RESEARCH COMMUNICATIONS

CURRENT SCIENCE, VOL. 95, NO. 3, 10 AUGUST 2008 397

*For correspondence. (e-mail: skanmbt2000@yahoo.com)

Regulatory mechanism of mouse sex pheromone and intracellular calcium level in V2Rx receptor expressing cells

S. Kannan1,2,*, C. Bharathiraja2 and M. Krishnan2

1Post Graduate and Research Department of Zoology, Ayya Nadar Janaki Ammal College, Sivakasi 626 124, India 2Department of Environmental Biotechnology, Bharathidasan University, Thiruchirappalli 620 024, India

Expression of V2Rx receptor and its binding efficiency with mouse sex pheromone (2-octanamine) was studied. A series of animal cell culture experiments were car-ried out using HEK-293 cell line to assess the interac-tion of sex pheromone binding with V2Rx receptor and regulation of calcium concentration in the cyto-plasm of vomeronasal neurons. V2Rx/pCDNA3(–) plas-mid was transiently transfected into HEK-293 cells and analysed the functional property of vomeronasal sensory neurons. The patch clamping study em-phasized the rise of calcium level in the cell line carrying pCDNA3(–)/V2Rx/HEK-293 cells exposed to 2-octanamine. However, there was no change in intra-cellular calcium level in the cells exposed to the other odorants such as n-octanamide and n-hexane. Fur-ther, this study confirmed that, the calcium current was found to be high in HEK-293 cells carrying V2Rx when compared to HEK-293 cells lacking V2Rx gene exposed to mouse sex pheromone. Thus, the present study concludes that both sex pheromone compound and its receptor protein efficiently regulate the intra-cellular calcium concentrations.

Keywords: Calcium inward-current, HEK-293 cells, mouse, 2-octanamine, sex pheromone, vomeronasal, V2Rx receptor.

PHEROMONES are molecules that consistently elicit a variety of behavioural responses in animals. The significance of this type of chemical communication is emphasized by the existence of pheromone perception system parallel to the main olfactory system, one that detects and integrates the intraspecific signals1,2. In rodents, pheromone detection starts in a sub-septal region of vomero nasal organ (VNO), where two different forms of G protein coupled receptors (GPCRs), namely V1R and V2R (~150 members in each), are effectively expressed in two distinct neuronal layers of the VNO. The V1R is expressed in the apical neurons (luminal side) whereas V2Rs are secreted from the basal neurons3,4. All basal neurons express supple-mentary and divergent V2Rs, namely V2R2 and V2Rx5,6.The literature suggests that the correct expression of V2Rs is required for the intracellular interaction with spe-cific major histocompatibility complex (MHC) class Ib

molecules in both vomeronasal neurons and transfected cell lines7,8. Interestingly, Pin et al.9; showed that all V2Rs belong to the group-III of GPCR family and exhibit structural and sequence homology with metabotropic glu-tamate receptors, calcium sensing receptor10, gamma-amino butyric acid type B receptor11, taste receptors12 and fish olfactory receptors13. Recently, V2Rx gene cloning and its expression was reported in NCBI6 (NCBI Acc. No. 267725) which revealed that V2Rx contains 912 amino acids with seven transmembrane structural identity. Be-sides, N-terminal domain is protruded outside the cell membrane whereas the C-terminal domain is facing the cytosolic region14. Vomeronasal receptors are considered as potential receptor for both volatile and non-volatile pheromone compounds14. It was reported that the oc-tanamine identified from female laboratory mouse sig-nificantly attracted the males when compared to solvents, the extracts of liver, kidney and jasmine odours. This ap-proach led to the unexpected finding of male attracting mouse sex pheromone15. The molecular understanding of the pheromone and receptor interaction is necessary to demonstrate the biological functions of mammalian pheromones. The aim of the present study is to determine the interaction of sex pheromone with that of V2Rx re-ceptor and its role on internal calcium concentration in cell line. Culture media were procured from Invitrogen (Paisely, UK), molecular biology chemicals, odorants and antibiot-ics were purchased from Sigma (St Louis, MO). Human embryonic kidney cells (293 cell line) were propagated in a monolayer at 37 C, 5% CO2 in DMEM medium, sup-plemented with 10% fetal bovine serum and antibiotic. Cells were transiently transfected by following the cal-cium phosphate method. For stable genome integration and Ampicillin regulated heterologous expression of V2Rx receptor, the components of pCDNA-3 (Invitrogen, Paisley, UK) and a modified HEK-293 cell line were stably inte-grated and used. The pCDNA-3/V2Rx construct was transfected into HEK-293 cell line and the expression was checked according to Kannan and Krishnan14. This genetically modified HEK-293 cell line was used to study the intracellular calcium level. The transfected cells were monitored by calcium imaging set-up of patch clamping apparatus with calcium sensor dye Fura-2AM. Vomeronasal sensory neuronal (VSN) cells were procured from R. Ivan, University of Geneva, Switzerland and cul-tured under suitable laboratory conditions (temperature 37 C; CO2 5%) with the help of CO2 incubator (Sanyo) in DMEM medium (Sigma) supplemented with 10% fetal serum and penicillin (0.001 M). The cells grown over-night were dislodged and used for isolation of DNA accord-ing to Sambrook et al.15. Similar experimental conditions were maintained for HEK-293 cells and dislodged just a couple of hours before doing transient transfection and seeded into a sterile flask (75 mm) with fresh DMEM medium. Cell culture flasks containing VSN cells were

