Research ArticleAssociations of C1qTNF-Related Protein-9Levels in Serum and Epicardial Adipose Tissue withCoronary Atherosclerosis in Humans

Jing Wang1 Tao Hang1 Xun-min Cheng1 De-min Li2 Qi-gao Zhang1 Li-jun Wang1

Yong-ping Peng1 and Jian-bin Gong1

1Department of Cardiology Jinling Hospital Clinical School of Medical College Nanjing University Nanjing 210002 China2Department of Cardiothoracic Surgery JinlingHospital Clinical School ofMedical College NanjingUniversity Nanjing 210002 China

Correspondence should be addressed to Jing Wang wangjing njdoc163com and Jian-bin Gong gongjianbingjb126com

Received 9 April 2015 Revised 30 June 2015 Accepted 2 July 2015

Academic Editor Rei Shibata

Copyright copy 2015 Jing Wang et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Objective To investigate the correlation of CTRP9 with coronary atherosclerosisMethods Coronary angiography confirmed CADin 241 patients (62 receivedCABG) and non-CAD in 121 (55 received valve replacement)Results Serum levels of LDL-C CRP TNF-120572 IL-6 and leptin in CAD patients were significantly higher than those in non-CAD patients (119875 lt 005) but APN and CTRP9were lower (119875 lt 005) Serum levels of CTRP9 and APN were negatively related to BMI HOMA-IR TNF-120572 IL-6 and leptinbut positively to HDL-C (119875 lt 005) in CAD patients After adjustment of APN CTRP9 was still related to the above parametersSerum CTRP9 was a protective factor of CAD (119875 lt 005) When compared with non-CAD patients leptin mRNA expressionincreased dramatically while CTRP9mRNA expression reduced markedly in epicardial adipose tissue of CAD patients (119875 lt 005)The leptin expression and macrophage count in CAD group were significantly higher than in non-CAD group but CAD patientshad a markedly lower CTRP9 expression (119875 lt 005) Conclusions Circulating and coronary CTRP9 plays an important role in theinflammation and coronary atherosclerosis of CAD patients Serum CTRP9 is an independent protective factor of CAD

1 Introduction

It has been well demonstrated that adipose tissue is anactive endocrine organ and can secrete a variety of bioac-tive molecules known as adipokines These adipokines maymodulate insulin sensitivity and function in a pro- or anti-inflammation capacity in metabolic dysfunction [1 2] Epi-cardial adipose tissue (EAT) is an unusual visceral fat depotwith anatomical and functional contiguity to the myocardi-um and coronary arteries and can secrete adipokines anddirectly mediate the occurrence and extent of coronaryatherosclerosis Thus EAT represents as a novel therapeu-tic target for obesity-related cardiovascular diseases [3 4]Recently a highly conserved family of adiponectin (APN)paralog known as C1qTNF-Related Protein (CTRP) is iden-tifiedThis family has been reported to provide a link betweeninflammation and metabolism [5 6] Of CTRPs CTRP9 isthe closest paralog of APN and has the highest amino acid

sequence homology (54) at the globular domain to APN[6] However few studies have been conducted to investigateCTRP9 and available studies focused on animals Thusthe role of CTRP9 in the pathogenesis of human diseasesespecially CAD is poorly understood In the present studyCTRP9 and other adipokines were detected in the serum andEAT of CAD patients and the relationship of circulating andcoronary CTRP9 with the coronary atherosclerosis (CA) andits risk factors was further evaluated which may elucidatewhether the role of these factors in CAD is independent ofAPN

2 Subjects and Methods

21 Subjects A total of 362 patients received coronaryangiography in the Department of Cardiology of NanjingJinlingHospital betweenDecember 2012 andDecember 2014Of them 241 patients were diagnosed with CAD (62 received

Hindawi Publishing CorporationBioMed Research InternationalVolume 2015 Article ID 971683 6 pageshttpdxdoiorg1011552015971683

2 BioMed Research International

Table 1 Primers used for RT-q PCR

Genes Forward (51015840-31015840) Reverse (51015840-31015840)120573-actin TTGTAACCAACTGGGACGATATGG GATCTTGATCTTCATGGTGCTAGGLeptin GATGACACCAAAACCCTCATC GCCACCACCTCTGTGGAGTAGCTRP9 ACCATGAGGATCTGGTGGCTTCTG TGTGTCATCGTCCT CATCAGCCTRP9 C1qTNF-Related Protein-9

coronary artery bypass grafting (CABG) in the Departmentof Cardiothoracic Surgery) and 121 with non-CAD (55underwent valve replacement) Exclusion criteria includedacute myocardial infarction congestive heart failure cancerthyroid disease chronic renal insufficiency and use of oralcorticosteroidsWritten informed consent was obtained fromeach patient before study and this study was approved by theEthics Committee of our hospital

22 Clinical Data Clinical information was obtained usinga standardized health questionnaire Body weight (kg) andblood pressure (BP mmHg) were measured and bodymass index (BMI) was calculated On admission bloodsamples were collected in the morning after an overnightfast (12ndash14 h) Fasting blood glucose (FBG) total cholesterol(TC) triglyceride (TG) low-density lipoprotein-cholesterol(LDL-C) high-density lipoprotein-cholesterol (HDL-C) C-reactive protein (CRP) and fasting insulin were measuredwith an automatic biochemical analytical instruments inthe Laboratory Center of Nanjing Jinling Hospital Theinsulin sensitivity was estimated with the homeostasis modelassessment (HOMA) which is based on fasting glucose andinsulin concentrations [7] Samples of adipose tissue werecollected during CABG and valve replacement EAT (05 gon average) was collected from the anterior interventricularsulcus These samples were divided into two parts One wasfrozen in liquid nitrogen and stored at minus80∘C for mRNAextraction and the other was fixed in paraformaldehyde forimmunohistochemistry

23 Diagnostic Criteria Diagnostic criteria for hypertensionwere as follows systolic blood pressure was ge140mmHgandor diastolic blood pressure was ge90mmHg or patientshad a history of antihypertensive treatment Diagnostic crite-ria for diabetes were as follows FBGwasge70mmolL 2-hourpostprandial blood glucose was ge111mmolL or patientswere treated with insulin or glucose-lowering drugs

24 Percutaneous Coronary Angiography Conventional cor-onary angiography was performed according to Judkinsrsquoprocedures via the femoral artery or radial artery and at leastfive projections were employed in each patient Quantitativecoronary angiographic analysis was done by calibration andmeasurement of coronary dimensions with a digital sub-traction angiography system (INNOVA 3100 GE HealthcareWaukesha WI USA) by two experienced interventionalcardiologists CAD was defined as 50 or greater stenosis ofa coronary artery

25 Quantitative RT-PCR In brief 100mg EATTAT washomogenized and total RNA was extracted and purifiedaccording to themanufacturerrsquos instructions (Beyotime Insti-tute of Biotechnology) The mRNA purity was determinedby measuring the optical density (OD) at 260 nm (A260)and 280 nm (A280) Additionally the mRNA integrity wasapproximated by 19S ribosomal bands Primers for targetgenes were designed and RT-PCRwas conducted to quantifythe mRNA expression of target genes with a 480 real-timePCR system (Roche Applied Science Indianapolis IN USA)following the standard protocol Primers for leptin CTRP9and 120573-actin are showed in Table 1 The fold change in mRNAexpression was determined after normalization to 120573-actinmRNA expression

26 Immunohistochemistry EAT was embedded in paraffinand cut into 4 120583m sections for hematoxylin and eosin (HampE)staining Sections were also treated with mouse anti-humanleptinmonoclonal antibody (Novus Biologicals USA) rabbitanti-human CTRP9 antibody (Aviscera Bioscience USA) ormouse anti-humanmacrophage antibody (Santa Cruz USA)After visualization these sections were observed under amicroscope and representative images were analyzed withImage-Pro Plus 80 software (Media Cybernetics CambridgeMA USA)

27 ELISA ELISAs were performed according to the man-ufacturerrsquos instructions (Nanjing Well-Offer BiotechnologyCo Ltd) In brief check-board titration was used to opti-mize the concentration of coated and capture antibodiesA standard curve was delineated on the basis of OD ofstandard samples The concentrations of target proteins weredetermined according to the standard curve

28 Statistical Analysis Statistical analysis was carried outwith SPSS version 190 (SPSS Inc Chicago IL USA) Contin-uous quantitative variables are expressed as mean plusmn standarddeviation (SD) and binary variables as percentages 1205942 testwas employed for intergroup comparison Quantitative datawere analyzed with independent Studentrsquos 119905-test or one-wayANOVA among groups GraphPad prism 50 was used for thecorrelation analysis and partial correlation analysis for dual-variant data Multiple logistic regression analysis was used tocalculate an adjusted odd ratio (OR) for the occurrence ofCAD and resultswere presented asORwith a 95confidenceinterval (CI) A two-tailed value of 119875 lt 005 was consideredstatistically significant

BioMed Research International 3

Table 2 Characteristics of subjects in the present study at baseline(119899 = 362)

Non-CAD (119899 = 121) CAD (119899 = 241) 119875 valueAge (years) 6129 plusmn 1147 6251 plusmn 1041 0734Male () 89 (7355) 172 (7137) 0969Smoking () 50 (4132) 103 (4274) 0864Drinking () 43 (3554) 97 (4025) 0493DM () 33 (2727) 95 (3942) 0072HBP () 77 (6364) 140 (5809) 0430BMI (kgm2) 2408 plusmn 162 2502 plusmn 350 0239TC (mmolL) 389 plusmn 106 405 plusmn 089 0492TG (mmolL) 158 plusmn 137 167 plusmn 084 0727HDL-C (mmolL) 113 plusmn 022 105 plusmn 019 0114LDL-C (mmolL) 198 plusmn 061 248 plusmn 078 0009FBG (mmolL) 561 plusmn 208 650 plusmn 335 0256HOMA-IR 150 plusmn 123 269 plusmn 101 0025CRP (mgL) 141 plusmn 107 581 plusmn 123 0034TNF-120572 (pgmL) 731 plusmn 287 826 plusmn 371 0019IL-6 (pgmL) 369 plusmn 082 496 plusmn 135 0039Leptin (pgmL) 742 plusmn 269 823 plusmn 305 0020APN (ngmL) 1067 plusmn 274 941 plusmn 149 0021CTRP9 (pgmL) 9614 plusmn 3313 8389 plusmn 3618 0005DM diabetes mellitus HBP hypertension BMI body mass index TC totalcholesterol TG triglyceride LDL-C low-density lipoprotein-cholesterolHDL-C high-density lipoprotein-cholesterol FBG fasting blood glucoseHOMA-IR homeostasis model of assessment for insulin resistance CRP C-reactive protein TNF-120572 tumor necrosis factor-120572 IL-6 interleukin-6 APNadiponectin CTRP9 C1qTNF-Related Protein-9

3 Results

31 Characteristics of Subjects at Baseline In the presentstudy there were no significant differences in the risk factorsof CAD (including age gender smoking status diabeteshypertension and BMI) between two groups Moreover theserum levels of TC TG HDL-C and FBG between groupswere also comparable (119875 gt 005) However the serum levelsof LDL-C CRP TNF-120572 IL-6 and leptin inCADpatients weremarkedly higher than those in non-CAD patients (119875 lt 005)and serum levels of APN and CTRP9 in CAD patients weredramatically lower than those in non-CAD patients (119875 =0021 and 119875 = 0005 resp) (Table 2)

32 Association of CTRP9 and APN with Cardiovascular RiskFactors Serum levels of CTRP9 and APN were positivelyrelated to BMI HOMA-IR TNF-120572 IL-6 and leptin (119875 lt005) but negatively to HDL-C (119875 lt 005) in CAD patientsIn addition there was a positive relationship between serumCTRP9 and serum APN (119903 = 0769 119875 lt 0001) Afteradjustment for APN CTRP9 was still associated with aboveparameters but the extent of its correlation with BMIHOMA-IR and HDL-C slightly reduced (119903 = minus0211ndashminus0207119875 = 0035 119903 = minus0249ndashminus0191119875 = 0045 and 119903 = 0240ndash0218119875 = 0044 resp) (Table 3)

Table 3 Correlation of CTRP9 and APN with risk factors ofcardiovascular diseases

CTRP9 APN Adjusted APN119903 119875 value 119903 119875 value 119903 119875 value

