RESEARCH Open Access

Effects of propranolol in combination withradiation on apoptosis and survival of gastriccancer cells in vitroXinhua Liao, Xiangming Che*, Wei Zhao, Danjie Zhang, Houlong Long, Prakash Chaudhary, Haijun Li

Abstract

Background: The National Comprehensive Cancer Network (NCCN) guidelines recommend radiotherapy as astandard treatment for patients with a high risk of recurrence in gastric cancer. Because gastric cancerdemonstrates limited sensitivity to radiotherapy, a radiosensitizer might therefore be useful to enhance theradiosensitivity of patients with advanced gastric carcinoma. In this study, we evaluated if propranolol, a b-adrenoceptor (b-AR) antagonist, could enhance radiosensitivity and explored its precise molecular mechanism ingastric cancer cells.

Methods: Human gastric adenocarcinoma cell lines (SGC-7901 and BGC-823) were treated with or withoutpropranolol and exposed to radiation. Cell viability and clonogenic survival assays were performed, and cellapoptosis was evaluated with flow cytometry. In addition, the expression of nuclear factor �B (NF-�B), vascularendothelial growth factor (VEGF), cyclooxygenase 2 (COX-2), and epidermal growth factor receptor (EGFR) weredetected by western blot and real-time reverse transcription polymerase chain reaction (PCR).

Results: Propranolol combined with radiation decreased cell viability and clonogenic survivability. Furthermore, italso induced apoptosis in both cell lines tested, as determined by Annexin V staining. In addition, treatment withpropranolol decreased the level of NF-�B and, subsequently, down-regulated VEGF, COX-2, and EGFR expression.

Conclusions: Taken together, these results suggested that propranolol enhanced the sensitivity of gastric cancercells to radiation through the inhibition of b-ARs and the downstream NF-�B-VEGF/EGFR/COX-2 pathway.

BackgroundGastric cancer is estimated to account for about 10% ofinvasive cancers worldwide and is the second leadingcause of cancer deaths. Although the incidence of gastriccancer has been decreasing, it remains a common malig-nancy worldwide, especially in Asia [1]. Patients with gas-tric cancer frequently experience recurrent tumors, evenafter a curative surgical resection, because gastric canceris frequently diagnosed at an advanced stage. Surgicaltreatment alone is not useful for patients with local anddistal recurrences. Therefore, another therapeutic modal-ity might be useful to prevent the recurrence of advancedgastric carcinoma. The National Comprehensive CancerNetwork (NCCN) guidelines on gastric cancer treatment

recommend radiotherapy as a standard treatment forpatients with a high risk of recurrence, which is also sup-ported by the clinical trial INT0116 [2]. Because gastriccancer has limited sensitivity to radiotherapy, a radiosen-sitizer is needed to overcome this problem.It has been reported that antagonists of cyclooxygenase

2 (COX-2), epidermal growth factor receptor (EGFR),and vascular endothelial growth factor (VEGF) can act asradiosensitizers to enhance therapeutic sensitivity inmany tumors [3-6]. Although associated with cell prolif-eration, invasion, angiogenesis and metastasis, nuclearfactor �B (NF-�B) has been closely linked with radiore-sistance in multiple tumors [7,8]. Numerous studies sug-gest that prosurvival signaling mediated by NF-�B islinked to radiation resistance and poorer clinical out-comes among many cancers. Helen et al. reported thatactivation of b-adrenoceptors (b-ARs) and the subse-quent stimulation of COX-2 and VEGF expression was

* Correspondence: Chexiang@mail.xjtu.edu.cnDepartment of General Surgery, First Affiliated Hospital of Medical College ofXi’an Jiao-Tong University, Yanta West Road 277, Xi’an 710061, PR China

Liao et al. Radiation Oncology 2010, 5:98http://www.ro-journal.com/content/5/1/98

© 2010 Liao et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.

perhaps an important mechanism in the tumorigenicaction of nicotine in colon tumor growth [9]. It is not yetknown whether propranolol (a b-AR antagonist) can beused as a radiosensitizer. The goal of this study was toinvestigate radiosensitizing activities of propranolol inhuman gastric cancer cell lines and to determine itsprecise signaling pathway.

