Research Article Development of a Novel Cysteine Sulfinic Acid Decarboxylase Knockout Mouse: Dietary Taurine …downloads.hindawi.com/journals/jaa/2014/346809.pdf · Target Amp-Nano

Research ArticleDevelopment of a Novel Cysteine Sulfinic Acid DecarboxylaseKnockout Mouse Dietary Taurine Reduces Neonatal Mortality

Eunkyue Park1 Seung Yong Park2 Carl Dobkin3 and Georgia Schuller-Levis1

1 Laboratory of Cellular Immunology Department of Developmental NeurobiologyNew York State Institute for Basic Research in Developmental Disabilities Staten Island NY 10314 USA

2College of Veterinary Medicine Konkuk University Seoul 143-701 Republic of Korea3 Laboratory of Molecular Genetics Department of Human Genetics New York State Institute forBasic Research in Developmental Disabilities Staten Island NY 10314 USA

Correspondence should be addressed to Eunkyue Park parkekopwddnygov

Received 16 October 2013 Revised 13 December 2013 Accepted 15 December 2013 Published 3 February 2014

Academic Editor Guoyao Wu

Copyright copy 2014 Eunkyue Park et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

We engineered a CSAD KO mouse to investigate the physiological roles of taurine The disruption of the CSAD gene was verifiedby Southern Northern andWestern blotting HPLC indicated an 83 decrease of taurine concentration in the plasma of CSADminusminusAlthough CSADminusminus generation (G)1 and G2 survived offspring from G2 CSADminusminus had low brain and liver taurine concentrationsand most died within 24 hrs of birth Taurine concentrations in G3 CSADminusminus born from G2 CSADminusminus treated with taurine in thedrinking water were restored and survival rates of G3 CSADminusminus increased from 15 to 92The mRNA expression of CDO ADOand TauT was not different in CSADminusminus compared to WT and CSAD mRNA was not expressed in CSADminusminus Expression of Gpx1 and 3 was increased significantly in CSADminusminus and restored to normal levels with taurine supplementation Lactoferrin and theprolactin receptor were significantly decreased in CSADminusminus The prolactin receptor was restored with taurine supplementationThese data indicated that CSAD KO is a good model for studying the effects of taurine deficiency and its treatment with taurinesupplementation

1 Introduction

Taurine (2-aminoethanesulfonic acid) which is essentialduring the development of mammals is not incorporatedinto proteins [1] It is mainly produced in the liver andkidney and is present in most other tissues including thebrain leukocytes retina heart placenta and muscle [1ndash3]Taurine is a key element in many diverse processes includingdevelopment of the brain retina and the immune sys-tem osmoregulation reproduction membrane stabilizationregulation of cardiac muscle and inflammation [2 4ndash10]Colostrum contains a very high taurine concentration whichis required for development of the brain and retina inthe newborn human [11] In response to research findingstaurine is universally added to infant formula as well as toparenteral solutions [2 12]

The biosynthesis of taurine from methionine or cysteinecan occur by two distinct pathways Cysteine is oxidizedby cysteine dioxygenase (CDO EC 11311 MW 24 kD)to cysteine sulfinic acid which is converted by CSAD tohypotaurine which is then oxidized to taurine CSAD (EC41129MW51 kD) is a cytosolic enzyme expressed primarilyin liver and kidney [13ndash16] The enzyme responsible for thealternative pathway for taurine biosynthesis is ADO (EC1131119 MW 28 kD) [17 18] Cysteine is incorporated intocoenzyme A (CoA) followed by the release of cysteamineduring CoA turnover Cysteamine is oxidized to hypotaurineby ADO Hepatic CSAD and CDO activity is high comparedto that in the kidney and brain [15 19ndash21] The tissue distri-bution of CSAD protein and mRNA detected by Westernand Northern blot analyses is consistent with CSAD activity

Hindawi Publishing CorporationJournal of Amino AcidsVolume 2014 Article ID 346809 12 pageshttpdxdoiorg1011552014346809

2 Journal of Amino Acids

ADO level is highest in the brain whereas CSAD and CDOlevels are highest in the liver [15 17 18 22]

Cysteine sulfinic acid decarboxylase (CSAD) is one ofrate-limiting enzymes for taurine biosynthesis [2 13] and thelevel of its activity determines the need for dietary taurineCats have been used for taurine studies because they have lowlevels of CDO and CSAD leading to a dependence on dietarysources of taurine Rodents have high levels of CSAD [1 2 23]and taurine is not essential to their diet Taurine is considereda conditionally essential amino acid in humans and isrequired in their diet at certain times during developmentAnalysis of murine CSAD cDNA shows that the enzyme has98and 90homology to rat andhumanCSAD respectively[14 24] Since the cat model has limitations including a longgestation period a heterogeneous genetic background and arelatively large maintenance expense we developed a CSADknockout mouse (CSAD KO) model to better understandthe physiological roles of taurine This novel murine modelwas developed to provide insight into the role of taurinein reproduction innate and adaptive immunity and braindevelopment We report here that the absence of a functionalCSAD gene in the CSAD KO mouse reduces the level ofthis amino acid by gt80 and has a severe effect on neonatalsurvival that is reversed by adding taurine (005) to thedrinking water

2 Materials and Methods

21 Materials Chemicals used in this study were purchasedfrom Sigma Chemicals (St Louise MO) if not otherwisenoted Oligonucleotide primers for PCR were obtained fromEurofins MWG Operon (Huntsville AL) Primers weredesigned by Primer Designer 4 (Scientific and EducationalSoftware Cary NC) Taq polymerase and deoxynucleotideswere obtained from New England Biolabs (Ipswich MA)Agarose was obtained from Lonza Group LTD (Rock-land ME) Nitrocellulose membranes for Western blot andnylon membranes for Northern blot were purchased fromInvitrogen (Carlsbad CA) and NEN Life Science Products(Boston MA) respectively Membranes for Southern blotwere obtained from Bio-Rad (Hercules CA) Trizol andRNeasy kit for RNA extraction and DNeasy kit for DNAextractionwere obtained from Invitrogen andQiagen (Valen-cia CA) respectively Protease inhibitors were purchasedfrom Roche Applied Science (Indianapolis IN) Restrictionenzymes were purchased from Promega (Madison WI)[32P]-dCTP was supplied by Perkin Elmer (Waltham MA)

22 CSAD KO Mice Chimeric CSAD KO mice were pro-duced by injection of cells from a gene trap ES cell line(XP0392) into C57BL6 (B6) blastocysts at theMouseMutantRegional Resource Centers (MMRRC UC Davis CA) whichwere implanted into a pseudopregnant B6 mouse Ninechimeric mice from MMRRC were mated with B6 (JacksonLaboratories Bar Harbor ME) in the animal colony at thisinstitution (NYS Institute for Basic Research in Developmen-tal Disabilities) Agouti mice produced by this mating wereback-crossed to B6 and offspring were genotyped using PCR

to identify germline transmitted CSAD+minus heterozygotes(CSAD+minus) Heterozygous siblings were mated to produceCSADminusminus homozygous pups (HO) Mice were fed taurine-free chow (LabDiet PMI Nutrition International St LouisMO) Taurine concentrations in commercial food were con-firmed by HPLC All mice were kept under 12 hr daynightwith free access to food and water Some experimentalanimals had exogenous taurine added to their water at005 as indicated in Section 3 For optimum reproductiveperformance one or two females were mated to a singlemale Both females and males used for mating in the taurine-treated groups were supplemented with taurine Animalswere weaned at 3 to 4 weaks of age

All procedures involving live animals were approved bythe Institutional Animal Care and Use Committee of IBR

23 Southern Blot Analysis DNA from the spleen was ana-lyzed by Southern blotting to confirm theCSADKOgenotypeusing a modified method previously described [25] DNAfrom the spleen was prepared with DNeasy kits (QiagenValencia CA) DNA was digested with EcoR V (Promega)fractionated by agarose gel electrophoresis and transferred toa nylonmembrane (Bio-Rad)Themembrane was hybridizedusing CSAD cDNA as a probe to confirm the disruption ofthe CSAD gene CSAD cDNA was prepared as previouslydescribed [14]