BMI(kgm2) minus0211 0032 minus0247 0020 minus0207 0035

TC(mmolL) minus0073 0500 minus0029 0791 minus0048 0486

TG(mmolL) minus0085 0494 minus0013 0905 minus0056 0597

HDL-C(mmolL) 0240 0024 0390 0018 0218 0044

LDL-C(mmolL) minus0069 0525 minus0070 0375 minus0036 0655

HOMA-IR minus0249 0032 minus0276 0022 minus0191 0045CRP(mgL) minus0059 0613 minus0170 0146 minus0068 0581

TNF-120572(pgmL) minus0484 lt0001 minus0319 lt0001 minus0388 lt0001

IL-6(pgmL) minus0295 lt0001 minus0198 lt0001 minus0228 lt0001

Leptin(pgmL) minus0662 lt0001 minus0529 lt0001 minus0803 lt0001

APN(ngmL) 0769 lt0001

BMI body mass index TC total cholesterol TG triglyceride LDL-C low-density lipoprotein-cholesterol HDL-C high-density lipoprotein-cholesterol HOMA-IR homeostasis model of assessment for insulin resis-tance CRP C-reactive protein TNF-120572 tumor necrosis factor-120572 IL-6interleukin-6 APN adiponectin CTRP9 C1qTNF-Related Protein-9

Table 4Multiple logistic regression analysis of independent predic-tors of coronary arterial disease

119875 value OR 95 CILower Upper

APN 0002 0504 0303 0720CTRP9 0011 0620 0482 0838Leptin 0042 2103 1003 3813TNF-120572 0039 3091 1204 4186IL-6 0120 1185 0957 1467TNF-120572 tumor necrosis factor-120572 IL-6 interleukin-6 APN adiponectinCTRP9 C1qTNF-Related Protein-9

33 Multiple Logistic Regression Analysis of Independent Pre-dictors of CAD Multiple logistic regression analysis showedserum levels of APN and CTRP9 were protective factorsof CAD (OR = 0504 119875 = 0002 and OR = 0620 119875 =0011 resp) but serum levels of TNF-120572 and leptin wereindependent risk factors of CAD (OR = 3091 119875 = 0039 andOR = 2103 119875 = 0042 resp) However serum IL-6 had noinfluence on CAD (119875 = 0120) (Table 4)

34 Inflammatory Cytokines in EAT EAT was collectedduring CABG and valve replacement and inflammatorycytokines were measured When compared with non-CAD

4 BioMed Research International

patients the leptin mRNA expression in the EAT increasedmarkedly (119875 lt 005) but CTRP9 mRNA expression in theEAT reduced dramatically (119875 lt 005 Figure 1) in CADpatients Immunohistochemistry for leptin and macrophagemarker in the EAT showed that leptin expression andmacrophage count in CAD patients were significantly higherthan those in non-CADpatients while theCTRP9 expressionreduced markedly in CAD patients (Figure 2)

4 Discussion

Adipose tissues have been proved to be a metabolicallyactive organ capable of secreting endocrine and paracrineagents that may potentially affect the cardiovascular systemand are independent risk factors of coronary arterial dis-ease (CAD) Leptin was identified as the first adipokine in1994 and is able to promote the progression of diabetesobesity and atherosclerosis [8] On the contrary APNa member of CTRP family has attracted much interestbecause of its anti-inflammatoryvasculoprotective and anti-ischemiccardioprotective properties To date 15 additionalmembers of the CTRP family have been identified [6]CTRP9 the closest adiponectin paralog is predominantlyexpressed in adipose tissues CTRP9 has attracted a lot ofattention due to its beneficial cardiovascular effects especiallythe antiatherosclerotic effect [9ndash12]

EAT is a heart fat depot and directly contacts withthe myocardium and coronary arteries The pathologicalincrease in EAT and the concomitance of othermetabolic andhemodynamic abnormalities turn it into an adverse lipotoxicprothrombotic and proinflammatory organ [13ndash15] Ourprevious study showed that pericardial adipose tissue volumewas significantly correlated with traditional cardiovascularrisk factors the severity of CA and the number of stenoticcoronary vessels [16] EAT-derived inflammatory cytokinesare also significantly related to the plaque vulnerabilityin CAD When compared with non-CAD patients moremacrophages were found and the expressions of leptin andMMP9 increased markedly in the EAT of CAD patients [17]Thus in the present study the serum and EAT levels ofCTRP9 and other proinflammatory cytokines were detectedin patients with and without CAD aiming at elucidating theinfluence of circulating and coronary CTRP9 on CAD

Our results showed there were no marked differences inthe age gender drinking status smoking status hyperten-sion diabetes andBMI betweenCADpatients and non-CADpatients In CAD patients the serum levels of LDL-C CRPTNF-120572 IL-6 and leptin increased significantly and serumlevels of APN and CTRP9 reduced markedly as comparedto non-CAD patients We further correlated serum levels ofCTRP9 and APN with risk factors of cardiovascular diseasesResults showed bothCTRP9 andAPNwere protective factorsof CAD negatively related to BMI HOMA-IR TNF-120572 IL-6 and leptin (risk factors) and positively related to HDL-C (a protective factor) Moreover there was a positivecorrelation between CTRP9 andAPNThese findings suggestthat CTRP9 like APN may exert antidiabetic and anti-inflammatory effects and regulate the glucose homeostasisprimarily through improving insulin sensitivity

CADNon-CAD

Leptin

mRN

A ex

pres

sion

CTRP9

lowast

lowast

0

1

2

3

4

Figure 1 mRNA expressions of leptin and CTRP9 in theEAT CTRP9 C1qTNF-Related Protein-9 non-CAD noncoronaryartery disease CAD coronary arterial disease EAT epicardialadipose tissue volume lowast119875 lt 005

CTRP9 and adiponectin can form heterotrimers via theglobular C1q domain that circulates in the blood [18] andshares the receptor Adipo R1 with adiponectin in the vascularendothelial cells [19] and cardiomyocytes [20] Therefore weexamined whether the favorable metabolic effects of CTRP9were adiponectin dependent After adjustment for APNwith partial correlation analysis CTRP9 was still negativelyassociated with BMI HOMA-IR TNF-120572 IL-6 and leptinand positively related to HDL although the extent of its rela-tionship with BMI HOMA-IR and HDL-C reduced slightlyMultivariate logistic regression analysis revealed that serumCTRP9 was an independent protective factor of CAD (OR =0620 119875 = 0011) This suggests that the antidiabetic anti-inflammatory and myocardial protective effects of CTRP9are independent of APN although the relationship of CTRP9and APN with risk factors of cardiovascular diseases iscomparable and there is a relationship between CTRP9 andAPN In recent 2 studies similar findings were obtainedserum CTRP9 level was positively associated with favorableglucose or metabolic phenotypes [7] and arterial stiffness inpatients with type 2 diabetes [12]

In this study EAT was collected around the coro-nary artery during CABG and valve replacement Resultsshowed that when compared with non-CAD patients leptinmRNAexpression increasedmarkedly but theCTRP9mRNAexpression reduced significantly in EAT of CAD patientsImmunohistochemistry for leptin and macrophage markerin EAT showed that the leptin expression and macrophagecount were significantly higher in CAD patients but theCTRP9 expression was lower in CAD patients as comparedto non-CAD patients CA is influenced by not only theproinflammatory and anti-inflammatory adipokins in thesystemic circulation but also the inflammatory status aroundthe coronary vessels With the development of CA the anti-inflammatory and vascular protective effects of CTRP9 arecompromised Our previous study showed that in rabbit

BioMed Research International 5

Non-CAD

Leptin CTRP9 Macrophage

CAD

Figure 2 Immunohistochemistry for leptin CTRP9 and macrophage marker in the EAT CTRP9 C1qTNF-Related Protein-9 non-CADnoncoronary artery disease CAD coronary heart disease

CA model the whiting epicardial brown adipose tissue waspresent in the progression of CA and IL-6 could induce thetransformation of epicardial brown adipose tissue into whiteadipose tissue by activating JAK-STAT3 pathway

Currently the specific mechanism underlying the effectsof CTRP9 on CA is still unclear In studies on CTRP9 KOmice [21] and transgenic CTRP9 mice [9] results showedthat pharmacologically elevated circulating CTRP9 exertedtherapeutic effects on the obesity and obesity-associatedinsulin resistance Several studies have indicated that CTRP9is able to exert protective effects on the cardiovascular sys-tem CTRP9 may induce vasorelaxation in an endothelium-dependent manner which is mediated by the adiponectinreceptor-1AMPKendothelial nitric oxide synthasenitricoxide signaling pathway [19] CTRP9 downregulation byTNF-120572-initiated oxidative PPAR120574 suppression contributes tothe exacerbated heart injury in diabetesTheC-terminal glob-ular domain of CTRP9 is able to attenuate the oxidative stressreduce the myocardial infarct area and enhance cardiacoutput in DIO mice after myocardial ischemiareperfusioninjury [22] CTRP9 overexpression reduces myocardialinfarct area and hypoxia-induced apoptosis of cardiacmyocytes following myocardial ischemiareperfusion in aAMPK signaling pathway dependent manner [20] and sub-stantially reduces the neointimal formation by suppressingthe vascular smooth muscle cell proliferation and the migra-tion through the cAMPPKAERK pathway [11]

5 Limitations

There are some limitations in our study First this was a cross-sectional study and whether there is causative association

among them is still unclear Second the study was conductedin a single center and in Chinese patients the sample size wassmall and whether our results can be generalized to otherpatients is uncertain In addition themechanisms underlyingthe protective effects of CTRP9 on the cardiovascular systemare required for further investigation Thus studies withlarge sample size and long-term follow-up are needed touncover the underlying mechanisms of the protective effectsof CTRP9

6 Conclusion

Our study for the first time investigated the associationsof CTRP9 and EAT with CA in humans In conclusionserum CTRP9 decreases significantly and the protein andmRNA expression of CTRP9 in EAT reduced markedly inCAD patients as compared to non-CAD patients SerumCTRP9 is negatively associated with traditional risk factorsof cardiovascular diseases and some inflammatory factorsbut positively with serum APN and HDL-C Moreover theabovementioned relationship between CTRP9 and beneficialmetabolic phenotypes is independent of serum adiponectinThis study suggests that circulating and coronary CTRP9plays an important role in the inflammation of CAD andthe CA Serum CTRP9 is an independent protective factorof CAD

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

6 BioMed Research International

Acknowledgment

The study was supported by the ldquoSix Peaks of the Talents inJiangsu Provincerdquo

References

[1] N Ouchi J L Parker J J Lugus and K Walsh ldquoAdipokines ininflammation andmetabolic diseaserdquoNature Reviews Immunol-ogy vol 11 no 2 pp 85ndash97 2011

[2] N Goncąlves I Falcao-Pires and A F Leite-MoreiraldquoAdipokines and their receptors potential new targets incardiovascular diseasesrdquo Future Medicinal Chemistry vol 7 no2 pp 139ndash157 2015

[3] G A PayneM C Kohr and J D Tune ldquoEpicardial perivascularadipose tissue as a therapeutic target in obesity-related coronaryartery diseaserdquo British Journal of Pharmacology vol 165 no 3pp 659ndash669 2012

[4] A M Noyes K Dua R Devadoss and L Chhabra ldquoCardiacadipose tissue and its relationship to diabetes mellitus andcardiovascular diseaserdquo World Journal of Diabetes vol 5 pp868ndash876 2014

[5] A Schaffler and C Buechler ldquoCTRP family linking immunityto metabolismrdquo Trends in Endocrinology and Metabolism vol23 no 4 pp 194ndash203 2012

[6] M M Seldin S Y Tan and G W Wong ldquoMetabolic functionof the CTRP family of hormonesrdquo Reviews in Endocrine andMetabolic Disorders vol 15 no 2 pp 111ndash123 2014

[7] Y-C Hwang S W Oh S-W Park and C-Y Park ldquoAssociationof serum C1qTNF-related Protein-9 (CTRP9) concentrationwith visceral adiposity and metabolic syndrome in humansrdquoInternational Journal of Obesity 2013

[8] Y Zhang R Proenca M Maffei M Barone L Leopold and JM Friedman ldquoPositional cloning of the mouse obese gene andits human homologuerdquo Nature vol 372 no 6505 pp 425ndash4321994

[9] J M Peterson Z Wei M M Seldin M S Byerly S Ajaand G W Wong ldquoCTRP9 transgenic mice are protected fromdiet-induced obesity and metabolic dysfunctionrdquo AmericanJournal of Physiology-Regulatory Integrative and ComparativePhysiology vol 305 no 5 pp R522ndashR533 2013