MethodsCell culture and drug treatmentTwo human gastric adenocarcinoma (HGC) cell lines,BGC-823 and SGC-7901, were established in the Peo-ple’s Hospital of Peking University and China andNo.6 Hospital of Shanghai, China, respectively. Thesetwo human gastric cancer cell lines were obtainedfrom the Medical Center Laboratory of Xi’an JiaotongUniversity (Xi’an, China). Both cell lines were culturedin complete Dulbecco’s modified eagle medium (Gibco,Grand Island, NY) containing 10% (v/v) heat-inacti-vated fetal bovine serum (Gibco, Grand Island, NY),penicillin (100 U/mL) and streptomycin (100 mg/mL),and they were maintained in a 37°C humidified incuba-tor supplying 5% CO2. When cells reached the loga-rithmic phase, they were treated with isoproterenol(25 μmol/L) or propranolol (50 μmol/L). The concen-trations of drugs were chosen from our previousresearch. The b-AR antagonist propranolol and theb-AR stimulator isoproterenol were purchased fromSigma Chemical. After 24 h of drug exposure,untreated and drug-treated cultures were irradiated atdifferent doses (0, 2, 4, 6, 8 and 10 Gy). X-irradiationwas performed with an X-ray generator (Elekta PreciseLinear Accelerator, UK) at 4 Mev with a source-skindistance of 100 cm and at a dose rate of 200 cGy/min.

Cell survival analysisColony formation assays were used to quantify the cyto-toxicity of gastric cancer cells induced by treatments.The cells were plated in six-well plates (Costar, USA) atlow densities. After overnight culture, the cells weretreated as described above. The treated cells were cul-tured until colonies formed. The colonies were washedwith PBS and stained with a crystal violet dye. The sur-viving fraction of each irradiation dose was calculated asthe total number of colonies/(total cells inoculated×plat-ing efficiency). A dose-survival curve was obtained foreach experiment and used for calculating several survi-val parameters. Parallel samples were set at each radia-tion dosage.

Cell apoptosis analysisTo detect phosphatidylserine externalization (on thesurface of cell membrane), an indicator of early apopto-sis, flow cytometry (FCM, BD Biosciences, USA) was

performed with PI and fluorescein isothiocyanate(FITC)-labeled Annexin V (Joincare Biosciences, Zhuhai,China) [10]. After treatment, the remaining intact cellswere incubated at 37°C for 24 hr, and then the cellswere washed with cold PBS at 4°C. After centrifugationat 1500 rpm for 5 min, 500 μL of 1×binding buffer,5 μL of FITC-labeled Annexin V and 10 μL of PI wereadded to the cell suspension and gently mixed. Afterincubation at 25°C for 10 min in the dark, the cells wereanalyzed by FCM.

Real-time reverse transcription polymerase chain reaction(real-time RT-PCR)Total RNA was extracted from cultured cells by Tri-Reagent (Sigma, MO, USA). To eliminate DNA contam-ination, extracted RNA was treated with a genomicDNA elimination mixture. Subsequently, the purifiedRNA was reverse transcribed to cDNA. Expression ofb1- and b2-AR mRNA was quantified by RT-PCR(Applied Biosystems, Inc., Foster City, CA). The expres-sion of COX-2, VEGF and EGFR was quantified using areal-time RT-PCR kit from Takara (Takara Biochem-icals, Japan). Briefly, following a pre-heating step at 95°Cfor 10 min, the reaction was carried out using an Icycler(Bio-Rad, Hercules, CA) at a melting temperature of95°C for 15 sec and an annealing temperature for 1 minfor 40 cycles. The primer sequences and annealing tem-peratures for the six genes studied are given in Table 1.Primers were designed according to Genbank, NCBI.For validation, each experiment was done in triplicate.