24 Genotype Determination Template DNA was isolatedfrom a tail sample at 3 weeks of age with a DNeasy kit(Qiagen) and analyzed with two sets of primers 120573-geo andvector insertion site (VIS) (Table 1) using a PCR kit (PerkinElmer Shelton CT) After an initial of 93∘C for 3min DNAwas denatured at 93∘C for 1min annealed at 63∘C for 1minand extended at 72∘C for one and a half min for 30 cyclesDNA was extended for additional 5min PCR products werecharacterized by agarose gel electrophoresis The sizes ofPCR products using 120573-geo and VIS primers were 682 bpand 1038 bp respectively DNA from HO and CSAD++ wildtype (WT) produced one band from either 120573-geo or VISrespectively and CSAD+minus produced bands from both 120573-geoand VIS

25 Northern Blot Analysis Northern blot analysis was per-formed as previously described [10] Briefly total RNAs fromliquid nitrogen frozen liver were extracted with Trizol andRNeasy kit RNAwas separated by agarose gel electrophoresisand transferred to a nylon membrane (NEN Life ScienceProduct) The membrane was hybridized using [32P]-dCTPlabeled CSAD cDNA as probe

26 Western Blot Analysis Western blot analysis was per-formed according to the method previously described[10] Briefly frozen liver and brain were homogenizedwith PBS buffer containing IGEPAL CA-630 and proteaseinhibitors (Roche Applied Science) Supernatants from tissuehomogenates were separated using SDS-PAGE and trans-ferred to a nitrocellulose membrane The membrane was

Journal of Amino Acids 3

Table 1 Sequences of PCR primers

Primer Sequence (51015840-31015840)1

120573-geo F TTATCGATGAGCGTGGTGGTTATGC120573-geo R GCGCGTACATCGGGCAAATAATATC2VIS F GCCTTGCCACAGGAGATTATVIS R AACACGCAGACTCAGGAACA1Primers for vector (pGT1xf)2Primers for vector insertion site

incubated with rabbit anti-CSAD antibody and then withalkaline phosphatase labeled goat anti-rabbit secondary anti-body after washing the membrane with PBS containing02 Tween 20 The membrane was visualized using 5-bromo-4-chloro-3-indolyl phosphatenitroblue tetrazoliumPolyclonal rabbit anti-CSAD was produced in our laboratoryusing c-terminal 15 peptides obtained from Synpep Corp(Doblin CA) [14]

27 High Performance Liquid Chromatography (HPLC) Thelevels of taurine were determined using HPLC (WatersMilford MA) [26] Briefly tissues were homogenized using5 TCA and centrifuged for removal of proteins Aftersamples were dried using a Speedvac (Savant Holbrook NY)theywere derivatized using phenylisothiocyanate (PITC) andseparated using a C18 columnwith a gradient of acetate buffercontaining 25 acetonitrile (pH 65) and 45 acetonitrilesolution containing 15 methanol at 45∘C The flow ratewas 1mLmin Taurine concentrations were determined bycomparison to a standard

28MicroarrayAnalysis Total RNAs from the brain and liverin WT and G3 HO at postnatal day 1 (PD1) were extractedusing RNeasy mini kit (Qiagen) according to manufacturerrsquosinstructions Biotin-RNA was generated using the EpicentreTarget Amp-Nano Labeling Kit for Illumina ExpressionBeadChip (Cat number TAN07908 San Diego CA) froman input of 300 ng of high quality RNA Illumina beadarrays were performed using Mouse WG-6 v2 Bead Chip(Cat number BD-103-0204) and Illumina gene expressionkit according to manufacturerrsquos protocol Raw intensity val-ues were acquired using the HiScan microarray scanner(Illumina) and imported to Genome Studio using the GeneExpression Module (Illumina)

29 RT2 qPCR Analysis Total RNA was extracted usingRNeasy kit (Qiagen) from the brain and liver at PD 1 andwas reverse-transcribed using cDNA kit according to themanufacturerrsquos instruction (Qiagen) Quantitative real timePCR with 10 ng of cDNA were carried out in duplicate ina 7300 real time PCR system (Effendorff Hauppauge NY)using the SYBRmastermix (Qiagen) and the following cycles2min at 50∘C 10min at 95∘C and then 40 cycles each at 95∘Cfor 15 s and 60∘C for 60 s [19] RT2 qPCR analysis was alsocarried out according tomanufacturerrsquosmanual using120573-actinas a control All primers used in this study were purchasedfrom Qiagen For data analysis the Ct method was used for

each gene fold changes were calculated as difference in geneexpression of G3 HO and G3 HOT compared to that in WTΔCt was calculated by subtraction of Ct of 120573-actin from Ctof the specific gene ΔΔCt was calculated by subtraction ofΔCt ofWT from ΔCt of G3 HO or H3 HOT Fold change wasdetermined by 2ΔΔ119862119905More than 1 indicates gene upregulationand less than 1 indicates gene downregulation

210 Statistical Analysis Data were represented as mean plusmnSE Statistical significance was determined using Statistica 8(StatSoft Tulsa OK) Significant differences between groupswere determined as 119875 lt 005 using LSD or tukey HSD in posthoc under one way ANOVA

3 Results

31 CSAD KO Mouse The murine CSAD gene is located onchromosome 15102 176 998-102 189 043 bp (assembly Dec2011 GRCm38mm10) Chimeric mice were derived from anES cell line in which the CSAD gene had been inactivatedby insertional mutagenesis (XP0392 MMRRC 022638-UCDSanger gene trap line) [Figure 1(a)] ES cells were insertedinto B6 blastocysts at the MMRRC [27 28] (work supportedby NCRR-NIH) Chimeric males (obtained from MMRRC)were mated with wild type B6 females The genotypes of theresulting offspring were determined by PCR using tail DNAwith two pairs of primers (Table 1) One primer pair (120573-geo) detects the presence of the gene trap insertion (vector)located between exons 8 and 9 in the CSAD gene [Figures1(a) and 1(c)] and the other primer pair (VIS) detects thewild type (WT) sequence at the insertion site and gives noproduct in the presence of the insertion The sizes of the 120573-geo and VIS PCR products are 682 and 1038 bp respectivelySouthern blot analysis of homozygous CSAD KOmice (HO)showed disruption of the CSAD gene [71 kb in Figure 1(b)]WT and CSAD+minus showed one band (59 kb) and two bands(59 and 71 kb) respectively The CSAD protein (510 kD)and CSAD mRNA were detected in WT and CSAD+minus butwere not detected in HO [Figures 1(e) and 1(d)] Plasmawas collected by heart puncture from all three groups atage of 8 weeks Plasma taurine concentration determinedby HPLC was significantly reduced in CSAD+minus but wasdrastically reduced by more than 80 in G1 HO and G2 HOcompared to WT (Table 2) Taurine concentrations were notsignificantly different in females compared to males and datafrom 8-week-old males and females were pooled Taurine isnot completely absent in HO presumably because there is analternative pathway for taurine biosynthesis from cysteamine[17] through cysteamine dioxygenase (ADO) CSAD+minus timesCSAD+minusmating produced offspring genotypes that were notdifferent from the expected Mendelian distribution

32 CSAD KO Reproduction To investigate the role oftaurine in reproduction we observed three generations ofhomozygous CSADminusminus Homozygotes are abbreviated asfollows G1 HO were born from CSAD+minus times CSAD+minus G2HO were born from G1 HO times G1 HO G3 HO were born


Wild typeCSAD12kb

pGTIxFGene trap

Vector

1kb8 EV

EV

EV 9

A

SA

B

pA120573-geo

(a)

++ +minus minusminus

71kb

59kb

(b)


VIS

120573-geo

(c)


CSAD

120572-Actin

(d)


CSAD

(e)

Figure 1 Analysis of the CSAD gene knockout (a) Schematic diagram of pGT01xf insertion into the CSAD gene Rectangles representexons and open rectangles represent untranslated regions ldquoArdquo shows the location of the VIS amplicon which is produced from the wild typechromosome and ldquoBrdquo shows the location of the 120573-geo amplicon which is produced from the gene trap vector inserted between exons 8 and9 SA splicing acceptor pA polyadenylation sequence EV EcoR V sites (b) Southern analysis of genomic DNA digested with EcoR V andhybridized using [32P]-dCTP labeled CSAD cDNA The wild type CSAD EcoR V fragment is 59 kb and that of disrupted fragment is 71 kbldquo++rdquo WT ldquo+minusrdquo CSAD+minus ldquominusminusrdquo CSADminusminus (c) PCR products (1038 bp and 682 bp) with VIS and 120573-geo primer sets 120573-geo product isabsent in WT and VIS PCR product is absent in CSADminusminus Both PCR products are present in CSAD+minus (d) Northern blot analysis of totalRNA from liver with [32P]-dCTP labeled cDNA and 120572-actin as a control probe (e) Western blot analysis of kidney homogenates probedwith an anti-CSAD antibody and detected with an alkaline phosphatase labeled goat anti-rabbit antibody CSAD (51 kD) was not detected inCSADminusminus homogenates

WT HT

G1 HO

HO G1 HO

G2 HO HOT G2 HOT

G3 HO G3 HOT

G4 HO G4 HOT

Figure 2 Mating scheme G represents generation of mice and T for taurine treatment Squares and circles represent male and femalerespectively White is WT half black is HT and black is HO G2 HOT were treated with 005 taurine in the drinking water 10 days prior tomating and G3 HOT were treated with taurine after weaning (3-4 weeks of age)

from G2 HO times G2 HO (Figures 2 and 3) There were nosignificant differences from wild type (WT) in the pregnancyrates in different generations of HO mice There was also nodifference in the number of females and males that were bredand the number of pregnancies per female averaged 3-4 in allgroups In addition the initial number of pups per litter didnot vary significantly across groups (Table 3) Although the

concentrations of taurine in the plasma were low in G1 HO(Table 2) all of the offspring from G1 HO pairs survived andthrived (Table 3)However offspring fromG2HOandG3HOhad a very low rate of survival although a normal numberof pups were born alive All of the pups from eleven out ofthirteen litters (85) born from G2 HO and from nine out often litters born from G3 HO (90) were dead within 24 hrs


WT

HTG1 HO G2 HO

G3 HO

G3 HOTG2 HOT

G4 HOT

WT

HT

lowast

lowastlowast

lowast

lowast

lowast

HOT taurine treatment (005)

Figure 3 Schematic diagram for generation of different genotypes and sampling tissues for taurine concentrations microarray analysis andRT2 qPCR Generations of different genotypes are shown as stepped horizontal lines Short vertical lines indicate mating of 8-week-old miceShort diagonal lines indicate birth of pups Taurine treatment of G2 HO animals (double headed arrow) began 10 days before mating Dashedvertical lines locate PD1 Asterisks (lowast) indicate observation of pup survival at PD1 and samples taken for taurine concentrations in the brainand liver Hash marks () indicate observation of pup survival at PD1 and samples taken for taurine concentrations in the brain and liver aswell as tissue samples taken at PD1 for microarray analysis andor RT2 qPCR of the liver and brain mRNA

Table 2 Plasma taurine concentrations in CSAD KO

Genotype (119873)1 Taurine concentrations2

WT (7) 9901 plusmn 9533

HT (6) 6779 plusmn 1068lowast

G1 HO (9) 1636 plusmn 107lowastlowast


1Number of animals at 8 weaks of age Two or three mice per each litter2120583M

3Data are expressed as mean plusmn SElowast

119875 lt 005 compared to WTlowastlowast

119875 lt 0001 compared to WT

(Table 3) Deathsurvival was measured at postnatal day one(PD1) (Figure 3) Survival rates of G3 and G4 HO littersborn from G2 and G3 HO were 15 and 10 respectivelyThe surviving pups all showed ldquomilk spotsrdquo (white materialin their stomachs visible through the skin) while there wereno milk spots apparent in the pups that died Birth weightsof live HO including G3 HO and G4 HO and WT were notsignificantly different although G3 and G4 HO pups withoutmilk spots were slightly smaller at PD1 (sim01 g) compared tothose with milk spots Surviving pups from G2 HO and G3HO grew normally although they were very few in number

Since the surviving pups had evidence of successfulnursing while the others did not we cross-fostered HO pupswith WT dams and WT pups with HO dams to see whetherthe fault lay in the dams nursing behavior or the pupsrsquosuckling When WT neonates born were nursed by G2 HOdams (that had delivered pups the same day) they suckledmilk and grew normally Neonates without milk spots bornfrom G2 HO did not survive when they were nursed by WTdams

To see the effect of exogenous taurine we also observedthree generations of homozygous CSADminusminus that were treatedwith 005 taurine in their drinking water (HOT) (Figure 3)Bothmales and females of G2 HOTwere treated with taurine(005) in their drinking water from 10 days prior to mating

until weaning of their offspring G3 HOT were born fromG2 HOT and treated with taurine from weaning to theiroffspringrsquos weaning Twelve of thirteen litters and fifteen ofsixteen litters fromG2 andG3HOT respectively treatedwith005 taurine in the drinking water thrived The survivalrates of litters fromG2HOT andG3HOTwere 92 and 94respectively There was no statistically significant differencein reproduction performance between G2 HOT and G3HOT pregnancy rates and the number of pups per litterwere not different from WT Pups from WT HT HO andHOT were weaned 3 to 4 weeks after birth Growth of pupsfrom WT HT and HOT was not significantly different Thehigh survival rates of litters from both taurine-supplementedgroups indicated that proper levels of taurine during gestationare necessary for survival The death of most pups in thenonsupplemented G2 and G3 HO litters within 24 hours ofbirth suggests that the lack of taurine in uteromay have beenthe important factor

33 Taurine Concentrations in the Liver and Brain Since theliver is a major source for the production of taurine requiredfor brain development [2] taurine concentrations in bothliver and brain were measured at PD1 [Figures 3 4(a) and4(b)] Taurine concentrations in the brain and liver weresignificantly reduced by more than 80 in G2 HO G3 HOand G4 HO but not in G1 HO in the brain which wereborn from heterozygote dams with normal levels of taurineHowever those in the liver from G1 HO were decreased by26 Taurine levels in both the liver and brain were increasedin mice whose drinking water was supplemented with 005taurine (G3HOTandG4HOT) Taurine concentrationswerenot significantly different in the brain ofHOTmice comparedto WT Although taurine concentrations in the liver from G3HOT and G4 HOT increased significantly compared to G3HO and G4 HO they were not completely restored to WTlevels Although some G3 HO PD1 pups did not show a milkspot taurine concentrations in the liver and brain were notsignificantly different in these two groups offspring with a


Table 3 Survival rate of litters from mating pairs as well as average number of total and surviving pups per litter

Mating pairs WT HT G1 HO G2 HO G2 HOT1 G3 HO G3 HOT2

Number of mating pairs 9 14 10 13 13 10 16Average number of total pups per litter 51 plusmn 08

4

62 plusmn 09 61 plusmn 07 45 plusmn 04 64 plusmn 06 49 plusmn 06 55 plusmn 05

Surviving litters from mating pairs3 9 14 10 2 12 1 15Average number of surviving pups per litter 49 + 08 62 + 09 56 plusmn 06 09 plusmn 02lowast 54 plusmn 07 04 plusmn 03

lowast

53 plusmn 05

1Mating pairs (G2 HO) were treated with taurine in drinking water (005) 10 days prior to mating2Mating pairs born from G2 HOT and treated with taurine after weaning3Litters are designated as ldquosurviving litterrdquo if one or more pups grew to weaning4Mean plusmn SElowast


milk spot (G3 HO WMS) versus offspring without a milkspot (G3 HOWOMS) in the liver and brain 21 plusmn 01 versus18 plusmn 02 and 60 plusmn 05 versus 55 plusmn 05 respectively

34 Gene Expression in Liver and Brain We used a microar-ray of more than 9000 genes to examine the effect of theCSAD knockout and taurine treatment on gene expressionin PD1 HO mice (Figure 3) As expected CSAD mRNAwas not detected in CSAD KO Three hundred genes inthe liver and 145 genes in the brain were changed bymore than 2-fold in the CSADminusminus at PD1 (Table 4) Genesin the liver were mostly upregulated while the genes inthe brain were mostly downregulated Genes selected frommicroarray data were summarized in Table 5 Of the taurine-related genes CSAD CDO ADO and TauT only CSADwas markedly reduced confirming deletion of this geneAntioxidant enzymes including Gpx1 and 3 and Prdx 2 and3 were examined because neonatal death may be caused byoxidative stress Uracil phopshorylase 2 and serine dehy-dratase two metabolic enzymes demonstrated significantupregulation and were further studied using RT2 qPCRProlactin and lactoferrin were significantly down-regulatedSince these factors are intimately associated with productionand function of milk and because milk spots were a predictorfor survival downregulation of these genes was confirmedusing RT2 qPCR Taurine-related genes including CSADCDO ADO and TauT were examined using RT2 qPCR(Table 6) The mRNA expression levels of TauT in theliver were not affected by taurine treatment while CDOwas significantly increased in G3 HO compared to WTThe gene expression of ADO in G3 HOT was increasedmarginally Expression of two antioxidant enzymes in theliver peroxireductase 2 and 3 (Prdx 2 and Prdx 3) wasnot significantly different in CSADminusminus compared to WT(Table 7) Prdx 2 in the brain from G3 HOT was significantlyincreased However glutathione peroxidase 1 and 3 (Gpx1and Gpx3) were increased significantly in CSADminusminus liverand restored to wild type levels in taurine-treated CSADminusminusanimals