[10] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factorndashrelated protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

[11] Y Uemura R Shibata K Ohashi et al ldquoAdipose-derived factorCTRP9 attenuates vascular smooth muscle cell proliferationand neointimal formationrdquoTheFASEB Journal vol 27 no 1 pp25ndash33 2013

[12] C H Jung M J Lee Y M Kang et al ldquoAssociation ofserum C1qTNF-related protein-9 concentration with arterialstiffness in subjects with type 2 diabetesrdquoThe Journal of ClinicalEndocrinology amp Metabolism vol 99 no 12 pp E2477ndashE24842014

[13] F Hajsadeghi V Nabavi A Bhandari et al ldquoIncreased epicar-dial adipose tissue is associated with coronary artery diseaseand major adverse cardiovascular eventsrdquo Atherosclerosis vol237 no 2 pp 486ndash489 2014

[14] M Kaya M Yeniterzi P Yazici et al ldquoEpicardial adipose tissueis associated with extensive coronary artery lesions in patients

undergoing coronary artery bypass grafting an observationalstudyrdquo Romanian Journal of Medical Practice vol 9 no 2 pp135ndash143 2014

[15] A H Talman P J Psaltis J D Cameron et al ldquoEpicardialadipose tissue far more than a fat depotrdquo CardiovascularDiagnosis and Therapy vol 4 article 416 2014

[16] J Wang L-J Wang Y-P Peng L-J Zhang S-S Jiang and J-B Gong ldquoAssociation of pericardial adipose tissue volume withpresence and severity of coronary atherosclerosisrdquo Clinical ampInvestigative Medicine vol 36 no 3 pp 143ndash150 2013

[17] M Oikawa T Owada H Yamauchi et al ldquoepicardial adiposetissue reflects the presence of coronary artery disease compar-ison with abdominal visceral adipose tissuerdquo BioMed ResearchInternational vol 2015 Article ID 483982 7 pages 2015

[18] J M Peterson Z Wei and G W Wong ldquoCTRP8 and CTRP9Bare novel proteins that hetero-oligomerizewithC1qTNF familymembersrdquo Biochemical and Biophysical Research Communica-tions vol 388 no 2 pp 360ndash365 2009

[19] Q Zheng Y Yuan W Yi et al ldquoC1qTNF-related proteins afamily of novel adipokines induce vascular relaxation throughthe adiponectin receptor-1AMPKeNOSnitric oxide signalingpathwayrdquo Arteriosclerosis Thrombosis and Vascular Biologyvol 31 no 11 pp 2616ndash2623 2011

[20] T Kambara K Ohashi R Shibata et al ldquoCTRP9 protein pro-tects against myocardial injury following ischemia-reperfusionthrough AMP-activated protein kinase (AMPK)-dependentmechanismrdquo The Journal of Biological Chemistry vol 287 no23 pp 18965ndash18973 2012

[21] Z Wei X Lei P S Petersen S Aja and G WWong ldquoTargeteddeletion of C1qTNF-related protein 9 increases food intakedecreases insulin sensitivity and promotes hepatic steatosis inmicerdquoThe American Journal of PhysiologymdashEndocrinology andMetabolism vol 306 no 7 pp E779ndashE790 2014

[22] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factor-related protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

2 BioMed Research International

Table 1 Primers used for RT-q PCR

Genes Forward (51015840-31015840) Reverse (51015840-31015840)120573-actin TTGTAACCAACTGGGACGATATGG GATCTTGATCTTCATGGTGCTAGGLeptin GATGACACCAAAACCCTCATC GCCACCACCTCTGTGGAGTAGCTRP9 ACCATGAGGATCTGGTGGCTTCTG TGTGTCATCGTCCT CATCAGCCTRP9 C1qTNF-Related Protein-9

coronary artery bypass grafting (CABG) in the Departmentof Cardiothoracic Surgery) and 121 with non-CAD (55underwent valve replacement) Exclusion criteria includedacute myocardial infarction congestive heart failure cancerthyroid disease chronic renal insufficiency and use of oralcorticosteroidsWritten informed consent was obtained fromeach patient before study and this study was approved by theEthics Committee of our hospital

22 Clinical Data Clinical information was obtained usinga standardized health questionnaire Body weight (kg) andblood pressure (BP mmHg) were measured and bodymass index (BMI) was calculated On admission bloodsamples were collected in the morning after an overnightfast (12ndash14 h) Fasting blood glucose (FBG) total cholesterol(TC) triglyceride (TG) low-density lipoprotein-cholesterol(LDL-C) high-density lipoprotein-cholesterol (HDL-C) C-reactive protein (CRP) and fasting insulin were measuredwith an automatic biochemical analytical instruments inthe Laboratory Center of Nanjing Jinling Hospital Theinsulin sensitivity was estimated with the homeostasis modelassessment (HOMA) which is based on fasting glucose andinsulin concentrations [7] Samples of adipose tissue werecollected during CABG and valve replacement EAT (05 gon average) was collected from the anterior interventricularsulcus These samples were divided into two parts One wasfrozen in liquid nitrogen and stored at minus80∘C for mRNAextraction and the other was fixed in paraformaldehyde forimmunohistochemistry

23 Diagnostic Criteria Diagnostic criteria for hypertensionwere as follows systolic blood pressure was ge140mmHgandor diastolic blood pressure was ge90mmHg or patientshad a history of antihypertensive treatment Diagnostic crite-ria for diabetes were as follows FBGwasge70mmolL 2-hourpostprandial blood glucose was ge111mmolL or patientswere treated with insulin or glucose-lowering drugs

24 Percutaneous Coronary Angiography Conventional cor-onary angiography was performed according to Judkinsrsquoprocedures via the femoral artery or radial artery and at leastfive projections were employed in each patient Quantitativecoronary angiographic analysis was done by calibration andmeasurement of coronary dimensions with a digital sub-traction angiography system (INNOVA 3100 GE HealthcareWaukesha WI USA) by two experienced interventionalcardiologists CAD was defined as 50 or greater stenosis ofa coronary artery

25 Quantitative RT-PCR In brief 100mg EATTAT washomogenized and total RNA was extracted and purifiedaccording to themanufacturerrsquos instructions (Beyotime Insti-tute of Biotechnology) The mRNA purity was determinedby measuring the optical density (OD) at 260 nm (A260)and 280 nm (A280) Additionally the mRNA integrity wasapproximated by 19S ribosomal bands Primers for targetgenes were designed and RT-PCRwas conducted to quantifythe mRNA expression of target genes with a 480 real-timePCR system (Roche Applied Science Indianapolis IN USA)following the standard protocol Primers for leptin CTRP9and 120573-actin are showed in Table 1 The fold change in mRNAexpression was determined after normalization to 120573-actinmRNA expression

26 Immunohistochemistry EAT was embedded in paraffinand cut into 4 120583m sections for hematoxylin and eosin (HampE)staining Sections were also treated with mouse anti-humanleptinmonoclonal antibody (Novus Biologicals USA) rabbitanti-human CTRP9 antibody (Aviscera Bioscience USA) ormouse anti-humanmacrophage antibody (Santa Cruz USA)After visualization these sections were observed under amicroscope and representative images were analyzed withImage-Pro Plus 80 software (Media Cybernetics CambridgeMA USA)

27 ELISA ELISAs were performed according to the man-ufacturerrsquos instructions (Nanjing Well-Offer BiotechnologyCo Ltd) In brief check-board titration was used to opti-mize the concentration of coated and capture antibodiesA standard curve was delineated on the basis of OD ofstandard samples The concentrations of target proteins weredetermined according to the standard curve

28 Statistical Analysis Statistical analysis was carried outwith SPSS version 190 (SPSS Inc Chicago IL USA) Contin-uous quantitative variables are expressed as mean plusmn standarddeviation (SD) and binary variables as percentages 1205942 testwas employed for intergroup comparison Quantitative datawere analyzed with independent Studentrsquos 119905-test or one-wayANOVA among groups GraphPad prism 50 was used for thecorrelation analysis and partial correlation analysis for dual-variant data Multiple logistic regression analysis was used tocalculate an adjusted odd ratio (OR) for the occurrence ofCAD and resultswere presented asORwith a 95confidenceinterval (CI) A two-tailed value of 119875 lt 005 was consideredstatistically significant

BioMed Research International 3

Table 2 Characteristics of subjects in the present study at baseline(119899 = 362)

Non-CAD (119899 = 121) CAD (119899 = 241) 119875 valueAge (years) 6129 plusmn 1147 6251 plusmn 1041 0734Male () 89 (7355) 172 (7137) 0969Smoking () 50 (4132) 103 (4274) 0864Drinking () 43 (3554) 97 (4025) 0493DM () 33 (2727) 95 (3942) 0072HBP () 77 (6364) 140 (5809) 0430BMI (kgm2) 2408 plusmn 162 2502 plusmn 350 0239TC (mmolL) 389 plusmn 106 405 plusmn 089 0492TG (mmolL) 158 plusmn 137 167 plusmn 084 0727HDL-C (mmolL) 113 plusmn 022 105 plusmn 019 0114LDL-C (mmolL) 198 plusmn 061 248 plusmn 078 0009FBG (mmolL) 561 plusmn 208 650 plusmn 335 0256HOMA-IR 150 plusmn 123 269 plusmn 101 0025CRP (mgL) 141 plusmn 107 581 plusmn 123 0034TNF-120572 (pgmL) 731 plusmn 287 826 plusmn 371 0019IL-6 (pgmL) 369 plusmn 082 496 plusmn 135 0039Leptin (pgmL) 742 plusmn 269 823 plusmn 305 0020APN (ngmL) 1067 plusmn 274 941 plusmn 149 0021CTRP9 (pgmL) 9614 plusmn 3313 8389 plusmn 3618 0005DM diabetes mellitus HBP hypertension BMI body mass index TC totalcholesterol TG triglyceride LDL-C low-density lipoprotein-cholesterolHDL-C high-density lipoprotein-cholesterol FBG fasting blood glucoseHOMA-IR homeostasis model of assessment for insulin resistance CRP C-reactive protein TNF-120572 tumor necrosis factor-120572 IL-6 interleukin-6 APNadiponectin CTRP9 C1qTNF-Related Protein-9

3 Results

31 Characteristics of Subjects at Baseline In the presentstudy there were no significant differences in the risk factorsof CAD (including age gender smoking status diabeteshypertension and BMI) between two groups Moreover theserum levels of TC TG HDL-C and FBG between groupswere also comparable (119875 gt 005) However the serum levelsof LDL-C CRP TNF-120572 IL-6 and leptin inCADpatients weremarkedly higher than those in non-CAD patients (119875 lt 005)and serum levels of APN and CTRP9 in CAD patients weredramatically lower than those in non-CAD patients (119875 =0021 and 119875 = 0005 resp) (Table 2)

32 Association of CTRP9 and APN with Cardiovascular RiskFactors Serum levels of CTRP9 and APN were positivelyrelated to BMI HOMA-IR TNF-120572 IL-6 and leptin (119875 lt005) but negatively to HDL-C (119875 lt 005) in CAD patientsIn addition there was a positive relationship between serumCTRP9 and serum APN (119903 = 0769 119875 lt 0001) Afteradjustment for APN CTRP9 was still associated with aboveparameters but the extent of its correlation with BMIHOMA-IR and HDL-C slightly reduced (119903 = minus0211ndashminus0207119875 = 0035 119903 = minus0249ndashminus0191119875 = 0045 and 119903 = 0240ndash0218119875 = 0044 resp) (Table 3)

Table 3 Correlation of CTRP9 and APN with risk factors ofcardiovascular diseases

CTRP9 APN Adjusted APN119903 119875 value 119903 119875 value 119903 119875 value

BMI(kgm2) minus0211 0032 minus0247 0020 minus0207 0035

TC(mmolL) minus0073 0500 minus0029 0791 minus0048 0486

TG(mmolL) minus0085 0494 minus0013 0905 minus0056 0597

HDL-C(mmolL) 0240 0024 0390 0018 0218 0044

LDL-C(mmolL) minus0069 0525 minus0070 0375 minus0036 0655

HOMA-IR minus0249 0032 minus0276 0022 minus0191 0045CRP(mgL) minus0059 0613 minus0170 0146 minus0068 0581