Western blot assayThe primary antibodies recognizing the b1-adrenergicreceptor and b2-adrenergic receptor were purchasedfrom Abcam (Cambridge, Mass). Antibodies recognizingCOX-2, VEGF, NF-�B (p65), and EGFR were purchasedfrom Santa Cruz Biotechnology (Santa Cruz, CA). Thenitrocellulose membrane was purchased from Millipore(Bedford, Mass). The BCA assay kit and the chemilumi-nescence kit were purchased from Pierce (Rockford, Ill).Equal amounts of protein (20 mg) of each sample, quan-tified by the Bradford method, were electrophoresed on10% SDS-PAGE and electrotransferred onto nitrocellu-lose membranes (400 mA for 2 hr) using a Bio-Rad MiniPROTEAN 3 System (Hercules, CA) according to thestandard protocol. Wet transfer was used for EGFR pro-tein, and semi-dry transfer was used for other proteins.The nitrocellulose membranes were then blocked withTBS containing 10% milk powder and 0.1% Tween-20 at37°C for 4 hr. Subsequently, the membranes were incu-bated with a 1:200 dilution of the primary antibodies forb1-AR, b2-AR, COX-2, VEGF, EGFR and NF-�B (p65),and a 1:500 dilution of anti-b-actin at 4°C overnight. Anantibody against rabbit or mouse IgG was used as the

Liao et al. Radiation Oncology 2010, 5:98http://www.ro-journal.com/content/5/1/98

Page 2 of 8

secondary antibody corresponding to the appropriate pri-mary antibody. Immunopositive bands were examined byan enhanced chemiluminescence (ECL) detection system(Amersham Bioscience, Piscataway, NJ, USA), and theimages were transferred onto an X-ray film according tothe manufacturer’s instructions.

Statistical analysisThe results were expressed as the mean ± S.D. Statisti-cal differences were estimated by one-way analysis ofvariance (ANOVA) followed by Dunnett’s test. Thosep values that were less than 0.05 were considered statis-tically significant. Analysis of the data and plotting ofthe figures were performed with the aid of software(Origin Version 7.5 and SPSS Version 13.0).

ResultsExpression of b1- and b2-adrenergic receptors in SGC-7901 and BGC-823 cellsBecause propranolol is a b-adrenergic receptor antago-nist, the expression of b1- and b2-ARs was determinedat both the mRNA and protein level in SGC-7901 andBGC-823 cells by RT-PCR and western blot. Our resultsshowed that b1- and b2-adrenergic receptors could bedetected at both the mRNA and protein level in bothcell lines. Figure 1 shows that expression of b1- and b2-adrenergic receptors in SGC-7901 cells was higher thanthat in BGC-823 cells.

Dose-survival curves of gastric cancer cells after differentdoses of irradiation with or without propranolol pre-treatmentTo analyze the survival capability of gastric cancer cellsagainst propranolol induced cell death, the cell linesSGC-7901 and BGC-823 were treated with propranolol(50 μmol/L) 24 hr prior to irradiation, and the survivingfraction of cells was determined in a clonogenic survivalassay. The survival curve of control and propranolol-treated SGC-7901 and BGC-823 cells after irradiation is

shown in Figure 2. A significant difference in the colonyforming rate was found in combination with irradiationand propranolol at 50 μmol/L in SGC-7901 and BGC-823 cells (p < 0.01) compared with irradiation alone.Pre-treatment of SGC-7901 and BGC-823 cells with50 μmol/L propranolol prior to irradiation resulted in asignificant decrease in the surviving fraction of cells andan increase in radiation sensitivity at low irradiationdoses. The decreased survival rate in propranolol-treatedcells indicated that treatment with propranolol signifi-cantly improved the biological effect of irradiation.