RESEARCH COMMUNICATIONS

CURRENT SCIENCE, VOL. 95, NO. 3, 10 AUGUST 2008 398

labelled as control (medium only to check the contamina-tion), negative control (seeded non-transfected HEK-293 cells), positive control (HEK-293 cells transfected with GFP/pCDNA-3(–) plasmid to assess the transfection effi-ciency) and finally experimental flask (HEK293 cells co-transfected with GFP and V2Rx carrying pCDNA-3(–) plasmid). During transfection the appropriate DNA sam-ples (10–15 g/75 mm flask) were mixed with transferrin reagents (BioLabs, UK). After 20 min of incubation at room temperature, the DNA–transferrin mixture was seeded on the surface of the cells adhered on the flask and then placed safely in 35 C with 0.003% CO2 maintained in a CO2 incubator for 12 h (which improve the transformation efficiency). As soon as the incubation period is completed, the medium was changed and kept in CO2 incubator maintained at 37 C and 5% CO2 level. Immediately after 45–50 h of transient transfection, the cells were monitored under inverted fluorescent microscope and transfected cells were sorted out by observing the GFP co-expressed cells. These cells were selected, marked and then dis-lodged from the flask with the help of sterile cell scraper (Sigma) and disposable dropper or pasture pipette. The V2Rx transfected cells were loaded with the Ca2+ indica-tor Fura 2AM 15/mm and imaged at cellular resolution. In mouse, sex pheromone and other odorants have been used to generate action potentials and also to stimulate calcium entry in HEK-293/pCDNA-3(–)/V2Rx/GFP cells. Similar studies were carried out to show that pheromones in insects and odorants in mice effectively regulate the calcium entry16,17. These results support the present work. In the present study, the V2Rx gene and GFP expressing HEK cells were exposed to male attracting sex phero-mone 2-octanamine and other odorants like n-hexane and octanamide to monitor intracellular calcium level. Calcium imaging was performed in 2 105 pCDNA-3/V2Rx/HEK-293 cells which were seeded onto 25 mm culture plate wells coated with poly L-lysine. Cells were incubated for 36 h in DMEM medium supplemented with 1 g/ml Ampicillin to induce expression. For imaging change in the internal free calcium concentration of sin-gle cell, the calcium-sensitive dye Fura-2AM was used. Cells were washed in Ringer solution (140 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1.5 mM MgCl2, 10 mM glucose, 10 mM HEPES, pH 7.2) and loaded with dye and incu-bated for 30 min at 25 C with 4 M/l of acetoxymethyl ester of Fura-2AM in Ringer solution. Cover slips with Fura-2AM loaded cells were placed into a flow chamber on the stage of an Olympus 1 70 inverted microscope equipped with epifluorescence. The chamber was rinsed with Ringer solution at a flow rate of 1 ml/10 s. Test so-lutions (400 l) were applied via syringes connected to the system by three-way valves at the same flow rate. Changes in calcium concentration in single cell upon stimulation with V2Rx receptor and sex pheromone were analysed by monitoring the intensity of fluorescent light emission at 510 nm, using excitation at 340 and 380 nm.