TNF-120572(pgmL) minus0484 lt0001 minus0319 lt0001 minus0388 lt0001

IL-6(pgmL) minus0295 lt0001 minus0198 lt0001 minus0228 lt0001

Leptin(pgmL) minus0662 lt0001 minus0529 lt0001 minus0803 lt0001

APN(ngmL) 0769 lt0001

BMI body mass index TC total cholesterol TG triglyceride LDL-C low-density lipoprotein-cholesterol HDL-C high-density lipoprotein-cholesterol HOMA-IR homeostasis model of assessment for insulin resis-tance CRP C-reactive protein TNF-120572 tumor necrosis factor-120572 IL-6interleukin-6 APN adiponectin CTRP9 C1qTNF-Related Protein-9

Table 4Multiple logistic regression analysis of independent predic-tors of coronary arterial disease

119875 value OR 95 CILower Upper

APN 0002 0504 0303 0720CTRP9 0011 0620 0482 0838Leptin 0042 2103 1003 3813TNF-120572 0039 3091 1204 4186IL-6 0120 1185 0957 1467TNF-120572 tumor necrosis factor-120572 IL-6 interleukin-6 APN adiponectinCTRP9 C1qTNF-Related Protein-9

33 Multiple Logistic Regression Analysis of Independent Pre-dictors of CAD Multiple logistic regression analysis showedserum levels of APN and CTRP9 were protective factorsof CAD (OR = 0504 119875 = 0002 and OR = 0620 119875 =0011 resp) but serum levels of TNF-120572 and leptin wereindependent risk factors of CAD (OR = 3091 119875 = 0039 andOR = 2103 119875 = 0042 resp) However serum IL-6 had noinfluence on CAD (119875 = 0120) (Table 4)

34 Inflammatory Cytokines in EAT EAT was collectedduring CABG and valve replacement and inflammatorycytokines were measured When compared with non-CAD

4 BioMed Research International

patients the leptin mRNA expression in the EAT increasedmarkedly (119875 lt 005) but CTRP9 mRNA expression in theEAT reduced dramatically (119875 lt 005 Figure 1) in CADpatients Immunohistochemistry for leptin and macrophagemarker in the EAT showed that leptin expression andmacrophage count in CAD patients were significantly higherthan those in non-CADpatients while theCTRP9 expressionreduced markedly in CAD patients (Figure 2)

4 Discussion

Adipose tissues have been proved to be a metabolicallyactive organ capable of secreting endocrine and paracrineagents that may potentially affect the cardiovascular systemand are independent risk factors of coronary arterial dis-ease (CAD) Leptin was identified as the first adipokine in1994 and is able to promote the progression of diabetesobesity and atherosclerosis [8] On the contrary APNa member of CTRP family has attracted much interestbecause of its anti-inflammatoryvasculoprotective and anti-ischemiccardioprotective properties To date 15 additionalmembers of the CTRP family have been identified [6]CTRP9 the closest adiponectin paralog is predominantlyexpressed in adipose tissues CTRP9 has attracted a lot ofattention due to its beneficial cardiovascular effects especiallythe antiatherosclerotic effect [9ndash12]

EAT is a heart fat depot and directly contacts withthe myocardium and coronary arteries The pathologicalincrease in EAT and the concomitance of othermetabolic andhemodynamic abnormalities turn it into an adverse lipotoxicprothrombotic and proinflammatory organ [13ndash15] Ourprevious study showed that pericardial adipose tissue volumewas significantly correlated with traditional cardiovascularrisk factors the severity of CA and the number of stenoticcoronary vessels [16] EAT-derived inflammatory cytokinesare also significantly related to the plaque vulnerabilityin CAD When compared with non-CAD patients moremacrophages were found and the expressions of leptin andMMP9 increased markedly in the EAT of CAD patients [17]Thus in the present study the serum and EAT levels ofCTRP9 and other proinflammatory cytokines were detectedin patients with and without CAD aiming at elucidating theinfluence of circulating and coronary CTRP9 on CAD

Our results showed there were no marked differences inthe age gender drinking status smoking status hyperten-sion diabetes andBMI betweenCADpatients and non-CADpatients In CAD patients the serum levels of LDL-C CRPTNF-120572 IL-6 and leptin increased significantly and serumlevels of APN and CTRP9 reduced markedly as comparedto non-CAD patients We further correlated serum levels ofCTRP9 and APN with risk factors of cardiovascular diseasesResults showed bothCTRP9 andAPNwere protective factorsof CAD negatively related to BMI HOMA-IR TNF-120572 IL-6 and leptin (risk factors) and positively related to HDL-C (a protective factor) Moreover there was a positivecorrelation between CTRP9 andAPNThese findings suggestthat CTRP9 like APN may exert antidiabetic and anti-inflammatory effects and regulate the glucose homeostasisprimarily through improving insulin sensitivity

CADNon-CAD

Leptin

mRN

A ex

pres

sion

CTRP9

lowast

lowast

0

1

2

3

4

Figure 1 mRNA expressions of leptin and CTRP9 in theEAT CTRP9 C1qTNF-Related Protein-9 non-CAD noncoronaryartery disease CAD coronary arterial disease EAT epicardialadipose tissue volume lowast119875 lt 005

CTRP9 and adiponectin can form heterotrimers via theglobular C1q domain that circulates in the blood [18] andshares the receptor Adipo R1 with adiponectin in the vascularendothelial cells [19] and cardiomyocytes [20] Therefore weexamined whether the favorable metabolic effects of CTRP9were adiponectin dependent After adjustment for APNwith partial correlation analysis CTRP9 was still negativelyassociated with BMI HOMA-IR TNF-120572 IL-6 and leptinand positively related to HDL although the extent of its rela-tionship with BMI HOMA-IR and HDL-C reduced slightlyMultivariate logistic regression analysis revealed that serumCTRP9 was an independent protective factor of CAD (OR =0620 119875 = 0011) This suggests that the antidiabetic anti-inflammatory and myocardial protective effects of CTRP9are independent of APN although the relationship of CTRP9and APN with risk factors of cardiovascular diseases iscomparable and there is a relationship between CTRP9 andAPN In recent 2 studies similar findings were obtainedserum CTRP9 level was positively associated with favorableglucose or metabolic phenotypes [7] and arterial stiffness inpatients with type 2 diabetes [12]

In this study EAT was collected around the coro-nary artery during CABG and valve replacement Resultsshowed that when compared with non-CAD patients leptinmRNAexpression increasedmarkedly but theCTRP9mRNAexpression reduced significantly in EAT of CAD patientsImmunohistochemistry for leptin and macrophage markerin EAT showed that the leptin expression and macrophagecount were significantly higher in CAD patients but theCTRP9 expression was lower in CAD patients as comparedto non-CAD patients CA is influenced by not only theproinflammatory and anti-inflammatory adipokins in thesystemic circulation but also the inflammatory status aroundthe coronary vessels With the development of CA the anti-inflammatory and vascular protective effects of CTRP9 arecompromised Our previous study showed that in rabbit

BioMed Research International 5

Non-CAD

Leptin CTRP9 Macrophage

CAD

Figure 2 Immunohistochemistry for leptin CTRP9 and macrophage marker in the EAT CTRP9 C1qTNF-Related Protein-9 non-CADnoncoronary artery disease CAD coronary heart disease

CA model the whiting epicardial brown adipose tissue waspresent in the progression of CA and IL-6 could induce thetransformation of epicardial brown adipose tissue into whiteadipose tissue by activating JAK-STAT3 pathway

Currently the specific mechanism underlying the effectsof CTRP9 on CA is still unclear In studies on CTRP9 KOmice [21] and transgenic CTRP9 mice [9] results showedthat pharmacologically elevated circulating CTRP9 exertedtherapeutic effects on the obesity and obesity-associatedinsulin resistance Several studies have indicated that CTRP9is able to exert protective effects on the cardiovascular sys-tem CTRP9 may induce vasorelaxation in an endothelium-dependent manner which is mediated by the adiponectinreceptor-1AMPKendothelial nitric oxide synthasenitricoxide signaling pathway [19] CTRP9 downregulation byTNF-120572-initiated oxidative PPAR120574 suppression contributes tothe exacerbated heart injury in diabetesTheC-terminal glob-ular domain of CTRP9 is able to attenuate the oxidative stressreduce the myocardial infarct area and enhance cardiacoutput in DIO mice after myocardial ischemiareperfusioninjury [22] CTRP9 overexpression reduces myocardialinfarct area and hypoxia-induced apoptosis of cardiacmyocytes following myocardial ischemiareperfusion in aAMPK signaling pathway dependent manner [20] and sub-stantially reduces the neointimal formation by suppressingthe vascular smooth muscle cell proliferation and the migra-tion through the cAMPPKAERK pathway [11]

5 Limitations

There are some limitations in our study First this was a cross-sectional study and whether there is causative association

among them is still unclear Second the study was conductedin a single center and in Chinese patients the sample size wassmall and whether our results can be generalized to otherpatients is uncertain In addition themechanisms underlyingthe protective effects of CTRP9 on the cardiovascular systemare required for further investigation Thus studies withlarge sample size and long-term follow-up are needed touncover the underlying mechanisms of the protective effectsof CTRP9

6 Conclusion

Our study for the first time investigated the associationsof CTRP9 and EAT with CA in humans In conclusionserum CTRP9 decreases significantly and the protein andmRNA expression of CTRP9 in EAT reduced markedly inCAD patients as compared to non-CAD patients SerumCTRP9 is negatively associated with traditional risk factorsof cardiovascular diseases and some inflammatory factorsbut positively with serum APN and HDL-C Moreover theabovementioned relationship between CTRP9 and beneficialmetabolic phenotypes is independent of serum adiponectinThis study suggests that circulating and coronary CTRP9plays an important role in the inflammation of CAD andthe CA Serum CTRP9 is an independent protective factorof CAD

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

6 BioMed Research International

Acknowledgment

The study was supported by the ldquoSix Peaks of the Talents inJiangsu Provincerdquo

References

[1] N Ouchi J L Parker J J Lugus and K Walsh ldquoAdipokines ininflammation andmetabolic diseaserdquoNature Reviews Immunol-ogy vol 11 no 2 pp 85ndash97 2011

[2] N Goncąlves I Falcao-Pires and A F Leite-MoreiraldquoAdipokines and their receptors potential new targets incardiovascular diseasesrdquo Future Medicinal Chemistry vol 7 no2 pp 139ndash157 2015

[3] G A PayneM C Kohr and J D Tune ldquoEpicardial perivascularadipose tissue as a therapeutic target in obesity-related coronaryartery diseaserdquo British Journal of Pharmacology vol 165 no 3pp 659ndash669 2012

[4] A M Noyes K Dua R Devadoss and L Chhabra ldquoCardiacadipose tissue and its relationship to diabetes mellitus andcardiovascular diseaserdquo World Journal of Diabetes vol 5 pp868ndash876 2014

[5] A Schaffler and C Buechler ldquoCTRP family linking immunityto metabolismrdquo Trends in Endocrinology and Metabolism vol23 no 4 pp 194ndash203 2012

[6] M M Seldin S Y Tan and G W Wong ldquoMetabolic functionof the CTRP family of hormonesrdquo Reviews in Endocrine andMetabolic Disorders vol 15 no 2 pp 111ndash123 2014

[7] Y-C Hwang S W Oh S-W Park and C-Y Park ldquoAssociationof serum C1qTNF-related Protein-9 (CTRP9) concentrationwith visceral adiposity and metabolic syndrome in humansrdquoInternational Journal of Obesity 2013

[8] Y Zhang R Proenca M Maffei M Barone L Leopold and JM Friedman ldquoPositional cloning of the mouse obese gene andits human homologuerdquo Nature vol 372 no 6505 pp 425ndash4321994

[9] J M Peterson Z Wei M M Seldin M S Byerly S Ajaand G W Wong ldquoCTRP9 transgenic mice are protected fromdiet-induced obesity and metabolic dysfunctionrdquo AmericanJournal of Physiology-Regulatory Integrative and ComparativePhysiology vol 305 no 5 pp R522ndashR533 2013

[10] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factorndashrelated protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

[11] Y Uemura R Shibata K Ohashi et al ldquoAdipose-derived factorCTRP9 attenuates vascular smooth muscle cell proliferationand neointimal formationrdquoTheFASEB Journal vol 27 no 1 pp25ndash33 2013

[12] C H Jung M J Lee Y M Kang et al ldquoAssociation ofserum C1qTNF-related protein-9 concentration with arterialstiffness in subjects with type 2 diabetesrdquoThe Journal of ClinicalEndocrinology amp Metabolism vol 99 no 12 pp E2477ndashE24842014