Propranolol enhances X-ray-induced gastric cancer celldeath by promoting apoptosisTo determine whether the radiosensitizing effect of pro-pranolol is mediated by apoptosis, the effect of propranololon the induction of apoptosis was examined using flowcytometric (FCM) analysis with Annexin V-PI staining.After propranolol pre-treatment (50 μM for 24 hr) andfollowing irradiation, FCM demonstrated an increase inAnnexin-V positive apoptotic BGC-823 and SGC-7901cells compared with irradiation alone. Figure 3 shows thatwhen cells were subjected to 800 cGy irradiation in addi-tion to propranolol, compared with irradiation alone, theapoptosis rates were 39.73 ± 2.23% vs. 25.20 ± 0.99%, p <0.01 (SGC-7901) and 38.69 ± 1.87% vs. 31.10 ± 1.83%, p <0.01 (BGC-823). These data suggest that propranolol cansignificantly increase cell death in both cell lines.

The effects of propranolol on radiation-induced geneexpression in gastric cancer cellsAs measured by real-time RT-PCR and western blot assay,we found that irradiation (last three groups) of BGC-823and SGC-7901 cells down regulated the levels of NF-�B(p65) at the protein level with a subsequent decrease inCOX-2, VEGF and EGFR mRNA levels (Figure 4) andproteins (Figure 5) compared with controls. After pre-treatment with propranolol, the expression of NF-�B,COX-2, VEGF, and EGFR was decreased and significantly

Table 1 The primer sequences and annealing temperatures for the seven genes studied

Gene Annealing temperature(°C) Primer sequence Amplicon (bp) Accession No.

b-actin 60 ForwardReverse

ATCGTGCGTGACATTAAGGAGAAGAGGAAGGAAGGCTGGAAGAGTG

179 NM_001101

b1-AR 60 ForwardReverse

GGGAGAAGCATTAGGAGGGCAAGGAAAGCAAGGTGGG

270 NM_000684

b2-AR 60 ForwardReverse

CAGCAAAGGGACGAGGTGAAGTAATGGCAAAGTAGCG

334 NM_000024

COX-2 57 ForwardReverse

TTGACCAGAGCAGGCAGATGCCAGAAGGGCAGGATACAGC

171 NM_000963.2

VEGF-A 57 ForwardReverse

CTGGGCTGTTCTCGCTTCGCTCTCCTCTTCCTTCTCTTCTTCC

140 NM_001025370.1

EGFR 53 ForwardReverse

AGG ACA GCA TAG ACG ACA CAGG ATT CTG CAC AGA GCC A

90 NM_005228.3

Liao et al. Radiation Oncology 2010, 5:98http://www.ro-journal.com/content/5/1/98

Page 3 of 8

lower than the irradiation-only group. In addition, the pre-treatment of isoproterenol had the opposite effect andreduced the downregulation of gene expression caused byirradiation. These results clearly suggested that treatmentwith propranolol significantly improved the biologicaleffect of irradiation and down regulated expression of the

COX-2, VEGF and EGFR genes in gastric cancer cells,which was mainly due to the decrease in expression ofNF-�B via inhibited b-ARs.

DiscussionGastric cancer is one of the major causes of cancer mor-talities in the world, and radiotherapy is an importanttreatment for gastric cancer patients with a high risk ofrecurrence. As we know, radiosensitizers have played akey role in radiotherapy. In recent years, many research-ers have focused on antagonists of VEGF, COX-2 andEGFR expression as radiosensitizers [3-6], all of whichhave the ability to enhance the sensitivity to radiation.Helen et al. reported that b-ARs and the downstreamCOX-2 and VEGF genes played an important role incolon tumor growth [9]. This suggests that propranolol(b-AR antagonist) may act as a radiosensitizer of gastriccancer. To our knowledge, this study was the first todetermine the propranolol radiosensitizing activities inhuman gastric cancer cell lines and to investigate itsprecise signaling pathway.Based on results from the colony-forming assays, pro-

pranolol and irradiation cooperated to yield fewer andsmaller colonies, suggesting that there was radiosensiti-zation in the SGC-7901 and BGC-823 cell lines. In addi-tion, propranolol showed a synergism of growthinhibition in combination with irradiation in SGC-7901and BGC-823 cells. On the contrary, isoproterenoldemonstrates anti-irradiation effects, which led to higher

