, D15S153 0.1µl

B D16S515, D15S1002, D16S520, D15S131, D15S117 0.1µl

Set PANEL 22 Amount

A D16S3046, D16S415, D15S978, D16S3103, D15S120 0.1µl

B D15S205, D16S404, D15S128, D16S516 0.1µl

C D15S1007, D15S994, D15S1012, D16S423 0.1µl

Set PANEL 23 Amount


B D17S949, D18S478, D17S831, D17S1868, D17S798, D17S787, D18S61 0.1µl

Set PANEL 24 Amount

A D17S944, D17S784, D18S464, D18S63, D18S64, D18S474 0.1µl

B D18S53, D17S938, D18S59, D17S921, D17S928, D18S452, D17S785, D18S1161,

D18S68 0.1µl

Set PANEL 25 Amount


D20S196 0.1µl

B D19S221, D19S210, D20S100, 0.1µl

Set PANEL 26 Amount


D22S423 0.1µl

B D19S884, D12S1252, D22S539 0.1µl

SM D22S274 0.1µl

Set PANEL 27 Amount


D19S226, D19S571, D21S1914 0.1µl

Table 2.1 Genome Wide Panels Sets for Multiplex PCR.


- 81 -

SAMPLE PREPARATION FOR ABI 3100 GENETIC ANALYZER

The fluorochromes labelled PCR products were pooled together in such a way

that none of the PCR products had the same size or fluorochrome in common. 1-2 µl of

the PCR products together with 11.8 µl deionized Hi-DiTM

Formamide (ABI) and 0.2 µl

of one of the internal size standard ROX®

or LIZ®

(ABI) were pooled by using 12

capillary Hamilton®

Syringe into a 96 well MicroAmp®

PCR plate. The samples were

denatured at 95°C for 5 min followed by chilling in the ice and loaded for genotyping in

ABI 3100 Genetic Analyzer according to the manufacturer’s instructions given in

technical manuals.

PRINCIPLE OF AUTOMATED FLUORESCENT GENOTYPING

The phenomenon behind the automated genotyping is that when DNA fragments

labeled with four different dyes electrophorese through the capillaries filled with

acrylamide gel are separated according to their size. At lower end of the capillaries the

dye labelled fragments pass through a region where a laser beam continuously scans the

capillaries. The laser excites the fluorescent dyes attached to the fragments and they

emit light at a specific wavelength for each dye. These light emissions are separated

according to wavelength, thus all four types of fluorescent emissions are detected with

one pass of the laser. With the help of data collection software light intensities are

collected and stored as electrical signals (Lee et al. 1997).

Automated allele assignment was performed using the ABI PRISM®

Gene Scan

Analysis Software Version 3.7 for Windows NT®

Platform. The Gene Scan analysis

software uses the automated fluorescent detection capability of the ABI PRISM®

3100

Genetic Analyzer instrument to size and quantitate DNA fragments and displays the

result of the experiment as a reconstructed gel image, electropherogram or tabular data or

a combination of electropherogram and corresponding tabular data. ABI PRISM®

Genotyper ®

3.7 NT is data analysis software and transformation tool that converts data

from Gene Scan result files into user application results. After obtaining a printout of the

genotypic results, alleles (smallest allele was called as 1) were called manually (Fig 2.5).


- 82 -

Fig 2.5 Electropherogram of marker D11S4166 representing heterozygous alleles (1,2; 2,3) of father,

mother, and normal while all the deaf individuals are homozygous for allele 2,2. The alleles were called

manually; smaller one was called as “1”.


- 83 -

HAPLOTYPE ANALYSIS

Haplotype represents an individual’s chromosomal segment. It is the set of

genotyped alleles arranged according to the cM distance along a chromosome. Alleles

were arranged in ways that confirm the inheritance pattern of segregating disease. If

three polymorphic markers located in the linkage interval of a DFNB locus did not show

homozygosity among the affected of a family, the family was considered unlinked.

Linkage to a particular locus was confirmed when homozygous data of affected members

cosegregates with the disease pattern in the family tree.

GENOME SCAN DATA ORGANIZATION AND ANALYSIS

For genome scan data organization and analysis, Microsoft Excel macro was

specially developed by Bioinformatics Lab, CEMB. This macro has different modules

and help in integrating different excel sheets to analyze data. Different excel sheets were

named: Data, Ranges, Basic Info, and Code sheet.

Data Sheet Genotyping data of individuals in shape of alleles sizes were called

and entered manually into the data sheet, it contain further information like: Panel ID,

Marker’s ID and cM distance, Labeling dye, Person name and ID, Disease status/

relation. Markers were listed column wise while individuals were arranged horizontally

and assigned 2 columns per individual for a set of alleles.

Ranges Sheet Data entered in the data sheet was subjected to different analysis

by using various modules of the macro, like Parentage, Coloring, Coding, and Filing. To

run specific module different ranges were adjusted in the ranges sheet.

HOW TO RUN THE MACRO

Data sheet and Ranges sheet act as a backbone to run different modules of

software. To run the macro it is selected from the Tools present in the Menu bar. A

window with the list of modules will be opened; relevant module was selected and Run

command is given. The whole procedure is depicted in Fig 2.6.

MODULES

They provide a computerized format for the enhanced management of data and

related information. The macro package is provided with five dynamic modules:

1. Parentage (Confirmation of inheritance pattern) This module compare the

given alleles of siblings with parental alleles. If any deviation regarding inheritance

pattern is observed the relevant cell was highlighted as RED.


- 84 -

2. Coloring (Coloring of homozygous alleles) This module highlights all the

homozygous alleles by changing their background color. For each marker, if there were

more than one homozygous pairs of alleles, different colors were assigned to different set

of values and same color to same set of values.

3. Coding This module analyze all the alleles appearing against a marker and

assign them a numeric codes starting from the lowest number. Finally it generates a new

version of data sheet having all information of original data sheet except alleles are

replaced by its numeric code.

4. Filing This module compiles the allelic data for a given set of markers (as

adjusted in the ranges sheet) in the form of concatenated alleles. The out put of the

module is to populate the column labeled “alleles” on a different sheet named Basic Info

which is further used to make pre file for lod score calculation. Other columns of this

sheet are filled manually according to the information of subjected pedigree.

5. Create Pre This module picks the data from “Basic Info” sheet; arrange it in a

specific pattern recommended by Linkage programme and saves it in a text-formatted

file with a “pre” extension. This pre file act as starting point to calculate Lod scores.

Fig 2.6 Representing the procedure to run Macro.


- 85 -

LOD SCORE CALCULATIONS

Morton (1995) demonstrated that lod scores represent the most efficient statistical

proof of evaluating pedigrees for linkage. Lod scores were calculated using FASTLINK

(v4.1p) (Schaffer et al 1994). Two point and multipoint lod scores were calculated with

MLINK and LINKMAP programs respectively. Deafness was assumed to be inherited

in an autosomal recessive manner with complete penetrance. Recombination frequencies

were assumed to be equal in both males and females. Genetic distances were based on

Marshfield human genetic map (http://www.marshmed.org/genetics/). PRE FILE is a

simple notepad file containing information regarding family structure, affection status

and sex of individuals along with their genotypic data for one marker or more than one.

PED FILE is a file in which the information about the consanguineous marriages/loops

in the family is entered. The loops are broken with the help of a program named

MAKEPED so that the program doesn’t revolve in enclosed circle. As the result the

program makes double entry of those individuals from where the loops were broken and

make a .Ped file. DAT FILE file is made with the help of PREPLINK program, and

contains the population data (allele frequency) of each of the marker for which lod score

is to be calculated. The frequency of deafness alleles were estimated by genotyping the

genomic DNA from 90 unrelated Pakistani subjects. Some time, the allele frequencies

were considered equal, according to the data of family or 10 alleles with equal frequency

of 0.1 were assumed to make total sum equals to 1.0. These a;ll above file acts as a back

bone for LCP PROGRAM to calculates the lod score and as result generates a file

named Final.out as default name. FAM2PD PROGRAM read this Final.out file and

gives us a readable file of lod score in notepad file format respresenting all the Zmax

against all the θ values.

DNA SEQUENCING

DNA sequencing, the process of determining the exact order of chemical building

blocks (called bases and abbreviated A, T, C, and G) that make up the DNA of 23

different human chromosomes. The crucial technique involves, making many copies of

targeted exon of gene or DNA fragment through PCR using primer pairs designed

through the Primer3 website and exposing these many copies of the DNA fragment to a

flourescently label at the end of the DNA strands. More than one primer pair was used

to sequence longer exons. The sequencing reactions were performed on an automated

ABI PRISM®

3100 Genetic Analyzer using Big Dye Terminator Chemistry (Heiner et al.


- 86 -

1998). The ABI PRISM®

3100 Genetic Analyzer functions the same way for both

sequencing and gene scan analysis. It performs electrophoretic separation and spectral

detection of dye labeled DNA fragments. ABI PRISM®

DNA Sequencing Analysis

Software Version3.7 was used to separate and analyze the results of four different dyes

used to identify A, C, G, and T extension reactions.

AMPLIFICATION OF PCR FRAGMENTS

The fragment of interest was amplified in a PCR reaction as follows: PCR

reactions were performed with 100 ng of template DNA in 25 µl reaction mixture

containing 0.75 µl of forward and reverse primer (8 µM), 2.5 µl of 10X PCR buffer (100

mM Tris-hCl, pH 8.4, 500 mM KCl, 15-20 mM MgCl2 and 1% Triton), and 2.5µl of

1.25 mM dNTPs and 1-2 unit of Taq DNA polymerase. Thermal cycling profile used for

amplification of different exons of genes is shown in Fig 2.7A whereas annealing

temperature is variable (52-580 C) for different exons.

AGAROSE GEL ELECTROPHORESIS AND EXO-SAP TREATMENT

5 µl of the PCR product was analyzed on a 1.5% agarose gel to confirm the

amplification and to check the purity of the PCR product before sequence analysis. The

DNA was then treated to remove unincorporated nucleotides and oligonucleotides with a

mixture containing Exonuclease1 and Shrimp Alkaline Phosphatase (SAP) according to

the USB Corporation instruction.

EXO-SAP Treatment

Amplified DNA 20 µl

Shrimp alkaline phosphatase 0.2 µl

Exonuclease 1 0.2 µl

10X SAP Buffer 1.5 µl

dH2O q.s to 25 µl

Incubated at 37oC for 1 hour, followed by 80

oC for 15 min to inactivate the

enzymes and lastly at 25°C for 30 min.

SEQUENCING REACTION

To the above 20 µl reaction, equal volume of dH2O was added to dilute the salt

concentration in the samples which otherwise could affect the sequencing results.

Sequencing PCR (Fig 2.7B) with both forward and reverse primer was performed using

the Big Dye Terminator Chemistry (Heiner et al. 1998) as under:


- 87 -

25 C

94 C95 C

52-58 C72 C

5.00 Min

0.45Sec

0.45Sec

2.00 Min

.............

36 Cycles1 Hld.2 Hld.

3 Tmp .............

72 C

10.0 Min

A

25 C

94 C95 C

50 C70 C

2.00 Min

0.10Sec

0.10Sec

4.00 Min

.............

36 Cycles1 Hld.2 Hld.

3 Tmp .............

70 C

10.0 Min

B

Reaction Mix

Diluted DNA sample 6 µl

Big dye sequencing mix 1 µl

Primer (3.2 µM) 1 µl

5X dilution buffer * 1 µl

dH2O q.s to 10 µl

* 5X buffer (Tris HCl 400 mM pH 8.7, MgCl2 10 mM)

Fig 2.7 A. Thermal cycling profile for exon amplification. B. Thermal cycler programme for sequencing

reaction.

SEQUENCING PRODUCT PRECIPITATION AND LOADING ON ABI 3100

SEQUENCER

Sequencing reaction was set up in 96 well MicroAmp®

PCR plate (ABI) and

precipitated using ethanol. 95% ethanol 18.9 µl and 1.1 µl of dH2O was added to each

well containing 10 µl sequencing reaction to make the final concentration of ethanol up

60± 3%. Plate was inverted a few times to mix after sealing with 3M Scotch®

aluminum

foil tape and was kept at room temperature for 15 min to precipitate the extended

products. The tray was centrifuged at 3000 rpm for 30min and adhesive tape was

carefully removed and supernatant was discarded by inverting the plate on a paper towel.

150 µl of 70% ethanol was added to each well to rinse the pellet, and plate was again

centrifuged at 3250 rpm for 20 min after covering with adhesive tape. Finally ethanol

was discarded similarly as above, pellets were air dried and dissolved in 12 µl of

deionized Hi-DiTM

Formamide (ABI). Samples were denatured at 95°C for 5 min and


- 88 -

quick chilled by placing in ice before loading on the ABI PRISM®

3100 Genetic

Analyzer according to manufacturer instructions.

ANALYSIS OF DNA SEQUENCES

Sequencing data was analyzed using ABI PRISM®

DNA Sequencing Analysis

Software Version3.7 and was read manually by using Chromas (v1.45) software. The

sequence was also blast against normal sequence by using either BlastN or BLAST 2

Sequences on the NCBI web. BLAST (Basic Local Alignments Search Tool) a family of

search programs designed to explore all the available databases against a query protein or

DNA sequence. The scores are assigned in a BLAST search based on a statistical

interpretation, thus differentiating real matches from random background hits (Altschul

et al 1990). 'BLAST 2 Sequences', a new BLAST-based tool for aligning two protein or

nucleotide sequences (Tatusova et al 1999). It utilizes the BLAST algorithm for

pairwise DNA-DNA or protein-protein sequence comparison. The resulting alignments

are presented in both graphical and text form. Any change in the DNA sequence was

confirmed by sequencing both sense and antisense strands for all the family individuals.


- 89 -

CHAPTER-III


- 90 -

SECTION-I

A MUTATION SPECTRUM

OF MYO7A ASSOCIATED

WITH USH1B AND

EVIDENCE FOR THE

EXISTENCE OF DFNB2


- 91 -

PREAMBLE Usher syndrome is an autosomal recessive disorder characterized by bilateral

sensorineural hearing impairment and progressive loss of vision due to retinitis

pigmentosa (RP). There are three clinical subtypes of usher syndrome as well as atypical

cases (Keats et al. 2004). Type 1 usher syndrome (USH1) is characterized by the

presence of severe to profound HL, vestibular dysfunction, and early onset of RP. Seven

USH1 loci have been mapped and genes for USH1B, 1C, 1D, 1F and 1G have been

identified (Weil et al. 1995, Verpy et al. 2000, Bork et al. 2001, Bolz et al. 2001, Ahmed

et al. 2001, Alagramam et al. 2001, Weil et al. 2003). Defects of myosin VIIa are

responsible for HL due to splayed and disorganized stereocilia of shaker 1 mouse, the

mariner zebrafish, the tornado rat (Self et al. 1998, Ernest et al. 2000, Smits et al. 2005),

Usher syndrome type 1B and dominantly inherited, progressive HL DFNA11 in humans

(Weil et al. 1995, Liu et al. 1997b).

Mutations of MYO7A at USH1B locus are a leading cause of USH1 in United

States, Northern Europe, Colombia and other populations and more than 100 mutant

alleles of MYO7A (Table 1.3) have been reported (Astuto et al. 2000, Hope et al. 1997,

Tamayo et al. 1991). Moreover, four mutant alleles of MYO7A are associated only with

progressive HL (DFNA11) inherited as a dominant trait (Liu et al. 1997, Bolz et al. 2004,

Luijendijk et al. 2004, Street et al. 2004). In addition, three mutant alleles of MYO7A

were initially reported to be associated with nonsyndromic deafness (DFNB2) in one

Tunisian and two Chinese families (Liu et al. 1997, Weil et al. 1997). However, the

original Tunisian family was re-evaluated to have usher syndrome when affected

members showed early signs of RP on detailed ocular examination (Zina et al. 2001). In

the absence of ERG data or fundoscopy examinations, affected members of the two

Chinese families were assumed to have a normal retinal function, although deaf

individuals from both these families have vestibular dysfunction, a feature of USH1

(Weil et al. 1997). An evaluation of these two families by Astuto and co-workers

concluded that there is no published evidence of mutations of MYO7A associated with

nonsyndromic deafness DFNB2 (Astuto et al. 2002). So far, no family with normal

vestibular or vision function (DFNB2) has been documented segregating recessive

mutant alleles of MYO7A.


- 92 -

A cohort of 270 families was studied (20 newly enrolled families + 250 families

from CEMB repository); DNA was isolated from the venous blood samples or buccal

swabs as described in previously. An exhaustive screen to identify an authentic DFNB2

family and to determine any genotype/phenotype correlation was undertaken by typing at

least three informative STR markers. Families linked to USH1B/DFNB2 locus were

sequenced for the 49 exons of MYO7A with primers designed from flanking intronic

sequence (Levy et. al, 1997). Medical histories were obtained and pure tone audiometry

was performed on affected individuals of all these families. Physical and clinical

examinations including Romberg test, Tandem gait, ENG (electonystagmography),

Fundoscopy and/or ERG were conducted on oldest affect individual from each family.

Eleven families showed linkage to DFNB2/USH1B region. Affected individuals

of all families had night vision problem except one family PKDF034 that does not have

such phenotype. No other neurological or clinical abnormality was detected in these

families. The mutational screen of MYO7A in affected individuals of these eleven

USH1B/DFNB2 families yielded 9 recessive mutant alleles of MYO7A. There were

seven previously not recognized MYO7A mutations in eight families with Usher

syndrome and an additional one in a family with DFNB2. These mutations were found

on 7 different haplotypes (Table 3.1) and are distributed across the gene (Fig 3.7). 96 or

180 normal anonymous DNA samples of Pakistani origin were sequenced to determine if

the mutations of MYO7A are common polymorphisms.

FAMLIES LINKED TO USHER TYPE 1B PKDF008

This family was enrolled from Multan (Punjab) and belongs to “Jadral” cast.

PKDF008 was a large, highly inbred family with five consanguineous marriages and five

affected individuals (V:4, V:5, V:6, V:7, V:11) in three sibships (Fig 3.1A); however

spouse IV:1 was thought to be distantly related cousin. Severe to profound sensorineural

HL with vestibular dysfunction, segregated in affected individuals of the family. Family

PKDF008 had a history of night vision problem which was further confirmed by

fundoscopic evaluation of the oldest affected member V:5 (aged 17yrs). Haplotype

analysis clearly showed linkage to USH1B locus as all the five affected individuals were

homozygous for the USH1B screening markers i.e. D11S4186, D11S1789, and


- 93 -

D11S4079; while 12 unaffected members of the family were either heterozygous or

normal (Fig 3.1A). The family fits on the USH1 criteria so evidently an USH1B family.

PKDF161

Family PKDF161 was enrolled from Gujrat (Punjab) and belongs to caste

“Harjoay”. PKDF161 had three affected individuals in two-loops, while spouse III:1

was thought to be a distantly related cousin (Fig 3.1B). Pure-tone air conduction

audiometry showed profound sensorineural HL segregating in family PKDF161.

Fundoscopy of oldest affected IV:7 (aged 15yrs) demonstrated early signs of RP,

vestibular dysfunction was also observed in affected individuals. All the three affected

individuals (IV:5, IV:6 and IV:7) were found homozygous for three informative STR,

while the normal individuals (III:2, III:5, III:6, IV:5, IV:8) were obligate carriers.

Haplotype analysis established linkage to DFNB2/USH1B bounded by markers

D11S4186, D11S1789, and D11S4079 (Fig 3.1B).

MISSENSE MUTATION (G214R) IN MYO7A CAUSES USH1B

Haplotypes of both the families (PKDF008 and PKDF161) were alike (Table 3.1)

raising the likelihood of a common ancestral mutation. On sequencing affected

individuals from both the families were found homozygous for a 640G>A transition

mutation (G214R) in exon 7 of MYO7A (Fig 3.1C) which encodes part of head domain

of myosinVIIa (Fig 3.7). This G214R mutation is conserved in 14 myosinVIIa

orthologues (Fig 3.1D) and previously reported in a family of Morocco origin (Adato et

al. 1997).

PKDF189

This family was enrolled from Lahore (Punjab) and was “Malik” by cast. Family

PKDF189 had seven affected individuals in three loops; 4 affected and 3 unaffected

members of the family were available for the study (Fig 3.2A). Severe to profound

sensorineural HL segregated in family PKDF189, while oldest affected individuals (III:4

and IV:3) complained loss of vision at night and vestibular dysfunction, demonstrating

the segregation of USH1 in this family. Fundoscopy of two older affected individuals

III:4 and IV:3 (aged 20 and 10 yrs) further confirmed the presence of RP. Deafness

phenotype of the family was syndromic in nature and all the four affected individuals

(III:4, IV:3, IV:4, and IV:5) were homozygous for six markers D11S4186, D11S1789,

D11S911, D11S937, D11S4166, and D11S918 on chromosme11 (Fig 3.2A).


- 94 -

21PKDF008A

1 2

2

3 4

1 3 4 5

76 852 431

8

212

212

212

212

212

221

9 10 11 1254

212

212

212

212

212

322

1 2 3 76

212

121

221

121

212

221

212

221

212

322

212

121

212

121

212

212

212

121

212

221

212

221

D11S4186D11S1789D11S4079

I

II

III

IV

V

1021

1 4

21

4

32

1

I

II

III

IV

D11S4186D11S1789D11S4079

PKDF161B

4 6

83 5

2

76 9

53

11

212

121

212

121

212

131

212

212

212

212

212

212

212

121

212

121

C

D

Fig 3.1 A. Pedigree drawing of PKDF008 along with haplotypes for markers on chromosome11. B. Pedigree drawing of PKDF161 along with haplotypes for

markers on chromosome11. C. Electropherogram illustrate homozygosity for a 640G>A transition mutation (G214R, Exon 7) in affected individuals of

PKDF008 and PKDF161 and homozygosity for the wild-type allele in an unaffected individual. D. Conservation of the glycine residue 214 in myosinVIIa

orthologues and the alignment of amino acids surrounding the mutation.


- 95 -

PKB1

PKB1, a small family enrolled from Multan having just two affected individuals

(II:2 and II:3) in a single loop. Six samples were available for the study in total i.e. 2

affecteds and 4 normals (Fig 3.2B). Severe to profound sensorineural HL was

segregating in family; moreover affected individuals (II:2 and II:3) had a history of night

blindness and vestibular dysfunction which indicated USH1 in this family. Family had a

syndromic phenotype and both the affected individuals (II:2, and II:3) were found

homozygous for six markers D11S4186, D11S1789, D11S911, D11S937, D11S4166,

and D11S918 bounding the region of USH1B (Fig 3.2B).

IN-FRAME DELETION MUTATION (495DELG) IN MYO7A CAUSES USH1B

Affected members of families PKDF189 and PKB1 linked to USH1B carry a

novel deletion mutation of G at 495th

base (Fig 3.2C), which truncates the protein after

169th

aminoacid residue (E166fsX170) and was not detected in 96 normal representative

DNA samples. This glutamate residue 166 in conserved in 14 myosinVIIa orthologues

(Fig 3.2D). Furthermore, haplotypesof both the families were alike (Table 3.1).

PKDF148

PKDF148 was enrolled from Rawalpindi (Punjab) with 3 affected (IV:1, IV:2,

and IV:3) and 3 normal (III:3, III:4 and IV:4) individuals and belongs to “Khokhar” caste

(Fig 3.3A). Severe to profound level of HL was observed on audiometry. Parents

informed that the oldest affected individual IV:1 (aged 10yrs) complains night vision

problem. Fundoscopy showed early signs of RP and demonstrate the presence of USH1

phenotype. All the three affected individuals (IV:1, IV:2, and IV:3) were found

homozygous for three markers D11S4186, D11S1789, and D11S4079 bounding the

region of USH1B (Fig 3.3A).