[13] F Hajsadeghi V Nabavi A Bhandari et al ldquoIncreased epicar-dial adipose tissue is associated with coronary artery diseaseand major adverse cardiovascular eventsrdquo Atherosclerosis vol237 no 2 pp 486ndash489 2014

[14] M Kaya M Yeniterzi P Yazici et al ldquoEpicardial adipose tissueis associated with extensive coronary artery lesions in patients

undergoing coronary artery bypass grafting an observationalstudyrdquo Romanian Journal of Medical Practice vol 9 no 2 pp135ndash143 2014

[15] A H Talman P J Psaltis J D Cameron et al ldquoEpicardialadipose tissue far more than a fat depotrdquo CardiovascularDiagnosis and Therapy vol 4 article 416 2014

[16] J Wang L-J Wang Y-P Peng L-J Zhang S-S Jiang and J-B Gong ldquoAssociation of pericardial adipose tissue volume withpresence and severity of coronary atherosclerosisrdquo Clinical ampInvestigative Medicine vol 36 no 3 pp 143ndash150 2013

[17] M Oikawa T Owada H Yamauchi et al ldquoepicardial adiposetissue reflects the presence of coronary artery disease compar-ison with abdominal visceral adipose tissuerdquo BioMed ResearchInternational vol 2015 Article ID 483982 7 pages 2015

[18] J M Peterson Z Wei and G W Wong ldquoCTRP8 and CTRP9Bare novel proteins that hetero-oligomerizewithC1qTNF familymembersrdquo Biochemical and Biophysical Research Communica-tions vol 388 no 2 pp 360ndash365 2009

[19] Q Zheng Y Yuan W Yi et al ldquoC1qTNF-related proteins afamily of novel adipokines induce vascular relaxation throughthe adiponectin receptor-1AMPKeNOSnitric oxide signalingpathwayrdquo Arteriosclerosis Thrombosis and Vascular Biologyvol 31 no 11 pp 2616ndash2623 2011

[20] T Kambara K Ohashi R Shibata et al ldquoCTRP9 protein pro-tects against myocardial injury following ischemia-reperfusionthrough AMP-activated protein kinase (AMPK)-dependentmechanismrdquo The Journal of Biological Chemistry vol 287 no23 pp 18965ndash18973 2012

[21] Z Wei X Lei P S Petersen S Aja and G WWong ldquoTargeteddeletion of C1qTNF-related protein 9 increases food intakedecreases insulin sensitivity and promotes hepatic steatosis inmicerdquoThe American Journal of PhysiologymdashEndocrinology andMetabolism vol 306 no 7 pp E779ndashE790 2014

[22] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factor-related protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

BioMed Research International 3

Table 2 Characteristics of subjects in the present study at baseline(119899 = 362)

Non-CAD (119899 = 121) CAD (119899 = 241) 119875 valueAge (years) 6129 plusmn 1147 6251 plusmn 1041 0734Male () 89 (7355) 172 (7137) 0969Smoking () 50 (4132) 103 (4274) 0864Drinking () 43 (3554) 97 (4025) 0493DM () 33 (2727) 95 (3942) 0072HBP () 77 (6364) 140 (5809) 0430BMI (kgm2) 2408 plusmn 162 2502 plusmn 350 0239TC (mmolL) 389 plusmn 106 405 plusmn 089 0492TG (mmolL) 158 plusmn 137 167 plusmn 084 0727HDL-C (mmolL) 113 plusmn 022 105 plusmn 019 0114LDL-C (mmolL) 198 plusmn 061 248 plusmn 078 0009FBG (mmolL) 561 plusmn 208 650 plusmn 335 0256HOMA-IR 150 plusmn 123 269 plusmn 101 0025CRP (mgL) 141 plusmn 107 581 plusmn 123 0034TNF-120572 (pgmL) 731 plusmn 287 826 plusmn 371 0019IL-6 (pgmL) 369 plusmn 082 496 plusmn 135 0039Leptin (pgmL) 742 plusmn 269 823 plusmn 305 0020APN (ngmL) 1067 plusmn 274 941 plusmn 149 0021CTRP9 (pgmL) 9614 plusmn 3313 8389 plusmn 3618 0005DM diabetes mellitus HBP hypertension BMI body mass index TC totalcholesterol TG triglyceride LDL-C low-density lipoprotein-cholesterolHDL-C high-density lipoprotein-cholesterol FBG fasting blood glucoseHOMA-IR homeostasis model of assessment for insulin resistance CRP C-reactive protein TNF-120572 tumor necrosis factor-120572 IL-6 interleukin-6 APNadiponectin CTRP9 C1qTNF-Related Protein-9

3 Results

31 Characteristics of Subjects at Baseline In the presentstudy there were no significant differences in the risk factorsof CAD (including age gender smoking status diabeteshypertension and BMI) between two groups Moreover theserum levels of TC TG HDL-C and FBG between groupswere also comparable (119875 gt 005) However the serum levelsof LDL-C CRP TNF-120572 IL-6 and leptin inCADpatients weremarkedly higher than those in non-CAD patients (119875 lt 005)and serum levels of APN and CTRP9 in CAD patients weredramatically lower than those in non-CAD patients (119875 =0021 and 119875 = 0005 resp) (Table 2)

32 Association of CTRP9 and APN with Cardiovascular RiskFactors Serum levels of CTRP9 and APN were positivelyrelated to BMI HOMA-IR TNF-120572 IL-6 and leptin (119875 lt005) but negatively to HDL-C (119875 lt 005) in CAD patientsIn addition there was a positive relationship between serumCTRP9 and serum APN (119903 = 0769 119875 lt 0001) Afteradjustment for APN CTRP9 was still associated with aboveparameters but the extent of its correlation with BMIHOMA-IR and HDL-C slightly reduced (119903 = minus0211ndashminus0207119875 = 0035 119903 = minus0249ndashminus0191119875 = 0045 and 119903 = 0240ndash0218119875 = 0044 resp) (Table 3)

Table 3 Correlation of CTRP9 and APN with risk factors ofcardiovascular diseases

CTRP9 APN Adjusted APN119903 119875 value 119903 119875 value 119903 119875 value

BMI(kgm2) minus0211 0032 minus0247 0020 minus0207 0035

TC(mmolL) minus0073 0500 minus0029 0791 minus0048 0486

TG(mmolL) minus0085 0494 minus0013 0905 minus0056 0597

HDL-C(mmolL) 0240 0024 0390 0018 0218 0044

LDL-C(mmolL) minus0069 0525 minus0070 0375 minus0036 0655

HOMA-IR minus0249 0032 minus0276 0022 minus0191 0045CRP(mgL) minus0059 0613 minus0170 0146 minus0068 0581

TNF-120572(pgmL) minus0484 lt0001 minus0319 lt0001 minus0388 lt0001

IL-6(pgmL) minus0295 lt0001 minus0198 lt0001 minus0228 lt0001

Leptin(pgmL) minus0662 lt0001 minus0529 lt0001 minus0803 lt0001

APN(ngmL) 0769 lt0001

BMI body mass index TC total cholesterol TG triglyceride LDL-C low-density lipoprotein-cholesterol HDL-C high-density lipoprotein-cholesterol HOMA-IR homeostasis model of assessment for insulin resis-tance CRP C-reactive protein TNF-120572 tumor necrosis factor-120572 IL-6interleukin-6 APN adiponectin CTRP9 C1qTNF-Related Protein-9

Table 4Multiple logistic regression analysis of independent predic-tors of coronary arterial disease

119875 value OR 95 CILower Upper

APN 0002 0504 0303 0720CTRP9 0011 0620 0482 0838Leptin 0042 2103 1003 3813TNF-120572 0039 3091 1204 4186IL-6 0120 1185 0957 1467TNF-120572 tumor necrosis factor-120572 IL-6 interleukin-6 APN adiponectinCTRP9 C1qTNF-Related Protein-9

33 Multiple Logistic Regression Analysis of Independent Pre-dictors of CAD Multiple logistic regression analysis showedserum levels of APN and CTRP9 were protective factorsof CAD (OR = 0504 119875 = 0002 and OR = 0620 119875 =0011 resp) but serum levels of TNF-120572 and leptin wereindependent risk factors of CAD (OR = 3091 119875 = 0039 andOR = 2103 119875 = 0042 resp) However serum IL-6 had noinfluence on CAD (119875 = 0120) (Table 4)

34 Inflammatory Cytokines in EAT EAT was collectedduring CABG and valve replacement and inflammatorycytokines were measured When compared with non-CAD

4 BioMed Research International

patients the leptin mRNA expression in the EAT increasedmarkedly (119875 lt 005) but CTRP9 mRNA expression in theEAT reduced dramatically (119875 lt 005 Figure 1) in CADpatients Immunohistochemistry for leptin and macrophagemarker in the EAT showed that leptin expression andmacrophage count in CAD patients were significantly higherthan those in non-CADpatients while theCTRP9 expressionreduced markedly in CAD patients (Figure 2)

4 Discussion

Adipose tissues have been proved to be a metabolicallyactive organ capable of secreting endocrine and paracrineagents that may potentially affect the cardiovascular systemand are independent risk factors of coronary arterial dis-ease (CAD) Leptin was identified as the first adipokine in1994 and is able to promote the progression of diabetesobesity and atherosclerosis [8] On the contrary APNa member of CTRP family has attracted much interestbecause of its anti-inflammatoryvasculoprotective and anti-ischemiccardioprotective properties To date 15 additionalmembers of the CTRP family have been identified [6]CTRP9 the closest adiponectin paralog is predominantlyexpressed in adipose tissues CTRP9 has attracted a lot ofattention due to its beneficial cardiovascular effects especiallythe antiatherosclerotic effect [9ndash12]

EAT is a heart fat depot and directly contacts withthe myocardium and coronary arteries The pathologicalincrease in EAT and the concomitance of othermetabolic andhemodynamic abnormalities turn it into an adverse lipotoxicprothrombotic and proinflammatory organ [13ndash15] Ourprevious study showed that pericardial adipose tissue volumewas significantly correlated with traditional cardiovascularrisk factors the severity of CA and the number of stenoticcoronary vessels [16] EAT-derived inflammatory cytokinesare also significantly related to the plaque vulnerabilityin CAD When compared with non-CAD patients moremacrophages were found and the expressions of leptin andMMP9 increased markedly in the EAT of CAD patients [17]Thus in the present study the serum and EAT levels ofCTRP9 and other proinflammatory cytokines were detectedin patients with and without CAD aiming at elucidating theinfluence of circulating and coronary CTRP9 on CAD

Our results showed there were no marked differences inthe age gender drinking status smoking status hyperten-sion diabetes andBMI betweenCADpatients and non-CADpatients In CAD patients the serum levels of LDL-C CRPTNF-120572 IL-6 and leptin increased significantly and serumlevels of APN and CTRP9 reduced markedly as comparedto non-CAD patients We further correlated serum levels ofCTRP9 and APN with risk factors of cardiovascular diseasesResults showed bothCTRP9 andAPNwere protective factorsof CAD negatively related to BMI HOMA-IR TNF-120572 IL-6 and leptin (risk factors) and positively related to HDL-C (a protective factor) Moreover there was a positivecorrelation between CTRP9 andAPNThese findings suggestthat CTRP9 like APN may exert antidiabetic and anti-inflammatory effects and regulate the glucose homeostasisprimarily through improving insulin sensitivity

CADNon-CAD

Leptin

mRN

A ex

pres

sion

CTRP9

lowast

lowast

0

1

2

3

4

Figure 1 mRNA expressions of leptin and CTRP9 in theEAT CTRP9 C1qTNF-Related Protein-9 non-CAD noncoronaryartery disease CAD coronary arterial disease EAT epicardialadipose tissue volume lowast119875 lt 005

CTRP9 and adiponectin can form heterotrimers via theglobular C1q domain that circulates in the blood [18] andshares the receptor Adipo R1 with adiponectin in the vascularendothelial cells [19] and cardiomyocytes [20] Therefore weexamined whether the favorable metabolic effects of CTRP9were adiponectin dependent After adjustment for APNwith partial correlation analysis CTRP9 was still negativelyassociated with BMI HOMA-IR TNF-120572 IL-6 and leptinand positively related to HDL although the extent of its rela-tionship with BMI HOMA-IR and HDL-C reduced slightlyMultivariate logistic regression analysis revealed that serumCTRP9 was an independent protective factor of CAD (OR =0620 119875 = 0011) This suggests that the antidiabetic anti-inflammatory and myocardial protective effects of CTRP9are independent of APN although the relationship of CTRP9and APN with risk factors of cardiovascular diseases iscomparable and there is a relationship between CTRP9 andAPN In recent 2 studies similar findings were obtainedserum CTRP9 level was positively associated with favorableglucose or metabolic phenotypes [7] and arterial stiffness inpatients with type 2 diabetes [12]