Since newborn G3 CSADminusminus often lacked milk spots apredictor of survival in newborn mice we examined theexpression of lactoferrin (Ltf) and the prolactin receptor(Prlr) and found that their expression was significantly

Table 4 Gene expression in G3 HO with more than 2-folddifference compared to WT

Total genes Upregulation DownregulationLiver from G3 HOlowast 305 265 40Brain from G3 HO 145 49 96lowastMicroarray was performed using two mice from G3 HO and WT at PD1

Table 5 Fold change of genes in the liver of G3 HO compared toWTlowast

Fold change RegulationCSAD 96 DownGpx 1 15 UpGpx 3 33 UpPrdx 2 14 UpPrdx 3 12 UpPrlr 27 DownLtf 24 DownUpp 2 94 UpSds 69 UplowastMicroarray was performed using two mice from G3 HO and WT at PD1

decreased in CSADminusminus animals Prlr expression in the liverwas brought to levels higher than WT by taurine treatmentbut expression of Ltf was not restored (Figure 5) Since theabsence of a milk spot predicts mortality we compared thegene expression of pups with a milk spot to those withouta milk spot (Table 8) G3 HO pups without a milk spot (G3HOwoMS) demonstrated significantly higher expression ofCdo Upp2 and Sds compared to those with a milk spot (G3HO wMS) However Ltf was significantly decreased in G3HOwoMS compared to G3 HOwMS Expression of Sds inG3 HO wMS was significantly increased compared to WT(Table 9) Expression of Cdo Upp2 and Sds in G3 HOT wasrestored to that in WT

4 Discussion

We have generated a new mouse model to study the phys-iological role of taurine by knocking out the CSAD geneDisruption of the CSAD gene in this mouse was documentedby Southern analysis [Figure 1(b)] the absence of CSAD


(a) (b)

Figure 4 Taurine concentrations in the liver and brain The livers (a) and brains (b) at PD1 in each group were homogenized with 5 TCAand centrifuged at 10000 timesg for 20min The supernatants were collected and dried using a Speedvac Dried samples were derivatized usingPITC PITC labeled taurine was determined using HPLC Data are expressed as 120583molesg wet tissue weight mean plusmn SE in (a) the liver and(b) the brain lowast119875 lt 0002 is statistically significant compared to WT 119875 lt 0001 is statistically significant compared to G3 HO and G4 HO

Table 6 Fold change of taurine-related genes in G3 HO and G3HOT compared to WT

Gene Genotype Liver Brain

CsadWT 10 plusmn 003

1

ND2G3 HO lt0002lowastlowast

G3 HOT lt0001lowastlowast

CdoWT 10 plusmn 005 10 plusmn 003

G3 HO 13 plusmn 010lowast

11 plusmn 010

G3 HOT 11 plusmn 009 13 plusmn 030

AdoWT 10 plusmn 003 10 plusmn 009

G3 HO 11 plusmn 006 10 plusmn 010

G3 HOT 13 plusmn 008lowast

11 plusmn 020

TauTWT 10 plusmn 006 10 plusmn 008



1Data represent mean plusmn SE from 4 WT 6 G3 HO and 4 G3 HOT at PD1respectively2ND means not determined due to low expression in the brainlowastSignificantly different compared to WT 119875 lt 005lowastlowastSignificantly different compared to WT 119875 lt 0001

mRNA and protein was shown by Northern and Westernanalyses [Figures 1(d) and 1(e)] and the taurine concentrationin the plasma of CSADminusminus animals was reduced by gt80(Table 2)

The physiological role of taurine has been studied in thecat [2] where it is an essential amino acid and in the ratafter treatmentwith guanidinoethanesulfonate (GES) a com-petitive inhibitor of taurine transport [29 30] More recentlymouse models of taurine deficiency have been engineered tofacilitate this investigation two taurine transporter knockoutmouse models (TauT KO) show reduced levels of taurinein various tissues in heart brain muscle kidney and liver[31ndash33] These TauT KO models demonstrate developmental

Table 7 Fold change of antioxidant genes in G3 HO and G3 HOTcompared to WT


Gpx 1WT 10 plusmn 005

NDG3 HO 15 plusmn 011lowast

G3 HOT 12 plusmn 009

Gpx 3WT 10 plusmn 014 10 plusmn 005


11 plusmn 010


Prdx 2WT 10 plusmn 005 10 plusmn 004


G3 HOT 10 plusmn 005 17 plusmn 089lowast

Prdx 3WT 10 plusmn 010

NDG3 HO 11 plusmn 008


NDmeans not determinedlowastData are expressed as mean plusmn SE and significantly different 119875 lt 005 Fourmice were used inWT andG3HOT and sixmice at PD1were used inG3HO

effects in various organs including the retina liver brainmuscle and heart In addition taurine deficient mice weredeveloped by knocking out the gene for CDOwhich producescysteine sulfinic acid a substrate for CSAD from cysteine[34ndash36] These mice have severe taurine deficiency andincreased catabolism of cysteine to hydrogen sulfide whichleads to pulmonary and pancreatic toxicity

The CSAD knockout mouse that we describe here showsdrastically reduced endogenous taurine biosynthesis andcomplete dependency on exogenous taurine for normalreproductive performance (Table 3) Heterozygous CSADKO mice had reduced levels of plasma taurine but CSADhaploinsufficiency had no detectable effect on reproductionG1 CSADminusminus derived from heterozygous parents had muchreduced plasma levels of taurine (Table 2) but had litters of


Table 8 Fold change of G3 HOwith a milk spot and without a milkspot compared to WT in the liver

G3 HO wo MS G3 HO wMSCsad 0001 plusmn 00

lowastlowast

0003 plusmn 00

Cdo 16 plusmn 004lowast

11 plusmn 014

Ado 11 plusmn 007 13 plusmn 007

TauT 11 plusmn 008 14 plusmn 009

Gpx 1 17 plusmn 016 13 plusmn 012


Prdx 2 22 plusmn 068 11 plusmn 007


Prlr 02 plusmn 003 04 plusmn 014

Ltf 04 plusmn 002lowast

05 plusmn 003

Upp 2 81 plusmn 144lowast

19 plusmn 051

Sds 226 plusmn 664lowast

23 plusmn 042

lowastSignificantly different (119875 lt 005) between G3 HO wo MS and G3 HOwMSlowastlowastData represent mean plusmn SE from 3 mice of each group at PD1

Table 9 Gene expression of Cdo Upp 2 and Sds in the liver

Cdo Upp 2 SdsWT 10 plusmn 005

10 plusmn 002 10 plusmn 022

G3 HO wo MS 16 plusmn 004lowast 81 plusmn 144lowast226 plusmn 664

lowast

G3 HO wMS 11 plusmn 014 19 plusmn 051 23 plusmn 042lowast

G3 HOT 11 plusmn 009 09 plusmn 010 12 plusmn 010

lowastSignificantly different 119875 lt 005 compared to WTSignificantly different 119875 lt 005 compared to G3 HO wMSData represent mean plusmn SE Fourmice were used inWT andG3HOTThreemice were used in G3 HO wo MS and G3 HO wMS

normal size that were indistinguishable from litters of WTor CSAD+minus (Table 3) Offspring from G2 CSADminusminus and G3CSADminusminus however had very low survival rates (Table 3)Thus abnormal reproductive performance appeared fromthe second generation of taurine deficient CSADminusminus whilereproduction of the first generation was not affected Taurinesupplementation in the drinking water (G2 HOT and G3HOT) prior to as well as during gestation and after birthcompletely restored the pup survival rate Reproductionperformancewas not significantly different betweenG2HOTG3 HOT and WT indicating that fetus and neonates werehealthy when they were supplied with necessary taurinethrough the placenta andmilkThese results strongly indicatethat the reduced level of taurine may be responsible for theneonatal mortality However since reduced taurine is not100 lethal and taurine concentrations in G3 HO wMSand G3 HO wo MS are not significantly different thereare apparently additional environmental or stochastic factorsthat influence neonatal mortality The cross-fostering resultsindicate that newborn pups have difficulty with sucklingThissuggests that the reduced taurine levels impact the suckling

lowast

lowast

lowastlowast

WT G3 HO G3 HOTN 4 6 4

15

1

05

0

Fold

chan

ge co

mpa

red

to W

T

PrlrLtf

Figure 5 Fold changes of Prlr and Ltf in G3 HO and G3 HOTcompared to those in WT The liver and brain at PD 1 werehomogenized with Trizol and mRNA was extracted using RNeasykit After cDNA was produced by reverse transcriptase 10 ng ofcDNA was mixed with SYBR master mix and reacted with primersusing PCR system Data are expressed as fold change compared toWT (lowast) is significantly different compared to WT 119875 lt 0001 and is significantly different compared to G3 HO 119875 lt 001

ability and it seems likely that this defect is associated withprenatal development