FRAME SHIFT MUTATION (L1046FSX1054) IN MYO7A CAUSES USH1B

Affected members of family PKDF148 were homozygous for a insertion of

cytosine between nucleotides 3135 and 3136 in exon25, encoding part of first MyTH4

domain of myosinVIIa (Fig 3.3C). 3513_3516 insC frame shift mutation truncates the

protein after 1053rd aminoacid residue (L1046fsX1054) and was not detected in 96

normal representative DNA samples. This leucine residue 1046 is conserved in all the

myosinVIIa orthologues (Fig 3.3E).


- 96 -

10654 9

2 3

21

1

41

72

I

II

III

IV

D11S4186D11S1789D11S911D11S937D11S4166D11S918

PKDF189

8

A

3 4 65

72 3

1

111213

221221

111213

111213

111213

221132

111213

111213

111213

111213

111213

111213

111213

111313

541

2

I

II

D11S4186D11S1789D11S911D11S937D11S4166D11S918

PKB1B

2 3

1

111213

131221

111213

232121

111213

111213

111213

111213

111213

232121

232121

131221

C

D

Fig 3.2 A. Pedigree drawing of PKDF189 along with haplotypes for markers on chromosome11. B. Pedigree drawing of PKB1 along with haplotypes for markers

on chromosome11. C. Electropherogram illustrate homozygosity for a 495delG mutation (E166fsX170, Exon 6) in affected individuals of PKDF189 and PKB1

and homozygosity for the wild-type allele in an unaffected individual. D. Conservation of the glutamate residue 166 in myosinVIIa orthologues and the

alignment of amino acids surrounding the mutation.


- 97 -

PKDF137

PKDF137, a highly inbreed family with three consanguineous marriages was

enrolled from Multan (Punjab) and was “Baloch” by cast. It had six affected individuals

(V:3, V:4, V:5, V:6, V:7, and V:8) in two sibships of 5th generation. Nine samples were

available for the study i.e. 6 affecteds and 3 normals (Fig 3.3B). Severe to profound

sensorineural HL segregated in family PKDF137 and all the affected individuals had

night vision and balance problem. Funduscopy of two affected individuals V:7 and V:8

(aged 22 and 25yrs) confirmed the segregation of RP in the family. Phenotype of this

family was syndromic in nature and all the affected individuals (V:3, V:4, V:5, V:6, V:7,

and V:8) were found homozygous for three markers D11S4186, D11S1789, and

D11S4079 bounding the region of USH1B locus (Fig 3.3B).

NONSENSE MUTATION (Q531X) IN MYO7A CAUSES USH1B

All the affected members were homozygous for a novel 1591C>T nonsense

mutation in exon14 of MYO7A (Fig 3.3D). Q531X nonsense mutation truncates the

protein prematurely in the motor domain and was not detected in 96 normal

representative DNA samples. Glutamine residue 531 is conserved in 10 myosinVIIa

orthologues (Fig 3.3E).

PKDF164

This single loop family was enrolled from Lahore with two affected individuals

IV:1, and IV:2 and belongs to “Arain” caste (Fig 3.4A). Audiometric analysis showed

that all the affected individuals had severe to profound HL. Gradual worsening of night

vision was reported by parent of the deaf individuals (aged 13 and 15 years); moreover

balance problem was also observed. Fundoscopy of the oldest affected confirmed the

presence of RP which was indicative of USH1 phenotype of the family. Both the

affected individuals were homozygous for three informative STR markers, while the

normal individuals (III:3, III:4, and IV:3) were obligate carriers. Haplotype analysis

established the linkage to USH1B (Fig 3.4A).

NONSENSE MUTATION (R972X) IN MYO7A CAUSES USH1B

Affected members of family PKDF164 linked to USH1B were homozygous for a

2914C>T nonsense mutation (R972X) in exon 24 (Fig 3.4C). Novel nonsense mutation

R972X causes the protein to truncate just downstream of the coiled-coil region and was

not detected in 96 normal representative DNA samples. This arganine residue 972 is

conserved in 8 of the myosinVIIa orthologues (Fig 3.4E).


- 98 -

PKDF142

PKDF142, a single loop family enrolled from Multan (Punjab) belongs to

“Rajput” caste. Pedigree was drawn up to 4th generations and only three affected

individuals (IV:2, IV:3 and IV:4) and two normal members (III:4 and IV:5) were

available for the study (Fig 3.4B). Audiometric analysis showed that all the affected

individuals had severe to profound level of HL. Oldest affected individuals IV:2 and

IV:3 (aged 11 and 10yrs) had a history of night blindness and abnormal vestibular

response indicating USH1 phenotype of the family. Haplotype analysis of the family

clearly showed linkage to USH1B locus as all the three affected individuals were

homozygous for screening markers D11S4186, D11S1789, and D11S4079. Father

(III:4) of deaf individuals was an obligate carrier while the normal sibling (IV:5) was not

even a carrier of the diseased allele (Fig 3.4B).

MISSENSE MUTATION (D437N) IN MYO7A CAUSES USH1B

All the affected individuals of PKDF142 were homozygous for a novel 1309G>A

transition mutation (D437N) in exon 12 of MYO7A (Fig 3.4D) which encodes part of

head domain of myosinVIIa (Fig 3.7). This missense mutation, D437N, is a residue of

the conserved switch II loop of the motor domain (Fig 3.4E) and was not detected in 96

normal representative DNA samples. D437 is equivalent to chicken skeletal muscle

myosin D465 and is conserved in all myosin reported till to date. Myosins with

mutations of D465 are nonmotile.

PKDF290

PKDF290, a large inbreed family enrolled from Rahimyar Khan had six affected

individuals in three loops and belongs to cast “Warya” (Fig 3.5A). Altogether 4 affected

individuals (IV:4, IV:5, IV:6, and IV:7) and 8 normal members (III:3, III:4, III:6, III:7,

IV:1, IV:3, IV:8 and IV:9) were enrolled. Affected individuals were severe to profound

deaf with a history of night vision problem and vestibular dysfunction. Fundoscopic

examination revealed early signs of RP confirming presence of USH1 phenotype in the

family. All the four affected individuals were homozygous for the seven STR markers

D11S4186, D11S1789, D11S4079, D11S911, D11S937, D11S4166, and D11S918

bounding DFNB2/USH1B region, seven unaffecteds members were obligate carriers

except individual IV:1 who is genetically normal (Fig 3.5A).


- 99 -

C

10

9

222

PKDF137B

21

4

21

4

3

D11S4186D11S1789D11S4079

5

3

2

8

7

43

1 2

222

112

1

95 6

86 73 51 42

I

II

III

IV

V

222

222

222

222

222

222

222

222

222

222

222

222

222

223

D E

A

4

21

2 3

4

I

II

III

IV

D11S4186D11S1789D11S4079

PKDF148

3

1

521 6

1 3 4

222

121

222

111

222

222

222

222

2 5 6

222

222

222

121

Fig 3.3 A. Pedigree drawing of PKDF148 along with haplotypes for markers of DFNB2/USH1B on chromosome11. B. Pedigree drawing of PKDF137 along with

haplotypes for markers on chromosome11. C. Electropherogram illustrate homozygosity for an insersion C between 3135_3136 base (L1046fsX1054, Exon 25)

in affected individuals of PKDF148 and homozygosity for the wild-type allele in an unaffected individual. D. Electropherogram illustrate homozygosity for a

1591C>T nonsense mutation (Q531X, Exon 14) in affected individuals of PKDF137 and homozygosity for the wild-type allele in an unaffected individual. E.

Conservation of the leucine residue 1046 and glutamine residue 531 in myosinVIIa orthologues and the alignment of amino acids surrounding the mutation.


- 100 -

C E

3

21

2 4

4

I

II

III

IV

D11S4186D11S1789D11S4079

PKDF164

2

3

1

5

5

21

A

6

1 3 4

222

112

222

231

222

222

222

222

222

112

D

B

6

2

21

1

31

3

I

II

III

IV

D11S4186D11S1789D11S4079

PKDF142

76

2 3

4

111

132

4

5

4 5

21

111

111

111

111

111

111

132

222


markers of DFNB2/USH1B on chromosome11. C. Electropherogram illustrate homozygosity for a 2914C>T nonsense mutation (R972X, Exon 24) in affected

individuals of PKDF164 and homozygosity for the wild-type allele in an unaffected individual. D. Electropherogram illustrate homozygosity for a 1309G>A

transition mutation (D437N, Exon 12) in affected individuals of PKDF142 and homozygosity for the wild-type allele in an unaffected individual. E.

Conservation of the arganine residue 972 and aspartic acid residue 437 in myosinVIIa orthologues and the alignment of amino acids surrounding the mutation.


- 101 -

SPLICE SITE MUTATION (IVS16 +1G>A) IN MYO7A CAUSES USH1B

Affected family members of PKDF290 were homozygous for a novel splice site

mutation IVS16 +1G>A (Fig 3.5C). This mutation was not detected in 96 normal

representative DNA samples. This splice site mutation is a transition of G>A at the

splice donor site of exon 16 and is predicted to cause exon skipping resulting in a

truncated protein, if synthesized at all (Maquat LE. 2004).

PKDF426

PKDF426 was enrolled from Okara (Punjab) with multiple affected individuals.

There were two consanguineous marriages and seven affected individuals in two

sibships. Sposuse III:1 was thought to be a distantly related cousin (Fig 3.5B).

Audiometric analysis revealed severe to profound HL in affected individuals. Parent

observed deteriorating night vision and vestibular function in affected individuals.

Funduscopic examination of IV:7 revealed RP signs and established the presence of

USH1 phenotype in this family. Phenotype of this family was found linked to three

markers D11S4186, D11S1789, and D11S4079 bounding the region of USH1B on

chromosme11 (Fig 3.5B).

SPLICE SITE MUTATION (IVS39 +1 G>A) IN MYO7A CAUSES USH1B

A novel splice site mutation IVS39 +1G>A (Fig 3.5D) was detected in deaf

individuals of family PKDF426 which was not detected in 96 normal representative

DNA samples. This splice site mutation is a transition of guanine to adenine at the splice

donor site of exon 39, which is predicted to use a downstream cryptic splice site leading

to a frame shift and truncation of the protein in the second MyTH4 domain.


- 102 -

FAMLIY LINKED TO DFNB2 PKDF034

PKDF034 is a large consangenious family having 6 deaf individuals from 4

sibships ranging in age from 15 to 48 years with no vision abnormality (Fig 3.6A). This

family was enrolled from Lahore and was “Gujjar” by cast. There was no history of any

other extra auditory phenotype in affected individuals of family PKDF034. However,

normal ENG of two oldest affected individuals (IV:3 and IV:4) and normal ERG of

affected family members aged 32 (IV:3), 36 (IV:2), 39 (V:8), 48 (IV:4) ruled out

vestibular abnormalities and further established the absence of retinal phenotype in this

family. All the five affected individuals (IV:2, IV:3, IV:4, V:8, and VI:5) were

homozygous for seven markers D11S4186, D11S1789, D11S4079, D11S911, D11S937,

D11S4166, and D11S918 bounding the region of DFNB2 while all the normal were

heterozygous for the diseased allele (Fig 3.6A).

DELETION MUTATION (5146_5148 DELGAG) IN MYO7A CAUSES DFNB2

Sequence analysis of MYO7A revealed a novel in-frame deletion of three

nucleotides 5146_5148delGAG, resulting in the loss of a glutamate at residue1716 (Fig

3.6B) in all the affected members of family PKDF034. All the normal hearing family

members were heterozygous for the wild type allele. This mutation was not detected in

180 representative, ethnically matched DNA samples. The glutamate at residue 1716 is

located in the tail region between the SH3 domain and the second MyTH4 domain (Fig

3.7). Furthermore, this glutamate is evolutionarily conserved among many myosinsVIIa

proteins (Fig 3.6C) with the exception of C. elegans where this residue is asparagines.

The loss of this glutamate residue of myosinVIIa is associated with profound HL in

family PKDF034 but does not alter retinal function.


- 103 -

C

D

21PKDF290A

21 54

1 72 63 4

89 1011 42 3 76

1112132

1113643

D11S4186D11S1789D11S4079D11S911D11S937D11S4166D11S918

I

II

III

IV

3

5

1112132

1111421

1112132

1113643

1112132

3335331

1112132

1111421

1112132

1112132

1112132

1112132

1112132

1112132

1112132

1112132

1112132

1113643

1112132

1113643

2221212

2334522

1

2 4

21

3

1

I

II

III

IV

D11S4186D11S1789D11S4079

PKDF426B

5

2 3

2

87

43

1

111

112

111

111

109

6 7

4 5 6

111

211

111

111

111

111

211

112


markers of DFNB2/USH1B on chromosome11. C. Electropherogram illustrate homozygosity for an IVS16 +1G>A splice site mutation (Exon 16) in affected

individuals of PKDF290 and homozygosity for the wild-type allele in an unaffected individual. D. Electropherogram illustrate homozygosity for an IVS39 +1

G>A splice site mutation (Exon 39) in affected individuals of PKDF426 and homozygosity for the wild-type allele in an unaffected individual.


- 104 -

PKDF034A

4

21

3

D11S4186D11S1789D11S4079D11S911D11S937D11S4166D11S918

32

1 2

1 4 9 105 6 7 8

321 4 875 6

85 764 91 2

65 72 41 3

I

II

III

IV

V

VI

1112213

1113121

1112213

1112213

1112213

1112213

1112213

1112213

1112213

1112214

1112213

2221322

1112213

1112213

1112213

2221322

1112213

2221322

B

C

3

Fig 3.6 A. Pedigree drawing of PKDF034 along with haplotypes for markers of DFNB2 on

chromosome11q13.5. B. Electropherogram illustrates homozygosity of a novel in-frame deletion of three

nucleotides 5146_5148delGAG (E1716del. Exon 37) in affected individuals of PKDF034 and

homozygosity for the wild-type allele in an unaffected individual. C. Conservation of glutamate at residue

1716 in myosinVIIa orthologues and the alignments of amino acids surrounding the mutation.


- 105 -

HAPLOTYPE ANALYSIS AND MYO7A ALLELES SEGREGATING

IN MORE THAN ONE FAMILY

Similar mutations 640G>A and 495delG were identified in two set of families

rising the probability that these families might have same founder alleles of MYO7A

segregating in them. To check this hypothesis two more STR markers (D11S5044 and

D11S5045) were designed flanking the MYO7A genes with the help of Primer3 web

server (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) and were

registered with GDB (http://www.gdb.org). Two affected individuals from each family

linked to DFNB2/USH1B region were amplified for three markers D11S5044, D11S5045

and D11S4186 and were simultaneously loaded on the ABI PRISM®

Genetic Analyzer

3100 to find the exact alleles and haplotypes of the families linked to DFNB2/USH1B.

The haplotype analysis and mutational screen of MYO7A in affected individuals

of eleven USH1B/DFNB2 families yielded 9 recessive mutant alleles of MYO7A. Out of

which 7 novel and 1 known recessive mutant allele of MYO7A is associated with

USH1B, while 1 novel recessive mutant allele of MYO7A is associated with

nonsyndromic deafness DFNB2. These mutations were found on 7 different haplotypes

(Table 3.1) and are distributed across the gene (Fig 3.7).

Postulate of having identical haplotypes for families carrying identical mutations

was confirmed (PKDF008 and PKDF161, PKDF189 and PKB1), indicating a common

ancestral origin of these families. On the contrary some families share analogous

haplotype but had different mutations e.g. PKDF148 and PKDF137, PKDF290 and

PKDF426 (Table 3.1). Occurrence of different mutation on the same haplotype may be

due to high frequency of these haplotypes in the population or these can be acquired de-

novo mutations at a later time after the haploype have been formed. It is also possible

that these families may show different haplotype if additional markers in close proximity

to gene or from intronic region are genotyped.


- 106 -

Families City Ethnic

Group Cast

D11S5044 δ

76468431 bp

D11S5045 λ

76646095 bp

D11S4186

76646142 bp

Nucleotide

Change

Protien

Effect Domain

PKDF008 Multan Punjabi Jadral 330 237 158 640G>A§ G214R Motor

PKDF161 Gujrat Punjabi Harjoay 330 237 158 640G>A§ G214R Motor

PKDF189 Lahore Punjabi Mailk 332 239 162 495delG ψ E166fsX170 Motor

PKB1 Multan - - 332 239 162 495delG ψ E166fsX170 Motor

PKDF142 Multan Punjabi Rajput 324 241 164 1309G>A ψ D437N Motor

PKDF164 Lahore Punjabi Araeen 330 239 162 2914C>T ψ R972X Post coiled-

coil domain

PKDF137 Multan Saraiki Balouch 330 243 164 1591C>T ψ Q531X Motor

PKDF148 Rawalpindi Punjabi Khokhar 330 243 164 3135_3136

insC ψ

L1046fsX

1054 MyTH4

PKDF290 R.Y Khan Sindhi Warya 324 237 158 IVS16 +1G>A ψ Frame shift Motor

PKDF426 Okara Punjabi - 324 237 158 IVS39 +1G>A ψ Frame shift MyTH4

PKDF034 Lahore Punjabi Gujjar 326 237 158 5146_5148del

GAG* E1716del

No known

domain

Table 3.1 Haplotype and Mutations of DFNB2/ USH1B families.

δ Primer sequence of D11S5044 (Forward: ACCAATTTGTCCTCCTACCACTAA, Reverse: TGGAAGAAAAAGTGCCCAAC)

λ Primer sequence of D11S5045 (Forward: TCCGATCAACATGTTTTCCA, Reverse: TGCACAGCTACCATTTGAGC)

§ Previously reported USH1B mutations. Ψ Novel mutations of USH1B reported in this study. * Novel mutation of DFNB2. Codon numbering starts with the first

in-frame methionine (accession number U39226). MYO7A is located at 76516957-76603931 bp on chromosome 11on the UCSC browser as of May 2004.


- 107 -

DISCUSSION Ten of the eleven families ascertained on the basis of HL actually have a type 1

usher syndrome, a diagnosis based upon ERG and /or fundus examination as well as

ENG testing. Eight mutations of MYO7A in the USH1B families are identified, six of

which are private mutations while a known mutation G214R is identified in two families

(Adato et al. 1997). Two missense, two nonsense, two frame shift and two splice site

mutations for USH1B were identified and are scattered throughout the gene (Fig 3.7).

About 4% of families analyzed during this study showed linkage to DFNB2/USH1B

locus which is comparable to my lab data (4.5%) and observed in more heterogeneous

populations as in USA and UK (Astuto et al. 2000, Petite C. 2001).

Family PKDF034 is segregating profound congenital NSHL without the evidence

of vestibular dysfunction or retinopathy. Furthermore, normal ERG of affected family

members aged 32 (IV:3), 36 (IV:2), 39 (V:8), 48 (IV:4) fortified the observation of a

normal retinal phenotype in this family. Late onset RP is unlikely since ERG of a 48

years old male (IV:4) in this family was normal. However, we cannot rule out a retinal

degeneration below the threshold of detection by ERG, which is the “gold standard” for

evaluating subtle degenerative changes of the retina. The mutation of MYO7A identified

in PKDF034 family is an in-frame deletion of three nucleotides (5146_5148delGAG),

which encodes a glutamate at residue1716 located inbetween SH3 and second MyTH4

domain. The loss of E1716 residue of myosinVIIa is associated with profound deafness

in family PKDF034 but doesn’t alter the retinal or vestibular function.

Till today three families have been reported to segregate nonsyndromic deafness

DFNB2. However, one of these families from Tunisia (Family D) was found to have a

balance problem and RP upon re-examination (Zina et al. 2001). The other two DFNB2

families (DFNB.01 and DFNB.05) are of Chinese origin. Family DFNB.01 has profound

congenital deafness and vestibular dysfunction. ERGs of two individuals, 25 and 27

years old, were reported to be normal (Liu et al. 1997; Liu 2002). Affected members of

DFNB.01 family are homozygous for R244P, which is an amino acid substitution in the

motor domain. R244P is equivalent to F277 of chicken skeletal muscle myosin and is an

arginine in some other myosins. Introduction of a proline at this residue is likely to

disable the motor domain and give rise to an USH1 phenotype. In the second Chinese

family (DFNB.05) affected individuals are profound deaf and show signs of vestibular

dysfunction. Affected individuals are compound heterozygous for a splice acceptor site


- 108 -

mutation (IVS3 -2A>G) in intron 3 and a T insertion mutation in exon 28 (V199insT)

leading to a frame shift and premature stop codon (Liu et al. 1997). These two mutations

of MYO7A reported for family DFNB.05 are both truncating and are consistent alleles of

MYO7A that are associated with usher syndrome.

In contrast to the DFNB.01 and DFNB.05 families described above, the affected

individuals of family PKDF034 have normal vestibular function based on an ENG

examination and there are no signs of RP based on ERG (Fig 3.8A-D and Table 3.2).

Also in contrast to typical USH1B patients (Fig 3.8F) and to the originally reported

nonsyndromic families, which have a profound HL across all frequencies (Liu 2002), all

affected members of PKDF034 have a residual hearing ability at low frequencies and

show a down-sloping audiogram from 75-80 dB thresholds at 250 and 500 Hz to >90 dB

at higher frequencies (Fig 3.8E). Taken together, these clinical data indicate that family

PKDF034 segregates nonsyndromic deafness.

Previously evidence for the genotype-phenotype relationship for the genes

associated with usher syndrome type1 at the USH1D/DFNB12, USH1C/DFNB18, and

USH1F/DFNB23 loci has been published (Bork et al. 2001, Ahmed et al. 2002, Ahmed

et al. 2003). Truncating or splice site mutations and some missense mutations of these

genes are associated with usher syndrome, whereas a few leaky splice site or missense

mutations are associated with nonsyndromic deafness. It is anticipated that might be the

residual protein function of harmonin, cadherin23, protocadherin15 or myosinVIIa is

sufficient for normal vision. Testing of these hypotheses will require development of

functional assays for each of these proteins. Such an obvious genotype-phenotype

correlation is difficult to predict for MYO7A mutant alleles due to insufficient number of

DFNB2 families however in-frame single amino acid deletion reported herein for

DFNB2 family in a post domain region might do not dysfunction the protein completely

and retina seems to be more tolerant for this milder MYO7A allele than organ of Corti.

Exploring the nature and location of the DFNB2/USHIB mutations provides an

insight into the molecular basis of this disorder and the diversity of mutations in

Pakistani population. It is concludes that USH1B represents a major portion of USH1 in

a cohort from Pakistan, which is associated to variety of mutations of MYO7A. Family

PKDF034 provides convincing evidence of the existence of nonsyndromic recessive

deafness, DFNB2. However the DFNB2 phenotype makes only a minor contribution to

families segregating HL with mutations in MYO7A.


- 109 -

COILED COIL

MOTOR HEADDOMAIN SH3NH2 COOH

Q531X

G214R R972XdelE1716D437N

2118 36 42373024

IVS16+1 G-A IVS39+1 G-A

27

L1046fsX1054E166fsX170

Table 3.2 Comparison of molecular genetics and clinical findings in three reported nonsyndromic families and in family PKDF034 linked to DFNB2.

Fig 3.7 Schematic presentation of the domain organization of myosinVIIa, along with mutations found in DFNB2/USH1B families. Mutation in purple is of

DFNB2 family (PKDF034), highlighted are novel USH1B mutations while other is reported earlier.

Family/

Ethnicity

Mode of

Inheritance

Mutation/

Domain

Auditory

phenotype

Age of onset

of hearing

loss

Vestibular

dysfunction

Retinopathy/age

at the time of

ERG

Reference

PKDF034/

Pakistani Recessive

E1716del in-frame/

no known domain

75-80 dB at 250-

500 Hz >90 dB

at 1000-4000 Hz

Congenital Absent Absent/ 32,36,39 and

48 years This study

Family D/

Tunisian Recessive M599I/ motor 65-100 dB Birth-16years Present Present/ 25-65 years

Zina et

al.2001

DFNB.01/

Chinese

Recessive/

semidominant R244P/ motor

>90 dB at 500-

8000 Hz Congenital Present

Absent but data not

shown/ 25-27 years

Liu et al.

1997

DFNB.05/

Chinese Recessive

IVS3-2A>G/ motor

Val1199insT/ FS

MyTH4

>90 dB at 500-

8000 Hz Congenital Present

Absent but data not

shown/ 28,33 years

Liu et al.