The ratio of fluorescence emission at 340/380 nm excita-tion was used as an index, indicating a rise in intracellular free calcium. For data analysis, Fura-2 AM fluorescence intensity ratios of V2Rx-expressing cells were determined before (Fo) and after stimulation (F). In a single experi-ment, F/Fo value of at least 10 individual cells was de-termined and averaged. The illumination (30 ms for each wavelength) was measured by a 1X-FLA monochromator connected to the microscope. Cells were viewed through a UApo/340/40X objective and images were detected with a MicroMax camera linked patch clamping appara-tus (Roper Scientific, Otto Brunn, Germany). To control the illuminator, the entire equipment set-up was supported with Meta-flour imaging system and software (Visitron Systems, Punchhelm, Germany). The calcium response to 10 mM ATP in Ringer solution was used as an internal control of cell viability. Washes with Ringer solution be-tween stimulations were performed for at least 5 min before applying the next test solution. Dilutions of hydro-phobic pheromone compounds were prepared from the stock solution in n-hexane, using Ringer solution with 0.1% DMSO. All dilutions were made freshly and used within 3–4 h18,19. The present study reveals the chemosensory property of V2Rx receptor. The V2Rx detect the sex pheromone (octanamine) with the heterologous expression of a spe-cific V2Rx receptor gene in HEK-293 cell lines main-tained under laboratory conditions (Figure 1). The present study concentrates on the receptor protein expressed in

Figure 1. Transient transfected cells expressing the pCDNA3(–) plasmid carrying V2Rx and GFP genes in the HEK-293 cell line. The confocal micrographs shown in the top panels reveal that the cells nor-mally do not express GFP and V2Rx genes. The rest of the panels in the bottom show that the co-transfected cells are effectively expressed. HEK-293 cells were co-transfected with the HA-tagged V2Rx gene with or without GFP. The cells were fixed and immunostained for V2Rx with rat monoclonal primary anti-HA antibodies for probing the cal-cium current in response to sex pheromone, 2-octanamine. Representa-tive confocal images are shown (n = 3); scale bar = 10 M.

RESEARCH COMMUNICATIONS

CURRENT SCIENCE, VOL. 95, NO. 3, 10 AUGUST 2008 399

Figure 2. Octanamine dose response profile of V2Rx expressing cells. Fura-2AM fluorescence intensity ratio of V2Rx and control (no V2Rx expression) HEK cells were determined before (Fo) and after stimulation (F) approaching different concentrations of sex pheromone, 2-octanamine.

Figure 3. V2Rx expressing HEK-293 cells respond to octanamine. Calcium imaging on V2Rx expressing cells loaded with Fura-2AM (10 M) Fo/F. 2-octanamine (10–7 M) induced an intracellular calcium increase (10 cells tested, all responded). The other odorants like n-hexane and octanamide did not elicit responses (10 cells tested).

accessory (vomeronasal) olfactory system. The literature reveals two distinct protein families such as V1R and V2R, which are encoded by approximately 300 genes20,21.Accordingly, the present work was designed to show the responsiveness of V2Rx gene transfected cells to sex pheromone, when compared to chemical analogue and solvent. The present results demonstrate that V2Rx performs its function as sex pheromone receptor. A similar situation was observed by Boschat et al.21, who showed that Vlrb2 expresses in vomeronasal sensory neurons and responds to the pheromonal compound, 2-heptanone identified from mouse urine. Furthermore, in Bombyx mori, the in-teraction between bombykol and pheromone-binding pro-tein leads to an increase in binding efficiency22. The present results provide a rational ‘road maps’ for under-standing the role of calcium ions in pheromone and recep-tor interactions. The results are in agreement with those of Offmanns and Simon23 and Krautwurst et al.22, which emphasize that the pheromone and its receptor interaction

lead to an increase of intracellular Ca2+ concentration. Nevertheless, the present data demonstrate a specific in-teraction of the pheromone receptor V2Rx with phero-mone compound of mouse in vitro. Further, the functional characterization of the V2Rx receptor, heterogeneously expressed in modified HEK-293 cells, has shown its highly sensitive and selectiveness to 2-octanamine but not to octanamide and n-hexane. A similar result has been re-ported after injecting a combination of RNAs into frog oocyte for BmOR-3 and BmOR-3 receptor. The oocyte was responsive to bombykol but weakly24–26. In the same study, it was shown that oocytes expressing BmR-1 led to a strong response but only a weak response to bombykol. Interestingly, Kannan et al.27 raised antibody against mouse V2Rx receptor in rabbit. They proposed a concept to regulate fertility status in mammals by allowing the re-productively active mice to inhale antipheromone-binding proteins. This antibody effectively prevents the binding of sex pheromone in the receptor site. Thus the present results identified the potential receptor for mouse sex pheromone and this work lays the basis for the molecular therapy development for fertility regulation in mammals.