In this study EAT was collected around the coro-nary artery during CABG and valve replacement Resultsshowed that when compared with non-CAD patients leptinmRNAexpression increasedmarkedly but theCTRP9mRNAexpression reduced significantly in EAT of CAD patientsImmunohistochemistry for leptin and macrophage markerin EAT showed that the leptin expression and macrophagecount were significantly higher in CAD patients but theCTRP9 expression was lower in CAD patients as comparedto non-CAD patients CA is influenced by not only theproinflammatory and anti-inflammatory adipokins in thesystemic circulation but also the inflammatory status aroundthe coronary vessels With the development of CA the anti-inflammatory and vascular protective effects of CTRP9 arecompromised Our previous study showed that in rabbit

BioMed Research International 5

Non-CAD

Leptin CTRP9 Macrophage

CAD

Figure 2 Immunohistochemistry for leptin CTRP9 and macrophage marker in the EAT CTRP9 C1qTNF-Related Protein-9 non-CADnoncoronary artery disease CAD coronary heart disease

CA model the whiting epicardial brown adipose tissue waspresent in the progression of CA and IL-6 could induce thetransformation of epicardial brown adipose tissue into whiteadipose tissue by activating JAK-STAT3 pathway

Currently the specific mechanism underlying the effectsof CTRP9 on CA is still unclear In studies on CTRP9 KOmice [21] and transgenic CTRP9 mice [9] results showedthat pharmacologically elevated circulating CTRP9 exertedtherapeutic effects on the obesity and obesity-associatedinsulin resistance Several studies have indicated that CTRP9is able to exert protective effects on the cardiovascular sys-tem CTRP9 may induce vasorelaxation in an endothelium-dependent manner which is mediated by the adiponectinreceptor-1AMPKendothelial nitric oxide synthasenitricoxide signaling pathway [19] CTRP9 downregulation byTNF-120572-initiated oxidative PPAR120574 suppression contributes tothe exacerbated heart injury in diabetesTheC-terminal glob-ular domain of CTRP9 is able to attenuate the oxidative stressreduce the myocardial infarct area and enhance cardiacoutput in DIO mice after myocardial ischemiareperfusioninjury [22] CTRP9 overexpression reduces myocardialinfarct area and hypoxia-induced apoptosis of cardiacmyocytes following myocardial ischemiareperfusion in aAMPK signaling pathway dependent manner [20] and sub-stantially reduces the neointimal formation by suppressingthe vascular smooth muscle cell proliferation and the migra-tion through the cAMPPKAERK pathway [11]

5 Limitations

There are some limitations in our study First this was a cross-sectional study and whether there is causative association

among them is still unclear Second the study was conductedin a single center and in Chinese patients the sample size wassmall and whether our results can be generalized to otherpatients is uncertain In addition themechanisms underlyingthe protective effects of CTRP9 on the cardiovascular systemare required for further investigation Thus studies withlarge sample size and long-term follow-up are needed touncover the underlying mechanisms of the protective effectsof CTRP9

6 Conclusion

Our study for the first time investigated the associationsof CTRP9 and EAT with CA in humans In conclusionserum CTRP9 decreases significantly and the protein andmRNA expression of CTRP9 in EAT reduced markedly inCAD patients as compared to non-CAD patients SerumCTRP9 is negatively associated with traditional risk factorsof cardiovascular diseases and some inflammatory factorsbut positively with serum APN and HDL-C Moreover theabovementioned relationship between CTRP9 and beneficialmetabolic phenotypes is independent of serum adiponectinThis study suggests that circulating and coronary CTRP9plays an important role in the inflammation of CAD andthe CA Serum CTRP9 is an independent protective factorof CAD

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

6 BioMed Research International

Acknowledgment

The study was supported by the ldquoSix Peaks of the Talents inJiangsu Provincerdquo

References

[1] N Ouchi J L Parker J J Lugus and K Walsh ldquoAdipokines ininflammation andmetabolic diseaserdquoNature Reviews Immunol-ogy vol 11 no 2 pp 85ndash97 2011

[2] N Goncąlves I Falcao-Pires and A F Leite-MoreiraldquoAdipokines and their receptors potential new targets incardiovascular diseasesrdquo Future Medicinal Chemistry vol 7 no2 pp 139ndash157 2015

[3] G A PayneM C Kohr and J D Tune ldquoEpicardial perivascularadipose tissue as a therapeutic target in obesity-related coronaryartery diseaserdquo British Journal of Pharmacology vol 165 no 3pp 659ndash669 2012

[4] A M Noyes K Dua R Devadoss and L Chhabra ldquoCardiacadipose tissue and its relationship to diabetes mellitus andcardiovascular diseaserdquo World Journal of Diabetes vol 5 pp868ndash876 2014

[5] A Schaffler and C Buechler ldquoCTRP family linking immunityto metabolismrdquo Trends in Endocrinology and Metabolism vol23 no 4 pp 194ndash203 2012

[6] M M Seldin S Y Tan and G W Wong ldquoMetabolic functionof the CTRP family of hormonesrdquo Reviews in Endocrine andMetabolic Disorders vol 15 no 2 pp 111ndash123 2014

[7] Y-C Hwang S W Oh S-W Park and C-Y Park ldquoAssociationof serum C1qTNF-related Protein-9 (CTRP9) concentrationwith visceral adiposity and metabolic syndrome in humansrdquoInternational Journal of Obesity 2013

[8] Y Zhang R Proenca M Maffei M Barone L Leopold and JM Friedman ldquoPositional cloning of the mouse obese gene andits human homologuerdquo Nature vol 372 no 6505 pp 425ndash4321994

[9] J M Peterson Z Wei M M Seldin M S Byerly S Ajaand G W Wong ldquoCTRP9 transgenic mice are protected fromdiet-induced obesity and metabolic dysfunctionrdquo AmericanJournal of Physiology-Regulatory Integrative and ComparativePhysiology vol 305 no 5 pp R522ndashR533 2013

[10] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factorndashrelated protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

[11] Y Uemura R Shibata K Ohashi et al ldquoAdipose-derived factorCTRP9 attenuates vascular smooth muscle cell proliferationand neointimal formationrdquoTheFASEB Journal vol 27 no 1 pp25ndash33 2013

[12] C H Jung M J Lee Y M Kang et al ldquoAssociation ofserum C1qTNF-related protein-9 concentration with arterialstiffness in subjects with type 2 diabetesrdquoThe Journal of ClinicalEndocrinology amp Metabolism vol 99 no 12 pp E2477ndashE24842014

[13] F Hajsadeghi V Nabavi A Bhandari et al ldquoIncreased epicar-dial adipose tissue is associated with coronary artery diseaseand major adverse cardiovascular eventsrdquo Atherosclerosis vol237 no 2 pp 486ndash489 2014

[14] M Kaya M Yeniterzi P Yazici et al ldquoEpicardial adipose tissueis associated with extensive coronary artery lesions in patients

undergoing coronary artery bypass grafting an observationalstudyrdquo Romanian Journal of Medical Practice vol 9 no 2 pp135ndash143 2014

[15] A H Talman P J Psaltis J D Cameron et al ldquoEpicardialadipose tissue far more than a fat depotrdquo CardiovascularDiagnosis and Therapy vol 4 article 416 2014

[16] J Wang L-J Wang Y-P Peng L-J Zhang S-S Jiang and J-B Gong ldquoAssociation of pericardial adipose tissue volume withpresence and severity of coronary atherosclerosisrdquo Clinical ampInvestigative Medicine vol 36 no 3 pp 143ndash150 2013

[17] M Oikawa T Owada H Yamauchi et al ldquoepicardial adiposetissue reflects the presence of coronary artery disease compar-ison with abdominal visceral adipose tissuerdquo BioMed ResearchInternational vol 2015 Article ID 483982 7 pages 2015

[18] J M Peterson Z Wei and G W Wong ldquoCTRP8 and CTRP9Bare novel proteins that hetero-oligomerizewithC1qTNF familymembersrdquo Biochemical and Biophysical Research Communica-tions vol 388 no 2 pp 360ndash365 2009

[19] Q Zheng Y Yuan W Yi et al ldquoC1qTNF-related proteins afamily of novel adipokines induce vascular relaxation throughthe adiponectin receptor-1AMPKeNOSnitric oxide signalingpathwayrdquo Arteriosclerosis Thrombosis and Vascular Biologyvol 31 no 11 pp 2616ndash2623 2011

[20] T Kambara K Ohashi R Shibata et al ldquoCTRP9 protein pro-tects against myocardial injury following ischemia-reperfusionthrough AMP-activated protein kinase (AMPK)-dependentmechanismrdquo The Journal of Biological Chemistry vol 287 no23 pp 18965ndash18973 2012

[21] Z Wei X Lei P S Petersen S Aja and G WWong ldquoTargeteddeletion of C1qTNF-related protein 9 increases food intakedecreases insulin sensitivity and promotes hepatic steatosis inmicerdquoThe American Journal of PhysiologymdashEndocrinology andMetabolism vol 306 no 7 pp E779ndashE790 2014

[22] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factor-related protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

4 BioMed Research International

patients the leptin mRNA expression in the EAT increasedmarkedly (119875 lt 005) but CTRP9 mRNA expression in theEAT reduced dramatically (119875 lt 005 Figure 1) in CADpatients Immunohistochemistry for leptin and macrophagemarker in the EAT showed that leptin expression andmacrophage count in CAD patients were significantly higherthan those in non-CADpatients while theCTRP9 expressionreduced markedly in CAD patients (Figure 2)

4 Discussion

Adipose tissues have been proved to be a metabolicallyactive organ capable of secreting endocrine and paracrineagents that may potentially affect the cardiovascular systemand are independent risk factors of coronary arterial dis-ease (CAD) Leptin was identified as the first adipokine in1994 and is able to promote the progression of diabetesobesity and atherosclerosis [8] On the contrary APNa member of CTRP family has attracted much interestbecause of its anti-inflammatoryvasculoprotective and anti-ischemiccardioprotective properties To date 15 additionalmembers of the CTRP family have been identified [6]CTRP9 the closest adiponectin paralog is predominantlyexpressed in adipose tissues CTRP9 has attracted a lot ofattention due to its beneficial cardiovascular effects especiallythe antiatherosclerotic effect [9ndash12]

EAT is a heart fat depot and directly contacts withthe myocardium and coronary arteries The pathologicalincrease in EAT and the concomitance of othermetabolic andhemodynamic abnormalities turn it into an adverse lipotoxicprothrombotic and proinflammatory organ [13ndash15] Ourprevious study showed that pericardial adipose tissue volumewas significantly correlated with traditional cardiovascularrisk factors the severity of CA and the number of stenoticcoronary vessels [16] EAT-derived inflammatory cytokinesare also significantly related to the plaque vulnerabilityin CAD When compared with non-CAD patients moremacrophages were found and the expressions of leptin andMMP9 increased markedly in the EAT of CAD patients [17]Thus in the present study the serum and EAT levels ofCTRP9 and other proinflammatory cytokines were detectedin patients with and without CAD aiming at elucidating theinfluence of circulating and coronary CTRP9 on CAD

Our results showed there were no marked differences inthe age gender drinking status smoking status hyperten-sion diabetes andBMI betweenCADpatients and non-CADpatients In CAD patients the serum levels of LDL-C CRPTNF-120572 IL-6 and leptin increased significantly and serumlevels of APN and CTRP9 reduced markedly as comparedto non-CAD patients We further correlated serum levels ofCTRP9 and APN with risk factors of cardiovascular diseasesResults showed bothCTRP9 andAPNwere protective factorsof CAD negatively related to BMI HOMA-IR TNF-120572 IL-6 and leptin (risk factors) and positively related to HDL-C (a protective factor) Moreover there was a positivecorrelation between CTRP9 andAPNThese findings suggestthat CTRP9 like APN may exert antidiabetic and anti-inflammatory effects and regulate the glucose homeostasisprimarily through improving insulin sensitivity