1997


- 110 -

Fig 3.8 (A-D) Normal ERG waves for four of the affected individuals of family PKDF034. A is IV:3, age

32 years, B is IV:2, age 36 years, C is V:8 age 39 years, D is IV:4 age 48 years. (E-F) Audiograms of left

and right ears from two affected members of family PKDF034 and one affected member of USH1B family

respectively. Symbols , represents right and left ears of individual IV:2 of family PKDF034

respectively. Symbols , represents right and left ears of individual IV:4 of family PKDF034

respectively. Symbols , * represent right and left ears of an affected from PKDF008.


- 111 -

SECTION-II

EXCLUSION STUDIES FOR

KNOWN DEAFNESS LOCI

AND MAPPING OF TWO

NOVEL DEAFNESS LOCI

DFNB51 & DFNB56


- 112 -

PREMABLE Deafness transmitted as recessive trait is the most frequent cause (77-88%) of

hereditary HL. It can occur with other pleiotropic manifestations to form a

recognized phenotype (syndromic hearing loss, SHL) or appear in isolation

(nonsyndromic hearing loss, NSHL). Nonsyndromic autosomal recessive deafness is

usually clinically homogeneous and exhibits a non progressive, severe hearing

phenotype (Van Camp et al. 1997). As expected from the structural and functional

complexity of the inner ear, sensorineural deafness exhibits a high degree of genetic

heterogenity; presently there are about 41 loci for nonsyndromic autosomal recessive

deafness reported in peer-reviewed journals, and twenty two of the causative genes

have been identified through positional cloning efforts (Hereditary Hearing Loss

Homepage, http://www.uia.ac.be/dnalab/hhh). Pakistani population offers a powerful

genetic resource for mapping and identifying novel deafness loci due to high

consanguinity (Hussain and Bittles 1998, Jaber et al. 1998, Elahi et al. 1998).

Fifty families with three or more affected individuals in a single or multiple

sibships were enrolled through schools for deaf children from different cities of

Punjab, Sindh, and Balochistan, out of them twenty families were selected for further

studies. Linkage analysis studies for all the known recessive deafness loci except

DFNB2 were performed on 17 families (3 families; PKDF008, PKDF290, and

PKDF426 were found linked to DFNB2 in priority screening for authentic DFNB2

families) by typing at least three STR markers. If the deafness phenotype in a family

showed potential linkage to a known locus, all the members of that family were

genotyped for those markers as well as additional markers to confirm the results.

Two families each to DFNB4 and DFNB12 were found linked during the exclusion

studies. Thirteen families remained unlinked to known loci; further augmenting the

conjecture that a large repertoire of human genes associated with deafness remains to

be mapped and identified (Friedman and Griffith 2003). This genetic heterogeneity of

deafness is further established by my lab data which represents that more than 50% of

the families segregating deafness remain unlinked to known loci (Unpublished).

All the thirteen families which remained unlinked during exclusion studies

were an excellent genetic resource to map novel deafness loci and genes. Genome

wide scan was planned on seven selected families as an advancing step to map novel

deafness loci. Panels 1 to 27 of the ABI PRISM®

Linkage Mapping Set version 2.5


- 113 -

MD10 containing 388 fluorescently labeled microsatellite markers spaced at an

average interval of 10 cM across the human genome was used for genome wide scan

(Fig 3.9). For intervals in which a single informative marker was homozygous, the

entire family was retyped for the same marker as well as additional closely spaced

markers to distinguish between a false positive and a real positive chromosomal

interval in which the new DFNB locus resides. Two-point and multi-point linkage

analysis was performed after calculating allele frequencies for microsatellite markers

by genotyping ninety randomly selected normal individuals from the same population.

Two novel loci DFNB51 and DFNB56 (as designated by HUGO Gene

Nomenclature Committee) were mapped on two sets of families. First novel locus

DFNB51 was mapped to chromosome 11p13-p12 in two consanguineous families

PKDF240 and PKDF407 (Fig 3.12) while two more consanguineous families

(PKDF637 and PKDF223) segregating recessively inherited, profound congenital

deafness helped to map another novel locus DFNB56 to chromosome 3q13.31-q21.1

(Fig 3.15). No other clinically allied feature was observed in all the four families

except deafness. Two hundred and fifty families segregating deafness from the

CEMB repository were screened for both the loci (DFNB51 and DFNB56) but

unfortunately no more family was found linked with these loci, perhaps both these

loci are rare in Pakistani population. No visual homozygosity was found in three

families on genome scan. Probably, due to slippage of small linkage interval between

the two markers placed apart. Every new discovery in the auditory system unveils

new molecular mechanisms of hearing impairment. Similarly DFNB51 and DFNB56

are two new discoveries in the fascinating biology of the auditory system and

hopefully both will bring us one step closer to transform the silence into sound.

RESULTS OF EXCULSION STUDIES

FAMILIES LINKED TO DFNB4 PKDF278

Family PKDF278 was enrolled from Tundo Muhammad Khan (Sindh) and

belongs to“Jaskani”caste. It is a highly in-breed family having eight consanguineous

marriages and six affected individuals dispersed in four generations (Fig 3.10A). A

total of five members of the family were available, including three affected (IV:2,

IV:3, and VI:2) and two normal (V:5 and VI:1) individuals. Audiometric studies on


- 114 -

the affected individuals, showed severe to profound level of HL and no vestibular or

retinal dysfunction was observed. The haplotype of the entire family PKDF278 was

found to be linked to DFNB4 locus at chromosome 7q31. The affected individuals

IV:2, and VI:2 were homozygous for markers D7S2420, D7S2459 and D7S2456

while IV:3 gave a telomeric recombination at D7S2456, present out side the SLC26A4

gene (Fig 3.10A). This chromosomal region harbors two overlapping loci i.e. DFNB4

and Pendred syndrome. Since no symptoms of goiter were observed in the affected

members of the family, so PKDF278 was considered to be linked with DFNB4.

MUTATIONAL ANALYSIS

Mutational analysis of SLC26A4 gene was performed as previously described

(Everett et al. 1997). A reported transition mutation 716T>A (Fig 3.10C) was

identified in all the affected individuals (Park et al. 2003). This missense mutation

replaces valine at 239th

residue with aspartic acid and is conserved in seven

orthologues of pendrin (Fig 3.10E).

PKDF453

This family had four affected individuals in two consanguineous sibships.

PKDF453 was enrolled from Sahiwal (Punjab) and belongs to “Arain” caste.

Affected individuals appeared in fourth generation and only three affected (IV:2,

IV:3, and IV:4) and two normal siblings (IV:1 and IV:5) were available for the study

(Fig 3.10B). Audiometric studies on the affected individuals, showed severe to

profound level of HL and no vestibular or retinal dysfunction is observed. Haplotype

analysis of the five siblings revealed its linkage to DFNB4 locus at chromosome 7q31.

All the affected individuals IV:2, IV:3 and IV:4 were homozygous for markers

D7S2420, D7S2459 while normal individuals IV:1 and IV:5 were absolutely normal

and carrier of the affected allele, respectively (Fig 3.10B). No symptoms of goiter

were observed in the affected members of the family, thus PKDF453 was considered

linked to DFNB4.

MUTATIONAL ANALYSIS

A transition mutation 1337A>G (Q446R) in exon 11 of SLC26A4 gene was

identified in all the affected individuals of PKDF453 (Fig 3.10D), which replaces

glutamine to arginine and is conserved in six orthologues of pendrin (Fig 3.10E).


- 115 -


- 116 -

Fig 3.9 Schematic representation of the ABI PRISM® Linkage Mapping Set version 2.5. Bolded are

the markers of MD10 panel set arranged 10 cM apart, while plain are markers of HD5 panel set

arranged 5 cM apart.


- 117 -

21

PKDF278A

9

1 2 43

222

313

D7S2420D7S2459D7S2456

43

5

65

6

5 62 3 4

2 3 4

1

1 8765

1 32 4 875 6

31 2

222

222

222

122

222

222

222

221

I

II

III

IV

V

VI

3

21

2

1

I

II

III

IV

PKDF453B

3

5

61 3 54

42

1 2

7

6

87

D7S2420D7S2459D7S2456

113

122

214

213

214

213

214

213

122

131

C D

E


markers of DFNB4/PDS on chromosome7. C. Electropherogram illustrate homozygosity for a 716T>A missense mutation (V239D, Exon 6) in affected

individuals of PKDF278 and homozygosity for the wild-type allele in an unaffected individual. D. Electropherogram illustrate homozygosity for a 1337A>G

transition mutation (Q446R, Exon 11) in affected individuals of PKDF453 and homozygosity for the wild-type allele in an unaffected individual. E.

Conservation of the valine residue 239 and glutamine residue 446 in pendrin orthologues and the alignment of amino acids surrounding the mutations.


- 118 -

FAMILIES LINKED TO DFNB12 PKDF176

PKDF176 was a single loop family collected from Kasur (Punjab) and belongs to

“Arain” cast with three affected individuals (IV:3, IV:4, and IV:5). At the time of

enrollment, three affected individuals aged between 20-25years and two normal

members (III:3 and IV:6) were available (Fig 3.11A). Audiometric assessment revealed

severe to profound level of HL in all the affected individuals. Clinical examination ruled

out presence of any extra auditory phenotype in affected individuals of PKDF176,

demonstrating that deafness is segregating as a nonsyndromic trait in this family. The

deafness phenotype of this family was found linked to DFNB12 locus on chromosome

10q21-q22. All the three affected individuals (IV:3, IV:4, and IV:5) were homozygous

for three markers D10S606, D10S1694 and D10S1432 (Fig 3.11A). DFNB12 is an

overlapping locus with USH1D, as there were no symptoms of retinitis pigmentosa in

affected individuals of family PKDF176, establishing its linkage to DFNB12. A

maximum two-point LOD score of 2.3 at θ=0 was observed for markers D10S1694 and

D10S1432 in family PKDF176.

PKDF177

PKDF177, a single loop family with two affected individuals (IV:3, and IV:4)

was collected from Kasur (Punjab) and belongs to “Ansari” cast. Two affected

individuals aged 14 and 11years along with two normal members (III:3 and IV:5) were

only available at the time of enrollment (Fig 3.11B). Audiometric assessment revealed

severe to profound level of HL in both the affected individuals. Although there was no

history of RP, it was difficult to rule out RP phenotype in affected individuals as they

were too young. The haplotype of the affected individuals of this family showed linkage

to DFNB12 locus on chromosome 10q21-q22. Both the affected individuals (IV:3, and

IV:4) were homozygous for three markers D10S606, D10S1694 and D10S1432

bounding the DFNB12/USH1D locus (Fig 3.11B). Since, no symptoms of RP appeared

in affected individuals of family PKDF177 yet, it was considered to be potentially linked

to DFNB12 with a maximum two-point LOD score of 1.5 at θ=0 on markers D10S606

and D10S1694.


- 119 -

A

221

111

4

21

2

3

1

I

II

III

IV

PKDF177

4

61 3 54

32

21

6 7

D10S606D10S1694D10S1432

5

7

221

111

221

221

221

221

B

4

21

2

3

1

I

II

III

IV

PKDF176

4

61 3 54

32

21

6

D10S606D10S1694D10S1432

5

7

211

123

211

211

211

211

211

211

123

132

Fig 3.11 A. Pedigree drawing of PKDF176 with haplotypes for markers on chromosome10. B. Pedigree

drawing of PKDF177 with haplotypes for markers of DFNB12/USH1D on chromosome10.


- 120 -

RESULTS OF GENOME WIDE SCAN

DFNB51, MAPS TO CHROMOSOME 11P13-P12 A novel locus DFNB51 was localized to chromosome 11p13-p12 following a

whole genome wide scan in two consanguineous families PKDF240 and PKDF407

segregating recessively inherited, profound congenital deafness (Fig 3.12). Haplotype

analysis of affected individuals in family PKDF240 mapped the gene distal to D11S4200

(42.55 cM) and proximal to D11S1279 (50.88 cM), delineating a genetic interval of

approximately 8.3 cM (Sheikh et al. 2005). A maximum two-point lod score of 3.5 and

2.5 for markers D11S4102 and D11S935 at recombination fraction θ=0 was obtained for

families PKDF240 and PKDF407, respectively (Table 3.3). Several good candidate

deafness genes reside in the DFNB51 interval including CD44, SLC1A2, RAMP, TRAF6

and NGL-1 (Fig 3.14). The mapping of DFNB51 is part of our saturating search for

human genes that are necessary for the development of the inner ear and the maintenance

of normal hearing. Below is the detailed description of the families that helped to map

this novel locus DFNB51.

PKDF240

PKDF240, a highly inbreed family with five consanguineous marriages was

enrolled from Hyderabad (Sindh) and belong to “Qureshi” caste (Fig 3.12A). There

were ten affected individuals in three loops, out of which seven affected and six normal

members were enrolled for detailed study. Multiple individuals were interviewed to

acquire the clinical history of the family and to draw a detailed pedigree up to seven

generations. However, spouses V:1 and VI:3 are thought to be distantly related cousins

and their relationship could not be confirmed. The affected individuals range in age

from 4 years to 42 years. The first affected individuals appeared in the 6th generation

i.e. three affected siblings (VI:4, VI:5, and VI:6). All affected individuals of family

PKDF240 exhibited prelingual bilateral profound sensorineural HL, with no obvious

vestibular or ocular abnormalities. Representative audiometric profiles of affected

individual (VII:3) of family PKDF240 is shown in Fig 3.13A. Moreover, no other

medical problem was found cosegregating with the deafness.


- 121 -

3

I

II

III

IV

PKDF407 1 2

5

5

8

7

4 61 2

31 2 4 6 7

4 652 31

D11S915 30.88cMD11S904 33.57cMD11S914 37.62cMD11S907 42.55cMD11S4203 45.94cMD11S935 45.94cMD11S4102 47.61cM

9 11101 32 54 6 87

1313313

2121212

2343211

2233121

1313313

2233121

1313313

2233121

1313313

2121212

1313313

2233121

1313313

2233121

2232431

2133121

2121212

2133121

2232431

2343211

2232431

2121212

1313313

1313313

2213313

2213313

2233121

2233121

2233121

2233121

2233121

2233123

2232431

2233123

1313313

2121212

2233121

2232431

V

B

11765 8 10

4

12 13

3 4

32 5

1 4

21

1

32

61

1 4

1 2 43

2 3

2

1 2 3 4 5 6 7 9 10 118

I

II

III

IV

V

VI

VII

VII

D11S4200 42.55cMD11S935 45.94cMD11S4102 47.61cMD11S5041D11S5042D11S5043D11S1279 50.88cM

PKDF240

2111212

3111211

2111213

1222113

2111213

3111211

2111213

2111212

2111213

3111212

1111213

2111212

2111213

3111211

2111213

2111212

1222113

3111211

1222113

2111212

1222113

2111212

1222113

2111212

1222113

2111212

9

A

Fig 3.12 Pedigrees of families PKDF240 and PKDF407 segregating recessive deafness with haplotypes of

markers at 11p13-p12. Filled and clear symbols represent affected and unaffected individuals, respectively.

The core haplotypes are boxed representing the ancestral chromosome harboring DFNB51. A Haplotypes

of PKDF240 revealed a 8.33 cM interval delimited by markers D11S4200 and D11S1279. Spouses V:1

and VI:3 are thought to be distantly related cousins; however their relationship could not be confirmed. B

Haplotypes of PKDF407 showing a homozygous region of 14.04 cM delimited by markers D11S904 and

D11S4102. The STR markers and their relative positions in centiMorgan (cM) according to the Marshfield

human genetic map [http://research.marshfieldclinic.org/genetics] are shown on the left side of the each

pedigree.


- 122 -

HAPLOTYPE ANALYSIS

Genome wide linkage analysis of family PKDF240 showed initial evidence of

linkage at marker D11S935 on chromosome 11p13-p12. In order to fine map and

confirm the linkage six additional STR markers (D11S4200, D11S4102, D11S5401,

D11S5402, D11S5403, and D11S1279) were genotyped for all participating family

members. Haplotype analysis revealed a homozygous region of 8.33 cM (Fig 3.12A),

delimited by markers D11S4200 (42.55 cM) and D11S1279 (50.88 cM). The

centromeric recombination at D11S4200 was given by individuals VI:6, VII:3, VII:5,

VII:7, and VII:8 while distal recombination at D11S1279 was provided by individuals

VI:6, VII:3, VII:4, VII:5, VII:6, VII:7, and VII:8. A maximum multi-point lod score of

3.8 was obtained at marker D11S4102, while a two-point lod scores (Z max) of 3.5 at

recombination fraction θ=0 was obtained at D11S4102 (Table 3.3).

PKDF407

Family PKDF407 had only three affected individuals in a single loop though

highly inbreed with five consanguineous marriages. It was enrolled from Rawalpindi

and belongs to “Rajput Janjua” caste (Fig 3.12B). Detailed pedigree up to five

generations was drawn and a total of eighteen affected and unaffected members were

enrolled from three generations. Affected individuals (V:6, V:7, and V:8) appeared in

the 5th generation and aged in range of 10 to 15 years. All affected individuals of family

PKDF407 showed prelingual bilateral profound sensorineural HL, with no obvious

vestibular or ocular abnormalities. Representative audiometric profiles of affected

individual (V:6) of family PKDF407 is shown in Fig 3.13B. No extra auditory

phenotype was observed in all the affected of PKDF407 after complete clinical.

HAPLOTYPE ANALYSIS

For deafness segregating in family PKDF407, evidence of linkage, although not

rising to statistical significance (Z max of 2.5 for D11S935 at θ=0, Table 3.3), was found

between markers D11S914 (37.62 cM) and D11S935 (45.94 cM) following a genome

wide scan. Multi-point linkage analysis yielded a lod score of 2.6 at marker D11S935.

After typing additional STR markers in the linkage region, haplotype analysis revealed a

homozygous region of approximately 14.04 cM (Fig 3.12B) flanked by markers

D11S904 (33.57 cM), a proximal boundary defined by normal hearing individual V:5

and D11S4102 (47.61 cM) a telomeric break point given by individual V:8.


- 123 -

BA-10

0

10

20

30

40

50

60

70

80

90

100

110

120

FREQUENCIES FREQUENCIES

-10

0

10

20

30

40

50

60

70

80

90

100

110

120

Table 3.3 Two-Point Lod Scores

Some markers in the region of homozygosity were not fully informative, thus

yielding reduced positive lod scores. For both families mapped to DFNB51, none of the

markers on other chromosome region gave lod score greater than 2.0.

Fig.3:13 Pure tone air (O, X right and left ear, respectively) audiograms. A Affected individual VII:3 (12

years) of PKDF240. B Affected individual V:5 (15 years) of PKDF407. The observed threshold in all deaf

subjects showed severe-to-profound hearing loss.

Z max at θ = 0

Markers

Marshfield

Map

Position

(cM)

PKDF240 PKDF407

D11S915 30.88 - - ∞

D11S904 33.57 - - ∞

D11S914 37.62 - 2.18

D11S907 42.55 - 0.23

D11S4200 42.55 - ∞ -

D11S4203 45.94 - 2.28

D11S935 45.94 3.38 2.50

D11S4102 47.61 3.50 - ∞

D11S5041 3.09 -

D11S5042 3.38 -

D11S5043 0.44 -

D11S1279 50.88 - ∞ -


- 124 -

Chr 11

cM

30.88

33.57

37.62

42.5542.55

45.9445.94

D11S904

D11S915

D11S914

D11S907D11S4200

D11S4203D11S935

47.61

50.88

D11S4102

D11S5041

D11S5042

D11S5043

D11S1279

MMRP19PDHX

CD44

SLC1A2

RAMPAF370388

FJX1TRIM44AF274942LOC143458

AK098257

FLJ45212COMMD9FLJ14213BC008922

TRAF6BC037344

BC008922

RAG1RAG2LOC1197AK127441NGL-1

Fig 3.14 Schematic representation of the DFNB51 interval on chromosome 11p13-p12 showing STR

markers (�) and meiotic recombinations (X). Solid vertical lines represent the genetic intervals in which

affected individuals are homozygous for the STR markers. Based on analyses of family PKDF240,

DFNB51 resides in a critical interval of approximately 8.33 cM, delimited by D11S4200 (42.55 cM) and

D11S1279 (50.88 cM). There are 23 genes annotated in the DFNB51 interval (UCSC Genome Browser,

http://genome.ucsc.edu). Genes in the 5.06 cM DFNB51 interval are shown in bold font. Genes that are

highlighted were sequenced and no mutation was found. Gene symbols were approved by the HUGO Gene

Nomenclature Committee (Povey et al. 2001).


- 125 -

SEQUENCING OF SOME OF THE IMPORTANT CANDIDATE

GENES OF DFNB51

Cloning and identification of the causative gene has always been a daunting task,

as mapped regions are usually very large for positional cloning efforts. For that reason

two methodologies are normally adopted; one way is to have another family with a

different recombination event than the original family to reduce the linkage interval, or to

screen candidate genes for mutations on the bases of their putative functions.

Approximately 21 genes reside in the DFNB51 interval (5.06 cM) including good

candidates such as CD44, SLC1A2, RAMP, and TRAF6 while 3 additional genes are

present in larger region (8.33 cM) given by PKDF240 (Fig 3.14). Moreover, GeneScan,

Geneid and TwinScan softwares predict approximately 19 more genes.

As part of our still on going search for the causative gene of DFNB51, both the

strategies were conducted simultaneously. Firtstly 250 consanguineous families from

CEMB repository were screened for linkage to DFNB51 but no more family was found

linked; perhaps it is a rare locus in Pakistani population. Secondly, three potential

candidate genes SLC1A2, TRAF6, and RAMP were sequenced. Primers were designed

using Primer3 site (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi),

for all the three genes (Table 3.5, Table 3.6, and Table 3.7). Coding regions of these

genes were sequenced in a deaf and an unaffected individual from both families used to

map DFNB51. No potentially causative variants were identified however six known

SNP’s and 1 novel SNP is identified which further demonstrate that the two alleles of the

families PKDF240 and PKDF407 are different from each other (Table 3.4).

Table 3.4 SNP’s identified in SLC1A2, TRAF6, and RAMP.

* Deaf Individual § Normal Individual

† IVS4 -36 T/C ‡ G885A-Exon5 ‼ T915A-Exon5

≈ T916A-Exon5 £ A1504G-Exon 8 α IVS2 -8 ins T γ G1409A-Exon8

All polymorphism are listed in UCSC Genome Browser except α which is novel to this report.

Family I.D SLC1A2 TRAF6 RAMP

T/C † G/A‡ T/A‼ T/A ≈ A/G £ ins T α G/A γ

VI: 6* T G T T G T G PKDF240

VI: 7§ T G T T G T G

V: 8* T G T T G - G PKDF407

IV: 3 § T G T T G - G


- 126 -

Table 3.5 Primer sequences for SLC1A2 exons.

§ Exon11 is 9KB big and starting few bases code for protein so primer is designed for the coding region

Table 3.6 Primer sequences for TRAF6 exons.

Table 3.7 Primer sequences for RAMP exons.

Exon Forward Primer Reverse Primer

Product

Size

(bp)

1 CCGCAGCAAAGCACAGGT CGCCTCTCTATCCGCATCC 479

2 GTCGAGCCCCTGAAACTGTA CCCACAGAGCCAGGAGAGT 271

3 GTCTAGAGTAAGTCATTTGACGAAGG TAAAAGCCAGGGCAGGAGTA 275

4 CGTCATAGAAATGTAGACACAGGTC AAAATACTCTTAAGTTATCGCCTTGA 399

5 TTGTTAACCTGTTGGGAACCTT GAAAAGGGAGTGCAGGATAGC 343

6 TGGCTCCATACATTGGGAAT AGCCCATGCCAACTTTTTC 319

7 CAGAAGAGCCAAGCGTTTTC GCAAAGAGGGCAAAAGAGTG 391

8 TGCAGTGGCATTCCAGTTT GGCCTCTGTCACATGGAGTT 354

9 CCAGGGTTGGTTTTGCTAAG GCCATGGGGATTAGCTAAGAT 299

10 TCCTCACTGAACCTTTTCTGTTC ATACATGCAGGGCTTTACGG 359

11§ CTTGGATTTGGTGCTTCTCC AAGCCTCGGCTAACAGATTAAG 295


Product

Size

(bp)

1 GATATATATGTGTGGGGTGTGAGTG TGTAAGACTACTTTTGGGATGTTCC 483

2 TTGTTTGGATTTTCTAATGTGAGTCT CATGTGCTAACAGCTAGAAAAGAAC 244

3 GCTTATATGTAGAAGACTTCAGAGTTGG ACCCCCTCAAGTACACATTTAAGA 292

4 TCAAAATTAGTTGTTTTCACTTTTTCA TCAATCTGTATTTCTTTGCCTTATTG 247

5 TAAATGTGATCGCATCAAACTAGAA CTCACAGCATCCATGAATAACTCTA 295

6A CCTTTTCCTACTCCTCACGGTAT AGTCGGTAACTGAAGGTGCAAG 499

6B AGGAGAAACCTGTTGTGATTCATAG CTTGTTTGTTTGCATGTTATTGAGA 549


Product

Size

(bp)

1 CTCCCTGGGTCCCTCCTCTC CCCAGGAGGAAAATGCTCCC 196

2 TCTTACCACTCCCTGCCAGGAC GTTCAGCCTGTTCCTGTTCATTACC 299

3 GATCAGAACTCGCAGGTGCTTTG GGAGATAAATTTTGGTCCATTGTAAGC 265

4 GGTGTGGCATGTGCTCAAAGTC GGCTCCAATATACAAAGGCTCCAG 318

5 CTTGAATGAGCCCAGCGGTC CATGGAAAGGAGATATTTATCTGGAGC 356

6 CAAGACTCTGGGCCTGAAGACATC TCTTAAAATCCTTCCATACCAGCCC 240

7 TGATTTTCAGTCTTGCCTTCTGTCTTAG AGAGCTCTCCCACCCTCCTTCTG 219

8 TCTTTTGAGCACCAGATCCTATATC GCTACCAAAAAGTCTAGCAACTTCA 396

9 CACCTGGTGTCCAGAAGTGGG AAGGGGAATGGAAGGGGAAATACTC 233

10 TGGGTAGTAAGGTTAAGCCAAAGGAAA TGGAGTGAGGGACAGAGGGAGA 599

11 CTCCTTTGGATGGCAAAGTCTGAG GGTATAATCACTGCTCTCCCGTGC 426

12A AAAATTTAGCTCCAAGCCTTGTCTG AGATATCAGAAGGGGCAGTGGGTTC 438

12B GCTTCAAGAACGACACACTGCG CGCAATGACACACGTACAGACG 394


- 127 -

DFNB56, MAPS TO CHROMOSOME 3Q13.31-Q21.1 The disease gene for a novel locus, DFNB56, was localized in two families

PKDF637 and PKDF223 segregating NSHL as an autosomal recessive trait through a

genome scan to chromosome 3q13.31-21.1 (Fig 3.15). A maximum two-point lod score

of 4.84 and 3.16 for markers D3S4523 and D3S1267 at recombination fraction θ=0 was

obtained for families PKDF637 and PKDF223, respectively (Table 3.8). Recombination

events in affected individuals mapped the gene distal to D3S2460 (134.64 cM) and

proximal to D3S1267 (139.12), delineating a genetic interval of 4.48 cM. SLC15A2,

UPK1B, CASR, and IQCB1 are among the candidate genes in the DFNB56 interval (Fig

3.17). Below is the thorough description of the families used to map this novel locus

DFNB56.

PKDF637

Family, PKDF637, an extremely inbreed family had five consanguineous

marriages and four affected individuals (VI:1, VI:6, VI:7, and VI:8) in three sibships

(Fig 3.15A). It was enrolled from Khuzdar (Balochistan) and belongs to “Badini” caste.

Perhaps due to strict social customs, family members rarely marry outside the family.

Multiple family members were interviewed to construct the pedigrees up to six

generations and all together thirteen samples from both affected and normal members

were collected for a comprehensive study. All affected individuals from the families

PKDF637 exhibited prelingual, bilateral, profound, deafness, with no vestibular

symptoms and retinitis pigmentosa (RP). No other extra auditory phenotype was found

co-segregating with the deafness after through clinical evaluation.

HAPLOTYPE ANALYSIS

Preliminary evidence of linkage in family PKDF637 was shown on chromosome

3q13.31-q21.1 by marker D3S4523 during a genome wide search. Additional eight

markers lying proximal and distal to D3S4523 were genotyped for all participating

members of the family PKDF637. Haplotype analysis revealed a region of

homozygosity of approximately 9.4 cM (Fig 3.15A), delimited by markers D3S1278

(129.73 cM) and D3S1267 (139.12 cM). The proximal recombination at D3S1278 was

provided by individual VI:8, while individual VI:1 provided the distal break point of the

critical linked region at D3S1267 (139.12 cM). A maximum two point lod score (Z max)

of 4.84 at recombination fraction θ=0 was obtained at D3S4523 (Table 3.8).


- 128 -

D3S1278 129.73cMD3S1558 133.93cMD3S2460 134.64cMD3S1303 136.32cMD3S4523 138.00cMD3S1267 139.12cMD3S1269 139.65cMD3S1589 141.79cMD3S3606 143.94cM

2 3

3

I

II

III

IV

VI

V

21

PKDF637A 1 2

21

4 53 6

5

7 8

2 31 4 7 85 6

1 3 54 6

5 6 71 4 9 108 11

4 6

2

321141112

413325422

321141134

133413233

321141134

321145422

321141134

413325422

321141134

413325422

321141112

133413234

321141134

522622231

321141134

321141134

321141134

433222134

321141134

243534322

121141134

321141134

321141134

321141134

321141134

133413233

I

II

III

IV

1 2

2

3

21 3 87

5

PKDF223B

1 8 9 10

10

3 41

3 4

6 7

5 62 4 7

4 5 6 9

D3S1278 129.73cMD3S1558 133.93cMD3S2460 134.64cMD3S1303 136.32cMD3S4523 138.00cMD3S1267 139.12cMD3S1269 139.65cMD3S1589 141.79cMD3S3606 143.94cM

111215322

122213124

111215323

332121122

123214411

221232222

332121122

123214411

122213124

332121122

111215323

122213124

111215323

122213124

311215323

122215322

111215323

111215324

111215322

111215323

332121122

111215322

332215323

122213124

332121323

122213124

332121122

111215322

123214411

221232222

111215323

332121122

Fig 3.15 Pedigrees of families PKDF637 and PKDF223 segregating recessive deafness with haplotype of

markers at 3q13.31-q21.1. Squares or circles filled with black symbolize individuals affected with NSHL.

The core haplotypes are boxed representing the ancestral chromosome harboring DFNB56. A Haplotypes

of PKDF637 revealed a homozygosity of approximately 9.4 cM delimited by markers D3S1278 and

D3S1267. Affected individual VI:8 provided the centromeric break point at marker D3S1278 while

affected individual VI:1provided the telomeric recombination at marker D3S1267. B Haplotypes of

PKDF223 showing a homozygous region of 9.3 cM delimited by markers D3S2460 and D3S3606. The

STR markers and their relative positions in centimorgan (cM) according to the Marshfield human genetic

map are shown on the left side of the each pedigree.


- 129 -

PKDF223

This is the second family that helped to map DFNB56. PKDF223, a small family

with three affected members (IV:4, IV:5, and IV:6) in single loop and was enrolled from

a Sukkhur (Sindh). Verbal history from multiple individuals was obtained for up to four

generations and a detailed pedigree was drawn (Fig 3.15B). In total, sixteen samples

were collected for in-depth analysis. This family belongs to “Yousaf Zai” caste and age

of the affected individuals fall in a range of 12 to 20 years. All affected individuals of

family PKDF223 exhibit prelingual, bilateral, profound, sensorineural HL, with no

obvious vestibular or ocular abnormalities. A representative audiometric profile of an

affected individual (IV:5) of family PKDF223 is shown in (Fig 3.16).

HAPLOTYPE ANALYSIS

For deafness segregating in family PKDF223, evidence of linkage was found at

marker D3S1267 (139.12 cM) following a genome wide scan. Haplotype analysis

revealed a region of homozygosity of approximately 9.3 cM (Fig 3.15B) flanked by

markers D3S2460 (134.64 cM), a centromeric boundary defined by individual (IV:4) and

D3S3606 (143.94 cM) a distal break given by individuals IV:4, IV:5, and IV:6. The Z

max of 3.16 at θ=0 was found for D3S1267 (Table 3.8).

Fine mapping of both families revealed that the DFNB56 gene lies within a 4.48

cM genetic interval delimited by D3S2460 (134.64 cM) and D3S1267 (139.12 cM) on

chromosome 3q13.31-q21.1. Haplotypes of both families differ from each other; most

likely the two mutant alleles would not be the same (Fig 3.15). Approximately 65

putative and known genes are present on 3q13.31-21.1 region, including interesting

candidate genes like SLC15A2, UPK1B, CASR, and IQCB1 (Fig 3.17).


- 130 -

-10

0

10

20

30

40

50

60

70

80

90

100

110

120

FREQUENCIES

Table 3.8 Two-Point Lod Scores

Some markers in the region of homozygosity were not fully informative, thus

yielded intermediate positive lod scores. For both families mapped to DFNB56, none of

the markers on other chromosome region gave lod score greater than 2.0.

Fig 3.16 Pure tone air conduction audiogram of an affected individual IV:5 (14 years) of family PKDF223.

The observed threshold in all deaf subjects showed profound hearing loss. “O” denote right ear while “X”

denote left ear.

Z max at θθθθ = 0

MARKERS

Marshfield

Map

Position

(cM) PKDF637 PKDF223

D3S1278 129.73 ∞ ∞

D3S1558 133.93 3.16 ∞

D3S2460 134.64 3.74 ∞

D3S1303 136.32 3.73 0.87

D3S4523 138.00 4.84 0.91

D3S1267 139.12 ∞ 3.16

D3S1269 139.65 ∞ 2.86

D3S1589 141.79 -1.84 ∞

D3S3606 143.94 -0.85 ∞


- 131 -

Chr 3

cM

129.73

133.93

134.64

136.32

138

139.12

139.65

141.79

143.94

D3S1558

D3S1278

D3S2460

D3S1303

D3S4523

D3S1267

D3S1269

D3S1589

D3S3606

IGSF11FLJ32859

UPK1B

B4GALT4CDGAPFLJ10902MSD010

AK126736

C3orf1

CD80ADPRHPLA1APOPDC2

COX17

CR749242C3orf15AF497717AL133066NR1l2

GSK3B

AY123976

AK126260

GPR156

AY255565

AK128198

BC013757

FSTL1NDUFB4HGDRABL3GTF2E1AB023223BC037531POLQ

AF163259HCLS1

GOLGB1

BC057227IQCB1EAF2SLC15A2ILDR1AK129974

CD86CASRCSTAE2lG5

WDR5B

KPNA1PARP9BX648869AL832929DTX3L

PARP15

PARP14

HSPBAP1

AK096705

BC063629

DIRC2

AK127315

SEMA5BPDIRSEC22L2ADCY5

151.55D3S2453

Fig 3.17 Schematic representation showing a comparison between DFNB42 and DFNB56 linked Pakistani

families on chromosome 3q13.31-q21.1. The linkage markers are arranged according to Marshfield genetic

map and represented as filled circles. A cross symbol is a meiotic recombination, and the solid vertical line

represents the chromosomal intervals in which markers are homozygous for affected individuals. Fine

mapping of the two families revealed a centromeric recombination at D3S2460 (134.64 cM) in family

PKDF223 while a telomeric recombination was detected at D3S1267 (139.12 cM) in family PKDF637.

Thus the linked region for DFNB56 is 4.48 cM delimited by D3S2460 (134.64 cM) and D3S1267 (139.12

cM). Genes inside the interval of DFNB56 are derived from data available on the UCSC Genome Browser

as on Jun 2005, while the candidate genes are bolded.


- 132 -

DISCUSSION Sense of hearing and balance is attributable to conductance of electrical signals

via nerve fibers to brain in reaction to stereocilia movements generated by pressure

waves of sound. This transduction requires a large ensemble of proteins to act in

concert, mutation in any of these proteins can result in deafness (Trussell, 2000). Given

the intricacy and fine precision required for the smooth operation of inner ear structures,

this implication that approximately 1% of the 30,000 or more human genes are necessary

for hearing (Friedman and Griffith 2003), seems to be legitimate. Although, remarkable

progress has been made regarding the molecular and biomechanics of sound transduction

in the last decade, still little is known about the loci and genes involved in deafness. Till

today more than 113 genetic loci for nonsyndromic deafness has been mapped with some

successfully traced up to gene and protein level (Hereditary Hearing Loss Homepage).

DFNB4/PDS, the 2nd

most common locus in Pakistani population (~5.6%;

unpublished lab data). Two families PKDF278 and PKDF453 showed linkage to

DFNB4/PDS and have different haplotypes. A reported missense mutation (V239D) in

3rd

extra cellular loop of pendrin is identified in PKDF278 (Park et al. 20003), while a

novel missense mutation Q446R is identified in PKDF453. Q446R is present in 10th

transmembrane domain of pendrin and is a prevalent mutation among Pakistani

population (unpublished lab data). Mutations of SLC26A4 contribute to approximately

10% of hereditary deafness in diverse populations including east and south Asians (Park

et al. 2003). Normally it is difficult to differentiate between PDS and DFNB4 as the

goitrous phenotype is incompletely penetrant and not usually evident until adolescence

(Reardon et al 1999). Moreover, phenocopies are common (Kopp et al. 1999) and

intermediate perchlorate discharge results are non-diagnostic (Sato et al. 2001). Since

these families are remotely resided, clinical diagnosis is difficult. However, no

symptoms of goiter were observed in the affected members of the families PKDF278 and

PKDF453 at the time of enrollement; hence considered as DFNB4 families.

Two families PKDF176 and PKDF177 are linked to DFNB12/USH1D locus.

Although the lod score of both the families does not rise to statistical significance yet

there linkages can be further established by enrolling additional members of the families.

DFNB12/USH1D is the 5th common deafness locus (3.7%; unpublished lab data) found

in Pakistani population. CDH23 is the gene for these two overlapping loci

DFNB12/USH1D which when mutated causes stereocilia abnormalities in number,


- 133 -

organization, shape and position relative to the kinocilium (Bork et al. 2001, Bolz et al.

2001). Affected individuals of both the families have no symptoms of RP and have

different haplotypes; so it is predicated that they would carry different mutations of

CDH23. The high variability of prevalence between the results could be due to biasness

of sample size.

MAPPING OF NEW LOCUS DFNB51

Cosegregation of markers on chromosome11p13-p12 with profound deafness in

two families (PKDF240 and PKDF407) defines a novel recessive deafness locus

DFNB51 (Fig 3.12). A maximum two-point lod score of 3.5 and 2.5 for markers

D11S4102 and D11S935 at recombination fraction θ=0 was obtained for families

PKDF240 and PKDF407, respectively (Sheikh et al. 2005). Assuming that the deafness

segregating in both families PKDF240 and PKDF407 is caused by allelic mutations,

haplotype analysis mapped the gene distal to D11S4200 (42.55 cM) and proximal to

D11S4102 (47.61 cM), delineating a genetic interval of approximately 5.06 cM (Fig

3.14). Most likely the two mutant alleles will not be the same, as the haplotypes in the

DFNB51 interval for the two families are different (Fig 3.12). An alternative possibility

is that there are two closely linked deafness loci.

To date, several NSHL and syndromic hearing loss loci including

DFNB2/A11/USH1B, DFNB18/USH1C, DFNB20, DFNB21/A8/A12, DFNB24, and

DFNA32, as well as Jervell and Lange-Nielsen syndrome type 1 (JLNS1) have been

localized on chromosome 11 (Friedman and Griffith, 2003). However, all of the above

nonsyndromic and syndromic deafness loci and genes are located outside of the DFNB51

genetic interval. Moreover, there is not a reported deaf mouse model mapped to the

syntenic region on mouse chromosome 2 corresponding to human chromosome 11p13-

p12. Approximately 21 genes reside in the DFNB51 interval (5.06 cM) including

candidates such as CD44, SLC1A2, RAMP, and TRAF6 (Fig 3.14). CD44 belongs to a

family of transmembrane glycoproteins and is considered to be one of the major

hyaluronic acid receptors (Underhill, 1992). Previous studies have indicated that the

intracellular domain of CD44 binds to certain cytoskeletal proteins such as ankyrin, and

ezrin, moesin, and radixin (Hirao et al. 1996; Bretscher, 1999; Thorne et al. 2004).

Recently it was reported that radixin deficiency in a mouse knock out of this gene is

associated with deafness (Pataky et al. 2004; Kitajiri et al. 2004).


- 134 -

Another interesting candidate is SLC1A2 (GLT1), which encodes a sodium-

dependent glutamate/aspartate transporter, and is a member of a super family of

transporters (Kanai et al. 2004). Lethal spontaneous seizures and increased susceptibility

to acute cortical injury was observed in a SLC1A2 knock out mouse, but deafness was

not reported (Tanaka et al. 1997). Pendred syndrome, DFNB4, and EVA (Enlarged

Vestibular Aqueduct) are allelic disorders caused by mutations of SLC26A4 (Everett et

al. 1997; Li et al. 1998; Usami et al. 1999). Mutations of SLC26A4 contribute to

approximately 10% of hereditary deafness in diverse populations including east and

south Asians (Park et al. 2003). RAMP has three major domains, one of which predicts

serine protease activity. So far, TMPRSS3 is the only gene encoding a serine protease

which when mutated is involved in the etiology of nonsyndromic deafness. Mutations of

TMPRSS3 account for 1.8% of the hereditary deafness segregating in 449 families

ascertained from Pakistan (Scott et al. 2001; Ben-Yosef et al. 2001; Ahmed et al. 2004).

In the linkage interval of 8.33 cM defined by family PKDF240, there is another

interesting candidate NGL-1. The human NGL-1 encodes a transmembrane protein

(NGL-1) expressed in embryonic and adult brain (Lin et al. 2003). NGL-1 is reported to

bind to two of the three PDZ domains of whirlin and is predicted to be involved in

stabilization of interstereociliar links (Delprat et al. 2005). In hair cells of the inner ear

whirlin is transported to the tips of stereocilia by myosin XVa (Belyantseva et al. 2005).

Mutations of both WHRN, and MYO15A, encoding whirlin and myosin XVa,

respectively, are associated with nonsyndromic, congenital, profound HL (Mburu et al.

2003; Wang et al. 1998; Liburd et al. 2001). Sequencing of three genes SLC1A2, RAMP,

and TRAF6 was done but no mutation was identified. Results of DFNB51 mapping in

two consanguineous families should encourage efforts to replicate these findings in other

families in the suggested region and further refine the interval to uncover the causative

gene.

MAPPING OF NEW LOCUS DFNB56

DFNB56, a novel locus for nonsyndromic recessive deafness is mapped on two

consanguineous families PKDF637 and PKDF223 to chromosome 3q13.3-21.1 (Fig

3.15). A maximum two-point lod score of 4.84 and 3.16 for markers D3S4523 and

D3S1267 at recombination fraction θ=0 was obtained for families PKDF637 and

PKDF223, respectively (Table 3.8). Fine mapping of both families revealed that the

DFNB56 gene lies within a 4.48 cM genetic interval delimited by D3S2460 (134.64 cM)


- 135 -

and D3S1267 (139.12 cM) on chromosome 3q13.31-q21.1. As the haplotypes of both

families differ from each other, most likely the two mutant alleles are not the same.

So far, six deafness loci (DFNB6, DFNA18, DFNA44, USH2B, USH3) have been

localized on chromosome 3 including DFNB15, which was presumably mapped to

3q21.3-25.2 (Fukushima et al. 1995; Bonsch et al. 2001; Modamio et al. 2003; Hmani et

al. 1999; Sankila et al. 1995; Chen et al. 1997). All the above loci segregate deafness as

one of the major phenotype and do not overlap with DFNB56 genetic interval.

Approximately 65 putative and known genes are present on 3q13.31-21.1 region,

including interesting candidate genes like SLC15A2, UPK1B, CASR, and IQCB1,

encoding solute carrier family 15 member 2, tansmembrane 4 superfamily member,

cellular calcium sensing receptor protein, integral membrane protein, and IQ domain

containing protein, respectively (Fig 3.17). Many syndromic and NSHL genes encoding

membrane transporters, ionic channels, integral membrane proteins have been reported to

play a critical role in homeostasis of endolymph and cochlear function (Friedman and

Griffith 2003).

One of the candidate gene in the DFNB56 interval is SLC15A2 (PEPT2)

encoding a peptide transporter. Pendred syndrome, DFNB4 and EVA are allelic disorder

caused by mutations of SLC26A4 (Everett et al. 1997; Li et al. 1998; Usami et al. 1999).

Mutations in SLC26A4 contribute to approximately 10% of hereditary deafness in

diverse populations including east and south Asians (Park et al. 2003). In conjunction to

this SLC12A2 knock out was also reported deaf (Delpire et al. 1999). Targeted

disruption of the SLC15A2 gene markedly reduces the dipeptide uptake in choroids

plexus of the kidney. The SLC15A2 knock out has not been reported deaf apparently due

to unevaluated hearing phenotype (Hong et al. 2003).

Another interesting candidate is Uroplakin1B; a transmembrane protein believed

to play a role in ocular surface homeostasis, and stabilizes the apical surface of the

mammalian urothelium during bladder distension (Adachi et al. 2000). Five mutant

alleles of TMIE (an integral transmembrane protein, with unknown function) have been

identified so far as a cause of hearing impairment linked to DFNB6 locus (Naz et al.

2002). Similarly TMC1 (transmembrane channel-like gene1) is predicted to encode a

multipass transmembrane protein was found to be mutated in families segregating

DFNA36 and DFNB7/11 deafness (Kurima et al. 2002). CASR is defective in familial

hypocalciuric hypercalcemia, type1 (FHH1) and is involved in maintaining and sensing


- 136 -

the extracellular calcium ions concentration (Aida et al. 1995). Knock out of Pmca2

gene encoding plasma membrane Ca+ ATPase isoform 2 was found to be deaf (Kozel et

al. 1998; Street et al. 1998). Pmca2 is expressed in stereocilia and basolateral membrane

of hair cells, where it is proposed to extrude intracellular calcium and maintain a high

local concentration of calcium in the endolymph surrounding hair cells (Yamoah et al.

1998). DFNB42 has been recently mapped to a 21.6 cM region on chromosome

3q13.31-q22.3 in a Pakistan family (Aslam et al. 2005), which seems to overlap the

smaller interval (4.48 cM) defined by DFNB56 (Fig 3.17). The acronyms DFNB56 and

DFNB42 were assigned by HUGO, considering the postulates that the mapped regions

(DFNB56 & DFNB42) are two closely spaced DFNB loci, which might have mutations

in different underlying genes. The other possibility is that these two loci might turn over

to be the mutant alleles of a same gene. The confirmation of either of the postulates will

be determined by the identification of underlying gene in both cases.

More than 60 recessive loci have been mapped/reserved till today and it has been

obsereved that loci/genes are population specific; DFNB1, DFNB2, DFNB3, DFNB4,

DFNB7/1, DFNB8/B10, DFNB12, DFNB23, and DFNB39 are some of the common loci

in Pakistan. Marriages within the family are quite common in our culture. Therefore, in

recessive deafness it is possible to identify carriers and to offer genetic counseling to the

families to reduce the incidence of hereditary deafness in our population. For obtaining

this objective, the need is to characterize the deafness at molecular level and identify

genes that contribute the most to HL in the respective country.

Since NSHL is the most prevalent form of hereditary deafness, mapping of new

genetic location always promises the identification and characterizing genes and genes

products expressing in the inner ear, which will ultimately augment our understanding

regarding the molecular processes behind the development and maintenance of the

auditory system. Similarly, identification of DFNB51 and DFNB56 hold the promise to

fill the missing links of auditory pathway and to unveil the absorbing biology of the

hearing. Moreover, it confirms the genetic heterogeneity underlying autosomal recessive

forms of nonsyndromic deafness. This research work will be succeeded if the continuing

voyage of discovery of deafness loci and causative genes will finish. Yet, the journey is

far from finish.


- 137 -

CHAPTER-IV


- 138 -

Abe, S., Usami, S., Shinkawa, H., Kelley, P. M., Kimberling, W. J. (2000) Prevalent

connexin 26 gene (GJB2) mutations in Japanese. J. Med. Genet. 37:41-43.

Adachi, W., Okubo, K., Kinoshita, S. (2000) Human Uroplakin1B in ocuar surface

epithelium. Invest Ophthalmol Vis Sci 41:2900-2905.

Adato, A., Weil, D., Kalinski, H., Pel-Or, Y., Ayadi, H., Petit, C., Korostishevsky, M.,

Bonne-Tamir, B. (1997) Mutation profile of all 49 exons of the human myosin VIIA

gene, and haplotype analysis, in usher 1B families from diverse origins. Am J Hum

Genet 61:813-821.

Adato, A., Michel, V., Kikkawa, Y., Reiners, J., Alagramam, K. N., Weil, D.,

Yonekawa, H., Wolfrum, U., El-Amraoui, A., Petit, C. (2005) Interactions in the

network of usher syndrome type 1 proteins. Hum Mol Genet 14:347–356.

Ahmad, J., Khan, S. N., Khan, S. Y., Ramzan, K., Riazuddin, S., Ahmed, Z. M., Wilcox,

E. R., Friedman, T. B., Riazuddin, S. (2005) DFNB48, a new nonsyndromic recessive

deafness locus, maps to chromosome 15q23-q25.1. Hum Genet 116:407-412

Ahmed, Z. M., Riazuddin, S., Bernstein, S. L., Ahmed, Z., Khan, S., Griffith, A. J.,

Morell, R. J., Friedman, T. B., Wilcox, E. R. (2001) Mutations of the protocadherin

gene PCDH15 cause Usher syndrome type 1F. Am J Hum Genet 69:25-34.

Ahmed, Z. M., Smith, T. N., Riazuddin, S., Makisima, T., Ghosh, M., Bokhari, S.,

Menon, P. S. N., Desmukh, D., Griffith, A. J., Riazuddin, S., Friedman, T. B., Wilcox,

E. R. (2002) Nonsyndromic Recessive Deafness DFNB18 and Usher Syndrome Type

IC Are Allelic Mutations of USHIC. Hum Genet. 110:527-531.

Ahmed, Z. M., Riazuddin, S., Ahmad, J. Bernstein, S. L., Guo, Y., Sabar, M. F.,

Sieving, P., Riazuddin, S., Griffith, A. J., Friedman, T. B., Belyantseva, I. A., Wilcox,

E. R. (2003) PCDH15 is expressed in the neurosensory epithelium of the eye and ear

and mutant alleles are responsible for both USH1F and DFNB23. Hum Mol Genet 12

3215–3223.

Ahmed, Z. M., Riazuddin, S., Riazuddin, S., Wilcox, E. R. The molecular genetics of

Usher syndrome. (2003a) Clin Genet 63:431-444

Ahmed, Z. M., Morell, R. J., Riazuddin, S., Gropman, A., Shaukat, S., Ahmad, M. M.,

Mohiddin, S. A., Fananapazir, L., Caruso, R. C., Husnain, T., Khan, S. N., Riazuddin, S.,

Griffith, A. J., Friedman, T. B., Wilcox, E. R. (2003b) Mutations of MYO6 are

associated with recessive deafness, DFNB37. Am J Hum Genet 72:1315-1322.

Ahmed, Z. M., Li, X. C., Powell, S. D., Riazuddin, S., Young, T. L., Ramzan, K.,

Ahmad, Z., Luscombe, S., Dhillon, K., MacLaren, L., Ploplis, B., Shotland, L. I., Ives,

E., Riazuddin, S., Friedman, T. B., Morell, R. J. and Wilcox, E. R. (2004)

Characterization of a new full length TMPRSS3 isoform and identification of mutant

alleles responsible for nonsyndromic recessive deafness in Newfoundland and Pakistan.

BMC Med Genet 5: 24.

Aida, K., Koishi, S., Inoue, M., Nakazato, M., Tawata, M., Onaya, T. (1995) Familial

hypocalciuric hypercalcemia associated with mutation in the human Ca(2+)-sensing

receptor gene. J. Clin. Endocr. Metab 80:2594-2598.

Alagramam, K. N., Yuan, H., Kuehn, M. H., Murcia, C. L., Wayne, S., Srisailpathy, C.

R., Lowry, R. B., Knaus, R., Van Laer, L., Bernier, F. P., Schwartz, S., Lee, C., Morton,

C. C., Mullins, R. F., Ramesh, A., Van Camp, G., Hageman, G. S., Woychik, R. P.,


- 139 -

Smith, R. J., Hagemen, G. S. (2001) Mutations in the novel protocadherin PCDH15

cause Usher syndrome type 1F. Hum Mol Genet 10:1709-18.

Alagramam, K. N., Murcia, C. L., Kwon, H. Y., Pawlowski, K. S., Wright, C. G.,

Woychik, R. P. (2001a) The mouse Ames waltzer hearing-loss mutant is caused by

mutation of Pcdh15, a novel protocadherin gene. Nat Genet 27:99-102.

Altman, D., Sweeney, H. L., Spudich, J. A. (2004) The mechanism of myosin VI

translocation and its load-induced anchoring. Cell 116:737-749.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. (1990) Basic local

alignment search tool. J Mol Biol 215:403-10.

Anderson, D. W., Probst, F. J., Belyantseva, I. A., Fridell, R. A., Beyer, L., Martin, D.

M., Wu, D., Kachar, B., Friedman, T. B., Raphael, Y., Camper, S. A. (2000) The motor

and tail regions of myosin XV are critical for normal structure and function of auditory

and vestibular hair cells. Hum Molec Genet 9:1729-1738.

Ansar, A., Aminudin, M., Arshad, M., Sohail, M., Faiyaz-ul-Haq, M., Haque, S., Ahmed,

W., Leal, S. M. (2003a) A Novel Autosomal Recessive Non-Syndromic Deafness Locus

(DFNB35) Maps to 14q24.1–14q24.3 in Large Consanguineous Kindred from Pakistan.

Euro J Hum Genet 11:77-80.

Ansar, A., Ramzan, M., Pham, T. L., Yan, K., Jamal, S. M., Haque, S., Ahmad, W., Leal,

S. M. (2003b) Localization of A Novel Autosomal Recessive Non-Syndromic Hearing

Impairment Locus (DFNB38) to 6q26-q27 in a Consanguineous Kindred from Pakistan.

Hum Hered 55:71-74.

Ansar, M., Chahrour, M. H., Amin ud Din, M., Arshad, M., Haque, S., Pham, T. L., Yan,

K., Ahmad, W., Leal, S. M. (2004) DFNB44, a novel autosomal recessive non-

syndromic hearing impairment locus, maps to chromosome 7p14.1-q11.22. Hum Hered

57:195-199.

Aslam, M., Wajid, M., Chahrour, M. H., Ansar, M, Haque, S., Pham, T. L., Santos, R. P.,

Yan, K., Ahmad, W., Leal, S. M. (2005) A Novel Autosomal Recessive Nonsyndromic

Hearing Impairment Locus (DFNB42) Maps to Chromosome 3q13.31-q22.3. Am J Med

Genet 133:18-22.

Assad, J. A., Corey, D. P. (1992) An active motor model for adaptation by vertebrate

hair cells. J Neurosci 12:3291-3309.

Assad, J. A., Shepherd, G. M., Corey, D. P. (1991) Tip-link integrity and mechanical

transduction in vertebrate hair cells. Neuron 7:985-994.

Astuto, L. M., Weston, M. D., Carney, C. A., Hoover, D. M., Cremers, C. W.,

Wagenaar, M., Moller, C., Smith, R. J., Pieke-Dahl, S., Greenberg, J., Ramesar, R.,

Jacobson, S. G., Ayuso, C., Heckenlively, J. R., Tamayo, M., Gorin, M. B., Reardon,

W., Kimberling, W. J. (2000) Genetic heterogeneity of Usher syndrome: analysis of

151 families with Usher type I. Am J Hum Genet 67:1569-74.

Astuto, L. M., Philip, M. K., James, W. A., Weston, M. D., Smith, R. J., Alswaid, A.

F., Mona, Al-Rakf., Kimberling, W. J. (2002) Searching for evidence of DFNB2. Am J

Hum Genet 109: 291-297.

Astuto, L. M., Bork, J. M., Weston, M. D., Askew, J. W., Fields, R. R., Orten, D. J.,

Ohliger, S. J., Riazuddin, S., Morell, R. J., Khan, S., Riazuddin, S., Kremer, H., van


- 140 -

Hauwe, P., Moller, C. G., Cremers, C. W., Ayuso, C., Heckenlively, J. R.,

Rohrschneider, K., Spandau, U., Greenberg, J., Ramesar, R., Reardon, W., Bitoun, P.,

Millan, J., Legge, R., Friedman, T. B., Kimberling, W. J. (2002a) CDH23 mutation and

phenotype heterogeneity: a profile of 107 diverse families with Usher syndrome and

nonsyndromic deafness. Am J Hum Genet 71:262-275.

Avraham, K. B., Hasson, T., Steel, K. P., Kingsley, D. M., Russell, L. B., Mooseker, M.

S., Copeland, N. G., Jenkins, N. A. (1995) The mouse Snell's waltzer deafness gene

encodes an unconventional myosin required for structural integrity of inner ear hair cells.

Nature Genet 11:369-375.

Avraham, K. B. (1998) Hear come more genes! Nat Med 4:1238-1239.

Balciuniene, J., Dahl, N., Jalonen, P., Verhoeven, K., Van Camp, G., Borg, E.,

Pettersson, U., Jazin, E. E. (1999) Alpha-tectorin involvement in hearing disabilities: one

gene-two phenotypes. Hum Genet 105:211-216.

Baldwin, C. T., Weiss, S., Farrer, L. A., De Stefano, A. L., Adair, R., Franklyn, B., Kidd,

K. K., Korostishevsky, M., Bonne-Tamir, B. (1995) Linkage of congenital, recessive

deafness (DFNB4) to chromosome 7q31 and evidence for genetic heterogeneity in the

Middle Eastern Druze population. Hum Mol Genet 4:1637-1642.

Batters, C., Arthur, C. P., Lin, A., Porter, J., Geeves, M. A., Milligan, R. A., Molloy, J.

E., Coluccio, L. M. (2004) Myo1c is designed for the adaptation response in the inner

ear. EMBO J 23:1433-1440.

Belyantseva, I. A., Boger, E. T., Friedman, T. B. (2003a) Myosin XVa localizes to the

tips of inner ear sensory cell stereocilia and is essential for stair case formation of the

hair bundle. Proc Natl Acad Sci USA 100:13958-13963.

Belyantseva, I. A., Labay, V., Boger, E. T., Griffith, A. J. Friedman, T. B. (2003b)

Stereocilia: the long and the short of it. Trends Mol Med 9:458-461.

Belyantseva, I. A., Boger, E. T., Naz, S., Frolenkov, G. I., Sellers, J. R., Ahmed, Z.

M., Griffith, A. J., Friedman, T. B. (2005) Myosin-XVa is required for tip localization

of whirlin and differential elongation of hair-cell stereocilia. Nat Cell Biol 7:148-156.

Ben-Yosef, T., Wattenhofer, M., Riazuddin, S., Ahmed, Z. M., Scott, H. S., Kudoh, J.,

Shibuya, K., Antonarakis, S. E., Bonne-Tamir, B., Radhakrishna, U., Naz, S., Ahmed, Z.,

Riazuddin, S., Pandya, A., Nance, W. E., Wilcox, E. R., Friedman, T. B., Morell, R. J.

(2001) Novel mutations of TMPRSS3 in four DFNB8/B10 families segregating

congenital autosomal recessive deafness. J Med Genet 38:396-400.

Ben-Yosef, T., Belyantseva, I., Saunders, T. L., Hughes, E. D., Kawamoto, K., et al.

(2002) Claudin 14 tight junction knockout mice are deaf due to cochlear hair cell

degeneration. Mol Biol Cell 13:497a.

Ben-Yosef, T., Ness, S. L., Madeo, A. C., Bar-Lev, A., Wolfman, J. H., Ahmed, Z. M.,

Desnick, R. J., Willner, J. P., Avraham, K. B., Ostrer, H., Oddoux, C., Griffith, A. J.,

Friedman, T. B. (2003) A mutation of PCDH15 among Ashkenazi Jews with the type 1

Usher syndrome. N Engl J Med 348:1664-1670.

Bergstrom, L., Hemenway, W. G., Downs, M. P. (1971) A high risk registry to find

congenital deafness. Otolaryngol Clin North Am 4:369-399.


- 141 -

Bergstrom, L. (1980) Pendred’s syndrome with atypical features. Annals of Otology,

Rhinology and Laryngology 89:135–139.

Beyer, L. A., Odeh, H., Probst, F. J., Lambert, E. H., Dolan, D. F., Camper, S. A.,

Kohrman, D. C., Raphael, Y. (2000). Hair cells in the inner ear of the pirouette and

shaker 2 mutant mice. J Neurocytol 29:227-240.

Bharadwaj, A. K., Kasztejna, J. P., Huq, S., Berson, E. L. and Dryja, T. P. (2000)

Evaluation of the myosin VIIA gene and visual function in patients with Usher syndrome

type I. Exp Eye Res 71:173-81.

Bhattacharya G, Miller C, Kimberling WJ, Jablonski MM, Cosgrove D. Localization and

expression of usherin: a novel basement membrane protein defective in people with

Usher’s syndrome type IIa. (2002) Hear Res 163: 1–11

Bitner-Glindzicz, M., Lindley, K. J., Rutland, P., Blaydon, D., Smith, V. V., Milla, P.

J., Hussain, K., Furth-Lavi, J., Cosgrove, K. E., Shepherd, R. M., Barnes, P. D.,

O'Brien, R. E., Farndon, P. A., Sowden, J., Liu, X. Z., Scanlan, M. J., Malcolm, S.,

Dunne, M. J., Aynsley-Green, A. and Glaser, B. (2000) A recessive contiguous gene

deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher

type 1C gene. Nat Genet 26:56-60.

Blumenfeld, H. (2001) Neuroanatomy through Clinical Cases. Yale University School

of Medicine, New York.

Boeda, B., El-Amraoui, A., Bahloul, A., Goodyear, R., Daviet, L., Blanchard, S.,

Perfettini, I., Fath, K. R., Shorte, S., Reiners, J., Houdusse, A., Legrain, P., Wolfrum, U.,

Richardson, G., Petit, C. (2002) Myosin VIIa, harmonin, and cadherin 23, three Usher I

gene products, cooperate to shape the sensory hair cell bundle. EMBO J 21:6689-6699.

Bolz, H., von Brederlow, B., Ramirez, A., Bryda, E. C., Kutsche, K., Nothwang, H. G.,

Seeliger, M., del, C. S. C. M., Vila, M. C., Molina, O. P., Gal, A., Kubisch, C. (2001)

Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher

syndrome type 1D. Nat Genet 27:108-112.

Bolz, H., Bolz, S. S., Schade, G., Kothe, C., Mohrmann, G., Hess, M., Gal, A. (2004)

Impaired calmodulin binding of myosin-7A causes autosomal dominant hearing loss

(DFNA11). Hum Mutat 24: 274-275.

Bonne-Tamir, B., DeStefano, A. L., Briggs, C. E., Adair, R., Franklyn, B., Weiss, S.,

Korostishevsky, M., Frydman, M., Baldwin, C. T., Farrer, L. A. (1996) Linkage of

congenital recessive deafness (gene DFNB10) to chromosome 21q22.3. Am J Hum

Genet 58:1254-1259.

Bonsch, D., Scheer, P., Neumann, C., Lang Roth, R., Seifert, E., Storch, P., Weiller, C.,

Lamprecht Dinnesen, A., Deufel, T. (2001) A novel locus for autosomal dominant,

nonsyndromic hearing impairment (DFNA18) maps to chromosome 3q22 immediately

adjacent to the DM2 locus. Eur J Hum Genet 9:165-170.

Bork, J. M., Peters, L. M., Riazuddin, S., Bernstein, S. L., Ahmed, Z. M., Ness, S. L.,

Polomeno, R., Ramesh, A., Schloss, M., Srisailpathy, C. R., Wayne, S., Bellman, S.,

Desmukh, D., Ahmed, Z., Khan, S. N., Kaloustian, V. M., Li, X. C., Lalwani, A.,

Riazuddin, S., Bitner-Glindzicz, M., Nance, W. E., Liu, X. Z., Wistow, G., Smith, R. J.,

Griffith, A. J., Wilcox, E. R., Friedman, T. B., Morell, R. J. (2001) Usher syndrome 1D


- 142 -

and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic

mutations of the novel cadherin-like gene CDH23. Am J Hum Genet 68:26-37.

Botstein, D., White, R. L., Skolnick, M., Davis, R. W. (1980) Construction of a genetic

linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet

32: 314-331.

Boughman, J. A., Vernon, M. and Shaver, K. A. (1983) Usher syndrome: definition

and estimate of prevalence from two high-risk populations. J Chronic Dis 36:595-603.

Bretscher, A. (1999) Regulation of cortical structure by the ezrin-radixin-moesin protein

family. Curr Opin Cell Biol 11:109-116.

Brownstein, Z., Friedlander, Y., Peritz, E., Cohen, T. (1991) Estimated number of loci

for autosomal recessive severe nerve deafness within the Israeli Jewish population, with

implications for genetic counseling. Am J Med Genet 41: 306-312.

Brunner, H. G., van Bennekom, A., Lambermon, E. M., Oei, T. L., Cremers, W. R.,

Wieringa, B., Ropers, H. H. (1988) The gene for X-linked progressive mixed deafness

with perilymphatic gusher during stapes surgery (DFN3) is linked to PGK. Hum Genet

80: 337-40.

Campbell, C., Cucci, R. A., Prasad, S., Green, G. E., Edeal, J. B., Galer, C. E., Karniski,

L. P., Sheffield, V. C., Smith, R. J. H. (2001) Pendred syndrome, DFNB4, and

PDS/SLC26A4 identification of eight novel mutations and possible genotype-phenotype

correlations. Hum Mutat 17:403-411.

Carrasquillo, M. M., Zlotogora, J., Barges, S., Chakravarti, A. (1997) Two different

connexin 26 mutations in an inbred kindred segregating nonsyndromic recessive

deafness: implications for genetic studies in isolated populations. Hum Mol Genet

6:2163-2172.

Chaib, H., Lina-Granade, G., Guilford, P., Plauchu, H., Levilliers, J., Morgon, A., Petit,

C. (1994) A gene responsible for a dominant form of neurosensory nonsyndromic

deafness maps to the NSRD1 recessive deafness gene interval. Hum Mol Genet 3:2219-

2222.

Chaib, H., Place, C., Salem, N., Dode, C., Chardenoux, S., Weissenbach, J., el Zir, E.,

Loiselet, J. and Petit, C. (1996) Mapping of DFNB12, a gene for a non-syndromal

autosomal recessive deafness, to chromosome 10q21-22. Hum Mol Genet 5:1061-4.

Chen, A., Wayne, S., Bell, A., Ramesh, A., Srisailpathy, C. R., Scott, D. A,, Sheffield,

V. C., Van Hauwe, P., Zbar, R. I., Ashley, J., Lovett, M., Van Camp, G., Smith, R. J.

(1997) New gene for autosomal recessive nonsyndromic hearing loss maps to either

chromosome 3q or 19p. Am J Med Genet 71:467-471.

Chen, H. (1988) Introduction to Human Genetics. In: Medical Genetics Handbook

Green, W. H. Missouri, USA.

Chung, C. S., Robison, O. W., Morton, N.E. (1959) A note on deaf mutism. Ann Hum

Genet 23: 357–366.

Chung, C. S. and Brown, K. S. (1970) Family studies of early childhood deafness

ascertained through the Clarke School for the Deaf. Am J Hum Genet 22: 630–644.

Cohen-Salmon M, El-Amraoui A, Leibovici M, Petit C. Otogelin: a glycoprotein specific

to the acellular membranes of the inner ear. (1997) Proc Natl Acad Sci USA 94: 14450–5


- 143 -

Cohen-Salmon, M., Ott, T., Michel, V., Hardelin, J.-P., Perfettini, I., Eybalin, M., Wu,

T., Marcus, D. C., Wangemann, P., Willecke, K., Petit, C. (2002 Targeted ablation of

connexin26 in the inner ear epithelial gap junction network causes hearing impairment

and cell death. Curr. Biol. 12: 1106-1111.

Conneally, P. M., and Rivas. (1980) Linakge analysis in man. New York, Plenum.

Corey, D. P., Hudspeth, A. J. (1979) Ionic basis of the receptor potential in a vertebrate

hair cell. Nature 281:675−677.

Corey, D. P. and Hudspeth, A. J. (1983) Kinetics of the receptor current in bullfrog

saccular hair cells. J. Neurosci 3: 962-976.

Corwin, J. T. and Warchol, M. E. (1991) Auditory hair cells: structure, function,

development, and regeneration. Annu Rev Neurosci 14:301-33.

Cosgrove D, Samuelson G, Pinnt J. Immunohistochemical localization of basement

membrane collagens and associated proteins in the murine cochlea. (1996a) Hear Res 97:

54–65

Cosgrove D, Kornak JM, Samuelson G. Expression of basement membrane type IV

collagen chains during postnatal development in the murine cochlea. (1996b) Hear Res

100: 21–32

Costeff, H. and Dar, H. (1980) Consanguinity analysis of congenital deafness in

Northern Israel. Am J Hum Genet 32: 64–68.

Coyle, B., Coffey, R., Armour, J. A. L., Gausden, E., Hochberg, Z., Grossman, E.,

Britton, K., Pembrey, M., Reardon, W., Trembath, R. (1996) Pendred syndrome (goitre

and sensorineural hearing loss) maps to chromosome 7 in the region containing the

nonsyndromic deafness gene DFNB4. Nat Genet 12:421-423.

Coyle, B., Reardon, W., Herbrick, J. A., Tsui, L. C., Gausden, E., Lee, J., Coffey, R.,

Grueters, A., Grossman, A., Phelps, P. D., Luxon, L., Kendall-Taylor, P., Scherer, S. W.,

Trembath, R. C. (1998) Molecular analysis of the PDS gene in pendred syndrome. Hum

Mol Genet 7:1105-1112.

Cranefield, P.F. and W. Federn. (1970) Paulus Zacchias on mental deficiency and on

deafness. Bull NY Acad Med 46: 3–21.

Crawford, A. C., Evans, M. G., Fettiplace, R. (1989) Activation and adaptation of

transducer currents in turtle hair cells. J Physiol (Lond.) 419:405-434.

Cremers, W. R., Bolder, C., Admiraal, R. J., Everett, L. A., Joosten, F. B., van Hauwe,

P., Green, E. D., Otten, B. J. (1998) Progressive sensorineural hearing loss and a

widened vestibular aqueduct in Pendred syndrome. Archives of Otolaryngology Head

and Neck Surgery 124:501–505.

Crouch, J. J., Sakaguchi, N., Lytle, C., Schulte, B. A. J Immunohistochemical

localization of the Na-K-Cl co-transporter (NKCC1) in the gerbil inner ear. (1997)

Histochem Cytochem 45:773-778

Das, V. K. (1996) Aetiology of bilateral sensorineural hearing impaiment in children: a

10 year study. Arch Dis Childhood 74: 8–12.

Davenport, S. L. H. and Omenn, G. S. (1977) The Heterogeneity of Usher syndrome.

Paper presented at Int Conf Birth Defects. Montreal.


- 144 -

del Castillo, I., Villamar, M., Moreno-Pelayo, M. A., del Castillo, F. J., Alvarez, A.,

Telleria, D., Menendez, I., Moreno, F. (2002) A deletion involving the connexin 30 gene

in nonsyndromic hearing impairment. New Eng J Med 346:243-249.

Delpire, E., Lu, J., England, R., Dull, C., Thorne, T. (1999) Deafness and imbalance

associated with inactivation of the secretory Na-K-2Cl co-transporter. Nat Genet

22:192-195.

Delprat, B., Michel, V., Goodyear, R., Yamasaki, Y., Michalski, N., El-Amraoui, A.,

Perfettini, I., Legrain, P., Richardson, G., Hardelin, J. P., Petit, C. (2005) Myosin XVa

and whirlin, two deafness gene products required for hair bundle growth, are located at

the stereocilia tips and interact directly. Hum Mol Genet 14:401-410.

den Dunnen, J. T., and Antonarakis, S. E: (2001) Nomenclature for the description of

human sequence variations. Hum Genet 109:121-124.

Denoyelle, F., Lina-Granade, G., Plauchu, H., Bruzzone, R., Chaib, H., Levi-Acobas, F.,

Weil, D., Petit, C.(1998) Connexin 26 gene linked to a dominant deafness. Nature 393:

319-320.

DeRosier, D. J., Tilney, L. G., Egelman, E. (1980) Actin in the inner ear: the remarkable

structure of the stereocilium. Nature 287:291-226.

DeRosier, D. J., Tilney, L. G. (2000) F-actin bundles are derivatives of microvilli: what

does this tell us about how bundles might form? J Cell Biol 148:1-6.

Di Palma, F., Holme, R. H., Bryda, E. C., Belyantseva, I. A., Pellegrino, R., Kachar, B.,

Steel, K. P., Noben-Trauth, K. (2001) Mutations in Cdh23, encoding a new type of

cadherin, cause stereocilia disorganization in waltzer, the mouse model for Usher

syndrome type 1D. Nat Genet 27:103-107.

Donaudy, F., Zheng, L., Ficarella, R., Ballana, E., Carella, M., Melchionda, S., Estivill,

X., Bartles, J. R., Gasparini, P. (2005) Espin gene (ESPN) mutations associated with

autosomal dominant hearing loss cause defects in microvillar elongation or organization.

J Med Genet Published Online Jun 1.

Eatock, R. A. (2000) Adaptation in Hair Cells. Annu Rev Neurosci 23:285-314.

Estivill, X., Fortina, P., Surrey, S., Rabionet, R., Melchionda, S., D-Agruma, L.,

Mansfield, E., Rappaport, E., Govea, N., Mila, M., Zelante, L., Gasparini, P. (1998)

Connexin-26 mutations in sporadic and inherited sensorineural deafness. Lancet

351:394-398.

El-Amraoui, A., Sahly, I., Picaud, S., Sahel, J., Abitbol, M., Petit, C. Human Usher

1B/mouse shaker-1: the retinal phenotype discrepancy explained by the presence/absence

of myosin VIIA in the photoreceptor cells. (1996) Hum Mol Genet 5:1171-1178

El-Amraoui, A., Schonn, J. S., Kussel-Andermann, P., Blanchard, S., Desnos, C., Henry,

J. P., Wolfrum, U., Darchen, F. and Petit, C. (2002) MyRIP, a novel Rab effector,

enables myosin VIIa recruitment to retinal melanosomes. EMBO Rep 3:463-70.

Elahi, M. M., Elahi, F., Elahi, A., Elahi, S. B. (1998) Paediatric hearing loss in rural

Pakistan. J Otolaryngol 27:348-353.

Ernest, S., Rauch, G. J., Haffter, P., Geisler, R., Petit, C. and Nicolson, T. (2000)

Mariner is defective in myosin VIIA: a zebrafish model for human hereditary deafness.

Hum Mol Genet 9:2189-96.


- 145 -

Eudy, J. D., Weston, M. D., Yao, S., Hoover, D. M., Rehm, H. L., Ma-Edmonds, M.,

Yan, D., Ahmad, I., Cheng, J. J., Ayuso, C., Cremers, C., Davenport, S., Moller, C.,

Talmadge, C. B., Beisel, K. W., Tamayo, M., Morton, C. C., Swaroop, A., Kimberling,

W. J. and Sumegi, J. (1998) Mutation of a gene encoding a protein with extracellular

matrix motifs in Usher syndrome type IIa. Science 280:1753-7.

Everett, L. A., Glaser, B., Beck, J. C., Idol, J. R., Buchs, A., Heyman, M., Adawi, F.,

Hazani, E., Nassir, E., Baxevanis, A. D., Sheffield, V. C., Green, E. D. (1997).

Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS).

Nat. Genet., 17: 411-422.

Everett, L. A., Belyantseva, I. A., Noben-Trauth, K., Cantos, R., Chen, A., Thakkar, S.

I., Hoogstraten-Miller, S. L., Kachar, B., Wu, D. K., Green, E. D. (2001) Targeted

disruption of mouse Pds provides insight about the inner-ear defects encountered in

Pendred syndrome. Hum Mol Genet 10:153–161.

Fettiplace, R., Ricci, A. J. (2003) Adaptation in auditory hair cells. Curr Opin Neurobiol.

13:446-451.

Forge A, Becker D, Casalotti S et al. Gap junctions and connexin expression in the inner

ear. (1999) Novartis Found Symp 219: 134–50, discussion 151–6

Forge, A., and Wright, T. (2002) The molecular architecture of the inner ear. Br Med

Bull 63:5-24.

Foroud, T. (1997) Introduction to genetic linkage analysis. Cancer Invest 15: 548-552.

Fraser, G. R. (1976) The causes of profound deafness in childhood. The Johns Hopkins

University Press, Baltimore, MD.

Friedman, T. B., Liang, Y., Weber, J. L., Hinnant, J. T., Barber, T. D., Winata, S.,

Arhya, I. N. Asher Jr, J. H. (1995) A gene for congenital recessive deafness DFNB3

maps to the pericentromeric region of chromosome 17. Nat Genet 9: 86-91.

Friedman, T. B., and Griffith, A. J. (2003) Human nonsyndromic sensorineural

deafness. Annu Rev Genomics Hum Genet 4:341–402.

Friedman, T. B., Schultz, J. M., Ben-Yosef, T., Pryor, S. P., Lagziel, A., Fisher, R. A.,

Wilcox, E. R., Riazuddin, S., Ahmed, Z. M., Belyantseva, I. A., Griffith A. J. (2003a)

Recent Advances in the Understanding of Syndromic Forms of Hearing Loss. Ear and

Hearing 24:289–302.

Frolenkov, G. I., Belyantseva, I. A., Friedman, T. B., Griffith, A. J. (2004) Genetic

insights into the morphogenesis of inner ear hair cells. Nature review Genetics 5:489-

498

Fukushima, K., Ramesh, A., Srisailapathy, C. R. S., Ni, L., Wayne, S., O'Neill, M. E.,

Van Camp, G., Coucke, P., Jain, P., Wilcox, E. R., Smith, S. D., Kenyon, J. B., Zbar, R.

I. S., Smith, R. J. H. (1995b) An autosomal recessive nonsyndromic form of

sensorineural hearing loss maps to 3p-DFNB6. Genome Res 5:305-308.

Gabriel, H. D., Jung, D., Butzler, C., Temme, A., Traub, O., Winterhager, E., Willecke,

K. (1998) Transplacental uptake of glucose is decreased in embryonic lethal connexin-

26 deficient mice J Cell Biol 140:1453-461.


- 146 -

Gibson, F., Walsh, J., Mburu, P., Varela, A., Brown, K. A., Antonio, M., Beisel, K. W.,

Steel, K. P. and Brown, S. D. (1995) A type VII myosin encoded by the mouse

deafness gene shaker-1. Nature 374:62-4.

Gillespie, P. G., Corey, D. P. (1997) Myosin and adaptation by hair cells. Neuron

19:955-958.

Goodyear, R. J., Legan, P. K., Wright, M. B., Marcotti, W., Oganesian, A., Coats, S. A.,

Booth, C. J., Kros, C. J., Seifert, R. A., Bowen-Pope, D. F., Richardson, G. P. (2003). A

receptor-like inositol lipid phosphatase is required for the maturation of developing

cochlear hair bundles. J Neurosci 23:9208-9219.

Goodyear, R. J., Marcotti, W., Kros, C. J., Richardson, G. P. (2005) Development and

properties of stereociliary link types in hair cells of the mouse cochlea. J Comp Neurol

485:75-85.

Goldstein, M.A. (1933) Problems of the deaf. The Laryngoscope Press, St. Louis, MO.

Gorlin, R. J., Toriello, H. V. and Cohen, M. M. (1995) Hereditary Hearing Loss and

Its Syndromes. Oxford University Press, New York/Oxford.

Graham, A. (2000) Development. Hear, hear, for the inner ear. Science 290:1904-5.

Grimberg, J., Nawoschik, S., Belluscio, L., McKee, R., Turck, A., Eisenberg, A. (1989)

A simple and efficient non-organic procedure for the isolation of genomic DNA from

blood. Nucleic Acids Res 17:8390.

Grondahl, J. (1987) Estimation of prognosis and prevalence of retinitis pigmentosa and

usher syndrome in Norway. Clin Genet 31:255-64.

Guilford, P., Ben Arab, S., Blanchard, S., Levilliers, J., Weissenbach, J., Belkahia, A.,

Petit, C. (1994a) A non-syndrome form of neurosensory, recessive deafness maps to the

pericentromeric region of chromosome 13q. Nat Genet 6: 24-28.

Guilford, P., Ayadi, H., Blanchard, S., Chaib, H., Le Paslier, D., Weissenbach, J., Drira,

M. and Petit, C. (1994b) A human gene responsible for neurosensory, nonsyndromic

recessive deafness is a candidate homologue of the mouse sh 1 gene. Hum Mol Genet

3:989-93.

Guipponi, M., Vuagniaux, G., Wattenhofer, M., Shibuya, K., Vazquez, M., Dougherty,

L., Scamuffa, N., Guida, E., Okui, M., Rossier, C., Hancock, M., Buchet, K., Reymond,

A., Hummler, E., Marzella, P. L., Kudoh, J., Shimizu, N., Scott, H. S., Antonarakis, S.

E., Rossier, B. C. (2002) The transmembrane serine protease (TMPRSS3) mutated in

deafness DFNB8/10 activates the epithelial sodium channel (ENaC) in vitro. Hum Mol

Genet 11(23):2829-2836.

Hallgren, B. (1959) Retinitis pigmentosa combined with congenital deafness, with

vestibulo-cerebellar ataxia and mental abnormality in a proportion of cases. A clinical

and genetico-statistical study. Munksgaard, Copenhagen.

Hammersschlag, V. (1907) Zur Kenntnis der hereditaer-de-generativen Taubstummen

und ihre differential-diagnostische Bedeutung. Z Ohrenheilk 54:18-36.

Hampton, L. L., Wright, C. G., Alagramam, K. N., Battey, J. F., Noben-Trauth, K.

(2003) A new spontaneous mutation in the mouse Ames waltzer gene, Pcdh15. Hear Res

180:67-75.


- 147 -

Harris, B. Z., Lim, W. A. (2001) Mechanism and role of PDZ domains in signaling

complex assembly. J Cell Sci 114:3219-3231.

Hartmann, A. (1881) Deafmutism and the education of deaf mutes by lipreading and

articulation. (translated by J.P. Cassels) Balliere, Tindall and Cox, London, UK.

Harvey SJ, Mount R, Sado Y et al. The inner ear of dogs with X-linked nephritis

provides clues to the pathogenesis of hearing loss in X-linked Alport syndrome. (2001)

Am J Pathol 159: 1097–104

Hasko JA, Richardson GP. The ultrastructural organization and properties of the mouse

tectorial membrane matrix. (1988) Hear Res 35: 21–38

Hasson, T., Heintzelman, M. B., Santos-Sacchi, J., Corey, D. P. and Mooseker, M. S.

(1995) Expression in cochlea and retina of myosin VIIa, the gene product defective in

usher syndrome type 1B. Proc Natl Acad Sci U S A 92:9815-9.

Hasson, T., Walsh, J., Cable, J., Mooseker, M. S., Brown, S. D. and Steel, K. P.

(1997) Effects of shaker-1 mutations on myosin-VIIa protein and mRNA expression.

Cell Motil Cytoskeleton 37:127-38.

Heathcote, K., Syrris, P., Carter, N. D., Patton, M. A. (2000) A connexin 26 mutation

causes a syndrome of sensorineural hearing loss and palmoplantar hyperkeratosis. J.

Med. Genet. 37:50–51.

Heiner, C. R., Hunkapiller, K. L., Chen, S. M., Glass, J. I., Chen, E. Y. (1998)

Sequencing multimegabase-template DNA with BigDye terminator chemistry. Genome

Res 8:557-61.

Higashida, C., Miyoshi, T., Fujita, A., Oceguera-Yanez, F., Monypenny, J., Andou, Y.,

Narumiya, S., Watanabe, N. (2004) Actin polymerization-driven molecular movement of

mDia1 in living cells. Science 303:2007-2010.

Hirao, M., Sato, N., Kondo, T., Yonemura, S., Monden, M., Sasaki, T., Takai, Y.,

Tsukita, S., Tsukita, S. (1996) Regulation mechanism of ERM (ezrin/radixin/moesin)

protein/plasma membrane association: possible involvement of phosphatidylinositol

turnover and Rho-dependent signaling pathway. J Cell Biol 135:37-51.

Hirokawa, N., Tilney, L. G. (1982) Interactions between actin filaments and between

actin filaments and membranes in quick-frozen and deeply etched hair cells of the chick

ear. J Cell Biol 95:249-261.

Hmani, M., Ghorbel, A., Boulila-Elgaied, A., Ben Zina, Z., Kammoun, W., Drira, M.,

Chaabouni, M., Petit, C., Ayadi, H. (1999) A novel locus for Usher syndrome type II,

USH2B, maps to chromosome 3 at p23-24.2. Eur J Hum Genet 7:363-367.

Hofer, D., Ness, W., Drenckhahn, D. (1997) Sorting of actin isoforms in chicken

auditory hair cells. J Cell. Sci. 110:765-770.

Hong, S., Smith, D. E., Keep, R. F., Xiang, J., Brosius III, F. C. (2003) Targeted

disruption of the PEPT2 gene markedly reduces dipeptide uptake in choroids plexus. J

Biol Chem 278:4786-4791.

Hope, C. I., Bundey, S., Proops, D., Fielder, A. R. (1997) Usher syndrome in the city

of Birmingham--prevalence and clinical classification. Br J Ophthalmol 81:46-53.

Holt, J. R., Corey, D. P. (2000) Two mechanisms for transducer adaptation in vertebrate

hair cells. Proc Natl Acad Sci USA 97:11730-11735.


- 148 -

Holt, J. R., Gillespie, S. K., Provance, D. W., Shah, K., Shokat, K. M., Corey, D. P.,

Mercer, J. A., Gillespie, P. G. (2002) A chemical-genetic strategy implicates myosin-1c

in adaptation by hair cells. Cell 108:371-381.

Howard, J. and Hudspeth, A. J. (1988) Compliance of the hair bundle associated with

gating of mechanoelectrical transduction channels in the bullfrog's saccular hair cell.

Neuron.1: 189-199.

Hudspeth, A. J. (1989) How the Ear’s Works. Nature 341: 397-404.

Hudspeth, A, J., Gillespie, P. G. (1994) Pulling springs to tune transduction: adaptation

by hair cells. Neuron 12:1-9.

Hussain, R., and Bittles A. H. (1998) The prevalence and demographic characteristics

of consanguineous marriages in Pakistan. J Biosoc Sci 30:261-275.

Iwasaki, S., Harada, D., Usami, S., Nagura, M., Takeshita, T., Hoshino, T. (2002)

Association of clinical features with mutation of TECTA in a family with autosomal

dominant hearing loss. Arch Otolaryngol Head Neck Surg 128:913-917.

Jaber, L., Halpern, G. J., Shohat, M. (1998) The impact of consanguinity worldwide,

Community. Genetics 1:12-17.

Jain, P. K., Fukushima, K., Deshmukh, D., Ramesh, A., Thomas, E., Lalwani, A. K.,

Kumar, S., Plopis, B., Skarka, H., Srisailapathy, C. R. (1995) A human recessive

neurosensory nonsyndromic hearing impairment locus is potential homologue of murine

deafness (dn) locus. Hum Mol Genet 4:2391-2394.

Jain, P. K., Lalwani, A. K., Li, X. C., Singleton, T. L., Smith, T. N., Chen, A.,

Deshmukh, D., Verma, I. C., Smith, R. J. and Wilcox, E. R. (1998) A gene for

recessive nonsyndromic sensorineural deafness (DFNB18) maps to the chromosomal

region 11p14-p15.1 containing the Usher syndrome type 1C gene. Genomics 50:290-2.

Jamora, C., Fuchs, E. (2002) Intercellular adhesion, signalling and the cytoskeleton.

Nature Cell Biol 4:101-108.

Janecke, A. R., Meins, M., Sadeghi, M., Grundmann, K., Apfelstedt-Sylla, E., Zrenner,

E., Rosenberg, T. and Gal, A. (1999) Twelve novel myosin VIIA mutations in 34

patients with Usher syndrome type I: confirmation of genetic heterogeneity. Hum Mutat

13:133-40.

Joensuu, T., Hamalainen, R., Yuan, B., Johnson, C., Tegelberg, S., Gasparini, P.,

Zelante, L., Pirvola, U., Pakarinen, L., Lehesjoki, A. E., de la Chapelle, A., Sankila, E.

M. Mutations in a novel gene with transmembrane domains underlie Usher syndrome

type 3. (2001) Am J Hum Genet 69:673-684

Johnson, K. R., Gagnon, L. H., Webb, L. S., Peters, L. L., Hawes, N. L., Chang, B.

Zheng, Q. Y. (2003) Mouse models of USH1C and DFNB18: phenotypic and molecular

analyses of two new spontaneous mutations of the Ush1c gene. Hum Mol Genet

12:3075-3086.

Kachar, B., Parakkal, M., Kurc, M., Zhao, Y., Gillespie, P. G. (2000) High-resolution

structure of hair-cell tip links. Proc Natl Acad Sci USA 97:13336-13341.

Kanai, Y., and Hediger, M. A. (2004) The glutamate/neutral amino acid transporter

family SLC1: molecular, physiological and pharmacological aspects. Pflugers Arch 447:

469-479.


- 149 -

Keats, B. J. and Savas, S. (2004) Genetic heterogeneity in Usher syndrome. Am J Med

Genet 130: 13-16.

Kelsell, D. P., Dunlop, J., Stevens, H. P., Lench, N. J., Liang, J. N., Parry, G., Mueller,

R. F., Leigh, I. M. (1997) Connexin 26 mutations in hereditary nonsyndromic

sensorineural deafness. Nature 387:80-83.

Kelsell, D. P., Wilgoss, A. L., Richard, G., Stevens, H. P., Munro, C. S., Leigh, I. M.

(2000) Connexin mutations associated with palmoplantar keratoderma and profound

deafness in a single family. Europ. J. Hum. Genet. 8:141-144.

Kikkawa, Y, Shitara, H, Wakana, S, Kohara, Y, Takada ,T., Okamoto, M., Taya, C.,

Kamiya, K., Yoshikawa, Y., Tokano, H., Kitamura, K., Shimizu, K., Wakabayashi, Y.,

Shiroishi, T., Kominami, R., Yonekawa, H. (2003) Mutations in a new scaffold protein

Sans cause deafness in Jackson shaker mice. Hum. Mol Genet 12:453-461.

Kikuchi T, Kimura RS, Paul DL, Adams JC. Gap junctions in the rat cochlea:

immunohistochemical and ultrastructural analysis. (1995) Anat Embryol (Berl) 191:

101–18

Kimberling, W. J., Moller, C. G., Davenport, S., Priluck, I. A., Beighton, P. H.,

Greenberg, J., Reardon, W., Weston, M. D., Kenyon, J. B., Grunkemeyer, J. A. and et

al. (1992) Linkage of USHer syndrome type I gene (USH1B) to the long arm of

chromosome 11. Genomics 14:988-94.

Kitajiri, S., Fukumoto, K., Hata, M., Sasaki, H., Katsuno, T., Nakagawa, T., Ito, J.,

Tsukita, S., Tsukita, S. (2004) Radixin deficiency causes deafness associated with

progressive degeneration of cochlear stereocilia. J Cell Biol 166:559-570.

Kobayashi, T., Walsh, M. C., Choi, Y. (2004) The role of TRAF6 in signal transduction

and the immune response. Microbes Infect. 6:1333-1338.

Konigsmark, B.W. (1969) Hereditary deafness in man. N Engl J Med 281: 713–720,

774–778, 827–832.

Konigsmark, B. W. and Gorlin, R. J. (1976) Genetic and metabolic deafness. W.B.

Saunders, Philadelphia, PA.

Kopp, P., Arseven, O. K., Sabacan, L., Kotlar, T., Dupuis, J., Cavaliere, H., Santos, C.

L., Jameson, J. L., Medeiros-Neto, G. (1999) Phenocopies for deafness and goiter

development in a large inbred Brazilian kindred with Pendred’s syndrome associated

with a novel mutation in the PDS gene. J Clin Endocrinol Metab 84:336-341.

Kossal, M. (1997) Sound emissions from cochlear filters and foveae-Does the auditory

sense organ makes sense? Naturwissenchaften 84: 9-16.

Kozel, P. J., Friedman, R. A., Erway, L. C., Yamoah, E. N., Liu, L. H. (1998)

Balance and hearing deficits in mice with a null mutation in the gene encoding plasma

membrane Ca2C-ATPase isoform 2. J Biol Chem 273:18693–18696.

Kros, C. J., Marcotti, W., van Netten, S. M., Self, T. J., Libby, R. T., Brown, S. D.,

Richardson, G. P., Steel, K. P. (2002) Reduced climbing and increased slipping

adaptation in cochlear hair cells of mice with Myo7a mutations. Nat Neurosci 5:41-47.

Kudo, T., Ikeda, K., Kure, S., Matsubara, Y., Oshima, T., Watanabe, K., Kawase, T.,

Narisawa, K., Takasaka, T. (2000) Novel mutations in the connexin 26 gene (GJB2)


- 150 -

responsible for childhood deafness in the Japanese population. Am J Med Genet 90:141-

145.

Kuijpers, W., Tonnaer, E. L., Peters, T. A., Ramaekers, F. C. Expression of intermediate

filament proteins in the mature inner ear of the rat and guinea pig (1991) Hear Res 52:

133–46.

Kumar, A., Babu, M., Kimberling, W. J., Venkatesh, C. P. (2004) Genetic analysis of a

four generation Indian family with Usher syndrome: a novel insertion mutation in

MYO7A. Mol Vis 10:910-916.

Kupka, S., Braun, S., Aberle, S., Haack, B., Ebauer, M., Zeissler, U., Zenner, H. P., Blin,

N., Pfister, M. Frequencies of GJB2 mutations in German control individuals and

patients showing sporadic non-syndromic hearing impairment. (2002) Hum Mutat 20:77-

78.

Kurima, K., Peters, L. M., Yang, Y., Riazuddin, S., Ahmed, Z. M., Naz, S., Arnaud, D.,

Drury, S., Mo, J., Makishima, T. Ghosh, M., Menon, P. S. N., Deshmukh, D., Oddoux,

C., Oster, H., Khan, S., Riazuddin, S., Deininger, L. P., Hampton, L. L., Sullivan, L. S.,

Battey, F. J., Keats, B. J. B., Wilcox, E. R., Friedman, T. B., and Griffith, A. J.

(2002) Dominant and recessive deafness caused by mutations of a novel gene, TMC1,

required for cochlear hair-cell function. Nat Genet 30: 277–284.

Kussel-Andermann, P., El-Amraoui, A., Safieddine, S., Nouaille, S., Perfettini, I., Lecuit,

M., Cossart, P., Wolfrum, U., Petit, C. (2000) Vezatin, a novel transmembrane protein,

bridges myosin VIIA to the cadherin-catenins complex. EMBO J 19:6020-6029.

Lagziel, A., Ahmed, Z. M., Schultz, J. M., Morell, R. J., Belyantseva, I. A., Friedman, T.

B. Spatiotemporal pattern and isoforms of cadherin 23 in wild type and waltzer mice

during inner ear hair cell development. (2005) Dev Biol 280:295-306

Lee, L. G., Spurgeon, S. L., Heiner, C. R., Benson, S. C., Rosenblum, B. B.,

Menchen, S. M., Graham, R. J., Constantinescu, A., Upadhya, K. G., Cassel, J. M.

(1997) New energy transfer dyes for DNA sequencing. Nucleic Acids Res 25:2816-22.

Lee, Y. J., Park, D., Kim, S. Y., Park, W, J. (2003) Pathogenic mutations but not

polymorphisms in congenital and childhood onset autosomal recessive deafness disrupt

the proteolytic activity of TMPRSS3. J Med Genet 40(8):629-631.

Legan PK, Rau A, Keen JN, Richardson GP. The mouse tectorins. Modular matrix

proteins of the inner ear homologous to components of the sperm-egg adhesion system.

(1997) J Biol Chem 272: 8791–801

Legan PK, Lukashkina VA, Goodyear RJ, Kossi M, Russell IJ, Richardson GP. A

targeted deletion in alpha-tectorin reveals that the tectorial membrane is required for the

gain and timing of cochlear feedback. (2000) Neuron 28: 273–85

Lentz, J., Savas, S., Ng, S. S., Athas, G., Deininger, P., Keats, B. The USH1C 216G-->A

splice-site mutation results in a 35-base-pair deletion. (2005) Hum Genet 116:225-227

Leon, P. E., Raventos, H., Lynch, E., Morrow, J., King, M. C. (1992) The gene for an

inherited form of deafness maps to chromosome 5q31. Proc Natl Acad Sci USA 89:

5181-5184.


- 151 -

Lerer, I., Sagi, M., Ben-Neriah, Z., Wang, T., Levi, H., Abeliovich, D. (2001) A deletion

mutation in GJB6 cooperating with a GJB2 mutation in trans in nonsyndromic deafness:

A novel founder mutation in Ashkenazi Jews. Hum. Mutat. 18:460

Levy, R. A. and Arts, H. A. (1996) Predicting neuroradiologic outcome in patients

referred for audiovestibular dysfunction. Am J Neuroradiology 17:1717-24.

Levy, G., Levi-Acobas, F., Blanchard, S., Gerber, S., Larget-Piet, D., Chenal, V., Liu, X.

Z., Newton, V., Steel, K. P., Brown, S. D., Munnich, A., Kaplan, J., Petit, C., Weil, D.

(1997) Myosin VIIA gene: heterogeneity of the mutations responsible for Usher

syndrome type IB. Hum Mol Genet 6:111-116.

Liang, Y., Wang, A., Probst, F. J., Arhya, I. N., Barber, T. D., Chen, K. S., Deshmukh,

D., Dolan, D. F., Hinnant, J. T., Carter, L. E., Jain, P. K., Lalwani, A. K., Li, X. C.,

Lupski, J. R., Moeljopawiro, S., Morell, R., Negrini, C., Wilcox, E. R., Winata, S.,

Camper, S. A., Friedman, T. B. (1998) Genetic mapping refines DFNB3 to 17p11.2,

suggests multiple alleles of DFNB3, and supports homology to the mouse model shaker-

2. Am J Hum Genet 62:904-915.

Liang, Y., Wang, A., Belyantseva, I. A., Anderson, D. W., Probst, F. J., Barber, T. D.,

Miller, W., Touchman, J. W., Jin, L., Sullivan, S. L., Sellers, J. R., Camper, S. A., Lloyd,

R. V., Kachar, B., Friedman, T. B., Fridell, R. A. (1999) Characterization of the human

and mouse unconventional myosin XV genes responsible for hereditary deafness DFNB3

and shaker 2. Genomics 61:243-258.

Liburd, N., Ghosh, M., Riazuddin, S., Naz, S., Khan, S., Ahmed, Z., Riazuddin, S.,

Liang, Y., Menon, P. S., Smith, T., Smith, A. C., Chen, K. S., Lupski, J. R., Wilcox, E.

R., Potocki, L., Friedman, T. B. (2001) Novel mutations of MYO15A associated with

profound deafness in consanguineous families and moderately severe hearing loss in a

patient with Smith-Magenis syndrome. Hum Genet 109:535-541.

Li, X. C., Everett, L. A., Lalwani, A. K., Desmukh, D., Friedman, T. B., Green, E. D.,

Wilcox, E. R. (1998) A mutation in PDS causes nonsyndromic recessive deafness. Nat

Genet 18: 215-217.

Lin, J. C., Ho, W. H., Gurney, A., Rosenthal, A. (2003) The netrin-G1 ligand NGL-1

promotes the outgrowth of thalamocortical axons. Nat Neurosci 6:1270-1276.

Liu, X. Z., Newton, V. E., Steel, K. P. and Brown, S. D. (1997c) Identification of a

new mutation of the myosin VII head region in Usher syndrome type 1. Hum Mutat

10:168-70.

Liu, X. Z., Walsh, J., Mburu, P., Kendrick-Jones, J., Cope, M. J., Steel, K. P., Brown,

S. D. (1997a) Mutations in the myosin VIIA gene cause nonsyndromic recessive

deafness. Nat Genet 16:188-190.

Liu, X. Z., Walsh, J., Tamagawa, Y., Kitamura, K., Nishizawa, M., Steel, K. P., Brown,

S. D. (1997b) Autosomal dominant nonsyndromic deafness caused by a mutation in the

myosin VIIA gene. Nat Genet 17:268-9.

Liu, X. Z., Hope, C., Walsh, J., Newton, V., Ke, X. M., Liang, C. Y., Xu, L. R., Zhou,

J. M., Trump, D., Steel, K. P., Bundey, S. and Brown, S. D. (1998) Mutations in the

myosin VIIA gene cause a wide phenotypic spectrum, including atypical Usher

syndrome. Am J Hum Genet 63:909-12.


- 152 -

Liu, X., Udovichenko, I. P., Brown, S. D., Steel, K. P. and Williams, D. S. (1999)

Myosin VIIa participates in opsin transport through the photoreceptor cilium. J Neurosci

19:6267-74.

Liu, X. Z. (2002) The clinical presentation of DFNB2. Adv Otorhinolarynngol. 61:

120-123.

Liu, X. Z., Xia, X. J., Ke, X. M., Ouyang, X. M., Du, L. L., Liu, Y. H., Angeli, S.,

Telischi, F. F., Nance, W. E., Balkany, T., Xu, L. R. (2002) The prevalence of connexin

26 (GJB2) mutations in the Chinese population. Hum Genet 111:394-397.

Lloyd, R. V., Vidal, S, Jin, L., Zhang, S., Kovacs, K., Horvath, E., Scheithauer, B. W.,

Boger, E. T., Fridell, R. A., Friedman, T. B. (2001) Myosin XVA expression in the

pituitary and in other neuroendocrine tissues and tumors. Am J Pathol 159:1375-1382.

Loomis, P. A., Zheng, L., Sekerkova, G., Changyaleket, B., Mugnaini, E., Bartles, J. R.

(2003) Espin cross-links cause the elongation of microvillus-type parallel actin bundles

in vivo. J Cell Biol 163:1045-1055.

Lucotte, G., Dieterlen, F. The 35delG mutation in the connexin 26 gene (GJB2)

associated with congenital deafness: European carrier frequencies and evidence for its

origin in ancient Greece. (2005) Genet Test 9:20-25

Luijendijk, M. W., Van, W. E., Bischoff, A. M., Krieger, E., Huygen, P. L., Pennings,

R. J., Brunner, H. G., Cremers, C. W., Cremers, F. P, Kremer, H. (2004)

Identification and molecular modelling of a mutation in the motor head domain of

myosin VIIA in a family with autosomal dominant hearing impairment (DFNA11). Hum

Genet 115:149-156.

Lumpkin, E. A., Marquis, R. E., Hudspeth, A. J. (1997) The selectivity of the hair cell's

mechanoelectrical-transduction channel promotes Ca2+

flux at low Ca2+ concentrations.

Proc Natl Acad Sci USA 94:10997-11002.

Lynch, E. D., Lee, M. K., Morrow, J. E., Welcsh, P. L., Leon, P. E., King, M. C. (1997)

Nonsyndromic deafness DFNA1 associated with mutation of a human homolog of the

Drosophila gene diaphanous. Science 278:1315-1318.

Maestrini, E., Korge, B. P., Ocana-Sierra, J., Calzolari, E., Cambiaghi, S., Scudder, P.

M., Hovnanian, A., Monaco, A. P., Munro, C. S. (1999) A missense mutation in

connexin26, D66H, causes mutilating keratoderma with sensorineural deafness

(Vohwinkel's syndrome) in three unrelated families. Hum Mol Genet 8:1237-1243.

Maheshwari, M., Vijaya, R., Ghosh, M., Shastri, S., Kabra, M., Menon, P. S. Screening

of families with autosomal recessive non-syndromic hearing impairment (ARNSHI) for

mutations in GJB2 gene: Indian scenario. (2003) Am J Med Genet 120:180-184

Makishima, T., Kurima, K., Brewer, C. C., Griffith, A. J. (2004) Early onset and rapid

progression of dominant nonsyndromic DFNA36 hearing loss. Otol Neurotol 25:714-

719.

Manley, G. A. (2000) Cochlear mechanisms from a phylogenetic viewpoint. Proc Natl

Acad Sci USA 97:11736-11743.

Maquat, L. E. (2004) Nonsense-mediated mRNA decay: splicing, translational and

mRNP dynamics. Nat Rev Mol Cell Biol 5: 89-99

Marazita, M. L., Ploughman, L. M., Rawlings, B., Remington, E., Arnos, K. S. and


- 153 -

Nance, W. E. (1993) Genetic Epedimiological studies of early onset deafness in U. S.

School-age population. Am J Med Genet 46: 486-491.

Marres, H. A. (1998) Congenital abnormalities of the inner ear. In: Ludman H, Wright

T (eds) Diseases of the Ear. Bath: Arnold & Oxford University Press pp. 288–296.

Mason, J.A. and Herrmann, K. R. (1998) Universal infant hearing screening by

automated auditory brainstem response measurement. Pediatrics 101: 221–228.

Mazeas, R. and Bourguet, J. (1975) [New method of deafness classification]. Ann

Otolaryngol Chir Cervicofac 92:567-72.

Mburu, P., Mustapha, M., Varela, A., Weil, D., El-Amraoui, A., Holme, R. H., Rump,

A., Hardisty, R. E., Blanchard, S., Coimbra, R. S., Perfettini, I., Parkinson, N., Mallon,

A. M., Glenister, P., Rogers, M. J., Paige, A. J., et al. (2003) Defects in whirlin, a PDZ

domain molecule involved in stereocilia elongation, cause deafness in the whirler mouse

and families with DFNB31. Nat Genet 34:421-428.

Mehl, A. L., and Thomson, V. (1998) Newborn hearing screening: the great omission.

Pediatrics 101: 1–6.

Mehl, A. L., and Thomson, V. (2002) The Colorado newborn hearing screening project,

1992–1999: on the threshold of effective population-based universal newborn hearing

screening. Pediatrics 109: 1–8.

Melchionda, S., Ahituv, N., Bisceglia, L., Sobe, T., Glaser, F., Rabionet, R., Arbones, M.

L., Notarangelo, A., Di Iorio, E., Carella, M., Zelante, L., Estivill, X., Avraham, K. B.,

Gasparini, P. (2001) MYO6, the human homologue of the gene responsible for deafness

in Snell's waltzer mice, is mutated in autosomal dominant nonsyndromic hearing loss.

Am J Hum Genet 69, 635-640.

Merin, S., Abraham, F. A., Auerbach, E. (1974) Usher's and Hallgren's syndromes.

Acta Genet Med Gemellol (Roma) 23:49-55.

Meyer,C. G., Gasmelseed, N. M., Mergani, A., Magzoub, M. M., Muntau, B., Thye, T.,

Horstmann, R. D. (2005) Novel TMC1 structural and splice variants associated with

congenital nonsyndromic deafness in a Sudanese pedigree. Hum Mutat 25:100.

Mhatre, A. N. and Lalwani, A. K. (1996) Molecular genetics of deafness. Otolaryngol

Clin North Am 29: 421–435.

Mir, A., Ansar, M., Chahrour, M. H., Pham, T. L., Wajid, M., Haque, S., Yan, K.,

Ahmad, W., Leal, S. M. (2005) Mapping of a novel autosomal recessive nonsyndromic

deafness locus (DFNB46) to chromosome 18p11.32-p11.31. Am J Med Genet A 133:23-

26.

Mitchem, K. L., Hibbard, E., Beyer, L. A., Bosom, K., Dootz, G. A., Dolan, D. F.,

Johnson, K. R., Raphael, Y., Kohrman, D. C. (2002) Mutation of the novel gene Tmie

results in sensory cell defects in the inner ear of spinner, a mouse model of human

hearing loss DFNB6. Hum Molec Genet 11:1887-1898.

Modamio-Hoybjor, S., Moreno-Pelayo, M. A., Mencia, A., del Castillo, I., Chardenoux,

S., Armenta, D., Lathrop, M., Petit, C., Moreno, F. (2003) A novel locus for autosomal

dominant nonsyndromic hearing loss (DFNA44) maps to chromosome 3q28-29. Human

Genet 112:24-28.


- 154 -

Morell, R. J., Kim, H. J., Hood, L. J., Goforth, L., Friderici, K., Fisherm, R., Van Camp,

G., Berlin, C. I., Oddoux, C., Ostrer, H., Keats, B., Friedman, T. B. Mutations in the

connexin 26 gene (GJB2) among Ashkenazi Jews with nonsyndromic recessive deafness.

(1998) N Engl J Med 339:1500-1505

Morell, R. J., Friderici, K. H., Wei, S., Elfenbein, J. L., Friedman, T. B., Fisher, R. A. A.

(2000) new locus for late-onset, progressive, hereditary hearing loss DFNA20 maps to

17q25. Genomics 63:1-6.

Moreno-Pelayo, M. A., delCastillo, I., Villamar, M., Romero, L., Hernandez-Calvin, F.

J., Herraiz, C., Barbera, R., Navas, C., Moreno, F. (2001) A cysteine substitution in the

zona pellucida domain of alpha-tectorin results in autosomal dominant, postlingual,

progressive, mid frequency hearing loss in a Spanish family. J Med Genet 38:13.

Morle, L., Bozon, M., Alloisio, N., Latour, P., Vandenberghe, A., Plauchu, H., Collet, L.,

Edery, P., Godet, J., Lina-Granade, G. (2000) A novel C202F mutation in the

connexin26 gene (GJB2) associated with autosomal dominant isolated hearing loss. J.

Med. Genet. 37:368-370.

Morton, N. E. (1991) Genetic epidemiology of hearing impairment. Ann N Y Acad Sci

630:16-31.

Mustapha, M., Weil, D., Chardenoux, S., Elias, S., El-Zir, E., Beckmann, J. S., Loiselet,

J., Petit, C. (1999) An alpha-tectorin gene defect causes a newly identified autosomal

recessive form of sensorineural pre-lingual non-syndromic deafness, DFNB21. Hum Mol

Genet 8:409-412.

Mustapha, M., Chouery, E., Torchard-Pagnez, D., Nouaille, S., Khrais, A., Sayegh, F.

N., Megarbane, A., Loiselet, J., Lathrop, M., Petit, C. and Weil, D. (2002) A novel

locus for Usher syndrome type I, USH1G, maps to chromosome 17q24-25. Hum Genet

110:348-50.

Najera, C., Beneyto, M., Blanca, J., Aller, E., Fontcuberta, A., Millan, J. M., Ayuso, C.

Mutations in myosin VIIA (MYO7A) and usherin (USH2A) in Spanish patients with

Usher syndrome types I and II, respectively. (2002) Hum Mutat 20:76-77

Najmabadi, H., Nishimura, C., Kahrizi, K., Riazalhosseini, Y., Malekpour, M., Daneshi,

A., Farhadi, M., Mohseni, M., Mahdieh, N., Ebrahimi, A., Bazazzadegan, N., Naghavi,

A., Avenarius, M., Arzhangi, S., Smith, R. J. GJB2 mutations: passage through Iran.

(2005) Am J Med Genet 133:132-137

Nance, W. E. (2003) The genetics of deafness. Mental retardation and developmental

disabilities. Research reviews 9: 109–119.

Naz, S., Giguere, C. M., Kohrman, D. C., Mitchem, K. L., Riazuddin, S., Morell, R. J.,

Ramesh, A., Srisailpathy, S., Deshmukh, D., Riazuddin, S., Griffth, A. J., Friedman T.

B., Smith, R. J., Wilcox, E. R. (2002) Mutations in a novel gene, TMIE, are associated

with hearing loss linked to DFNB6 locus. Am J Hum Genet: 71: 632-636.

Naz, S., Alasti, F., Mowjoodi, A., Riazuddin, S., Sanati, M. H., Friedman, T. B., Griffith,

A. J., Wilcox, E. R. Riazuddin, S. (2003) Distinctive audiometric profile associated with

DFNB21 alleles of TECTA. J Med Genet 40:360-363.

Naz, S., Griffith, A. J., Riazuddin, S., Hampton, L. L., Battey, J. F. Jr., Khan, S. N.,

Riazuddin, S., Wilcox, E. R., Friedman, T. B. (2004) Mutations of ESPN cause

autosomal recessive deafness and vestibular dysfunction. J Med Genet 41:591-595.


- 155 -

Nelson, W. J., Nusse, R. (2004) Convergence of Wnt, -catenin, and cadherin pathways.

Science 303:1483-1487.

Newton, V. E. (1985) Aetiology of bilateral sensorineural hearing loss in young

children. Journal of Laryngology and Otology (Suppl) 10: 1–57.

Ohmori, H. (1985) Mechano-electrical transduction currents in isolated vestibular hair

cells of the chick. J Physiol 359:189−217.

Oliver, T. N., Berg, J. S., Cheney, R. E. (1999) Tails of unconventional myosins. Cell

Mol Life Sci 56:243-2457.

Ott, J. (1991) Analysis of Human Genetic Linkage. Johns Hopkins University Press,

Baltimore.

Ouyang, X. M., Yan, D., Du, L. L., Hejtmancik, J. F., Jacobson, S. G., Nance, W. E.,

Li, A. R., Angeli, S., Kaiser, M., Newton, V., Brown, S. D., Balkany, T., Liu, X. Z.

(2005) Characterization of Usher syndrome type I gene mutations in an Usher syndrome

patient population. Hum Genet 116: 292-299.

Pandya, A., Arnos, K. S., Xia, X. J., Welch, K. O., Blanton, S. H., Friedman, T. B.,

Sanchez, G. G., Liu, X. Z., Morell, R., Nance, W. E. (2003) Frequency and distribution

of GJB2 (connexin 26) and GJB6 (connexin 30) mutations in a large North American

repository of deaf probands. Genet Med 5:295-303.

Park, H. J., Shaukat, S., Liu, X. Z., Hahn, S. H., Naz, S., Ghosh, M., Kim, H. N.,

Moon, S. K., Abe, S., Tukamoto, K., Riazuddin, S., Kabra, M., Erdenetungalag, R.,

Radnaabazar, J., Khan, S., Pandya, A., Usami, S. I., Nance, W. E., Wilcox, E. R.,

Riazuddin, S., Griffith, A. J. (2003) Origins and frequencies of SLC26A4 (PDS)

mutations in east and south Asians: global implications for the epidemiology of deafness.

J Med Genet 40:242-248.

Pataky, F., Pironkova, R., Hudspeth, A. J. (2004) Radixin is a constituent of stereocilia

in hair cells. Proc Natl Acad Sci USA 101:2601-2606.

Parving, A. (1996) Epidemiology of genetic hearing impairment. In: Genetics and

Hearing Impairment. London: Whurr, pp. 73–81.

Parving, A. (1999) The need for universal neonatal hearing screening--some aspects of

epidemiology and identification. Acta Paediatr (Suppl) 432: 69–72.

Pendred, V. (1896). Deaf-mutism and goitre. Lancet 2:532.

Petit, C. (1996) Genes responsible for human hereditary deafness: symphony of a

thousand. Nat Genet 14:385-91.

Petit, C. (2001) Usher syndrome: from genetics to pathogenesis. Annu Rev Genomics

Hum Genet 2:271-97.

Petit, C., Levilliers, J. and Hardelin, J. P. (2001) Molecular genetics of hearing loss.

Annu Rev Genet 35:589-646.

Phelps, P. D., Coffey, R. A., Trembath, R. C., Luxon, L. M., Grossman, A. B.,

Britton, K. E., Kendall-Taylor, P., Graham, J. M., Cadge, B. C., Stephens, S. G.,

Pembrey, M. E., Reardon, W. (1998) Radiological malformations of the ear in Pendred

syndrome. Clinical Radiology 53:268–273.


- 156 -

Pickles, J. O., Comis, S. D., Osborne, M. P. (1984) Crosslinks between stereocilia in the

guinea pig organ of Corti, and their possible relation to sensory transduction. Hear Res

15:103-112.

Povey, S., Lovering, R., Bruford, E., Wright, M., LUSH, M., Wain, H. (2001) The

HUGO Gene Nomenclature Committee (HGNC). Hum Genet 109:678-680.

Prezant, T. R., Agapian, J. V., Bohlman, M. C., Bu, X., Oztas, S., Qiu, W. Q., Arnos,

K. S., Cortopassi, G. A., Jaber, L., Rotter, J. I., and et al. (1993) Mitochondrial

ribosomal RNA mutation associated with both antibiotic- induced and nonsyndromic

deafness. Nat Genet 4: 289-294.

Probst, F. J., Fridell, R. A., Raphael, Y., Saunders, T. L., Wang, A., Liang, Y., Morell, R.

J., Touchman, J. W., Lyons, R. H., Noben-Trauth, K., Friedman, T. B., Camper, S. A.

(1998) Correction of deafness in shaker-2 mice by an unconventional myosin in a BAC

transgene. Science 280:1444-1447.

Rabionet, R., Gasparini, P., Estivill, X. (2000) Molecular genetics of hearing

impairment due to mutations in gap junction genes encoding beta connexins. Hum.

Mutat 16:190-202.

Ramzan, K., Shaikh, R. S., Ahmad, J., Khan, S. N., Riazuddin, S., Ahmed, Z. M.,

Friedman, T. B, Wilcox, E. R., Riazuddin, S. (2005) A new locus for nonsyndromic

deafness DFNB49 maps to chromosome 5q12.3-q14.1. Hum Genet 116:17-22

Raphael, Y., Kobayashi, K. N., Dootz, G. A., Beyer, L. A., Dolan, D. F., Burmeister, M.

(2001) Severe vestibular and auditory impairment in three alleles of Ames waltzer (av)

mice. Hear Res:151:237-249.

Reardon, W. (1990) Sex linked deafness: Wilde revisited. J Med Genet 27: 376–379.

Reardon, W., Coffey, R., Chowdhury, T., Grossman, A., Jan, H., Button, K., Kendall- L.

S.,Taylor, P., Trembath, R. (1997) Prevalence, age of onset, and natural history of

thyroid disease in Pendred syndrome. J Med Genet 36:595-598.

Reardon, W., O'Mahoney, C. F., Trembath, R., Jan, H., Phelps, P. D. (2000) Enlarged

vestibular aqueduct: a radiological marker of Pendred syndrome, and mutation of the

PDS gene. Quart J Med 93:99-104.

Rehm, H. L. (2003). Genetics and the genome project. Ear and Hearing 24.

Riazuddin, S., Castelein, C. M., Ahmed, Z. M., Lalwani, A. K., Mastroianni, M. A., Naz,

S., Smith, T. N., Liburd, N. A., Friedman, T. B., Griffith, A. J., Riazuddin, S., Wilcox, E.

R. (2000) Dominant modifier DFNM1 suppresses recessive deafness DFNB26 Nat Genet

26(4):431-434.

Richardson GP, Russell IJ, Duance VC, Bailey AJ. Polypeptide composition of the

mammalian tectorial membrane. (1987) Hear Res 25: 45–60

Richardson, G. P., Forge, A., Kros, C. J., Fleming, J., Brown, S. D., Steel, K. P. (1997) -

Myosin VIIA is required for aminoglycoside accumulation in cochlear hair cells. J

Neurosci 17:9506-9519.

Richardson, G. P., Forge, A., Kros, C. J., Marcotti, W., Becker, D., Williams, D. S.,

Thorpe, J., Fleming, J., Brown, S. D. and Steel, K. P. (1999) A missense mutation in

myosin VIIA prevents aminoglycoside accumulation in early postnatal cochlear hair

cells. Ann N Y Acad Sci 884:110-24.


- 157 -

Richardson NB, Savage JE, Cefaratti LK, Yoo TJ. Electron-microscopic localization of

type II, IX, and V collagen in the organ of Corti of the gerbil. (1992) Cell Tissue Res

267: 413–8

Rodgers KD, Barritt L, Miner JH, Cosgrove D. The laminins in the murine inner ear:

developmental transitions and expression in cochlear basement membranes. (2001) Hear

Res 158: 39–50

Rose, S. P., Conneally, P. M., Nance, W. E. (1977) Genetic analysis of childhood

deafness. In: Bess FH, editor. Childhood Deafness. New York:Grune & Stratton. p 19

–35.

Rzadzinska, A. K., Schneider, M. E., Davies, C., Riordan, G. P., Kachar, B. (2004) An

actin molecular treadmill and myosins maintain stereocilia functional architecture and

self-renewal J Cell Biol 164:887-897.

Sank, D. (1963) Genetic aspects of early total deafness. In Family and mental health

problems in a deaf population (ed. J.D. Rainer, K.Z. Altshuler, and F.J. Kallman),

New York State Psychiatric Institute, New York, NY pp. 28–81.

Sankila, E. M., Pakarinen, L., Kaariainen, H., Aittomaki, K., Karjalainen, S., Sistonen,

P., de la Chapelle, A. (1995) Assignment of an Usher syndrome type III (USH3) gene to

chromosome 3q. Hum Mol Genet 4:93-8.

Santos, R. L., Wajid, M., Pham, T. L., Hussan, J., Ali, G., Ahmad, W., Leal, S. M.

(2005) Low prevalence of Connexin 26 (GJB2) variants in Pakistani families with

autosomal recessive nonsyndromic hearing impairment. Clin Genet 67:61-68.

Sato, E., Nakashima, T., Miura, Y., Furuhashi, A., Nakayama, A., Mori, N., Murakami,

H., Naganawa, S., Tadokoro, M. (2001) Phenotypes associated with replacement of His

by Arg in the Pendred syndrome gene. Eur J Endocrinol 145:697-703.

Schaffer, A. A., Gupta, S. K., Shriram, K., Cottingham, R. W., Jr. (1994) Avoiding

recomputation in linkage analysis. Hum Hered 44:225-37.

Schaffer, A. A. (1996) Faster linkage analysis computations for pedigrees with loops or

unused alleles. Hum Hered 46:226-35.

Schneider, M. E., Belyantseva, I. A., Azevedo, R. B., Kachar, B. (2002) Rapid renewal

of auditory hair bundles. Nature 418:837-838.

Schulte BA, Adams JC. Immunohistochemical localization of vimentin in the gerbil

inner ear (1989). J Histochem Cytochem 37: 1787–97

Scott, D. A., Carmi, R., Elbedour, K., Yosefsberg, S., Stone, E. M., Sheffield, V. C.

(1996) An autosomal recessive nonsyndromic-hearing-loss locus identified by DNA

pooling using two inbred Bedouin kindreds. Am J Hum Genet 59:385-391.

Scott, D. A., Kraft, M. L., Stone, E. M., Sheffield, V. C., Smith, R. J. (1998)

Connexin mutations and hearing loss. Nature 391:32.

Scott, D. A., and Karniski, L. P. (2000) Human pendrin expressed in Xenopus laevis

oocytes mediates chloride/formate exchange. American Journal of Physiology. Cell

Physiology 278:C207–211.

Scott, H. S., Kudoh, J., Wattenhofer, M., Shibuya, K., Berry, A., Chrast, R., Guipponi,

M., Wang, J., Kawasaki, K., Asakawa, S., et al. (2001) Insertion of beta-satellite repeats


- 158 -

identifies a transmembrane protease causing both congenital and childhood onset

autosomal recessive deafness. Nat Genet 27: 59-63.

Seeman, P., Malikova, M., Raskova, D., Bendova, O., Groh, D., Kubalkova, M.,

Sakmaryova, I., Seemanova, E., Kabelka, Z. Spectrum and frequencies of mutations in

the GJB2 (Cx26) gene among 156 Czech patients with pre-lingual deafness. (2004) Clin

Genet 66:152-157

Self, T., Mahony, M., Fleming, J., Walsh, J., Brown, S. D., Steel, K. P. (1998) Shaker-1

mutations reveal roles for myosin VIIA in both development and function of cochlear

hair cells. Development 125:557-566.

Self, T., Sobe, T., Copeland, N. G., Jenkins, N. A., Avraham, K. B., Steel, K. P. (1999)

Role of myosin VI in the differentiation of cochlear hair cells. Dev Biol 214:331-341.

Siemens, J., Lillo, C., Dumont, R. A., Reynolds, A., Williams, D. S., Gillespie, P. G.,

Muller, U. (2004) Cadherin 23 is a component of the tip link in hair-cell stereocilia.

Nature 428:950-955.

Shaikh, R. S., Ramzan, K., Nazli, S., Sattar, S., Khan, S. N., Riazuddin, S., Ahmed, Z.

M., Friedman, T. B., Riazuddin, S., (2005) A New Locus for Nonsyndromic Deafness

DFNB51 Maps to Chromosome 11p13-p12. Am J Med Genet Published Online

Sheffield, V. C., Kraiem, Z., Beck, J. C., Nishimura, D., Stone, E. M., Salameh, M.,

Sadeh, O., Glaser, B. (1996) Pendred syndrome maps to chromosome 7q21-34 and is

caused by an intrinsic defect in thyroid iodine organification. Nat Genet 12:424-426.

Sheng, M., Sala, C. (2001) PDZ domains and the organization of supramolecular

complexes. Annu Rev Neurosci 24:1-29.

Shepherd, G. M., Corey, D. P. (1994) The extent of adaptation in bullfrog saccular hair

cells. J Neurosci 14:6217-6229.

Simmler MC, Zwaenepoel I, Verpy E et al. Twister mutant mice are defective for

otogelin, a component specific to inner ear acellular membranes. (2000) Mamm Genome

11: 960–966

Slepecky NB. Structure of the mammalian cochlea. In: Dallos P, Popper AN, Fay RR.

(eds) The Cochlea. (1996) New York: Springer 44–129

Smith, R. J., Lee, E. C., Kimberling, W. J., Daiger, S. P., Pelias, M. Z., Keats, B. J.,

Jay, M., Bird, A., Reardon, W., Guest, M. and et al. (1992) Localization of two genes

for Usher syndrome type I to chromosome 11. Genomics 14:995-1002.

Smits, B. M. G., Peters, T. A., Mul , J. D., Croes, H. J., Fransen, J. A. M., Beynon,

A. J., Guryev, V., Plasterk, R. H. A., Cuppen, E. (2005) Identification of a rat model

for usher syndrome type 1B by ENU mutagenesis-driven forward genetics. Genetics

Published Online June 18

Sollner, C., Rauch, G. J., Siemens, J., Geisler, R., Schuster, S. C., Muller, U., Nicolson,

T (2004) Mutations in cadherin 23 affect tip links in zebrafish sensory hair cells. Nature

428:955-959.

Steel, K. P., Kros, C. J. (2001) A genetic approach to understanding auditory function.

Nat Genet 27:143-149.

Steel, K. P. (2002) Varitint-waddler: a double whammy for hearing. Proc Natl Acad Sci

USA 99:14613-4615.


- 159 -

Stephens, S.D.G. (1985) Genetic hearing loss: A historical overview. Adv. Audiol. 3:

3–17.

Steyger, P. S., Gillespie, P. G., Baird, R. A. (1998) Myosin Ibeta is located at tip link

anchors in vestibular hair bundles. J Neurosci 18:4603-4615.

Stevenson, A. C. and Cheeseman, E. A. (1956) Hereditary deaf mutism, with

particular reference to Northern Ireland. Ann Hum Genet 20: 177–207.

Strachen, T. and Read, A. P. (1996) DNA structure and gene expression. Am J Hum

Genet 71:1-26.

Street, V. A., McKee-Johnson, J. W., Fonseca, R. C., Tempel, B. L., Noben-Trauth, K.

(1998) Mutations in a plasma membrane Ca2C-ATPase gene cause deafness in

deafwaddler mice. Nat Genet 19:390–394.

Street, V. A., Kallman, J. C., Kiemele, K. L. (2004) Modifier controls severity of a

novel dominant low-frequency MyosinVIIA (MYO7A) auditory mutation. J Med Genet

41:e62.

Sunose, H., Liu, J., Marcus, D. C. cAMP increases K+ secretion via activation of apical

IsK/KvLQT1 channels in strial marginal cells. (1997) Hear Res 114:107-116

Tamagawa, Y., Kitamura, K., Ishida, T., Ishikawa, K., Tanaka, H., Tsuji, S. Nishizawa,

M. (1996) A gene for a dominant form of nonsyndromic sensorineural deafness

(DFNA11) maps within the region containing the DFNB2 recessive deafness gene. Hum

Mol Genet 5:849-52.

Tamayo, M. L., Bernal, J. E., Tamayo, G. E., Frias, J. L., Alvira, G., Vergara, O.,

Rodriguez, V., Uribe, J. I., Silva, J. C. (1991) Usher syndrome: results of a screening

program in Colombia. Clin Genet 40:304-311.

Tanaka, K., Watase, K., Manabe, T., Yamada, K., Watanabe, M., Takahashi, K., Iwama,

H., Nishikawa, T., Ichihara, N., Kikuchi, T., Okuyama, S., Kawashima, N., Hori, S.,

Takimoto, M., Wada, K. (1997) Epilepsy and exacerbation of brain injury in mice

lacking the glutamate transporter GLT-1. Science 276:1699-1702.

Tatusova, T. A., Madden, T. L (1999) BLAST 2 Sequences, a new tool for comparing

protein and nucleotide sequences. FEMS Microbiol Lett 174: 247-250.

Tekin, M., Akar, N., Cin, S., Blanton, S. H., Xia, X. J., Liu, X. Z., Nance, W. E., Pandya,

A. Connexin 26 (GJB2) mutations in the Turkish population: implications for the origin

and high frequency of the 35delG mutation in Caucasians. (2001) Hum Genet 108:385-

389

Terwillger, J. D. and Ott, J. (1994) Handbook of human genetic linkage. Baltimore,

John Hopkins University Press.

Thorne, R. F., Legg, J. W., Isacke, C.M. (2004) The role of the CD44 transmembrane

and cytoplasmic domains in co-ordinating adhesive and signalling events. J Cell Sci

117:373-380.

Thompson, R. F., Langford, G. M. 2002. Myosin superfamily evolutionary history. Anat.

Rec. 268:276-289.

Tilney, L. G., Derosier, D. J. & Mulroy, M. J. (1980) The organization of actin filaments

in the stereocilia of cochlear hair cells. J. Cell Biol. 86:244-259.


- 160 -

Tomaski, S. M., and Grundfast, K. M. (1999) A stepwise approach to the diagnosis and

treatment of hereditary hearing loss. Pediatr Clin North Am 46:35-49.

Trussell, L. (2000) Mutant ion channel in cochlear hair cells causes deafness. Proc Natl

Acad Sci U S A 97:3786-3788.

Tseng, C. J. and Lalwani, A. K. (2000) Cracking the Auditory Genetic Code: Part II

Syndromic Hereditary Hearing Impairment. Am J Otol 21:437-451.

Tsukita, S., Yonemura, S. (1999) Cortical actin organization: lessons from ERM

(ezrin/radixin/moesin) proteins. J Biol Chem 274:34507-34510.

Tyska, M. J., Mooseker, M. S. (2002) MYO1A (brush border myosin I) dynamics in the

brush border of LLC-PK1-CL4 cells. Biophys J 82:1869-1883.

Underhill, C. (1992) CD44: the hyaluronan receptor. J Cell Sci 03:293-298.

Usami, S., Abe, S., Weston, M. D., Shinkawa, H., Van Camp, G., Kimberling, W. J.

(1999) Nonsyndromic hearing loss associated with enlarged vestibular aqueduct is

caused by PDS mutations. Hum Genet 104:188-192.

Usher, C. H. (1914) On the inheritance of retinitis pigmentosa, with notes of cases. R

Lond Ophthalmol Hosp Rep 19:130-236.

Van Camp, G., Willems, P. J., Smith, R. J. H. (1997) Nonsyndromic hearing

impairment unparalleled heterogeneity. Am J Hum Genet 60: 758–764.

Van Hauwe, P., Everett, L. A., Coucke, P., Scott, D. A., Kraft, M. L., Ris-Stalpers, C.,

Bolder, C., Otten, B., de Vijlder, J. J., Dietrich, N. L., Ramesh, A., Srisailapathy, S. C.,

Parving, A., Cremers, C. W., Willems, P. J., Smith, R. J., Green, E. D., Van Camp, G.

(1998) Two frequent missense mutations in pendred syndrome. Hum Mol Genet 7:1099-

1104.

van Rijn, P. M., and Cremers, C. W. R. J. (1991). Causes of childhood deafness at a

Dutch school for the hearing impaired. The Annals of Otology, Rhinology and

Laryngology 100: 903– 908.

van Wijk, E., Krieger, E., Kemperman, M. H., De Leenheer, E. M. R., Huygen, P. L. M.,

Cremers, C. W. R. J., Cremers, F. P. M., Kremer, H. (2003) A mutation in the gamma

actin 1 (ACTG1) gene causes autosomal dominant hearing loss (DFNA20/26). J. Med.

Genet. 40:879-884.

Verhoeven, K., Van Laer, L., Kirschhofer, K., Legan, P. K., Hughes, D. C., Schatteman,

I., Verstreken, M., Van Hauwe, P., Coucke, P., Chen, A., Smith, R. J., Somers, T.,

Offeciers, F. E., VandeHeyning, P., Richardson, G. P., Wachtler, F., Kimberling, W. J.,

Willems, P. J., Govaerts, P. J., Van Camp, G. (1998) Mutations in the human alpha-

tectorin gene cause autosomal dominant nonsyndromic hearing impairment. Nat Genet

19:60-62.

Vernon, M. (1969) Usher's syndrome--deafness and progressive blindness. Clinical

cases, prevention, theory and literature survey. J Chronic Dis 22:133-151.

Verpy, E., Leibovici, M., Zwaenepoel, I., Liu, X. Z., Gal, A., Salem, N., Mansour, A.,

Blanchard, S., Kobayashi, I., Keats, B. J., Slim, R., Petit, C. (2000) A defect in

harmonin, a PDZ domain-containing protein expressed in the inner ear sensory hair cells,

underlies usher syndrome type 1C. Nat Genet 26:51-55.


- 161 -

Veske, A., Oehlmann, R., Younus, F., Mohyuddin, A., Muller-Myhsok, B., Mehdi, S. Q.,

Gal, A. (1996) Autosomal recessive non-syndromic deafness locus (DFNB8) maps on

chromosome 21q22 in a large consanguineous kindred from Pakistan. Hum Mol Genet

5:165-168.

Vilfan, A, Duke, T. (2003) Two adaptation processes in auditory hair cells together can

provide an active amplifier. Biophys J 85:191-203.

von Graefe, A. (1858) Vereinzelte Beobachtungen und Bemerkungen. Exceptionelle

Verhalten des Gesichtsfeldes bei Pigmentenartung des Netzhaut. Albrecht Graefes Arch

Klin Ophthalmol 4:250-3.

Vreugde, S., Erven, A., Kros, C. J., Marcotti, W., Fuchs, H., Kurima, K., Wilcox, E. R.,

Friedman, T. B., Griffith, A. J., Balling, R., Hrabe De Angelis, M., Avraham, K. B.,

Steel, K. P. (2002) Beethoven, a mouse model for dominant, progressive hearing loss

DFNA36. Nat Genet 30:257-258.

Wajid, M., Abbasi, A. A., Ansar, M., Pham, T. L., Yan, K., Haque, S., Ahmad, W. Leal,

S. M. (2003) DFNB39, a recessive form of sensorineural hearing impairment, maps to

chromosome 7q11.22-q21.12. Eur J Hum Genet 11:812-815.

Wang, A., Liang, Y., Fridell, R. A., Probst, F. J., Wilcox, E. R., Touchman, J. W.,

Morton, C. C., Morell, R. J., Noben-Trauth, K., Camper, S. A., Friedman, T. B.

(1998) Association of unconventional myosin MYO15 mutations with human

nonsyndromic deafness DFNB3. Science 280: 1447-1451.

Walker, A. H., Najarian, D., White, D. L., Jaffe, J. F., Kanetsky, P. A, Rebbeck, T. R.

(1999) Collection of genomic DNA by buccal swabs for polymerase chain reaction-

based biomarker assays. Environ Health Perspect 107:517-20.

Wallis, C., Ballo, R., Wallis, G., Beighton, P., Goldblatt, J. (1988) X-linked mixed

deafness with stapes fixation in a Mauritian kindred: linkage to Xq probe pDP34.

Genomics 3: 299-301.

Wayne, S., Der Kaloustian, V. M., Schloss, M., Polomeno, R., Scott, D. A.,

Hejtmancik, J. F., Sheffield, V. C. and Smith, R. J. (1996) Localization of the Usher

syndrome type ID gene (USH1D) to chromosome 10. Hum Mol Genet 5:1689-92.

Wayne, S., Lowry, R. B., McLeod, D. R., Knaus, R., Farr, C. and Smith, R. J. H.

(1997) Localization of the Usher syndrome type IF (USH1F) to chromosome 10. Am J

Hum Genet 61:300 Suppl.

Weil, D., Blanchard, S., Kaplan, J., Guilford, P., Gibson, F., Walsh, J., Mburu, P.,

Varela, A., Levilliers, J., Weston, M. D., et al. (1995) Defective myosin VIIA gene

responsible for usher syndrome type 1B. Nature 374:60-61.

Weil, D., Kussel, P., Blanchard, S., Levy, G., Levi-Acobas, F., Drira, M., Ayadi, H.,

Petit, C. (1997) The autosomal recessive isolated deafness, DFNB2, and the Usher 1B

syndrome are allelic defects of the myosin-VIIA gene. Nat Genet 16:191-193.

Weil, D., El-Amraoui, A., Masmoudi, S., Mustapha, M., Kikkawa, Y., Laine, S.,

Delmaghani, S., Adato, A., Nadifi, S., Zina, Z. B., Hamel, C., Gal, A., Ayadi, H.,

Yonekawa, H., Petit, C. (2003) Usher syndrome type I G (USH1G) is caused by

mutations in the gene encoding SANS, a protein that associates with the USH1C protein,

harmonin. Hum Mol Genet 12: 463-71.


- 162 -

Wells, A. L., Lin, A. W., Chen, L. Q., Safer, D., Cain, S. M., Hasson, T., Carragher, B.

O., Milligan, R. A., Sweeney, HL. (1999) Myosin VI is an actin-based motor that moves

backwards. Nature 401, 505-508.

Weston, M. D., Kelley, P. M., Overbeck, L. D., Wagenaar, M., Orten, D. J., Hasson,

T., Chen, Z. Y., Corey, D., Mooseker, M., Sumegi, J., Cremers, C., Moller, C.,

Jacobson, S. G., Gorin, M. B. and Kimberling, W. J. (1996) Myosin VIIA mutation

screening in 189 Usher syndrome type 1 patients. Am J Hum Genet 59:1074-83.

Weston, M. D., Carney, C. A., Rivedal, S. A. and Kimberling, W. J. (1998) Spectrum

of myosin VIIA mutations causing Usher syndrome type 1b. Paper presented at Assoc

Res Otolaryngol Abs.

White, K. R., Vohr, B. R., Behrens, T. R. (1993) Universal newborn hearing screening

using transient evoked otoacoustic emissions: results of the Rhode Island Hearing

Assessment Project. Semin Hear 14: 18–29.

Wilcox, E. R., Burton, Q. L., Naz, S., Riazuddin, S., Smith, T. N., Ploplis, B.,

Belyantseva, I., Ben-Yosef, T., Liburd, N. A., Morell, R. J., Kachar, B., Wu, D. K.,

Griffith, A. J., Riazuddin, S., Friedman, T. B. (2001). Mutations in the Gene Encoding

Tight Junction Claudin-14 Cause Autosomal Recessive Deafness DFNB29. Cell

104:165-172.

Wilson, S. M., Householder, D. B., Coppola, V., Tessarollo, L., Fritzsch, B., Lee, E. C.,

Goss, D., Carlson, G. A., Copeland, N. G., Jenkins, N. A. (2001) Mutations in Cdh23

cause nonsyndromic hearing loss in waltzer mice. Genomics 74:228-233.

Wu, Q. and Maniatis, T. (1999) A striking organization of a large family of human

neural cadherin-like cell adhesion genes. Cell 97:779-90.

Yamoah, E. N., Lumpkin, E. A., Dumont, R. A., Smith, P. J., Hudspeth, A. J.,

Gillespie, P. G. (1998) Plasma membrane Ca2C-ATPase extrudes Ca2C from hair cell

stereocilia. J. Neurosci 18: 610–624.

Zheng, J., Shen, W., He, D. Z., Long, K. B., Madison, L. D. and Dallos, P. (2000)

Prestin is the motor protein of cochlear outer hair cells. Nature 405:149-155.

Zheng, L., Sekerkova, G., Vranich, K., Tilney, L. G., Mugnaini, E., Bartles, J. R. (2000a)

The deaf jerker mouse has a mutation in the gene encoding the espin actin-bundling

proteins of hair cell stereocilia and lacks espins. Cell 102:377-385.

Zheng, Q. Y., Yan, D., Ouyang, X. M., Du, L. L., Yu, H., Chang, B., Johnson, K. R.,

Liu, X. Z. Digenic inheritance of deafness caused by mutations in genes encoding

cadherin 23 and protocadherin 15 in mice and humans. (2005) Hum Mol Genet 14:103-

111

Zhu, M., Yang, T., Wei, S., DeWan, A. T., Morell, R. J., Elfenbein, J. L., Fisher, R. A.,

Leal, S. M., Smith, R. J., Friderici, K. H. (2003) Mutations in the γ-actin gene (ACTG1)

are associated with dominant progressive deafness (DFNA20/26). Am J Hum Genet

73:1082-1091.

Zina, Z. B., Masmoudi, S., Ayadi, H., Chaker, F., Ghorbel, A. M., Drira, M., Petit, C.

(2001) From DFNB2 to Usher syndrome: variable expressivity of the same disease. Am

J Med Genet 101:181-183.


- 163 -

Electronic database information

Center for Medical Genetics, Marshfield Medical Research Foundation:

http://research.marshfieldclinic.org/genetics/

Hereditary Hearing Loss Homepage:

http://dnalab-www.uia.ac.be/dnalab/hhh/

Online Mendelian Inheritance in Man (OMIM):

http://www.ncbi.nlm.nih.gov/entrez/OMIM

Primer3 Web-Based Server (primer3_www.cgi v 0.2)

http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi

The Human Genome Organization (HUGO)

http://www.gene.ucl.ac.uk/hugo/

UCSC Genome Bioinformatics:

http://genome.ucsc.edu/

Documents

Rehan Sadiq Sheikh's Ph.D Thesis