1. Halpern, M. and Martinez-Marcos, A., Structure and function of the vomeronasal system: An update. Prog. Neurobiol., 2003, 70,245–318.

2. Silvotti, L., Giannini, G. and Tirindelli, R., The vomeronasal re-ceptor V2R2 does not require escort molecules for expression in heterologous systems. Chem. Senses, 2005, 30, 1–8.

3. Dulac, C. and Axel, R., A novel family of genes encoding putative pheromone receptors in mammals. Cell, 1995, 83, 195–206.

4. Ryba, N. J. and Tirindelli, R., A new multigene family of putative pheromone receptors. Neuron, 1997, 19, 371–379.

5. Martini, S., Silvotti, L., Shirazi, A., Ryba, N. J. and Tirindelli, R., Co-expression of putative pheromone receptors in the sensory neu-rons of the vomeronasal organ. J. Neurosci., 2001, 21, 843–848.

6. Kannan, S. and Krishnan, M., Molecular cloning and characteriza-tion of mouse V2Rx pheromone receptor NCBI website. NCBI website, Acc. No. AB267725, 2006.

7. Ishii, T., Hirota, J. and Mombaerts, P., Combinatorial coexpres-sion of neural and immune multigene families in mouse vomero-nasal sensory neurons. Curr. Biol., 2003, 13, 394–400.

8. Loconto, J. et al., Functional expression of murine V2R phero-mone receptors involves selective association with the M10 and M1 families of MHC class Ib molecules. Cell, 2003, 112, 607–618.

9. Pin, J. P., Galvez, T. and Prezeau, L., Evolution, structure, and ac-tivation mechanism of family 3/C G-protein-coupled receptors. Pharmacol. Ther., 2003, 98, 325–354.

10. Brown, E. M. et al., Cloning and characterization of an extracellu-lar Ca(2+)-sensing receptor from bovine parathyroid. Nature,1993, 366, 575–580.

11. Kaupmann, K. et al., Expression cloning of GABA(B) receptors uncovers similarity to metabotropic glutamate receptors. Nature,1997, 386, 239–246.

12. Hoon, M. A., Adler, E., Lindemeier, J., Battey, J. F., Ryba, N. J. and Zuker, C. S., Putative mammalian taste receptors: A class of taste-specific GPCRs with distinct topographic selectivity. Cell,1999, 96, 541–551.

13. Speca, D. J., Lin, D. M., Sorensen, P. W., Isacoff, E. Y., Ngai, J. and Dittman, A. H., Functional identification of a goldfish odorant receptor. Neuron, 1999, 23, 487–498.

RESEARCH COMMUNICATIONS

CURRENT SCIENCE, VOL. 95, NO. 3, 10 AUGUST 2008 400

14. Kannan, S. and Krishnan, M., Purification and sequence determi-nation of pheromone binding protein of mouse VNO. Biochemis-try, 2007 (under revision).

15. Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual (Volumes 1 to 3), CSH, NY, 2000.

16. Zufall, F., Leinders-Zufall, T. and Greer, C. A., Amplification of odour-induced Ca(2+) transients by store-operated Ca(2+) release and its role in olfactory signal transduction. J. Neurophysiol., 2000, 83, 501–512.

17. Wilde, E. G., Savtos, A. and Krieger, J., A pheromone binding protein mediates the bombykol induced activation of a pheromone receptor in vitro. Chem. Senses, 2006, 31, 547–555.

18. Novotny, M. V., Pheromones, binding proteins and receptor re-sponses in rodents. Biochem. Soc. Trans., 2003, 31, 117–122.

19. Keverne, E. B., Odor here, odor there: Chemosensation and repro-ductive function. Nature Neurosci., 2005, 8, 1637–1638.

20. Buck, L. and Axel, R., Novel multi-gene family may encode odor-ant receptors: A molecular basis for odor recognition. Cell, 1999, 65, 175–187.

21. Boschat, C. et al., Pheromone detection mediated by a V1r vo-meronasal receptor. Nat. Neurosci., 2002, 5, 1261–1262.

22. Krautwurst, D., Yau, K. W. and Reed, R. R., Identification of ligands for olfactory receptor by functional expression of a recep-tor library. Cell, 1998, 95, 917–926.

23. Offmanns, S. and Simon, M. I., G 15 and G 16 couple a wide va-riety of receptors to phospholipase C. J. Biol. Chem., 1995, 270,15175–15180.

24. Rodriguez, I., Greer, C. A., Mok, M. Y. and Mombaerts, P., A pu-tative pheromone receptor gene expressed in human olfactory mu-cosa. Nat. Genet., 2000, 26, 18–19.

25. Nakagawa, T., Sakurai, T., Nishioka, T. and Touhara, K., Insect sex-pheromone signals mediated by specific combinations of ol-factory receptors. Science, 2005, 307, 1638–1642.

26. Benton, R., Sachse, S., Michnic, S. W. and Vosshall, L. B., Apical membrane topology and heteromeric function of Drosophilaodourant receptors in vivo. PLoS Biol., 2006, 4, 20–31.

27. Kannan, S., Krishnan, M., Tarvinder K. Taneja and Vinod Kumar,S., Raising antibody against mouse sex pheromone binding protein in rabbit. J. Biosci. (Malaysia), 2007, 2, 6–13.

ACKNOWLEDGEMENTS. S.K. acknowledges the DBT, New Delhi, The University of Birmingham and The Institute of Membrane and Sys-tems Biology, University of Leeds, UK for providing research training. We thank Management and Principal, Ayya Nadar Janaki Ammal Col-lege, Sivakasi for encouragement.

Received 7 August 2007; revised accepted 9 July 2008

Bombyx mori vitellogenin receptor-like mRNA, partial sequence GenBank: GU078432.1 FASTA Graphics Go to: LOCUS GU078432 440 bp mRNA linear INV 27-OCT-2009 DEFINITION Bombyx mori vitellogenin receptor-like mRNA, partial sequence. ACCESSION GU078432 VERSION GU078432.1 GI:261873418 KEYWORDS . SOURCE Bombyx mori (domestic silkworm) ORGANISM Bombyx mori Eukaryota; Metazoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Lepidoptera; Glossata; Ditrysia; Bombycoidea; Bombycidae; Bombycinae; Bombyx. REFERENCE 1 (bases 1 to 440) AUTHORS Bharathiraja,C., Krishnan,M. and Sivasudha,T. TITLE Molecular characterization of vitellogenin receptor in silk worm Bombyx mori JOURNAL Unpublished REFERENCE 2 (bases 1 to 440) AUTHORS Bharathiraja,C., Krishnan,M. and Sivasudha,T. TITLE Direct Submission JOURNAL Submitted (09-SEP-2009) The Department of Environmental Biotechnology, Bharathidasan University, Palkaliperur, Tiruchirappalli, Tamil Nadu 620 024, India FEATURES Location/Qualifiers source 1..440 /organism="Bombyx mori" /mol_type="mRNA" /db_xref="taxon:7091" /tissue_type="ovary" misc_feature <1..>440 /note="similar to vitellogenin receptor" ORIGIN 1 gacaatatct cgcggagcac gccgggtgct agctgcgtga gggtctgtga cgtcaccagg 61 aggagatgcg ccaggctgca gaagataccc tctgacgcaa cggtcaaggc attgatagtg 121 gagccggcgt cacggcgcat gttctactgc gtccagcgcg gccacgagtc cgtggtctgg 181 tccgcctcgc tctccggccg gagcgccctg gacctcctcc acgtgaccca gtgctcggga 241 ttagctgccg attcgttcac gaggaggctg tacgtggcag agactgcgcc cccccacatc 301 atggtggtcg acttcgatgg aaagaatccg aaccaccatg atgtgggggg gcgcagtctc 361 tgcagtacag ccttctcgtg aagaatccgc gtaatccgaa cactgggtca cggggaagaa 421 ggtcccgggc tctcctgcca

Bombyx mori vitellogenin receptor 10 III-like (VgR 10) mRNA, partial sequence GenBank: HQ419188.1 FASTA Graphics Go to: LOCUS HQ419188 441 bp mRNA linear INV 23-MAR-2011 DEFINITION Bombyx mori vitellogenin receptor 10 III-like (VgR 10) mRNA, partial sequence. ACCESSION HQ419188 VERSION HQ419188.1 GI:326417271 KEYWORDS . SOURCE Bombyx mori (domestic silkworm) ORGANISM Bombyx mori Eukaryota; Metazoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Lepidoptera; Glossata; Ditrysia; Bombycoidea; Bombycidae; Bombycinae; Bombyx. REFERENCE 1 (bases 1 to 441) AUTHORS Bharathiraja,C., Krishnan,M., Sivasudha,T., Deeparani,A., Pandiarajan,J. and Arun Prasanna,V. TITLE Silkworm vitellogenin receptor JOURNAL Unpublished REFERENCE 2 (bases 1 to 441) AUTHORS Bharathiraja,C., Krishnan,M., Sivasudha,T., Deeparani,A., Pandiarajan,J. and Arun Prasanna,V. TITLE Direct Submission JOURNAL Submitted (30-JUL-2010) Department of Environmental Biotechnology, Bharathidasan University, Palakalaiperur, Tiruchirappalli, Tamil Nadu 620024, India FEATURES Location/Qualifiers source 1..441 /organism="Bombyx mori" /mol_type="mRNA" /db_xref="taxon:7091" /tissue_type="ovarioles" /PCR_primers="fwd_seq: gtggcagtggactgggtgac, rev_seq: gctctagacaatcaatacaatattg" gene <1..>441 /gene="VgR 10" /note="BmVgR 10" misc_feature <1..>441 /gene="VgR 10" /note="similar to vitellogenin receptor 10 III" ORIGIN 1 agggtaactt tcgccggaag cacgccgggt gctagctgcg tgagggtctg tgacgtcacc 61 aggaggagat gcgccaggct gcagaagata ccgtcggacg caacggttaa ggcattgata 121 gtggagcccg cgtcccggcg catgttctac tgcgtccagc gcggccacga gtccgtgatc 181 tggtccgcct cgctttccgg ccggagcgcc ctggacctcc tccacgtgac ccagtgctcg 241 ggattagctg ccgattcgtt cacgaggagg ctgtacgtgg cagagactgc gcccccccac 301 atcatggtgg tcgatttcga tggcaagaat cccaagaata tcctgacgga acgtccgcag 361 ctgcaatcgc cccacgggtt ggcgctcttt gaagacctta tctctaagtt ttaagacgac 421 aggtaccgac attggttgac c

Bombyx mori vitellogenin receptor 10 II-like (VgR 10) mRNA, partial sequence GenBank: HQ419187.1 FASTA Graphics Go to: LOCUS HQ419187 443 bp mRNA linear INV 23-MAR-2011 DEFINITION Bombyx mori vitellogenin receptor 10 II-like (VgR 10) mRNA, partial sequence. ACCESSION HQ419187 VERSION HQ419187.1 GI:326417270 KEYWORDS . SOURCE Bombyx mori (domestic silkworm) ORGANISM Bombyx mori Eukaryota; Metazoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Lepidoptera; Glossata; Ditrysia; Bombycoidea; Bombycidae; Bombycinae; Bombyx. REFERENCE 1 (bases 1 to 443) AUTHORS Bharathiraja,C., Krishnan,M., Sivasudha,T., Deeparani,A., Pandiarajan,J. and Arun Prasanna,V. TITLE Molecular characterization of vitellogenin receptor (yolk protein receptor) from the domesticated silkworm Bombyx mori JOURNAL Unpublished REFERENCE 2 (bases 1 to 443) AUTHORS Bharathiraja,C., Krishnan,M., Sivasudha,T., Deeparani,A., Pandiarajan,J. and Arun Prasanna,V. TITLE Direct Submission JOURNAL Submitted (30-JUL-2010) Department of Environmental Biotechnology, Bharathidasan University, Palakalaiperur, Tiruchirappalli, Tamil Nadu 620024, India FEATURES Location/Qualifiers source 1..443 /organism="Bombyx mori" /mol_type="mRNA" /db_xref="taxon:7091" /tissue_type="ovarioles" /PCR_primers="fwd_seq: gtggcagtggactgggtgac, rev_seq: gttaattgagaaatttatttttgcg" gene <1..>443 /gene="VgR 10" /note="BmVgR 10" misc_feature <1..>443 /gene="VgR 10" /note="similar to vitellogenin receptor 10 II" ORIGIN 1 gagggaacat ttcgcggaag cacgccgggg tgctagctgc gtgagggtct gtgacgtcac 61 caggaggaga tgcgccaggc tgcagaagat accgtcggac gcaacggtta aggcattgat 121 agtggagccc gcgtcccggc gcatgttcta ctgcgtccag cgcggccacg agtccgtggt 181 ctggtccgcc tcgctttccg gccggagcgc cctggacctc ctccacgtga cccagtgctc 241 gggattagct gccgattcgt tcacgaggag gctgtacgtg gcagagactg cgccccccca 301 catcatggtg gtcgatttcg atggcaagaa tcccaagaag atcctaacgg aacgtccaca 361 gctgcaagcg ccccacgcct tggcgctctt tgaagaccac atatattatt tggtgggcga 421 ctcataccgg cctcgggcgc tgt