CADNon-CAD

Leptin

mRN

A ex

pres

sion

CTRP9

lowast

lowast

0

1

2

3

4

Figure 1 mRNA expressions of leptin and CTRP9 in theEAT CTRP9 C1qTNF-Related Protein-9 non-CAD noncoronaryartery disease CAD coronary arterial disease EAT epicardialadipose tissue volume lowast119875 lt 005

CTRP9 and adiponectin can form heterotrimers via theglobular C1q domain that circulates in the blood [18] andshares the receptor Adipo R1 with adiponectin in the vascularendothelial cells [19] and cardiomyocytes [20] Therefore weexamined whether the favorable metabolic effects of CTRP9were adiponectin dependent After adjustment for APNwith partial correlation analysis CTRP9 was still negativelyassociated with BMI HOMA-IR TNF-120572 IL-6 and leptinand positively related to HDL although the extent of its rela-tionship with BMI HOMA-IR and HDL-C reduced slightlyMultivariate logistic regression analysis revealed that serumCTRP9 was an independent protective factor of CAD (OR =0620 119875 = 0011) This suggests that the antidiabetic anti-inflammatory and myocardial protective effects of CTRP9are independent of APN although the relationship of CTRP9and APN with risk factors of cardiovascular diseases iscomparable and there is a relationship between CTRP9 andAPN In recent 2 studies similar findings were obtainedserum CTRP9 level was positively associated with favorableglucose or metabolic phenotypes [7] and arterial stiffness inpatients with type 2 diabetes [12]

In this study EAT was collected around the coro-nary artery during CABG and valve replacement Resultsshowed that when compared with non-CAD patients leptinmRNAexpression increasedmarkedly but theCTRP9mRNAexpression reduced significantly in EAT of CAD patientsImmunohistochemistry for leptin and macrophage markerin EAT showed that the leptin expression and macrophagecount were significantly higher in CAD patients but theCTRP9 expression was lower in CAD patients as comparedto non-CAD patients CA is influenced by not only theproinflammatory and anti-inflammatory adipokins in thesystemic circulation but also the inflammatory status aroundthe coronary vessels With the development of CA the anti-inflammatory and vascular protective effects of CTRP9 arecompromised Our previous study showed that in rabbit

BioMed Research International 5

Non-CAD

Leptin CTRP9 Macrophage

CAD

Figure 2 Immunohistochemistry for leptin CTRP9 and macrophage marker in the EAT CTRP9 C1qTNF-Related Protein-9 non-CADnoncoronary artery disease CAD coronary heart disease

CA model the whiting epicardial brown adipose tissue waspresent in the progression of CA and IL-6 could induce thetransformation of epicardial brown adipose tissue into whiteadipose tissue by activating JAK-STAT3 pathway

Currently the specific mechanism underlying the effectsof CTRP9 on CA is still unclear In studies on CTRP9 KOmice [21] and transgenic CTRP9 mice [9] results showedthat pharmacologically elevated circulating CTRP9 exertedtherapeutic effects on the obesity and obesity-associatedinsulin resistance Several studies have indicated that CTRP9is able to exert protective effects on the cardiovascular sys-tem CTRP9 may induce vasorelaxation in an endothelium-dependent manner which is mediated by the adiponectinreceptor-1AMPKendothelial nitric oxide synthasenitricoxide signaling pathway [19] CTRP9 downregulation byTNF-120572-initiated oxidative PPAR120574 suppression contributes tothe exacerbated heart injury in diabetesTheC-terminal glob-ular domain of CTRP9 is able to attenuate the oxidative stressreduce the myocardial infarct area and enhance cardiacoutput in DIO mice after myocardial ischemiareperfusioninjury [22] CTRP9 overexpression reduces myocardialinfarct area and hypoxia-induced apoptosis of cardiacmyocytes following myocardial ischemiareperfusion in aAMPK signaling pathway dependent manner [20] and sub-stantially reduces the neointimal formation by suppressingthe vascular smooth muscle cell proliferation and the migra-tion through the cAMPPKAERK pathway [11]

5 Limitations

There are some limitations in our study First this was a cross-sectional study and whether there is causative association

among them is still unclear Second the study was conductedin a single center and in Chinese patients the sample size wassmall and whether our results can be generalized to otherpatients is uncertain In addition themechanisms underlyingthe protective effects of CTRP9 on the cardiovascular systemare required for further investigation Thus studies withlarge sample size and long-term follow-up are needed touncover the underlying mechanisms of the protective effectsof CTRP9

6 Conclusion

Our study for the first time investigated the associationsof CTRP9 and EAT with CA in humans In conclusionserum CTRP9 decreases significantly and the protein andmRNA expression of CTRP9 in EAT reduced markedly inCAD patients as compared to non-CAD patients SerumCTRP9 is negatively associated with traditional risk factorsof cardiovascular diseases and some inflammatory factorsbut positively with serum APN and HDL-C Moreover theabovementioned relationship between CTRP9 and beneficialmetabolic phenotypes is independent of serum adiponectinThis study suggests that circulating and coronary CTRP9plays an important role in the inflammation of CAD andthe CA Serum CTRP9 is an independent protective factorof CAD

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

6 BioMed Research International

Acknowledgment

The study was supported by the ldquoSix Peaks of the Talents inJiangsu Provincerdquo

References

[1] N Ouchi J L Parker J J Lugus and K Walsh ldquoAdipokines ininflammation andmetabolic diseaserdquoNature Reviews Immunol-ogy vol 11 no 2 pp 85ndash97 2011

[2] N Goncąlves I Falcao-Pires and A F Leite-MoreiraldquoAdipokines and their receptors potential new targets incardiovascular diseasesrdquo Future Medicinal Chemistry vol 7 no2 pp 139ndash157 2015

[3] G A PayneM C Kohr and J D Tune ldquoEpicardial perivascularadipose tissue as a therapeutic target in obesity-related coronaryartery diseaserdquo British Journal of Pharmacology vol 165 no 3pp 659ndash669 2012

[4] A M Noyes K Dua R Devadoss and L Chhabra ldquoCardiacadipose tissue and its relationship to diabetes mellitus andcardiovascular diseaserdquo World Journal of Diabetes vol 5 pp868ndash876 2014

[5] A Schaffler and C Buechler ldquoCTRP family linking immunityto metabolismrdquo Trends in Endocrinology and Metabolism vol23 no 4 pp 194ndash203 2012

[6] M M Seldin S Y Tan and G W Wong ldquoMetabolic functionof the CTRP family of hormonesrdquo Reviews in Endocrine andMetabolic Disorders vol 15 no 2 pp 111ndash123 2014

[7] Y-C Hwang S W Oh S-W Park and C-Y Park ldquoAssociationof serum C1qTNF-related Protein-9 (CTRP9) concentrationwith visceral adiposity and metabolic syndrome in humansrdquoInternational Journal of Obesity 2013

[8] Y Zhang R Proenca M Maffei M Barone L Leopold and JM Friedman ldquoPositional cloning of the mouse obese gene andits human homologuerdquo Nature vol 372 no 6505 pp 425ndash4321994

[9] J M Peterson Z Wei M M Seldin M S Byerly S Ajaand G W Wong ldquoCTRP9 transgenic mice are protected fromdiet-induced obesity and metabolic dysfunctionrdquo AmericanJournal of Physiology-Regulatory Integrative and ComparativePhysiology vol 305 no 5 pp R522ndashR533 2013

[10] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factorndashrelated protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

[11] Y Uemura R Shibata K Ohashi et al ldquoAdipose-derived factorCTRP9 attenuates vascular smooth muscle cell proliferationand neointimal formationrdquoTheFASEB Journal vol 27 no 1 pp25ndash33 2013

[12] C H Jung M J Lee Y M Kang et al ldquoAssociation ofserum C1qTNF-related protein-9 concentration with arterialstiffness in subjects with type 2 diabetesrdquoThe Journal of ClinicalEndocrinology amp Metabolism vol 99 no 12 pp E2477ndashE24842014

[13] F Hajsadeghi V Nabavi A Bhandari et al ldquoIncreased epicar-dial adipose tissue is associated with coronary artery diseaseand major adverse cardiovascular eventsrdquo Atherosclerosis vol237 no 2 pp 486ndash489 2014

[14] M Kaya M Yeniterzi P Yazici et al ldquoEpicardial adipose tissueis associated with extensive coronary artery lesions in patients

undergoing coronary artery bypass grafting an observationalstudyrdquo Romanian Journal of Medical Practice vol 9 no 2 pp135ndash143 2014

[15] A H Talman P J Psaltis J D Cameron et al ldquoEpicardialadipose tissue far more than a fat depotrdquo CardiovascularDiagnosis and Therapy vol 4 article 416 2014

[16] J Wang L-J Wang Y-P Peng L-J Zhang S-S Jiang and J-B Gong ldquoAssociation of pericardial adipose tissue volume withpresence and severity of coronary atherosclerosisrdquo Clinical ampInvestigative Medicine vol 36 no 3 pp 143ndash150 2013

[17] M Oikawa T Owada H Yamauchi et al ldquoepicardial adiposetissue reflects the presence of coronary artery disease compar-ison with abdominal visceral adipose tissuerdquo BioMed ResearchInternational vol 2015 Article ID 483982 7 pages 2015

[18] J M Peterson Z Wei and G W Wong ldquoCTRP8 and CTRP9Bare novel proteins that hetero-oligomerizewithC1qTNF familymembersrdquo Biochemical and Biophysical Research Communica-tions vol 388 no 2 pp 360ndash365 2009

[19] Q Zheng Y Yuan W Yi et al ldquoC1qTNF-related proteins afamily of novel adipokines induce vascular relaxation throughthe adiponectin receptor-1AMPKeNOSnitric oxide signalingpathwayrdquo Arteriosclerosis Thrombosis and Vascular Biologyvol 31 no 11 pp 2616ndash2623 2011

[20] T Kambara K Ohashi R Shibata et al ldquoCTRP9 protein pro-tects against myocardial injury following ischemia-reperfusionthrough AMP-activated protein kinase (AMPK)-dependentmechanismrdquo The Journal of Biological Chemistry vol 287 no23 pp 18965ndash18973 2012

[21] Z Wei X Lei P S Petersen S Aja and G WWong ldquoTargeteddeletion of C1qTNF-related protein 9 increases food intakedecreases insulin sensitivity and promotes hepatic steatosis inmicerdquoThe American Journal of PhysiologymdashEndocrinology andMetabolism vol 306 no 7 pp E779ndashE790 2014

[22] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factor-related protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

BioMed Research International 5

Non-CAD

Leptin CTRP9 Macrophage

CAD

Figure 2 Immunohistochemistry for leptin CTRP9 and macrophage marker in the EAT CTRP9 C1qTNF-Related Protein-9 non-CADnoncoronary artery disease CAD coronary heart disease

CA model the whiting epicardial brown adipose tissue waspresent in the progression of CA and IL-6 could induce thetransformation of epicardial brown adipose tissue into whiteadipose tissue by activating JAK-STAT3 pathway

Currently the specific mechanism underlying the effectsof CTRP9 on CA is still unclear In studies on CTRP9 KOmice [21] and transgenic CTRP9 mice [9] results showedthat pharmacologically elevated circulating CTRP9 exertedtherapeutic effects on the obesity and obesity-associatedinsulin resistance Several studies have indicated that CTRP9is able to exert protective effects on the cardiovascular sys-tem CTRP9 may induce vasorelaxation in an endothelium-dependent manner which is mediated by the adiponectinreceptor-1AMPKendothelial nitric oxide synthasenitricoxide signaling pathway [19] CTRP9 downregulation byTNF-120572-initiated oxidative PPAR120574 suppression contributes tothe exacerbated heart injury in diabetesTheC-terminal glob-ular domain of CTRP9 is able to attenuate the oxidative stressreduce the myocardial infarct area and enhance cardiacoutput in DIO mice after myocardial ischemiareperfusioninjury [22] CTRP9 overexpression reduces myocardialinfarct area and hypoxia-induced apoptosis of cardiacmyocytes following myocardial ischemiareperfusion in aAMPK signaling pathway dependent manner [20] and sub-stantially reduces the neointimal formation by suppressingthe vascular smooth muscle cell proliferation and the migra-tion through the cAMPPKAERK pathway [11]