These results are generally consistent with studies oftaurine deficiency in the cat Studies have shown that thereproductive performance of cats fed taurine deficient diets(0 or 001) was poor and that they frequently had still-born or low birth weight kittens with severe neurologicalabnormalities [2 37 38]The offspring from taurine deficientcats showed abnormal births including stillbirths abnormalbrain and eye development and poor growth In contrastG1 CSADminusminus born from HT and with low taurine levelsgrew normally and their offspring also appeared normal(Table 3) A high rate of neonatal death occurred in most ofthe offspring fromG2CSADminusminus andG3 CSADminusminusThese dataindicate that low plasma taurine levels like G1 HO (Table 2)are not sufficient to induce poor reproductive performanceTaurine concentrations at PD1 in the liver and brain from G1HOwere similar toWT [Figures 4(a) and 4(b)] G1HOwith ataurine rich fetal environment andG2HOwith a taurine poorfetal environment implicate a taurine deficient fetal life for ahigher death rate [Table 3 and Figures 4(a) and 4(b)] In thecat model the offspring which show abnormalities or deathdevelop in a low taurine environment due to intrinsically lowlevels of CDO and CSAD as well as the absence of dietarytaurine

To determine whether oxidants contributed to neonataldeath antioxidant enzymes including Gpx1 and 3 as wellas Prdx 2 and 3 were examined [39ndash44] Since Gpx1 and 3were significantly increased oxidants may be contributingfactors in the neonatal death of HOmice (Table 7)These data


support our hypothesis that taurine supplementation mayrestore oxidant induced damage

We used microarray analysis to examine how the mRNAexpression of more than 9000 genes might have been alteredby the deletion of CSAD It is important to keep in mind thatthese changes could be due to transcriptional differences ordifferences in mRNA processing or mRNA stability whichmay or may not lead to more or less of the protein itselfAnalysis of the brain and liver from WT and G3 HO atPD1 showed that gene expression in the liver was mostlyincreased while gene expression in the brain was mostlydecreased (Table 4) Using RT2 qPCR gene expression ofrelevant genes to fetal death was examined at PD1 in WTG3 HO and G3 HOT (Tables 6 7 8 and 9) As expectedCSAD was absent in the KO RT2 qPCR data in the levels ofADO CDO and CSAD are consistent in the brain and liverwith data previously described [15 17] Taurine in the liverbrain and blood of the CSADminusminus mouse is not completelyabsent presumably because of the alternative pathway fortaurine biosynthesis through ADO (Table 2 and Figure 4)[2 17] The mRNA expression of ADO was not significantlydifferent in both the liver and brain in G3 HO (Table 6)and taurine concentrations were markedly reduced in G2G3 and G4 HO [Figures 4(a) and 4(b)] indicating that thealternative ADO pathway is a relatively minor source fortaurine production TauT was not changed in three groupsincluding WT G3 CSADminusminus and G3 HOT suggesting thatthe increase of taurine in G3 HOT is not mediated by theinduction of TauTmRNAThese data also indicate that TauTdoes not show the increased expression at PD1 that is seenlater in taurine depriveddeficient animals [36]

Because newborn G3 CSADminusminus often lacked milk spotswhich are a predictor of survival in newborn mice weexamined the gene expression of Ltf and Prlr which weremarkedly reduced in microarray analysis (Table 5) Ltf andPrlr in the liver were decreased significantly in G3 HO butonly Prlr was restored by taurine supplementation (G3 HOT)(Figure 5) Ltf has innate immune function to protect new-born offspring from infection and is elevated in colostrum[45ndash47] Prolactin is a lactogenic hormone and regulates theoutput of insulin-like growth factor-1 Genetic ablation of Prlrresults in mice which show multiple defects in reproductionleading to infertility altered maternal behavior and reducedbone development [48ndash50] The decreased expression ofthese two genes may contribute to CSADminusminus neonatal deathMeanwhile CDOwas increased inG3HOwithoutmilk spotsbut not in G3 HO with milk spots These data indicate thatincrease of CDO in G3 HO is attributable to the absence ofmilk (Tables 6 and 8) Since uridine phosphorylase 2 (Upp2)and serine dehydratase (Sds) in G3 HO were dramaticallyincreased in microarray analysis (Table 5) these genes wereexamined using RT2 qPCR Upp2 and Sds were significantlyincreased and Lft was significantly decreased in G3 HOwithout milk spots compared to G3 HO with milk spots(Table 8) Upp 2 catalyzes the cleavage of uridine to uracil andribose which are involved with energy supply and nucleotidesynthesis [51ndash53] The significance of the increase in Upp2 in G3 HO without milk spot is unclear but may be a

consequence of the morbidity of these mice Serine is asubstrate for Sds with production of pyruvate (precursor ofglucose) and NH

3

[54ndash56] The activation of this enzyme isaugmented by starvation [57] The lack of a milk spot andsubsequent death indicate starvation which is responsible forthe large increase in Sds Expression of Sds in G3 HO withmilk spots was remarkably lower than in G3 HO withoutmilk spots However expression of Sds in G3 HO with milkspots is significantly increased compared to WT indicatingthat low taurine in G3 HO may induce gluconeogenesis byan increase in Sds This result suggests that Sds expressionis synergistically up-regulated by the HO genotype and bystarvationabsence of a milk spot WT expression levelsof these genes were restored in G3 HOT suggesting thattaurine corrects abnormalities in nucleotide and amino acidmetabolism due to an increase of Upp2 and Sds (Table 9) Ltfis widely present in fluids such as milk and colostrum with ahigh affinity for iron Lft a component of the innate immunesystem is important in bacteriostasis and required for opti-mal neutrophil functionThe significant decrease of Lft in G3HO wo MS is consistent with the importance of this proteinfor survival Taurine concentrations in the brain liver andplasma from CSADminusminus were significantly lower comparedto WT and CSAD+minus These data indicate that CSAD is aneffective target for lowering taurine to symptomatic levels andthat wild-type taurine levels can be restored in the brain andliver of CSAD KO mice by adding taurine to their drinkingwater Taurine treatment dramatically increased survival ratesof G3 HO and G4 HO mice These data indicate that thisCSAD KOmouse will be a powerful additional model for theanalysis of the physiological role of taurine particularly sincetaurine requirements can be supplied in food or water

Abbreviations

CSAD Cysteine sulfinic acid decarboxylaseCSAD KO Cysteine sulfinic acid decarboxylase

knockout miceCDO Cysteine dioxygenaseCDO KO Cysteine dioxygenase knockout miceADO Cysteamine (2-aminoethanethiol)

dioxygenaseWT Wild type (CSAD++)HT Heterozygotic mice (CSAD+minus)HO Homozygotic mice (CSADminusminus)HOT Homozygotic mice treated with

005 taurineTauT Taurine transporterTauT KO Taurine transporter knockout miceGpx 1 Glutathione peroxidase 1Gpx 3 Glutathione peroxidase 3Prdx 2 Peroxireductase 2Prdx 3 Peroxireductase 3Prlr Prolactin receptorLtf LactoferrinUpp 2 Uridine phosphorylase 2Sds Serine dehydrataseG1 G2 G3 G4 Generations 1 2 3 and 4


G1 HO HO (CSADminusminus) mice born from HT(CSAD+minus) parents

G2 or G3 HO Mice born from G1 HO parents or G2HO

G3 HO wMS The third generation of homozygoteswith a milk spot

G3 HO wo MS The third generation of homozygoteswithout a milk spot

PD1 Postnatal Day 1PITC Phenyl isothiocyanateHPLC High Performance Liquid

ChromatographyGES Guanidinoethanesulfonate

Conflict of Interests

The authors declare that they have no conflict of interestsregarding the publication of this paper

Acknowledgments

This work was supported by the Office of Mental Retardationand Developmental Disabilities Albany NY and Dong APharmaceutical Co LTD Seoul Korea The authors arethankful to Drs John Sturman and William Levis for dis-cussing the research and reviewing this paper

References

[1] G Schuller-Levis and E Park ldquoIs taurine a biomarkerrdquoAdvances in Clinical Chemistry vol 41 pp 1ndash21 2006

[2] J A Sturman ldquoTaurine in developmentrdquo Physiological Reviewsvol 73 no 1 pp 119ndash148 1993

[3] R J Huxtable ldquoPhysiological actions of taurinerdquo PhysiologicalReviews vol 72 no 1 pp 101ndash163 1992

[4] Y Xu P Lu H Imaki and J A Sturman ldquoFeline maternaldeficiency a quantitative morphometric and immunohisto-chemical study of newborn visual cortexrdquo Dendron vol 1 pp129ndash145 1992

[5] P Lu G Schuller-Levis and J A Sturman ldquoDistribution oftaurine-like immunoreactivity in cerebellum of kittens fromtaurine-supplemented and taurine-deficient mothersrdquo Interna-tional Journal of Developmental Neuroscience vol 9 no 6 pp621ndash629 1991

[6] G Schuller-Levis P D Mehta R Rudelli and J SturmanldquoImmunologic consequences of taurine deficiency in catsrdquoJournal of Leukocyte Biology vol 47 no 4 pp 321ndash333 1990

[7] G B Schuller-Levis and J A Sturman ldquolsquoActivation of alveolarleukocytes isolated from cats fed taurine-free dietsrdquo Advancesin Experimental Medicine and Biology vol 315 pp 83ndash90 1992

[8] G Schuller-Levis R E Gordon C Wang S Y Park and EPark ldquoProtection of bleomycin-induced fibrosis and inflamma-tion by taurinerdquo International Immunopharmacology vol 9 no7-8 pp 971ndash977 2009

[9] E Park M R Quinn C E Wright and G Schuller-LevisldquoTaurine chloramine inhibits the synthesis of nitric oxide andthe release of tumor necrosis factor in activated RAW 2647

cellsrdquo Journal of Leukocyte Biology vol 54 no 2 pp 119ndash1241993

[10] E Park G Schuller-Levis and M R Quinn ldquoTaurine chlo-ramine inhibits production of nitric oxide and TNF-120572 inactivated RAW 2647 cells by mechanisms that involve tran-scriptional and translational eventsrdquo Journal of Immunologyvol 154 no 9 pp 4778ndash4784 1995

[11] R Jenness ldquoThe composition of human milkrdquo Seminars inPerinatology vol 3 no 3 pp 225ndash239 1979

[12] H Imaki M Neuringer and J Sturman ldquoLong-term effectson retina of rhesus monkeys fed taurine-free human infantformulardquo Advances in Experimental Medicine and Biology vol403 pp 351ndash360 1996

[13] J de la Rosa and M H Stipanuk ldquoEvidence for a rate-limiting role of cysteinesulfinate decarboxylase activity intaurine biosynthesis in vivordquo Comparative Biochemistry andPhysiology B vol 81 no 3 pp 565ndash571 1985

[14] E Park S Y Park C Wang J Xu G LaFauci and G Schuller-Levis ldquoCloning of murine cysteine sulfinic acid decarboxylaseand its mRNA expression in murine tissuesrdquo Biochimica etBiophysica Acta vol 1574 no 3 pp 403ndash406 2002

[15] M H Stipanuk ldquoRole of the liver in regulation of body cysteineand taurine levels a brief reviewrdquo Neurochemical Research vol29 no 1 pp 105ndash110 2004

[16] D L Bella Y-H Kwon L L Hirschberger andM H StipanukldquoPost-transcriptional regulation of cysteine dioxygenase in ratliverrdquo Advances in Experimental Medicine and Biology vol 483pp 71ndash85 2000

[17] J E Dominy Jr C R Simmons L L Hirschberger J HwangR M Coloso and M H Stipanuk ldquoDiscovery and character-ization of a second mammalian thiol dioxygenase cysteaminedioxygenaserdquo Journal of Biological Chemistry vol 282 no 35pp 25189ndash25198 2007

[18] I Ueki and M H Stipanuk ldquoEnzymes of the taurine biosyn-thetic pathway are expressed in rat mammary glandrdquo Journal ofNutrition vol 137 no 8 pp 1887ndash1894 2007

[19] D L Bella L L Hirschberger Y H Kwon and M HStipanuk ldquoCysteine metabolism in periportal and perivenoushepatocytes perivenous cells have greater capacity for glu-tathione production and taurine synthesis but not for cysteinecatabolismrdquo Amino Acids vol 23 no 4 pp 453ndash458 2002

[20] Y Hosokawa A Matsumoto J Oka H Itakura and K Yam-aguchi ldquoIsolation and characterization of a cDNA for rat livercysteine dioxygenaserdquo Biochemical and Biophysical ResearchCommunications vol 168 no 2 pp 473ndash478 1990

[21] J E Dominy Jr J Hwang S Guo L L Hirschberger SZhang and M H Stipanuk ldquoSynthesis of amino acid cofactorin cysteine dioxygenase is regulated by substrate and representsa novel post-translational regulation of activityrdquo Journal ofBiological Chemistry vol 283 no 18 pp 12188ndash12201 2008

[22] I Ueki andM H Stipanuk ldquo3T3-L1 adipocytes and rat adiposetissue have a high capacity for taurine synthesis by the cysteinedioxygenasecysteinesulfinate decarboxylase and cysteaminedioxygenase pathwaysrdquo Journal of Nutrition vol 139 no 2 pp207ndash214 2009

[23] R J Huxtable ldquoExpanding the circle 1975ndash1999 sulfur bio-chemistry and insights on the biological functions of taurinerdquoAdvances in Experimental Medicine and Biology vol 483 pp 1ndash25 2000


[24] I Reymond A Sergeant and M Tappaz ldquoMolecular cloningand sequence analysis of the cDNA encoding rat liver cysteinesulfinate decarboxylase (CSD)rdquo Biochimica et Biophysica Actavol 1307 no 2 pp 152ndash156 1996

[25] A Kuma M Hatano M Matsui et al ldquoThe role of autophagyduring the early neonatal starvation periodrdquo Nature vol 432no 7020 pp 1032ndash1036 2004

[26] A Battaglia A Bertoluzza F Calbucci et al ldquoHigh-performance liquid chromatographic analysis of physiologicalamino acids in human brain tumors by pre-column derivati-zation with phenylisothiocyanaterdquo Journal of ChromatographyB vol 730 no 1 pp 81ndash93 1999

[27] M Charalambous F M Smith W R Bennett T E CrewF Mackenzie and A Ward ldquoDisruption of the imprintedGrb10 gene leads to disproportionate overgrowth by an Igf2-independent mechanismrdquo Proceedings of the National Academyof Sciences of the United States of America vol 100 no 14 pp8292ndash8297 2003

[28] W L Stanford T Epp T Reid and J Rossant ldquoGene trappingin embryonic stem cellsrdquoMethods in Enzymology vol 420 pp136ndash162 2006

[29] D W Bonhaus H Pasantes-Morales and R J HuxtableldquoActions of guanidinoethane sulfonate on taurine concentra-tion retinal morphology and seizure threshold in the neonatalratrdquo Neurochemistry International vol 7 no 2 pp 263ndash2701985

[30] J De La Rosa and M H Stipanuk ldquoEffect of guanidinoethane-sulfonate administration on taurine levels in rat dams and theirpupsrdquo Nutrition Reports International vol 30 no 5 pp 1121ndash1125 1984

[31] B Heller-Stilb C van Roeyen K Rascher et al ldquoDisruption ofthe taurine transporter gene (taut) leads to retinal degenerationin micerdquoThe FASEB Journal vol 16 no 2 pp 231ndash233 2002

[32] U Warskulat B Heller-Stilb E Oermann et al ldquoPhenotype ofthe taurine transporter knockout mouserdquoMethods in Enzymol-ogy vol 428 pp 439ndash458 2007

[33] T Ito Y Kimura Y Uozumi et al ldquoTaurine depletion caused byknocking out the taurine transporter gene leads to cardiomy-opathy with cardiac atrophyrdquo Journal of Molecular and CellularCardiology vol 44 no 5 pp 927ndash937 2008

[34] I Ueki H B Roman A Valli et al ldquoKnockout of the murinecysteine dioxygenase gene results in severe impairment inability to synthesize taurine and an increased catabolism ofcysteine to hydrogen sulfiderdquo American Journal of Physiologyvol 301 no 4 pp E668ndashE684 2011

[35] I Ueki H B Roman L L Hirschberger C Junior andM H Stipanuk ldquoExtrahepatic tissues compensate for loss ofhepatic taurine synthesis in mice with liver-specific knockoutof cysteine dioxygenaserdquo American Journal of Physiology vol302 pp E1292ndashE1299 2012

[36] H B Roman L L Hirschberger J Krijt A Valli V Kozich andM H Stipanuk ldquoThe cysteine dioxygenase knockout mousealtered cyteinemetabolism in nonhepatic tissues leads to excessH2

SHSminus production and evidence of pancreatic and lungtoxicityrdquo Antioxidants and Redox Signaling vol 19 no 12 pp1321ndash1336 2013

[37] J A Sturman and J M Messing ldquoDietary taurine content andfeline reproduction and outcomerdquo Journal of Nutrition vol 121no 8 pp 1195ndash1203 1991

[38] J A Sturman and J M Messing ldquoHigh dietary taurine effectson feline tissue taurine concentrations and reproductive perfor-mancerdquo Journal of Nutrition vol 122 no 1 pp 82ndash88 1992

[39] M Trujillo G Ferrer-Sueta LThomson L Flohe and R RadildquoKinetics of peroxiredoxins and their role in the decompositionof peroxynitriterdquo Sub-Cellular Biochemistry vol 44 pp 83ndash1132007

[40] R A Poynton andM BHampton ldquoPeroxiredoxins as biomark-ers of oxidative stressrdquo Biochimica et Biophysica Acta vol 1840no 2 pp 906ndash912 2013

[41] S W Schaffer J Azuma andMMozaffari ldquoRole of antioxidantactivity of taurine in diabetesrdquo Canadian Journal of Physiologyand Pharmacology vol 87 no 2 pp 91ndash99 2009

[42] R Brigelius-Flohe andMMaiorino ldquoGlutathione peroxidasesrdquoBiochimica et Biophysica Acta vol 1830 no 5 pp 3289ndash33032013

[43] D Autheman R A Sheldon N Chaudhuri et al ldquoGlutathioneperoxidase overexpression causes aberrant ERK activation inneonatalmouse cortex after hypoxic preconditioningrdquo PediatricResearch vol 72 no 6 pp 568ndash575 2012

[44] E Lubos J Loscalzo andD EHandy ldquoGlutathione peroxidase-1 in health and disease from molecular mechanisms to thera-peutic opportunitiesrdquoAntioxidants and Redox Signaling vol 15no 7 pp 1957ndash1997 2011

[45] D Legrand ldquoLactoferrin a key molecule in immune andinflammatory processesrdquo Biochemistry and Cell Biology vol 90no 3 pp 252ndash268 2012

[46] D Legrand and JMazurier ldquoA critical review of the roles of hostlactoferrin in immunityrdquo BioMetals vol 23 no 3 pp 365ndash3762010

[47] P P Ward and O M Conneely ldquoLactoferrin role in ironhomeostasis and host defense against microbial infectionrdquoBioMetals vol 17 no 3 pp 203ndash208 2004

[48] C L Brooks ldquoMolecular mechanisms of prolactin and itsreceptorrdquo Endocrine Reviews vol 33 no 4 pp 1ndash22 2012

[49] N Binart A Bachelot and J Bouilly ldquoImpact of prolactinreceptor isoforms on reproductionrdquo Trends in Endocrinologyand Metabolism vol 21 no 6 pp 362ndash368 2010

[50] C Bole-Feysot V Goffin M Edery N Binart and P A KellyldquoProlactin (PRL) and its receptor actions signal transductionpathways and phenotypes observed in PRL receptor knockoutmicerdquo Endocrine Reviews vol 19 no 3 pp 225ndash268 1998

[51] T P Roosild S Castronovo A Villoso A Ziemba and GPizzorno ldquoAnovel structuralmechanism for redox regulation ofuridine phosphorylase 2 activityrdquo Journal of Structural Biologyvol 176 no 2 pp 229ndash237 2011

[52] LWanDCao J ZengA Ziemba andG Pizzorno ldquoActivationof STAT1 IRF-1 and NF-120581B is required for the induction of uri-dine phosphorylase by tumor necrosis factor-120572 and interferon-120574rdquo Nucleosides Nucleotides and Nucleic Acids vol 29 no 4ndash6pp 488ndash503 2010

[53] M Johansson ldquoIdentification of a novel human uridine phos-phorylaserdquo Biochemical and Biophysical Research Communica-tions vol 307 no 1 pp 41ndash46 2003

[54] T Masuda H Ogawa T Matsushima et al ldquoLocalizationand hormonal control of serine dehydratase during metabolicacidosis differ markedly from those of phosphoenolpyruvatecarboxykinase in rat kidneyrdquo International Journal of Biochem-istry and Cell Biology vol 35 no 8 pp 1234ndash1247 2003


[55] S Imai R Kanamoto I Yagi M Kotaru T Saeki and K IwamildquoResponse of the induction of rat liver serine dehydrataseto changes in the dietary protein requirementrdquo BioscienceBiotechnology and Biochemistry vol 67 no 2 pp 383ndash387 2003

[56] I Lopez-Flores J Peragon R Valderrama et al ldquoDownreg-ulation in the expression of the serine dehydratase in the ratliver during chronic metabolic acidosisrdquo American Journal ofPhysiology vol 291 no 5 pp R1295ndashR1302 2006

[57] E Ishikawa T Ninagawa and M Suda ldquoHormonal anddietary control of serine dehydratase in rat liverrdquo Journal ofBiochemistry vol 57 no 4 pp 506ndash513 1965

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


ADO level is highest in the brain whereas CSAD and CDOlevels are highest in the liver [15 17 18 22]

Cysteine sulfinic acid decarboxylase (CSAD) is one ofrate-limiting enzymes for taurine biosynthesis [2 13] and thelevel of its activity determines the need for dietary taurineCats have been used for taurine studies because they have lowlevels of CDO and CSAD leading to a dependence on dietarysources of taurine Rodents have high levels of CSAD [1 2 23]and taurine is not essential to their diet Taurine is considereda conditionally essential amino acid in humans and isrequired in their diet at certain times during developmentAnalysis of murine CSAD cDNA shows that the enzyme has98and 90homology to rat andhumanCSAD respectively[14 24] Since the cat model has limitations including a longgestation period a heterogeneous genetic background and arelatively large maintenance expense we developed a CSADknockout mouse (CSAD KO) model to better understandthe physiological roles of taurine This novel murine modelwas developed to provide insight into the role of taurinein reproduction innate and adaptive immunity and braindevelopment We report here that the absence of a functionalCSAD gene in the CSAD KO mouse reduces the level ofthis amino acid by gt80 and has a severe effect on neonatalsurvival that is reversed by adding taurine (005) to thedrinking water

2 Materials and Methods

21 Materials Chemicals used in this study were purchasedfrom Sigma Chemicals (St Louise MO) if not otherwisenoted Oligonucleotide primers for PCR were obtained fromEurofins MWG Operon (Huntsville AL) Primers weredesigned by Primer Designer 4 (Scientific and EducationalSoftware Cary NC) Taq polymerase and deoxynucleotideswere obtained from New England Biolabs (Ipswich MA)Agarose was obtained from Lonza Group LTD (Rock-land ME) Nitrocellulose membranes for Western blot andnylon membranes for Northern blot were purchased fromInvitrogen (Carlsbad CA) and NEN Life Science Products(Boston MA) respectively Membranes for Southern blotwere obtained from Bio-Rad (Hercules CA) Trizol andRNeasy kit for RNA extraction and DNeasy kit for DNAextractionwere obtained from Invitrogen andQiagen (Valen-cia CA) respectively Protease inhibitors were purchasedfrom Roche Applied Science (Indianapolis IN) Restrictionenzymes were purchased from Promega (Madison WI)[32P]-dCTP was supplied by Perkin Elmer (Waltham MA)

22 CSAD KO Mice Chimeric CSAD KO mice were pro-duced by injection of cells from a gene trap ES cell line(XP0392) into C57BL6 (B6) blastocysts at theMouseMutantRegional Resource Centers (MMRRC UC Davis CA) whichwere implanted into a pseudopregnant B6 mouse Ninechimeric mice from MMRRC were mated with B6 (JacksonLaboratories Bar Harbor ME) in the animal colony at thisinstitution (NYS Institute for Basic Research in Developmen-tal Disabilities) Agouti mice produced by this mating wereback-crossed to B6 and offspring were genotyped using PCR

to identify germline transmitted CSAD+minus heterozygotes(CSAD+minus) Heterozygous siblings were mated to produceCSADminusminus homozygous pups (HO) Mice were fed taurine-free chow (LabDiet PMI Nutrition International St LouisMO) Taurine concentrations in commercial food were con-firmed by HPLC All mice were kept under 12 hr daynightwith free access to food and water Some experimentalanimals had exogenous taurine added to their water at005 as indicated in Section 3 For optimum reproductiveperformance one or two females were mated to a singlemale Both females and males used for mating in the taurine-treated groups were supplemented with taurine Animalswere weaned at 3 to 4 weaks of age

All procedures involving live animals were approved bythe Institutional Animal Care and Use Committee of IBR

23 Southern Blot Analysis DNA from the spleen was ana-lyzed by Southern blotting to confirm theCSADKOgenotypeusing a modified method previously described [25] DNAfrom the spleen was prepared with DNeasy kits (QiagenValencia CA) DNA was digested with EcoR V (Promega)fractionated by agarose gel electrophoresis and transferred toa nylonmembrane (Bio-Rad)Themembrane was hybridizedusing CSAD cDNA as a probe to confirm the disruption ofthe CSAD gene CSAD cDNA was prepared as previouslydescribed [14]

24 Genotype Determination Template DNA was isolatedfrom a tail sample at 3 weeks of age with a DNeasy kit(Qiagen) and analyzed with two sets of primers 120573-geo andvector insertion site (VIS) (Table 1) using a PCR kit (PerkinElmer Shelton CT) After an initial of 93∘C for 3min DNAwas denatured at 93∘C for 1min annealed at 63∘C for 1minand extended at 72∘C for one and a half min for 30 cyclesDNA was extended for additional 5min PCR products werecharacterized by agarose gel electrophoresis The sizes ofPCR products using 120573-geo and VIS primers were 682 bpand 1038 bp respectively DNA from HO and CSAD++ wildtype (WT) produced one band from either 120573-geo or VISrespectively and CSAD+minus produced bands from both 120573-geoand VIS

25 Northern Blot Analysis Northern blot analysis was per-formed as previously described [10] Briefly total RNAs fromliquid nitrogen frozen liver were extracted with Trizol andRNeasy kit RNAwas separated by agarose gel electrophoresisand transferred to a nylon membrane (NEN Life ScienceProduct) The membrane was hybridized using [32P]-dCTPlabeled CSAD cDNA as probe

26 Western Blot Analysis Western blot analysis was per-formed according to the method previously described[10] Briefly frozen liver and brain were homogenizedwith PBS buffer containing IGEPAL CA-630 and proteaseinhibitors (Roche Applied Science) Supernatants from tissuehomogenates were separated using SDS-PAGE and trans-ferred to a nitrocellulose membrane The membrane was



Primer Sequence (51015840-31015840)1








3 Results




Wild typeCSAD12kb

pGTIxFGene trap

Vector

1kb8 EV

EV

EV 9

A

SA

B

pA120573-geo

(a)


71kb

59kb

(b)


VIS

120573-geo

(c)


CSAD

120572-Actin

(d)


CSAD

(e)


WT HT

G1 HO

HO G1 HO

G2 HO HOT G2 HOT

G3 HO G3 HOT

G4 HO G4 HOT





WT

HTG1 HO G2 HO

G3 HO

G3 HOTG2 HOT

G4 HOT

WT

HT

lowast

lowastlowast

lowast

lowast

lowast





WT (7) 9901 plusmn 9533

















4



lowast

53 plusmn 05











4 Discussion



(a) (b)





1





11 plusmn 010





11 plusmn 020














11 plusmn 010














lowastlowast

0003 plusmn 00


11 plusmn 014









05 plusmn 003


19 plusmn 051


23 plusmn 042






lowast





lowast

lowast

lowastlowast


15

1

05

0

Fold

chan

ge co

mpa

red

to W

T

PrlrLtf










3


Abbreviations














Acknowledgments


References





































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



Primer Sequence (51015840-31015840)1








3 Results




Wild typeCSAD12kb

pGTIxFGene trap

Vector

1kb8 EV

EV

EV 9

A

SA

B

pA120573-geo

(a)


71kb

59kb

(b)


VIS

120573-geo

(c)


CSAD

120572-Actin

(d)


CSAD

(e)


WT HT

G1 HO

HO G1 HO

G2 HO HOT G2 HOT

G3 HO G3 HOT

G4 HO G4 HOT





WT

HTG1 HO G2 HO

G3 HO

G3 HOTG2 HOT

G4 HOT

WT

HT

lowast

lowastlowast

lowast

lowast

lowast





WT (7) 9901 plusmn 9533

















4



lowast

53 plusmn 05











4 Discussion



(a) (b)





1





11 plusmn 010





11 plusmn 020














11 plusmn 010














lowastlowast

0003 plusmn 00


11 plusmn 014









05 plusmn 003


19 plusmn 051


23 plusmn 042






lowast





lowast

lowast

lowastlowast


15

1

05

0

Fold

chan

ge co

mpa

red

to W

T

PrlrLtf










3


Abbreviations














Acknowledgments


References





































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


Wild typeCSAD12kb

pGTIxFGene trap

Vector

1kb8 EV

EV

EV 9

A

SA

B

pA120573-geo

(a)


71kb

59kb

(b)


VIS

120573-geo

(c)


CSAD

120572-Actin

(d)


CSAD

(e)


WT HT

G1 HO

HO G1 HO

G2 HO HOT G2 HOT

G3 HO G3 HOT

G4 HO G4 HOT





WT

HTG1 HO G2 HO

G3 HO

G3 HOTG2 HOT

G4 HOT

WT

HT

lowast

lowastlowast

lowast

lowast

lowast





WT (7) 9901 plusmn 9533

















4



lowast

53 plusmn 05











4 Discussion



(a) (b)





1





11 plusmn 010





11 plusmn 020














11 plusmn 010














lowastlowast

0003 plusmn 00


11 plusmn 014









05 plusmn 003


19 plusmn 051


23 plusmn 042






lowast





lowast

lowast

lowastlowast


15

1

05

0

Fold

chan

ge co

mpa

red

to W

T

PrlrLtf










3


Abbreviations














Acknowledgments


References





































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


WT

HTG1 HO G2 HO

G3 HO

G3 HOTG2 HOT

G4 HOT

WT

HT

lowast

lowastlowast

lowast

lowast

lowast





WT (7) 9901 plusmn 9533

















4



lowast

53 plusmn 05











4 Discussion



(a) (b)





1





11 plusmn 010





11 plusmn 020














11 plusmn 010














lowastlowast

0003 plusmn 00


11 plusmn 014









05 plusmn 003


19 plusmn 051


23 plusmn 042






lowast





lowast

lowast

lowastlowast


15

1

05

0

Fold

chan

ge co

mpa

red

to W

T

PrlrLtf










3


Abbreviations














Acknowledgments


References





































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology





4



lowast

53 plusmn 05











4 Discussion



(a) (b)





1





11 plusmn 010





11 plusmn 020














11 plusmn 010














lowastlowast

0003 plusmn 00


11 plusmn 014









05 plusmn 003


19 plusmn 051


23 plusmn 042






lowast





lowast

lowast

lowastlowast


15

1

05

0

Fold

chan

ge co

mpa

red

to W

T

PrlrLtf










3


Abbreviations














Acknowledgments


References





































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


(a) (b)





1





11 plusmn 010





11 plusmn 020














11 plusmn 010














lowastlowast

0003 plusmn 00


11 plusmn 014









05 plusmn 003


19 plusmn 051


23 plusmn 042






lowast





lowast

lowast

lowastlowast


15

1

05

0

Fold

chan

ge co

mpa

red

to W

T

PrlrLtf










3


Abbreviations














Acknowledgments


References





































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




lowastlowast

0003 plusmn 00


11 plusmn 014









05 plusmn 003


19 plusmn 051


23 plusmn 042






lowast





lowast

lowast

lowastlowast


15

1

05

0

Fold

chan

ge co

mpa

red

to W

T

PrlrLtf










3


Abbreviations














Acknowledgments


References





































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology






3


Abbreviations














Acknowledgments


References





































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology










Acknowledgments


References





































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology













































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Documents

Research Article Development of a Novel Cysteine Sulfinic Acid Decarboxylase Knockout Mouse: Dietary Taurine …downloads.hindawi.com/journals/jaa/2014/346809.pdf · Target Amp-Nano