Figure 1 Expression of b-ARs in human gastric cell lines SGC-7901 and BGC-823 by RT-PCR and western blotting. (A) Expression of b-ARs in human gastric cell lines SGC-7901 and BGC-823 at the mRNA level by RT-PCR. Both of cell lines expressed b1- and b2-AR mRNA (contolgroup had no cDNA). (B) Expression of b-ARs in human gastric cell lines SGC-7901 and BGC-823 at the protein level by western blotting. Both ofcell lines expressed the proteins of the b1- and b2-ARs.

Figure 2 Dose-survival curves of BGC-823 and SGC-7901 cellsafter different doses of radiation with or without propranolol(50 μmol/L) 24 hr before irradiation. Propranolol administrationbefore irradiation of BGC-823 (A) and SGC-7901 (B) cells; BGC-823(C) and SGC-7901 (D) cells with irradiation. Compared with theirradiation-only groups, the cells exposed to propranolol beforeirradiation were more sensitive to irradiation.

Liao et al. Radiation Oncology 2010, 5:98http://www.ro-journal.com/content/5/1/98

Page 4 of 8

survival rates than treatment with irradiation only byusing isoproterenol before irradiation. Furthermore, theapoptosis assays show that the combination of propra-nolol and irradiation leads to higher apoptosis ratescompared with irradiation only. In addition to this,less apoptosis was observed in comparison to the

irradiation-only group caused by pre-treatment of iso-proterenol. The apoptosis rates of these three groupsare higher than the control group. These results suggestthat propranolol (b-adrenergic receptor antagonist)might be a useful irradiation sensitizer in gastric cancertherapy. Guidelines of the NCCN on gastric cancer

Figure 3 Apoptosis induction by isoproterenol or propranolol in combination with irradiation in BGC-823 and SGC-7901 cells. There wasan increasing rate of apoptosis in gastric cancer cell lines in response to the following treatments: isoproterenol before irradiation, irradiation only,and propranolol before irradiation. The two cell lines that were treated with propranolol before irradiation had the highest apoptosis rates.

Figure 4 Quantification of mRNA expression of different genes. Analysis of mRNA expression of COX-2, VEGF and EGFR was performed on fourgroups: control, radiotherapy (800 cGy) after isoproteronol (25 μM), radiotherapy (800 cGy) and radiotherapy (800 cGy) after propranolol (50 μM)using an iCycler (Bio-Rad). Expression of COX-2, VEGF and EGFR was reduced significantly in different groups (*p < 0.05 versus the control group).

Liao et al. Radiation Oncology 2010, 5:98http://www.ro-journal.com/content/5/1/98

Page 5 of 8

treatment show that radiotherapy is a standard treat-ment for gastric cancer patients. Taken together, radio-therapy in combination with propranolol can be moreuseful for patients with a high risk of recurrence in gas-tric cancer.Investigation of the specific mechanisms of NF-�B

activation by radiation is currently a rapidly expandingfield of research. It has been reported that NF-�B playsa key role in cellular protection against a variety of gen-otoxic agents including irradiation [11]. Radiation acti-vates NF-�B activity in cancer cells, thus making thecells radioresistant [12]. Activation of NF-�B by variousstimuli, including inflammation, stress and radiation,involves degradation of the inhibitory subunit and trans-location of activated NF-�B to the nucleus to regulatetranscription [13,14]. Our results demonstrated thattreatment of BGC-823 and SGC-7901 cells with propra-nolol reduced the levels of NF-�B, suggesting that cellu-lar radiosensitivity is increased by propranolol-inducedNF-�B inhibition. It has been shown that NF-�B is

involved in the modulation of expression of severalproinflammatory, prometastatic and proangiogenicgenes, including COX-2, EGFR and VEGF [15]. Anti-apoptotic COX-2 is an enzyme that converts arachido-nic acid to prostaglandins and is inducible by radiation[16,17]. It is reported that COX-2 inhibitors act asradiosensitizers in brain tumors [3]. EGFR is a memberof the ErbB family of receptors. Its stimulation by endo-genous ligands, EGF or transforming growth factor-alpha (TGF-a), results in activation of intracellular tyro-sine kinases and promotes cell cycle progression. EGFRwas shown to play an influential role not only in cellulargrowth and differentiation in healthy tissues, but also intumorigenesis and the progression of malignant disease[18]. Now, in most studies, EGFR inhibitors are given asa radiosensitizer to enhance the effect of radiotherapy[19-21]. VEGF is thought to be a critical angiogenic fac-tor for endothelial cell proliferation and blood vesselformation. Thus, interfering with VEGF signaling hasbecome a major strategy to inhibit tumor growth and

Figure 5 Effects of isoproterenol, propranolol and/or radiotherapy on COX-2, VEGF, EGFR and NF-�B (p65) proteins. SGC-7901 (A) andBGC-823 (B) cells were treated with/without isoproterenol or propranolol for 24 hr prior to radiotherapy (800 cGy). The protein levels of COX-2,VEGF, EGFR and NF-�B were analyzed by western blot.

Liao et al. Radiation Oncology 2010, 5:98http://www.ro-journal.com/content/5/1/98

Page 6 of 8

spread [22,23]. It has been shown that anti-angiogenicagents combined with radiotherapy improved tumoroxygenation and increased treatment efficacy by killingboth cancer and endothelial cells [24]. It is well acceptedthat the expression of EGFR, VEGF, and COX-2 is regu-lated by NF-�B [25-27]. In the present study, proprano-lol radiosensitization effects were found to be associatedwith changes in the levels of COX-2 and EGFR andVEGF signaling molecules. It was observed that propra-nolol can act as a radiosensitizer, which occurred viainhibition of b-ARs and subsequent reduced NF-�BDNA-binding activity, which concomitantly inhibitedthe expression of COX-2, EGFR and VEGF genes. Inthis way, propranolol can enhance the effect of radio-therapy on gastric cancer.These findings, along with the present experimental

data, strongly suggest that propranolol, a b-adrenergicreceptor antagonist, plays an important role in theradiotherapy of gastric cancer. The present studydemonstrates for the first time that b-adrenergic inhibi-tion can enhance the effect of radiotherapy on gastriccancer cells in vitro through the downregulation of NF-�B and modulation of downstream COX-2, EGFR andVEGF gene expression. Furthermore, there is an oppo-site effect caused by isoproterenol (b-adrenergic recep-tor agonist) administration. These data suggest thatblockade of b-AR-stimulated signaling pathways couldhave therapeutic implications for augmenting the sensi-tivity of radiotherapy on gastric cancer.

ConclusionIn conclusion, the addition of propranolol to radiother-apy led to a decrease in gastric cancer cell survival invitro. Adding the drug will enhance the sensitivity ofgastric cancer cells to radiation through the inhibitionof b-ARs and the downstream NF-�B -VEGF/EGFR/COX-2 pathway.

AcknowledgementsThe authors thank Dr. Dong Zhang for his technical assistance, who is fromthe Hepatobiliary Department of First Affiliated Hospital and the Institutionof Genetic Disease Research of Xi’an Jiaotong University.

Authors’ contributionsXC and XL designed the study, coordinated the work and drafted themanuscript. HLo, HLi and PC did the cytological work, helped withirradiation tests, performed Western blots and PCR. WZ coordinated thework, interpreted the data and helped drafting the manuscript. All authorsread and approved the final manuscript.

Competing interestsThe authors declare that they have no competing interests.

Received: 5 August 2010 Accepted: 26 October 2010Published: 26 October 2010

References1. David M.R: The epidemiology of gastric cancer. Gastric Cancer 2002,

5:5-11.2. Macdonald JS, Smalley SR, Benedeth J, Estes N, Haller DG, Ajani JA,

Gunderson LL, Jessup M, Martenson JA: Postoperative combined radiationand chemotherapy improves disease-free survival (DFS) and overallsurvival (OS) in resected adenocarcinoma of the stomach andgastroesophageal junction: Update of the results of Intergroup StudyINT-0116 (SWOG 9008). Gastrointestinal Cancers Symposium 2004, Abstract6.

3. Sminia P, Kuipers G, Geldof A, Lafleur V, Slotman B: COX-2 inhibitors act asa radiosensitizer in tumor treatment. Biomed Pharmacother 2005,59:272-275.

4. Geoerger B, Gaspar N, Opolon P, Morizet J, Devanz P, Lecluse Y, Valent A,Lacroix L, Grill J, Vassal G: EGFR tyrosine kinase inhibition radiosensitizesand induces apoptosis in malignant glioma and childhoodependymoma xenografts. Int J Cancer 2008, 123:209-216.

5. Michel Z, Abderrahim Z, David A, Mahmut O: The epidermal growth factorreceptor (EGFR) in head and neck cancer: its role and treatmentimplications. Radiation Oncology 2006, 1:11.

6. Wachsberger PR, Burd R, Cardi C, Thakur M, Daskalakis C, Holash J,Yancopoulos GD, Dicker AP: VEGF trap in combination with radiotherapyimproves tumor control in U87 glioblastoma. Int J Radiat Oncol Biol Phys2007, 67:1526-1537.

7. Graham W, Kris G, Yong X, Mahesh K, William ST: Clair Selectivelyenhanced radiation sensitivity in prostate cancer cells associated withproteasome inhibition. Oncology Reports 2006, 15:1287-1291.

8. Lee YY, Kao CL, Tsai PH, Tsai TH, Chiou SH, Wu WF: Caffeic acid phenethylester preferentially enhanced radiosensitizing and increased oxidativestress in medulloblastoma cell line. Childs Nerv Syst 2008, 24:987-994.

9. Helen PSW, Le Y, Emily KYL, Emily KKT, William KW, Cho CH: NicotinePromotes Colon Tumor Growth and Angiogenesis through β-AdrenergicActivation. Toxicological Sciences 2007, 97:279-287.

10. Vermes I, Clemens H, Helga SN, Chris R: A novel assay for apoptosis Flowcytometric detection of phosphatidylserine expression on earlyapoptotic cells using fluorescein labelled Annexin V. Journal ofImmunological Methods 1995, 17:39-51.

11. Ahmed KM, Li JJ: ATM-NF-kappaB connection as a target for tumorradiosensitization. Curr Cancer Drug Targets 2007, 7:335-342.

12. Tamatani T, Azuma M, Motegi K, Takamaru N, Kawashima Y, Bando T:Cepharanthin-enhanced radiosensitivity through the inhibition ofradiation-induced nuclear factor-kappaB activity in human oralsquamous cell carcinoma cells. Int J Oncol 2007, 31:761-768.

13. Voorhees PM, Dees EC, O’Neil B, Orlowski RZ: The proteasome as a targetfor cancer therapy. Clin Cancer Res 2003, 9:6316-6325.

14. Adams J: The proteasome: structure, function, and role in the cell. CancerTreat Rev 2003, 29:3-9.

15. Xiong HQ, Abbruzzese JL, Lin E, Wang L, Zheng L, Xie K: NF-κB activityblockade impairs the angiogenic potential of human pancreatic cancercells. Int J Cancer 2004, 108:181-188.

16. Liao Z, Komaki R, Mason KA, Milas L: Role of cyclooxygenase 2 inhibitorsin combination with radiation therapy in lung cancer. Clin Lung Cancer2003, 4:356-365.

17. Terakado N, Shintani S, Yano J, Chunnan L, Mihara M, Nakashiro K,Hamakawa H: Overexpression of cyclooxygenase 2 is associated withradioresistance in oral squamous cell carcinoma. Oral Oncol 2004,40:383-389.

18. Arteaga C: Targeting HER1/EGFR: a molecular approach to cancertherapy. Semin Oncol 2003, 30:3-14.

19. Wu RR, Wu SX, Zhao C, Xie FY, Gao JM, Hu WH, Gao YH, Li FY, Cui TT,Lu TX: Phase II clinical trial of h-R3 combined radiotherapy forlocoregionally advanced nasopharyngeal carcinoma. Chin J Cancer 2007,26:874-879.

20. Huang XD, Yi JL, Gao L, Xu GZ, Jin J, Yang WZ, Lu TX, Wu SX, Wu RR,Hu WH, Xie WC, Han F, Gao YH, Gao JM, Pan JJ, Chen CB, Lang JY, Li T,Dong Y, Fu YB, Fan L, Li BS, Li J, Wang XH, Chen BX, Gao XS, Zhang P,Wu XW, Hu BQ: Multi-center phase II clinical trial of humanized anti-epidermal factor receptor monoclonal antibody h-R3 combined withradiotherapy for locoregionally advanced nasopharyngeal carcinoma.Chin J Onco 2007, 29:197-202.

Liao et al. Radiation Oncology 2010, 5:98http://www.ro-journal.com/content/5/1/98

Page 7 of 8

21. Bonner JA, Harari PM, Giralt J, Azarnia N, Shin DM, Cohen RB, Jones CU,Sur R, Raben D, Jassem J, Ove R, Kies MS, Baselga J, Youssoufian H,Amellal N, Rowinsky EK, Ang K: Radiotherapy plus cetuximab forsquamous-cell carcinoma of the head and neck. Engl J Med 2006,354:567-578.

22. Ferrara N: Vascular endothelial growth factor as a target for anticancertherapy. Oncologist 2004, 9:2-10.

23. Hicklin DJ, Ellis LM: Role of the vascular endothelial growth factorpathway in tumor growth and angiogenesis. J Clin Oncol 2005,23:1011-1027.

24. Teicher BA, Dupuis N, Kusomoto T, Robinson FM, Liu F, Menon K,Coleman CN: Antiangiogenic agents can increase tumor oxygenationand response to radiation therapy. Rad Oncol Invest 1995, 2:269-276.

25. Sclabas GM, Uwagawa T, Schmidt C, Hess KR, Evans DB, Abbruzzese JL,Chiao PJ: Nuclear factor κB activation is a potential target for preventingpancreatic carcinoma by aspirin. Cancer 2005, 103:2485-2490.

26. Takada Y, Kobayashi Y, Aggarwal BB: Evodiamine abolishes constitutiveand inducible NF-κB activation by inhibiting InBa kinase activation,thereby suppressing NF-κB-regulated antiapoptotic and metastatic geneexpression, up-regulating apoptosis, and inhibiting invasion. J Biol Chem2005, 280:17203-17212.

27. Takada Y, Murakami A, Aggarwal BB: Zerumbone abolishes NF-κB andInBa kinase activation leading to suppression of antiapoptotic andmetastatic gene expression, upregulation of apoptosis, anddownregulation of invasion. Oncogene 2005, 24:6957-6969.

doi:10.1186/1748-717X-5-98Cite this article as: Liao et al.: Effects of propranolol in combinationwith radiation on apoptosis and survival of gastric cancer cells in vitro.Radiation Oncology 2010 5:98.

Submit your next manuscript to BioMed Centraland take full advantage of:

• Convenient online submission

• Thorough peer review

• No space constraints or color figure charges

• Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar

• Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit

Liao et al. Radiation Oncology 2010, 5:98http://www.ro-journal.com/content/5/1/98

Page 8 of 8