5 Limitations

There are some limitations in our study First this was a cross-sectional study and whether there is causative association

among them is still unclear Second the study was conductedin a single center and in Chinese patients the sample size wassmall and whether our results can be generalized to otherpatients is uncertain In addition themechanisms underlyingthe protective effects of CTRP9 on the cardiovascular systemare required for further investigation Thus studies withlarge sample size and long-term follow-up are needed touncover the underlying mechanisms of the protective effectsof CTRP9

6 Conclusion

Our study for the first time investigated the associationsof CTRP9 and EAT with CA in humans In conclusionserum CTRP9 decreases significantly and the protein andmRNA expression of CTRP9 in EAT reduced markedly inCAD patients as compared to non-CAD patients SerumCTRP9 is negatively associated with traditional risk factorsof cardiovascular diseases and some inflammatory factorsbut positively with serum APN and HDL-C Moreover theabovementioned relationship between CTRP9 and beneficialmetabolic phenotypes is independent of serum adiponectinThis study suggests that circulating and coronary CTRP9plays an important role in the inflammation of CAD andthe CA Serum CTRP9 is an independent protective factorof CAD

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

6 BioMed Research International

Acknowledgment

The study was supported by the ldquoSix Peaks of the Talents inJiangsu Provincerdquo

References

[1] N Ouchi J L Parker J J Lugus and K Walsh ldquoAdipokines ininflammation andmetabolic diseaserdquoNature Reviews Immunol-ogy vol 11 no 2 pp 85ndash97 2011

[2] N Goncąlves I Falcao-Pires and A F Leite-MoreiraldquoAdipokines and their receptors potential new targets incardiovascular diseasesrdquo Future Medicinal Chemistry vol 7 no2 pp 139ndash157 2015

[3] G A PayneM C Kohr and J D Tune ldquoEpicardial perivascularadipose tissue as a therapeutic target in obesity-related coronaryartery diseaserdquo British Journal of Pharmacology vol 165 no 3pp 659ndash669 2012

[4] A M Noyes K Dua R Devadoss and L Chhabra ldquoCardiacadipose tissue and its relationship to diabetes mellitus andcardiovascular diseaserdquo World Journal of Diabetes vol 5 pp868ndash876 2014

[5] A Schaffler and C Buechler ldquoCTRP family linking immunityto metabolismrdquo Trends in Endocrinology and Metabolism vol23 no 4 pp 194ndash203 2012

[6] M M Seldin S Y Tan and G W Wong ldquoMetabolic functionof the CTRP family of hormonesrdquo Reviews in Endocrine andMetabolic Disorders vol 15 no 2 pp 111ndash123 2014

[7] Y-C Hwang S W Oh S-W Park and C-Y Park ldquoAssociationof serum C1qTNF-related Protein-9 (CTRP9) concentrationwith visceral adiposity and metabolic syndrome in humansrdquoInternational Journal of Obesity 2013

[8] Y Zhang R Proenca M Maffei M Barone L Leopold and JM Friedman ldquoPositional cloning of the mouse obese gene andits human homologuerdquo Nature vol 372 no 6505 pp 425ndash4321994

[9] J M Peterson Z Wei M M Seldin M S Byerly S Ajaand G W Wong ldquoCTRP9 transgenic mice are protected fromdiet-induced obesity and metabolic dysfunctionrdquo AmericanJournal of Physiology-Regulatory Integrative and ComparativePhysiology vol 305 no 5 pp R522ndashR533 2013

[10] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factorndashrelated protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

[11] Y Uemura R Shibata K Ohashi et al ldquoAdipose-derived factorCTRP9 attenuates vascular smooth muscle cell proliferationand neointimal formationrdquoTheFASEB Journal vol 27 no 1 pp25ndash33 2013

[12] C H Jung M J Lee Y M Kang et al ldquoAssociation ofserum C1qTNF-related protein-9 concentration with arterialstiffness in subjects with type 2 diabetesrdquoThe Journal of ClinicalEndocrinology amp Metabolism vol 99 no 12 pp E2477ndashE24842014

[13] F Hajsadeghi V Nabavi A Bhandari et al ldquoIncreased epicar-dial adipose tissue is associated with coronary artery diseaseand major adverse cardiovascular eventsrdquo Atherosclerosis vol237 no 2 pp 486ndash489 2014

[14] M Kaya M Yeniterzi P Yazici et al ldquoEpicardial adipose tissueis associated with extensive coronary artery lesions in patients

undergoing coronary artery bypass grafting an observationalstudyrdquo Romanian Journal of Medical Practice vol 9 no 2 pp135ndash143 2014

[15] A H Talman P J Psaltis J D Cameron et al ldquoEpicardialadipose tissue far more than a fat depotrdquo CardiovascularDiagnosis and Therapy vol 4 article 416 2014

[16] J Wang L-J Wang Y-P Peng L-J Zhang S-S Jiang and J-B Gong ldquoAssociation of pericardial adipose tissue volume withpresence and severity of coronary atherosclerosisrdquo Clinical ampInvestigative Medicine vol 36 no 3 pp 143ndash150 2013

[17] M Oikawa T Owada H Yamauchi et al ldquoepicardial adiposetissue reflects the presence of coronary artery disease compar-ison with abdominal visceral adipose tissuerdquo BioMed ResearchInternational vol 2015 Article ID 483982 7 pages 2015

[18] J M Peterson Z Wei and G W Wong ldquoCTRP8 and CTRP9Bare novel proteins that hetero-oligomerizewithC1qTNF familymembersrdquo Biochemical and Biophysical Research Communica-tions vol 388 no 2 pp 360ndash365 2009

[19] Q Zheng Y Yuan W Yi et al ldquoC1qTNF-related proteins afamily of novel adipokines induce vascular relaxation throughthe adiponectin receptor-1AMPKeNOSnitric oxide signalingpathwayrdquo Arteriosclerosis Thrombosis and Vascular Biologyvol 31 no 11 pp 2616ndash2623 2011

[20] T Kambara K Ohashi R Shibata et al ldquoCTRP9 protein pro-tects against myocardial injury following ischemia-reperfusionthrough AMP-activated protein kinase (AMPK)-dependentmechanismrdquo The Journal of Biological Chemistry vol 287 no23 pp 18965ndash18973 2012

[21] Z Wei X Lei P S Petersen S Aja and G WWong ldquoTargeteddeletion of C1qTNF-related protein 9 increases food intakedecreases insulin sensitivity and promotes hepatic steatosis inmicerdquoThe American Journal of PhysiologymdashEndocrinology andMetabolism vol 306 no 7 pp E779ndashE790 2014

[22] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factor-related protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

6 BioMed Research International

Acknowledgment

The study was supported by the ldquoSix Peaks of the Talents inJiangsu Provincerdquo

References

[1] N Ouchi J L Parker J J Lugus and K Walsh ldquoAdipokines ininflammation andmetabolic diseaserdquoNature Reviews Immunol-ogy vol 11 no 2 pp 85ndash97 2011

[2] N Goncąlves I Falcao-Pires and A F Leite-MoreiraldquoAdipokines and their receptors potential new targets incardiovascular diseasesrdquo Future Medicinal Chemistry vol 7 no2 pp 139ndash157 2015

[3] G A PayneM C Kohr and J D Tune ldquoEpicardial perivascularadipose tissue as a therapeutic target in obesity-related coronaryartery diseaserdquo British Journal of Pharmacology vol 165 no 3pp 659ndash669 2012

[4] A M Noyes K Dua R Devadoss and L Chhabra ldquoCardiacadipose tissue and its relationship to diabetes mellitus andcardiovascular diseaserdquo World Journal of Diabetes vol 5 pp868ndash876 2014

[5] A Schaffler and C Buechler ldquoCTRP family linking immunityto metabolismrdquo Trends in Endocrinology and Metabolism vol23 no 4 pp 194ndash203 2012

[6] M M Seldin S Y Tan and G W Wong ldquoMetabolic functionof the CTRP family of hormonesrdquo Reviews in Endocrine andMetabolic Disorders vol 15 no 2 pp 111ndash123 2014

[7] Y-C Hwang S W Oh S-W Park and C-Y Park ldquoAssociationof serum C1qTNF-related Protein-9 (CTRP9) concentrationwith visceral adiposity and metabolic syndrome in humansrdquoInternational Journal of Obesity 2013

[8] Y Zhang R Proenca M Maffei M Barone L Leopold and JM Friedman ldquoPositional cloning of the mouse obese gene andits human homologuerdquo Nature vol 372 no 6505 pp 425ndash4321994

[9] J M Peterson Z Wei M M Seldin M S Byerly S Ajaand G W Wong ldquoCTRP9 transgenic mice are protected fromdiet-induced obesity and metabolic dysfunctionrdquo AmericanJournal of Physiology-Regulatory Integrative and ComparativePhysiology vol 305 no 5 pp R522ndashR533 2013

[10] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factorndashrelated protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

[11] Y Uemura R Shibata K Ohashi et al ldquoAdipose-derived factorCTRP9 attenuates vascular smooth muscle cell proliferationand neointimal formationrdquoTheFASEB Journal vol 27 no 1 pp25ndash33 2013

[12] C H Jung M J Lee Y M Kang et al ldquoAssociation ofserum C1qTNF-related protein-9 concentration with arterialstiffness in subjects with type 2 diabetesrdquoThe Journal of ClinicalEndocrinology amp Metabolism vol 99 no 12 pp E2477ndashE24842014

[13] F Hajsadeghi V Nabavi A Bhandari et al ldquoIncreased epicar-dial adipose tissue is associated with coronary artery diseaseand major adverse cardiovascular eventsrdquo Atherosclerosis vol237 no 2 pp 486ndash489 2014

[14] M Kaya M Yeniterzi P Yazici et al ldquoEpicardial adipose tissueis associated with extensive coronary artery lesions in patients

undergoing coronary artery bypass grafting an observationalstudyrdquo Romanian Journal of Medical Practice vol 9 no 2 pp135ndash143 2014

[15] A H Talman P J Psaltis J D Cameron et al ldquoEpicardialadipose tissue far more than a fat depotrdquo CardiovascularDiagnosis and Therapy vol 4 article 416 2014

[16] J Wang L-J Wang Y-P Peng L-J Zhang S-S Jiang and J-B Gong ldquoAssociation of pericardial adipose tissue volume withpresence and severity of coronary atherosclerosisrdquo Clinical ampInvestigative Medicine vol 36 no 3 pp 143ndash150 2013

[17] M Oikawa T Owada H Yamauchi et al ldquoepicardial adiposetissue reflects the presence of coronary artery disease compar-ison with abdominal visceral adipose tissuerdquo BioMed ResearchInternational vol 2015 Article ID 483982 7 pages 2015

[18] J M Peterson Z Wei and G W Wong ldquoCTRP8 and CTRP9Bare novel proteins that hetero-oligomerizewithC1qTNF familymembersrdquo Biochemical and Biophysical Research Communica-tions vol 388 no 2 pp 360ndash365 2009

[19] Q Zheng Y Yuan W Yi et al ldquoC1qTNF-related proteins afamily of novel adipokines induce vascular relaxation throughthe adiponectin receptor-1AMPKeNOSnitric oxide signalingpathwayrdquo Arteriosclerosis Thrombosis and Vascular Biologyvol 31 no 11 pp 2616ndash2623 2011

[20] T Kambara K Ohashi R Shibata et al ldquoCTRP9 protein pro-tects against myocardial injury following ischemia-reperfusionthrough AMP-activated protein kinase (AMPK)-dependentmechanismrdquo The Journal of Biological Chemistry vol 287 no23 pp 18965ndash18973 2012

[21] Z Wei X Lei P S Petersen S Aja and G WWong ldquoTargeteddeletion of C1qTNF-related protein 9 increases food intakedecreases insulin sensitivity and promotes hepatic steatosis inmicerdquoThe American Journal of PhysiologymdashEndocrinology andMetabolism vol 306 no 7 pp E779ndashE790 2014

[22] Y Sun W Yi Y Yuan et al ldquoC1qtumor necrosis factor-related protein-9 a novel adipocyte-derived cytokine attenu-ates adverse remodeling in the ischemicmouse heart via proteinkinase A activationrdquo Circulation vol 128 no 1 pp S113ndashS1202013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

MEDIATORSINFLAMMATION

of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Behavioural Neurology

EndocrinologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Disease Markers

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

OncologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Oxidative Medicine and Cellular Longevity

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Computational and Mathematical Methods in Medicine

OphthalmologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Diabetes ResearchJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Research and TreatmentAIDS

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Gastroenterology Research and Practice

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom