Rights / License: Research Collection In Copyright - Non ...48077/et… · Prof. Dr. M. Zinn, co-examiner Prof. Dr. S. Panke, co-examiner Dr. Q. Ren, co-examiner 2015 . 1 Acknowledgements

Research Collection

Doctoral Thesis

Biosynthesis of polyhydroxyalkanoates (PHAs) from low-costgrowth carbon substrates in recombinant bacterial strains

Author(s): Le Meur, Sylvaine G.A.

Publication Date: 2015

Permanent Link: https://doi.org/10.3929/ethz-a-010515010

Rights / License: In Copyright - Non-Commercial Use Permitted

This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.

ETH Library

https://doi.org/10.3929/ethz-a-010515010

http://rightsstatements.org/page/InC-NC/1.0/

https://www.research-collection.ethz.ch

https://www.research-collection.ethz.ch/terms-of-use

Diss. ETH No. 22715

Biosynthesis of polyhydroxyalkanoates (PHAs) from

low-cost growth carbon substrates in recombinant

bacterial strains

A thesis submitted to attain the degree of

DOCTOR OF SCIENCES OF ETH ZURICH

(Dr. sc. ETH Zurich)

presented by

SYLVAINE GISELE AURELIE LE MEUR

M. sc. Biotechnology, University of La Rochelle (FR)

Born on 24.02.1984

Citizen of France

Accepted on recommendation of

Prof. Dr. M. Ackermann, examiner

Prof. Dr. T. Egli, examiner

Prof. Dr. M. Zinn, co-examiner

Prof. Dr. S. Panke, co-examiner

Dr. Q. Ren, co-examiner

2015

1

Acknowledgements

First of all, I am extremely grateful to my direct supervisor, Dr. Qun Ren for choosing me as

PhD student for this project and for always being there for me. Qun was a fabulous advisor:

insight, sharp, indulgent and involved. She gave me the confidence to explore my research

interests and the guidance to avoid getting lost in my exploration. Thanks to Qun for her

encouragement, support and continuous optimism and for generally being a great person with

whom working was great. She is an inspiration.

I would like to take this opportunity to thank Prof. Dr. Thomas Egli for giving me the

opportunity to perform this PhD work under his supervision and for his very helpful comments

and suggestions. I am very fortunate to have had co-supervisor Prof. Dr. Manfred Zinn with his

brilliant ideas, advices and support. I am grateful to Prof. Dr. Linda Thöny-Meyer to accept me

in her laboratory and for her interest in my doctoral researches. I thank Prof. Dr. Sven Panke

and Prof. Dr. Martin Ackermann greatly for their agreement to be my external examiner and

my new supervisor, respectively.

I express my warm gratitude to Dr. Stéphanie Follonier for her support at several points

throughout my doctoral studies, for proofreading some parts of this thesis and for giving me

great technical advices.

Life would not have been so nice without the good friends I met at EMPA. I would like to

extend my thanks to the whole Laboratory especially Jasmin, Nicolas, Pantelis, Melisa,

Bernhard, Steffi, Maite, Sabrina and the people from other Labs: Agathe, Marek, Andrej,

Joanna and Ana-Maria. I thank also my French friends, especially, Léna and Annaïk for her

support and optimism.

2

I also would like to thank my parents: Mireille and Jean-Charles Le Meur, who through my

childhood and study career had always encouraged me to follow my scientific interest.

My deepest thanks go to my husband, Julien, for his patience during my writing of this

dissertation, and for always supporting me during these PhD years when we were far away from

each other and now for the wonderful life that we share together with our 6-month-old son,

Ewen.

The presented work was carried out at EMPA St. Gallen and financed by the Swiss National

Science Foundation (SNSF).

3

Table of Contents

Acknowledgements ................................................................................................................... 1

Abbreviations ............................................................................................................................ 5

Summary ................................................................................................................................... 7

Résumé .................................................................................................................................... 11

General introduction .............................................................................................................. 15

Background .......................................................................................................................... 16

History of polyhydroxyalkanoates (PHAs) ........................................................................... 21

Diversity and chemical structure of PHAs ........................................................................... 22

Properties of PHAs ............................................................................................................... 25

Biochemical synthesis of PHAs ............................................................................................ 28

Reducing costs of PHA production ...................................................................................... 35

PHA applications ................................................................................................................. 42

Aim and scope of this thesis ................................................................................................. 44

Production of medium-chain-length polyhydroxyalkanoates by sequential feeding xylose

and octanoic acid in engineered Pseudomonas putida KT2440 .......................................... 47

Abstract ................................................................................................................................ 48

Background .......................................................................................................................... 49

Methods ................................................................................................................................ 51

Results .................................................................................................................................. 58

Discussion ............................................................................................................................ 67

Conclusions .......................................................................................................................... 71

Construction and expression of recombinant plasmids encoding for orfZ and phaC genes

into an inducible vector .......................................................................................................... 73

Abstract ................................................................................................................................ 74

Introduction .......................................................................................................................... 74

Materials and methods ......................................................................................................... 77

Results .................................................................................................................................. 81

Conclusions .......................................................................................................................... 91

Poly(4-hydroxybutyrate) (P4HB) production in recombinant Escherichia coli: P4HB

synthesis is uncoupled with cell growth ................................................................................ 93

Abstract ................................................................................................................................ 94

Background .......................................................................................................................... 95

Methods ................................................................................................................................ 98

Results ................................................................................................................................ 102

4

Discussion .......................................................................................................................... 113

Conclusions ........................................................................................................................ 116

Improved productivity of poly(4-hydroxybutyrate) (P4HB) in recombinant Escherichia

coli using glycerol as the growth substrate with fed-batch culture ................................. 119

Abstract .............................................................................................................................. 120

Background ........................................................................................................................ 121

Methods .............................................................................................................................. 123

Results and Discussion ....................................................................................................... 130

Conclusions ........................................................................................................................ 145

The effect of molecular weight on the material properties of biosynthesized poly(4-

hydroxybutyrate) .................................................................................................................. 147

Abstract .............................................................................................................................. 148

Introduction ........................................................................................................................ 148

Experimental ...................................................................................................................... 150

Results and discussion ........................................................................................................ 153

Conclusions ........................................................................................................................ 162

General discussion ................................................................................................................ 163

Overview of the main research topics of this thesis ........................................................... 164

Mcl-PHAs from xylose ....................................................................................................... 165

Bioprocess optimization approaches ................................................................................. 168

Potential strategies to further optimize P4HB production ................................................. 170

Conclusions ........................................................................................................................ 173

References ............................................................................................................................. 175

Curriculum vitae ........................................................................ Error! Bookmark not defined.

5

Abbreviations

Abbreviations Names Units

PHAs: Polyhydroxyalkanoates

scl-PHAs: Short-chain-length PHAs

mcl-PHAs: Medium-chain-length PHAs

P3HB: Poly(3-hydroxybutyrate)

P4HB: Poly(4-hydroxybutyrate)

P3HV: Poly(3-hydroxyvalerate)

P3HH: Poly(3-hydroxyhexanoate)

P3HP: Poly( 3-hydroxyheptanoate)

P3HO: Poly(3-hydroxyoctanoate)

RHA-CoA: (R)-hydroxyacyl-coenzyme A

PLA: Polylactic acid

PCL: Polycaprolactone

PEA: Polyesteramide

PBSA: Polybutylene succinate-co-adipate

PBAT: Polybutyrate adipate terephthalate

GRP: Glycerol-rich-phase

Na-4HB: Sodium 4-hydroxybutyrate

NH4OH: Ammonium hydroxide

H2SO4: Sulfuric acid

CDW: Cell dry weight (biomass) g L-1

Y P4HB/Na-4HB: Production yield of P4HB from Na-4HB g g-1

F0: Initial substrate feeding/ flow rate g L-1 h-1

F: Substrate feeding/flow rate g L-1 h-1

µ: Specific growth rate h-1

µmax: Maximum specific growth rate h-1

s0: Initial substrate concentration in batch g L-1

s: Actual l substrate concentration g L-1

YX/S: Growth yield for the limiting substrate g g-1

qs: Specific substrate consumption rate g g-1 h-1

x0: Initial actual biomass concentration g L-1

V0: Initial volume of the culture L

x: Actual biomass concentration g L-1

V: Actual volume of the culture L

6

Summary

7

Summary

Owing to the involved volume and the environmental impact of petroleum-based

plastics, the development of biodegradable ecofriendly plastics from renewable sources

becomes a crucial global issue with time.

To compete with conventional synthetic plastics, biodegradable and bio-based plastic

materials should mimic the desired physical and chemical properties of their chemical

homologues. Polyhydroxyalkanoates (PHAs) offer a promising alternative because they

possess similar properties to current synthetic thermoplastics and elastomers. Furthermore,

PHAs are completely degraded by microorganisms under both aerobic and anaerobic conditions

upon disposal. These natural polyesters are produced by a number of bacteria as intracellular

storage materials of carbon and energy, under nutrient limiting conditions and carbon in excess.

Given that the price of carbon source represents about 50% of the total PHA production cost,

the development of strains and fermentation processes allowing to produce PHAs from a cheap

carbon source is necessary to compete with chemically synthesized plastics.

The aim of this doctoral thesis is to use inexpensive carbon sources to produce high

added-value PHAs such as medium-chain-length (mcl-PHAs) or poly(4-hydroxybutyrate)

(P4HB). Various investigations were performed in bioreactors using recombinant strains of

Pseudomonas putida or Escherichia coli, in defined media with low-cost growth carbon

substrates such as xylose, a hemicellulose derivative or glycerol, a waste byproduct from the

biodiesel industry.

Utilization of xylose was investigated for mcl-PHA production and is described in

chapter 2. A mcl-PHA producing strain, P. putida KT2440, was used as the host to express

genes from E. coli W3110 encoding xylose isomerase (XylA) and xylulokinase (XylB). These

Summary

8

genes gave the recombinant P. putida KT2440 (pSLM1) the ability to grow on xylose. The cells

reached a maximum specific growth rate of 0.24 h-1 and a maximal yield of 0.41 g cell dry

weight per g xylose. Since biosynthesis of mcl-PHAs from only xylose was not possible,

sequential feeding strategy was applied using xylose and octanoic acid, leading to tailor-made

PHAs. Biopolymer content up to 20% w w-1 of mcl-PHAs was achieved with a yield of 0.4 g

mcl-PHA per g octanoic acid. For the first time, a process using xylose as growth carbon

substrate and fatty acids as polymer precursor for the accumulation of tailor-made PHAs is

reported here.

Utilization of xylose was investigated to produce P4HB, another type of high added-value PHA

with high potential in medical applications. In chapter 3 different plasmid constructs

containing genes for biosynthesis of P4HB were introduced into recombinant E. coli and their

effect on plastic production was studied. pKSSE5.3 plasmid harboring a PHA synthase gene

(phaC) from Ralstonia eutropha and a 4-hydroxybutyric acid-coenzyme A transferase gene

(orfZ) from Clostridium kluyveri gives the ability to recombinant E. coli to convert 4-

hydroxybutyric acid to P4HB when the precursor is supplemented in the medium broth. Three

different plasmids containing phaC and orfZ genes with or without their respective promoters

(i.e. inducible or not) were constructed through classical DNA manipulation. P4HB

accumulation was investigated in various batch studies; however, low P4HB accumulation was

observed in all tested strains.

In chapter 4, six different E. coli strains were transformed with plasmid pKSSE5.3

carrying phaC and orfZ. P4HB accumulation and cell growth were compared to identify the

best E. coli recombinant. The impact of various cultivation parameters and physiological stage

at which Na-4HB precursor should be added was investigated. For the first time, P4HB

biosynthesis was revealed to be separated from the growth of E. coli JM109 (pKSSE5.3) and

Summary

9

to mainly take place after the end of the exponential growth phase. P4HB production by simple

batch culture using xylose and Na-4HB was achieved with a high conversion yield of 92% g g

-1 based on carbon.

In chapter 5, the impact of N, C, Mg and amino acid limitation, as well as the utilization of

acetate as a stimulator to enhance the P4HB accumulation, was studied in recombinant E. coli

JM109 (pKSSE5.3). Efficient P4HB accumulation stimulated by amino acid limitation (NZ-

amines) and by addition of acetic acid was obtained when glycerol was used as the carbon

source for growth. High cell density cultures using glycerol with various feeding modes were

performed. A fed-batch with an exponential feeding regime gave the highest productivity for

P4HB reported so far.

P4HBs with different molecular weight were characterized with respect to their material

properties in chapter 6. Acid-catalyzed hydrolysis allowed the preparation of P4HBs with

tunable molecular weight, which leads to different thermal and mechanical properties. A

decrease in the molecular weight led to an increase in the degree of crystallinity of the polymer.

It was also found that the molecular weight, rather than the degree of crystallinity, played role

in the tensile mechanical properties. The developed method allows the preparation of polymer

fractions for biomedical applications with easier processability and still adequate thermal and

mechanical properties. In chapter 7, various options for further research are discussed which

would allow sustainable PHA production.

Results of this doctoral thesis demonstrate that PHAs as a high value added product can be

efficiently biosynthesized from inexpensive carbon sources using optimized strains and

fermentation conditions. These biotechnological explorations will lead to new prospects for

industrial production of PHAs.

10

Résumé

11

Résumé

Le développement de plastiques biodégradables provenant de matières premières

renouvelables « bio-sourcés » devient un enjeu planétaire majeur au vu de l’accroissement des

volumes et de l’impact environnemental des plastiques issus de la pétrochimie. Afin de rivaliser

et remplacer, à terme, ces plastiques conventionnels, les nouveaux matériaux plastiques

biodégradables et bio-sourcés devront conserver des propriétés rhéologiques similaires à leurs

homologues chimiques. Les polyhydroxyalcanoates (PHAs) offrent une alternative prometteuse

aux plastiques conventionnels car ils possèdent des propriétés rhéologiques similaires aux

thermoplastiques et élastomères actuels. De plus, ils peuvent être totalement dégradés par les

microorganismes en conditions aérobies ou anaérobies. Autre aspect prometteur, les PHAs sont

biocompatibles et extrêmement bien tolérés in vivo, ce qui ouvre la voie à de nombreuses

applications médicales.

Ces biopolyesters naturels sont produit par de nombreuses bactéries, comme matériel de

réserve intracellulaire, offrant ainsi une source de carbone et d’énergie lors de conditions

déficitaires en nutriments et d’un excès de source carbonée. Leurs biosynthèses s’effectuent

lors d’une limitation en azote, en phosphate ou en oxygène et lorsque d’un excédent de source

carbonée est encore présent dans le milieu de culture. Mais pour s’imposer comme alternative

durable aux plastiques conventionnels, il convient également de minimiser le coût de

production des PHAs et notamment celui du substrat carboné qui représente 50% du coût de

production total. Pour ce faire, il convient de développer et d’optimiser des souches

bactériennes et des procédés de fermentation en utilisant un substrat carboné bon marché. Le

but de cette thèse de doctorat est donc d’utiliser une source de carbone peu onéreuse pour

produire des PHAs de haute valeur-ajoutée, tels que les PHAs à moyenne longueur de chaine

carbonée (mcl-PHAs) et les Poly(4-hydroxybutyrate) (P4HB). Dans cet objectif, diverses

Résumé

12

investigations ont été réalisées en bioréacteurs en utilisant des souches recombinantes de

Pseudomonas putida ou d’Escherichia coli dans un milieu de culture défini, contenant un

substrat de croissance carboné peu couteux : le xylose, un dérivé d’hémicellulose, ou le

glycérol, un sous-produit inutilisé issue de l’industrie du biodiesel.

Le chapitre 2 de cette thèse décrit l’utilisation de xylose comme substrat carboné lors

de la production de mcl-PHAs. P. putida KT2440, une souche bactérienne naturellement

productrice de mcl-PHA, ne possédant pas le métabolisme nécessaire à la dégradation de

xylose, fut utilisée comme hôte pour exprimer les gènes d’E. coli W3110 encodant pour les

enzymes xylose isomerase (XylA) et xylulokinase (XylB). Ces gènes ont permis à la souche

recombinante de cataboliser le xylose présent dans le milieu de culture.

Les cellules bactériennes recombinées ont atteint un taux de croissance spécifique de

0.24 h-1 et un rendement maximal de 0.41 g (CDW) g-1 sur xylose. La biosynthèse de mcl-PHAs

n’a pas été constatée lorsque le xylose était l’unique source de carbone. Pour y remédier, une

stratégie d’alimentation séquencée a été employée en utilisant du xylose et un acide gras, l’acide

octanoïque, permettant la biosynthèse d’un PHA « sur-mesure ». Une accumulation jusqu’à

20% w w-1 de mcl-PHAs a été atteinte avec un rendement 0.4 g de mcl-PHA par g d’acide

octanoïque. Pour la première fois dans un travail de recherche, un bioprocédé permettant

l’accumulation de mcl-PHAs spécifiques utilisant le xylose comme substrat de croissance et de

l’acide octanoïque comme précurseur de la biosynthèse de polymère est présenté.

Dans le chapitre 3, l’utilisation de xylose comme substrat a également été étudié pour

produire un autre type de PHAs à haute valeur ajoutée: le P4HB. Ce polyester biocompatible et

biodégradable possède un haut potentiel dans le domaine biomédical puisqu’il est d’ores et déjà

autorisé comme suture résorbable par la « U.S. Food and Drug Administration » (FDA). Le

Résumé

13

plasmide pKSSE5.3 portant le gène de PHA synthase (phaC) de Ralstonia eutropha et le gène

de 4-acide hydroxybutyrique -coenzyme A transferase (orfZ) de Clostridium kluyveri permet à

la souche recombinante d’E. coli de convertir l’acide 4-hydroxybutyrique en P4HB lorsque le

précurseur est ajouté dans le milieu de culture. L’induction de ces gènes de biosynthèse du

P4HB a été étudiée à travers différentes constructions génétiques. Trois plasmides contenant

les gènes phaC et orfZ avec ou sans leurs promoteurs respectifs ont été transformés dans une

souche recombinante d’E. coli BL21 (DE3). De nombreuses études de croissances ont été

réalisées et l’accumulation du biopolymère après induction a été analysée.

Dans le chapitre 4, différentes souches d’E. coli ont été transformées avec le même

plasmide pKSSE5.3. L’accumulation de biopolymère et les croissances cellulaires ont été

comparées pour identifier la meilleure souche recombinante d’E. coli. L’impact de plusieurs

paramètres de cultures et l’état physiologique lors de l’ajout du précurseur a été examiné. Il a

été démontré pour la première fois que la biosynthèse de P4HB est séparée de la phase de la

croissance d’E. coli JM109 (pKSSE5.3) et s’effectue principalement pendant la fin de la

croissance exponentielle. La production de P4HB par une simple culture en batch en utilisant

du xylose et du Na-4HB a été obtenue avec un haut rendement de conversion de 92% g g-1.

Le chapitre 5 vise à optimiser la production de P4HB, par la souche recombinante E.

coli JM109 (pKSSE5.3), en étudiant l’impact de différentes limitations nutritionnelles et

l’utilisation d’acétate comme stimulateur de biosynthèse de P4HB. L’accumulation de P4HB a

été stimulée par la limitation en acides aminées (NZ-amines) et par l’addition d’acide acétique

lors de cultures sur glycérol. Des cultures à haute densité cellulaire ont été réalisées avec du

glycérol comme source carbonée de croissance. Un procédé de « Fed-Batch » avec une

alimentation microbienne exponentielle a permis d’aboutir à la plus haute productivité de P4HB

publiée à ce jour.

Résumé

14

Les propriétés rhéologiques du P4HB à faible poids moléculaire ont été étudiées dans le

chapitre 6. Des échantillons contenant un polymère à faible poids moléculaire ont été réalisés

par une méthode d’hydrolyse catalysée par de l’acide, décrite dans cette thèse. Cette méthode a

permis l’obtention d’un polymère facilement transformable et possédant des caractéristiques

mécaniques adéquates pour de futures applications médicales.

Diverses perspectives de recherches ont été discutées dans le chapitre 7, pour améliorer

la production de P4HB dans une optique de développement durable. Les résultats de cette thèse

de doctorat démontrent que des biopolymères tel que les PHAs peuvent être synthétisés à

moindre coût en utilisant des substrats carbonés peu onéreux combinés à des procédés de

fermentations optimaux. Ces avancées biotechnologiques apportent de nouvelles perceptives

industrielles dans le domaine de la production de PHAs.

Chapter 1

General introduction

Chapter 1 : General introduction

16

Background

Terminology of polymeric materials

To avoid misunderstandings, the terms plastic, polymer and biopolymer must be defined.

Plastic is a generic term used for polymeric materials and it is defined, according to the

American Chemistry Council, as a “synthetic or semi-synthetic man-made organic polymer,

capable of being molded, extruded, cast into various shapes and films, or drawn into filaments.

Plastics are typically of high molecular mass, and most commonly derived from

petrochemicals” [1]. According to the American Chemistry Council (ACC), polymer is defined

as a “chemical made of many repeating units” [1], and according to the International Union of

Pure and Applied Chemistry (IUPAC), a biopolymer is a “polymer which is produced by living

organisms” [2].

From petroleum-based plastic to bio-based plastic

Despite the numerous possible applications, production and use of plastics become increasingly

problematic. The most conventional types of plastics are petroleum-based plastics, which

means they are manufactured from fossil fuels, like polyethylene terephthalate (PET),

polyethylene (PE) and polypropylene (PP). The conventional petroleum-based plastics are

currently faced with two critical main issues: i) fossil resources will become scarce in the world,

which will increases the oil price; and ii) most of these petroleum-based plastics are non-

biodegradable and accumulate in the environment creating a huge pollution over time (Fig. 1.1).

Resource depletion may become a determining factor in future plastic production, but for a

numbers of raisons the exact time point is difficult to predict. For example, the total extent of

estimated fuel reserves is still uncertain, new extraction technics are being developed and

economical and political obstacles influence this process. Furthermore, since the 1950s when


17

the massive plastic production started, plastic debris have accumulated in the environment

causing severe pollution and threat to the wildlife on land as well as in the Sea (Fig. 1.1).

Figure 1.1: On the left, plastic pollution on beaches of Hong Kong in July 2012 [3], on the right,

a marine turtle eating plastic in Florida [4].

The longevity of conventional plastic is estimated to be hundreds to thousands of years, but it

seems to be even longer in the Deep Sea [5]. Conventional petrochemically produced plastics

accumulate in Nature leading to a pollution of 165 million tons of plastics in the world's oceans

[6]. This pollution calls for the development of biodegradable substitutes.

To minimize plastic pollution, recycling would be an option but presently this seems to be

unrealistic because the plastic waste is too disseminated, the people’s involvement is too weak

and the recycling profit is too low. The development of “green materials” from renewable

resources is an attractive option. Bio-based polymers are considered to be ecofriendly versions

for replacing petroleum-based plastics. They could decrease the long-term pollution and our

dependency on fossil fuel thereby adding to global sustainability. Bio-based polymers represent

an appropriate answer to the conventional plastics issues because they are renewable, most of

them are biodegradable and some of them have very similar properties as conventional

petroleum-based polymers.


18

Global problem of plastic waste

The worldwide conventional plastic production increased from 1.5 million of tons per year in

the 1950’s to 245 million in 2008 [7]. It is predicted that this output could triple by 2050 [7]. In

2008 around 25 million tons of plastic waste was generated in European Union (EU) and only

5.3 million tons were recycled [7]. Currently, burying in landfills and burning are the

predominant waste treatment practices applied to plastics. The trends of plastic waste

generation observed in the EU will probably be more pronounced in fast growing countries like

India, China, Brazil and Indonesia as well in developing countries [8]. Plastic waste is an

international problem which that needs concrete action as mentioned in the Rio+20 United

Nation Conference on Sustainable Development in June 2012. One of the solutions for this

problem can be the development of innovative materials that possess similar properties to

conventional plastics but which are environmentally friendly.

Market projections for bio-plastics

The biodegradable polymer market increased in the last years and reached 10% of the total

market in Europe in 2009. Europe is responsible for half of the global bio-plastic consumption

[9]. According to recent reports from “European Bioplastics” [8], a strong growth of bio-based

polymers is predicted for the near future. This source forecasted that global bio-plastic

production would increase from 1.2 million of tons in 2011 to 5.8 million tons in 2016 which

would represent a five-fold increase over 5 years. By 2016, polylactic acid (PLA) and

polyhydroxyalkanoate (PHA) based materials are predicted to contribute to this growth with an

expected annual production of 298,000 tons and 142,000 tons, respectively. However, PLAs

and PHAs will have to share this market with bio-based PET synthesized from ethanol produced

from sugar cane (but chemically polymerized) with 250,000 tons [8]. According to a European


19

Commission study in 2005 [10], the maximal substitution of conventional plastic by bio-plastic

is estimated to be around 33% of the total actual production by 2020.

One of the most critical obstacles to enter the global market is the production cost of bio-

plastics. In 2006, biopolymers were on average 1.5 to 4 times more expensive than conventional

plastics [11], but in 2010, P3HB known as MirelTM was commercialized at 1.50€ kg-1 [12]. At

this price, P3HB can compete with most of the produced petroleum-based plastics [12]. But

assuming that petroleum prices will continuously increase and that research on bio-based

plastics will contribute to reducing production cost, the bioplastics can be expected to become

more and more competitive.

Commercially available bio-plastics

Currently, different kinds of bio-based plastics are available. These polymers are defined as

“bio-based” when they are manufactured from a renewable carbon source such as cellulose,

vegetable fats, corn starch, pea starch or organic waste (Table 1.1). However, on the one hand

not all bio-based plastics are biodegradable (and on the other hand some petroleum-based

plastics can be biodegradable). Table 1.1 shows different possible combinations. As defined

later on, plastics are biodegradable when they can be decomposed to CO2 and biomass by

bacteria or others microorganisms in a favorable environment.


20

Table 1.1: Examples of bio-plastics in the notion of biodegradability and bio-based materials.

(Based on [13]).

Substrate source Biodegradability Example

Renewable Biodegradable Polyhydroxyalkanoates (PHAs); polylactic acids

(PLAs); starch

Non-Renewable Biodegradable Polycaprolactone (aliphatic polyester )

Renewable Non-Biodegradable Vegetable-based polyethylene

Non-Renewable Non-Biodegradable Polyether etherketone (PEEK, biocompatible)

Classification of biodegradable polymers

Biodegradable polymers can be classified into two groups [14].

Figure 1.2: Classification of biodegradable polymers according to their monomer sources

(adapted from [14]).

The first group represents polymers extracted directly from agricultural resources (Fig. 1.2). In

this group, we can find polysaccharides, ligno-cellulosic products, and proteins. The second

group contains three categories of polymers (Fig. 1.2). First, polymers from bacterial

fermentations such as polyhydroxyalkanoates (PHAs), second, polymers resulting from

chemical polymerization using monomers from biomass such as polylactic acids (PLAs), and

third, polymers made of fossil resources, meaning they are not bio-based but still biodegradable.

Biodegradable

polymers

Biodegradable

polymers

Agropolymers Biopolymers

Polymers from

bacterial

fermentation

Polymers from

biotechnology

Polymers from

petrochemical

resources


21

This last group includes polycaprolactones (PCL), polyesteramides (PEA) and other aliphatics

or aromatic copolyesters such as polybutylene succinate-co-adipate (PBSA) and polybutyrate

adipate terephthalate (PBAT).

The advantage of renewable and biodegradable bioplastics is to reduce the global amount of

persisting waste materials. They also allow to save fossil resources and to decrease our

dependence on petroleum. According to the advantages presented for bio-plastics, PHA

represents a promising candidate. However, the main problem that limits the utilization and the

development of PHAs is presently the production cost.

History of polyhydroxyalkanoates (PHAs)

In 1926, the French scientist Maurice Lemoigne at the Pasteur Institute observed P3HB granules

under the microscope in cells of Bacillus megaterium. After isolation, he found that the granules

to consist of poly(3-hydroxybutyrate) (P3HB); this was the first discovered member of PHA

family [15].

In 1958, a functional role of P3HB was proposed by Macrae and Wilkinson as they observed

that in carbon and energy limiting medium, the granules were degraded, which suggested that

the component acted as an intracellular reserve material [16]. The first heteropolymeric chain

of PHAs was described in 1974; it was assembled of 3-hydroxyvaleric acid (3HV) and 3-

hydroxybutyric acid (3HB) as the major components, 3-hydroxyhexanoic acid (3HH) and

probably also 3-hydroxyheptanoic acid (3HP). It was isolated from activated sludge and its

physical and chemical properties were similar to that of P3HB [17]. After the oil crisis in 1973,

interest for such storage components increased and they were assumed to become the future of

polymer industry because they have similar physical properties as conventional plastics. In

addition, they exhibit other features like biodegradability, biocompatibility and piezoelectric


22

properties, but also the potential to serve as a source of optically active molecules kept the

interest growing even after the end of the oil crisis [18].

A wide range of microorganisms, including Gram-negative and Gram-positive bacteria, is able

to accumulate various kinds of PHAs as intracellular carbon and energy reserve material. PHAs

are even synthesized in photosynthetic bacteria under aerobic (cyanobacteria) and anaerobic

(non-sulfur and sulfur purple bacteria) conditions, as well as in some archaebacteria [19]. Also

recombinant Escherichia coli is able to accumulate PHA in its cytoplasm as shown in the

fluorescence microscopy picture below (Fig. 1.3). Since Lemoigne’s discovery, 125 different

hydroxyalkanoic acids (HA) were identified [20, 21].

Figure 1.3: Recombinant E. coli JM109 (pKSSE5.3) cells accumulating PHAs as granules in

their cytoplasm. PHA granules are visible as fluorescent bright spots after staining with Nile

red. The bar scale corresponds to 10 µm. (Picture S. Le Meur)

Diversity and chemical structure of PHAs

PHAs are polyesters consisting of hydroxyalkanoic acids that are linked through ester bonds

between the hydroxyl group and the carboxylic group of the next monomer (Fig. 1.4). Up to

now, in all described PHAs, the carbon atom of the hydroxyl group is in R configuration, except

for P4HB which has no chirality. In the P4HB polymer, the monomer units are linked between

PHA granule

Cell wall of bacteria 10 µm


23

the 4-hydroxyl group and the next carboxylic group. In contrast to P4HB, most of the PHA

polymers have the alkyl group in beta position, which can range from a methyl (C1) to a

pentadecanoyl (C15) residue.

m=1

PHA-scl

R=H Poly(3-hydroxypropionate) P3HP

R=CH3 Poly(3-hydroxybutyrate) P3HB

R=C2H5 Poly(3-hydroxyvalerate) P3HV

PHA-mcl

R=C3H7 Poly(3-hydroxyhexanoate) P3HHx

R=C5H11 Poly(3-hydroxyoctanoate) P3HO

R=C7H15 Poly(3-hydroxydecanoate) P3HD

PHA-lcl R=C11H23 Poly(3-hydroxytetradecanoate) P3HTD

R=C15H31 Poly(3-hydroxyoctadecanoate) P3HOD

m=2 PHA-scl R=H Poly(4-hydroxybutyrate) P4HB

Figure 1.4: General chemical structure of polyhydroxyalkanoates. m = 1, 2, 3 but m = 1 is most

common, n can range from 100 to several thousands. R is variable as shown in the examples.

Based on the chain length of the fatty acid monomers, PHAs can be classified into three

categories: short-chain-length (scl) PHAs with 3 to 5 carbon atoms, medium-chain-length (mcl)

PHAs with 6 to 14 carbon atoms, and long-chain-length (lcl) PHAs with more than 14 carbon

atoms [22] (Fig. 1.4).

In most cases, the structural composition of PHA polymers varies as function of the skeleton of

the carbon compound supplied as the growth substrate and the bacterial strain used [23]. The

side chain can be saturated or not, and can possess branched, aromatic, halogenated, and even


24

epoxidized monomers (Fig. 1.5). Functionalized side-chains containing for example a bromine

or aromatic group, have been found in PHA polymer produced by Pseudomonas putida [24,

25] (Fig. 1.5). As another example, a carbon source containing the functional group 6-para-

methylphenoxyhexanoic acid led to the production of PHA containing the corresponding 3-

hydroxy aromatic acid [26].

Figure 1.5: Examples of various monomers units present in mcl-PHAs accumulated in P.

putida.

As additional option, chemical modifications can be used to introduce the desired functional

group into PHAs [27]. Various hydroxyalkanoate monomers with functional groups have been

described leading to many possible chemical modifications of natural PHAs [28]. The

difference in length and/or chemical structure of the alkyl side chain of the PHAs influences

the material properties of the polymers to a great extent [29].

3-(R)-

hydroxyoctanoate

3-(R)-

hydroxy-7-

octenoate

3-(R)-

hydroxy-6-

methyl-

octanoate

3-(R)-

hydroxy-5-

phenyl-

valerate

3-(R)-

hydroxy-6-

bromo-

hexanoate


25

Properties of PHAs

Biodegradability

A polymer is classified by ISO norm as biodegradable when “the breakdown by

microorganisms in the presence of oxygen leads to carbon dioxide, water and mineral salts of

any other elements present and new biomass” [30, 31]. As mentioned above, PHAs have the

advantage of being completely biodegradable [32]. The degradation rate depends on many

factors. First, it is related to the physical properties of the polymer itself, in particular to its

surface area, its molecular weight, its monomeric composition, and its crystallinity. Second, it

depends on environmental conditions such as temperature, moisture level, pH and available

nutrients [33-35]. In nature, specialized microorganisms are able to degrade PHA using secreted

PHA depolymerase [36].

Biocompatibility

Polymers must be biocompatible to be used as medical materials, i.e. they must not cause severe

immune reactions when introduced to soft tissues or blood of a host organism. Recently, PHAs

have attracted much attention due to their many different potential applications in the medical

field [37]. For example, P4HB and P3HB are biocompatible and extremely well tolerated in

vivo given that their hydrolysis yields 4-hydroxybutyric acid (4HB) and 3-hydroxybutyric acid

(3HB), respectively, which are common metabolites occurring naturally in the human body and

suggests nontoxicity of implanted biopolymers [38, 39]. In vitro tests have shown that P3HB

was non-toxic in various human cell lines, including osteoblasts, fibroblasts, epithelial cells,

and ovine chondrocytes [40, 41].

PHAs are generally biodegradable in vivo, with good biocompatibility, making them attractive

as tissue engineering biomaterials [34, 42]. Furthermore, release of bioactive compounds can


26

be triggered by PHA degradation. In addition, PHAs are of hydrophobic nature and can be used

to delivered drugs such as antibiotic or anti-tumor agents. Potential delivery systems are

subcutaneous implants, compressed tablets for oral administration, and microparticulate

carriers for intravenous use [37].

Material properties

Since the 80’ies, extensive studies were performed to improve the mechanical properties of

PHAs [43]. The three-dimensional order of PHAs at the molecular level determines the physical

properties resulting in partially crystalline and partially amorphous regions [44]. In general,

polymers are characterized by their thermal properties using differential scanning calorimetry

(DSC); the glass transition temperature (Tg) of the amorphous phase is measured as well as the

melting temperature (Tm) of the crystalline phase. Most of PHAs behave as thermoplastics with

melting temperatures between 50 and 180°C (Table 1.2). The length of the side chain and the

presence of functional groups influence the physical properties, i.e., melting point, glass

transition temperature, and crystallinity [45]. When polymer composition changes, the

mechanical properties are also modified as well as the degradation rate and the biocompatibility

under specific physiological conditions [46].


27

Table 1.2: Thermal and mechanical properties of PHAs compared with conventional synthetic

plastics. (Poly(3-hydroxybutyrate): P3HB; Poly(3-hydroxyvalerate): P3HV; Poly(4-

hydroxybutyrate): P4HB; mcl-PHAs copolymer (P(3HO-co-3HH)) containing 88% of 3-

hydroxyoctanoate and 12% of 3-hydroxyhexanoate monomers: (mcl-PHAs). From [37, 47].

Melting

temperature

Tm (°C)

Glass-

transition

temperature

Tg (°C)

Tensile

strength

(MPa)

Young’s

modulus

(GPa)

Elongation

at break

(%)

Reference

P3HB 180 4 40 3.5 5 [48]

P(3HB-co-20%

3HV) 145 -1 9 1.2 50 [48]

P4HB 53 -48 104 0.15 150 [49]

mcl-PHAs

(P(3HO-co-

12%3HH))

61 -35 9 0.008 380 [50]

Polyacrylate – -106 68 2.2 50 [51]

Polyethylene 100 -78 23 1.13 200 [51]

Polypropylene 176 -10 38 1.7 400 [48]

Polystyrene 240 100 60 3 7 [51]

The molecular weight (Mw) of PHAs is generally between 50,000 and 1,000,000 Da. It varies

with the bacterial growth condition, the producer strain, and the downstream processing. After

extraction, the polymer can appear in various forms according to its composition and process

of purification. Usually, increased crystallinity is associated with an increase in rigidity, tensile

strength and opacity [52]. Amorphous polymers are usually more transparent, less rigid, weaker

and more easily deformable [52]. P3HB has properties similar to polypropylene due to a similar

melting point, tensile strength and glass transition temperature (Table 1.2). It is a stiff and brittle

plastic material due to its high crystallinity. Material properties also depend on isolation

procedures. For example, purified P3HB looks fibrous after solvent extraction and precipitation

in ice cold methanol whereas purified P4HB behaves similar to elastic-like paper when treated

identically (Fig. 1.6).


28

Figure 1.6: Purified P3HB (a) and P4HB (b) biopolymer. (Picture S. Le Meur)

In contrast to P3HB, P4HB material is strong and flexible, with a colossal tensile strength

leading to a 10 times elongation before breaking [53]. This allows a wide range of medical

applications like tissue engineering and drug delivery [53]. Its solubility in a range of polar

solvents (e.g., acetone), its elastomeric character at room and body temperature and its high

molecular weight are the ideal features for many biomedical applications [53]. Furthermore, its

lower melting temperature compared to PHB allows an easier processability [53].

Biochemical synthesis of PHAs

In 1958, Macrae and Wilkinson discovered that the amount of stored PHAs increased with the

carbon to nitrogen ratio in the growth medium. Generally, accumulation occurs when an excess

of carbon is available in the environment and when at least one other nutrient is

stoichiometrically limiting growth [16]. Initiation of PHA biosynthesis is often triggered by a

lack of either nitrogen, magnesium, sulfate, phosphate [54, 55] or oxygen [56].

The main physiological role of PHAs is as a storage of carbon and energy in the form of

intracellular granules [19]. Other reserve compounds, known to be accumulated in microbes

are glycogen, neutral lipids, starch as carbon source [57]. Similarly, nitrogen and phosphorus

can be store in the form of cyanophycine [58] and volutin, respectively [59]. PHAs constitute

a b a b


29

an ideal carbon and energy storage material due to their low solubility and high molecular

weight. When polymerized, such compounds apply negligible osmotic pressure to the bacterial

cell. For many bacteria PHA polymer, once accumulated, acts also as a storage reducing-power

[60, 61].

Short-chain-length polyhydroxyalkanoates (scl-PHAs)

Poly(3-hydroxybutyrate)

Biosynthesis of PHAs was intensively studied in the past decades. This applies especially for

the scl-PHA poly(3-hydroxybutyrate) (P3HB), which is the most common type of PHAs found

in bacteria. Three genes, phaC, phaA and phaB, encode the essential enzymes for P3HB

accumulation in Ralstonia eutropha (Fig.1.7). They are organized in an operon named phaCAB.

These genes encode a PHA synthase (phaC), a β-ketothiolase (phaA) and a NADP-dependent

acetoacetyl-CoA reductase (phaB) [62, 63]. PHA synthase polymerizes (R)-3-hydroxyacyl-

coenzyme A (RHA-CoAs) into PHA with the concomitant release of coenzyme A. This is the

key step for PHA biosynthesis.

Figure 1.7: Pathway for P3HB biosynthesis in R. eutropha.

Acetyl-CoA

Acetoacetyl-CoA

(R)-3-hydroxybutyryl-CoA

P3HB

phaA

phaB

phaC


30

Poly(4-hydroxybutyrate)

One of the most promising scl-PHAs for medical applications is poly(4-hydroxybutyrate)

(P4HB) due to its FDA approval as suture. Hein and coworkers reported that the introduction

of the plasmid pKSSE5.3 carrying PHA synthase gene (phaC) from Ralstonia eutropha and a

4-hydroxybutyric acid-coenzyme A transferase gene (orfZ) from Clostridium kluyveri enabled

E. coli strains to produce P4HB when 4HB was supplied in the culture medium as a precursor

[64] (Fig. 1.8).

Figure 1.8: P4HB metabolic pathway in recombinant E. coli. OrfZ: 4-hydroxybutyric acid CoA

transferase; PhaC: PHA synthase.

First, OrfZ catalyzes a coenzyme A transferase reaction from 4HB to 4HB-CoA using free

coenzyme A or acetyl-CoA as donor [64]. Then, the PhaC polymerizes 4HB-CoA into P4HB

with the concomitant release of CoA (Fig. 1.8). The product is P4HB homopolyester.

OrfZ

PhaC

SH-CoA

SH-CoA

4HB

4HB-CoA

P4HB

n


31

Based on the initial study of Hein and coworkers in 1997, four studies were published that

reported on the increase P4HB homopolymer accumulation, and an increase in productivity and

an elucidation its metabolic pathway [64-67]. In these papers, the production of P4HB in

recombinant E. coli was investigated using glucose as growth substrate and Na-4HB as

precursor [64, 65]. Song and coworkers succeeded in producing 4.4 g L-1 P4HB using

recombinant E. coli XL1-Blue (pKSSE5.3) under fed-batch conditions with glucose as growth

carbon substrate and Na-4HB as precursor. A recent study reported the accumulation of P4HB

using only glucose as carbon substrate in fed-batch cultivation. An engineered E. coli was

obtained by inactivation of genes encoding succinate semialdehyde dehydrogenase, sad and

gabD, and by expressing the PHA binding proteins as well as the PHB synthase genes from R.

eutropha, allowing a P4HB production of 7.8 g L-1 [67]. In chapter 5 of this thesis, we obtained

15 g L-1 of P4HB from glycerol and stimulated by acetate with Na-4HB precursor [68].

Medium-chain-length polyhydroxyalkanoates (mcl-PHAs)

β-oxidation and de novo fatty acid biosynthesis pathways (see Figure 1.9) generate many

intermediates which are activated by coenzyme A or acyl carrier protein (ACP). These

metabolites are possible precursors for PHA biosynthesis because they can easily be converted

into RHA-CoAs. Biosynthesis of these thioesters can be performed via two different metabolic

routes in Pseudomonas putida [69].

When fatty acids are used as carbon source, the main pathway is the β-oxidation allowing a

biosynthesis of structurally related mcl-PHAs (Fig. 1.9). Fatty acid de novo biosynthesis is the

main route when P. putida is growing on carbon sources like gluconate, acetate, or ethanol

allowing accumulation of the structurally non-related carbon source as mcl-PHAs (Fig. 1.9).

Different enzymes generate RHA-CoAs from intermediates of metabolic pathways such as the

PhaA and the 3-ketoacyl-coenzyme A reductase (FabG) [62]. The wide substrate specificity of


32

PhaC allows incorporating various monomers. However, occasionally the substrate specificity

of the PhaC had to be modified using site-specific mutagenesis to produce, for example, scl-

mcl PHA copolymer in a recombinant E. coli strain [70].


33

Figure 1.9: Pathways for mcl-PHA synthesis. Synthesis of mcl-PHA in P. putida can be accomplished either through the use of intermediates of the fatty

acid β-oxidation cycle (left) or of the de novo fatty acid biosynthetic pathway (right).

Acetyl-CoA

Mcl-PHA

Malonyl-ACP

R-3-Hydroxyacyl-CoA

CO2

+

ACP

Acyl-

CoA

S-3-

Hydroxyacyl

-CoA

3-Ketoacyl-

CoA

Trans-2-

enoyl-CoA

acyl-CoA

dehydrogenase

Alkanoic

acid

Fatty acid

acetoacetyl-CoA

reductase

S-3-hydroxyacyl-CoA

dehydrogenase

3-ketoacyl-

CoA thiolase

epimerase

Trans-2-enoyl-

ACP

3-ketoacyl-CoA

reductase

acyl-CoA synthetase

3-Ketoacyl-ACP

Acyl-ACP

R-3-hydroxyacyl-

ACP dehydratase

2-enoyl-ACP

reductase 3-ketoacyl-ACP synthase

3-ketoacyl-ACP

reductase R-3-

Hydroxyacyl

-ACP

3-hydroxyacyl-ACP-

CoA transacylase PHA synthase

Fatty acid

β-oxidation

Fatty acid

de novo

synthesis

Acetyl-CoA Malonyl-

CoA

Carbohydrate

s

ACP-SH

CoA-SH

malonyl-CoA-ACP

transacylase


34

Mcl-PHA accumulation from fatty acids in Pseudomonas putida

During growth of P. putida on fatty acids, PHAs biosynthesis is directly related to the carbon

source supplied in the medium as the products of the cyclic β-oxidation pathway are

incorporated into PHA polymer chain [23] (Fig. 1.9). After activation of a fatty acid by ATP

via the acyl-CoA synthase, it goes through a series of enzymatic reactions which produce after

each cycle an acetyl-CoA, decreasing the number of carbon atoms of the fatty acid by two [71].

For example, during growth on decanoic acid, P. putida accumulates PHA containing 3-

hydroxydecanoates, 3-hydroxyoctanoates and 3-hydroxyhexanoates monomers [23]. In dual

(i.e. carbon and nitrogen) limited fed-batch cultures of P. putida KT2442, co-feeding of two

different fatty acids led to the biosynthesis of mcl-PHA copolymer containing a similar ratio of

the corresponding fatty acid monomers, which suggested that both substrates were consumed

at similar rates [72]. The cellular content of mcl-PHAs can be enhanced using engineered

bacterial strains that have knocked out fadAB (3-ketoacyl-CoA thiolase and 3-hydroxyacyl-

CoA dehydrogenase) (Fig. 1.9), leading to an increased precursor pool for the polymerase [73].

Further knockouts of β-oxidation genes led to biosynthesis of PHA homopolymers [74].

Mcl-PHA accumulation from other carbon sources in Pseudomonas putida

Accumulation of PHAs during growth on carbon sources structurally not related to mcl fatty

acids such as glucose, acetate, and ethanol, proceeds through acetyl-CoA and fatty acid de novo

biosynthesis. In contrast to the β-oxidation pathway which shortens the fatty acyl substrates by

two carbon atoms, the fatty acid de novo biosynthesis builds up fatty acids by incorporating

malonyl-CoA per cycle via acyl carrier protein (ACP). The key enzyme linking fatty acid de

novo synthesis and β-oxidation for the accumulation of mcl-PHAs from unrelated carbon

sources is PhaG (3-hydroxy-acyl carrier protein (ACP)-CoA transacylase). As an exception, P.


35

putida GPo1 is not able to produce mcl-PHAs from unrelated carbon source due to a cryptic

PhaG [75].

Regulation of PHA biosynthesis

PHA synthesis is regulated at the enzymatic level. The intracellular concentrations of acetyl-

CoA and free coenzyme A play a central role in the regulation of polymer synthesis. P3HB

synthesis is regulated by both high intracellular concentrations of NAD(P)H and high ratios of

NAD(P)H/NAD(P) [76]. Different enzymes are involved in PHA degradation such as PHA

depolymerase, dimer hydrolase, 3-hydroxybutyrate dehydrogenase [77]. In case of P. putida,

PhaC activity was found to be sensitive to the ratio of [R-3- hydroxyacyl-CoA]/[CoA)] in which

free CoA was a mild competitive inhibitor [78].

Reducing costs of PHA production

Sources of carbon

PHAs can be synthesized from sugars [79], free fatty acids [80], alkanes and alkanols [81],

triacylglycerols [82] but also from CO2 [83]. As mentioned above, the type of carbon source

supplied in the growth medium affects the nature of PHAs as well as productivity and

production cost. Much effort has been put into the search for inexpensive carbon substrates

because the latter contribute up to 50% of the total PHA production cost [84].

Low-cost carbon sources: an overview

In most large-scale PHA production studies, sugars such as glucose, gluconate, sucrose and

fructose were employed as carbon sources. The first report published in 1987 described growth

of Cupriavidus necator (earlier Ralstonia eutropha) on fructose to produce P3HB at an

industrial scale. Later on, Aeromonas hydrophila 4AKA was cultivated on glucose in a 20,000


36

L bioreactor to produce a copolymer of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) [85].

However, the high cost of these sugars makes the production of PHAs too expensive compared

to conventional plastics. In comparison to carbohydrates, fatty acids are energetically

advantageous substrates because more energy is delivered in form of ATP per mole of fatty

acid [86]. In order to decrease the substrate cost, utilization of plant oils has been investigated

to produce PHAs. A broad range of vegetable oils from coconut, corn, olive, palm, soybean,

palm kernel was found to be feasible for biosynthesis of scl-PHAs [86].

As mentioned above, the carbon substrate cost represents up to approximately 50% of the PHA

production cost [86, 87], therefore, utilization of low-price substrates can decrease the

production cost. A report from Lee and coworkers summarized the effect of substrate cost and

production yield on the P3HB production cost [87]. Table 1.3 demonstrate that for the same

production yield, the final product P3HB can be seven times more expensive depending on the

substrate used. Historically, fatty acids were the preferred substrates for mcl-PHA production.

Recently, the use of waste streams or by-products from industries as fermentative carbon

substrates has generated real interest. Consequently, other sources were investigated to

synthesize mcl-PHAs such as a combination of soybean oil-based biodiesel and pure glycerol.

Soy molasses was also tested to produce mcl-PHAs but only low productivities was achieved

[88, 89].


37

Table 1.3: Effect of substrate cost and P3HB yield on the P3HB production cost (from [87]).

Substrate Substrate cost (US

$ kg-1)

Yield (g P3HB g

substrate -1)

Product cost (US $

kg-1 P3HB)

Glucose 0.493 0.38 1.35

Sucrose 0.295 0.40 0.72

Methanol 0.180 0.43 0.42

Acetic acid 0.595 0.38 1.56

Ethanol 0.502 0.50 1.00

Cane molasse 0.220 0.42 0.52

Cheese whey 0.071 0.33 0.22

Hydrolyzed corn starch 0.220 0.185 0.58

Hemicellulose hydrolysate 0.069 0.20 0.34

The use of cheese whey, xylose, molasses, bagasse, starch hydrolysate which are inexpensive

and renewable carbon substrates, has been investigated for the production of P3HB. According

to Table 1.3, cheese whey and hemicellulose hydrolysates represent the least expensive

carbonaceous compounds for bacterial biopolymer production even when compared to very

cheap substrates like methanol. Comparing the benefit generated by the utilization of

hemicellulose hydrolysate instead of glucose, the P3HB production cost decreases by four,

although the conversion yield is lower for hemicellulose hydrolysate (Table 1.3). A maximum

P3HB yield of 25 g L-1 was reached using Bacillus sp. JMa5 growing in medium containing

sugar cane molasses and sucrose, making the process economically feasible [86].

Hemicellulose hydrolysate as a carbon source

Annually, 60 billion tons of hemicelluloses accumulate and remain mostly unused [90].

Hemicellulose is the third most abundant polymer in nature and can be hydrolyzed into

fermentable sugars by either chemical or enzymatic hydrolysis [91]. The dominant building

block of hemicelluloses is xylose. In some plants, xylose comprises up to 40% of the total dry


38

plant material. Xylose is an industrially relevant carbon source for bacterial growth [92]. P3HB

was synthesized from xylose in Pseudomonas pseudoflava or Pseudomonas cepacia up to 22%

(w w-1) and 50% (w w-1), respectively [93-95]. In other studies, P3HB polymer was

accumulated up to 74% (w w-1) from xylose into E. coli harboring the PHA biosynthesis genes

of Ralstonia eutropha with a yield of 0.23 g PHB per g xylose [96]. Usually, P. putida is not

able to utilize xlose as growth substrate. But, it has been shown by Meijnen and cowokers that

an engineered strain of P. putida S12 can utilize D-xylose and L-arabinose by introducing xylA

(encoding xylose isomerase) and xylB (encoding xylulokinase) from E. coli, but PHA

accumulation was not studied [97]. This is why we investigated the production of mcl-PHAs

from xylose by P. putida in the chapter 2 [98].

Glycerol as carbon source

A particularly interesting carbohydrate for cultivating microbial cells is glycerol. It is a waste

byproduct in the biodiesel industry which is expanding very fast, reaching 22.5 billion liters per

year with growth rate of 17% between the end of 2007 and 2012 [99-101]. Glycerol-rich-phase

(GRP) from biodiesel industries has a low value due to the presence of impurities (such as

methanol, salts, mono- and di-glycerides and fatty acids). Nevertheless, it has a high potential

to be converted into a wide variety of value-added products [102]. Recently, glycerol has been

proposed for microbial bulk products such as 1,3-propanediol, dihydroxyacetone, ethanol,

succinate, propionate [103]. In E. coli, glycerol uptake occurs by facilitated diffusion across the

inner membrane via an integral membrane protein, the glycerol facilitator GlpF [104-106]. The

ability to metabolize glycerol via both oxidative and reductive pathways under anaerobic

conditions is a feature of many microbial strains including Klebsiella, Citrobacter, Clostridium

and Enterobacter [103].


39

With respect to bioplastics the production of copolymers and terpolymers, respectively P(3HB-

co-4HB) and P(3HB-co-4HB-co-3HV), was reported recently using high-cell density fed-batch

cultures of Cupriavidus necator DSM 545 grown on waste glycerol (GRP) [107]. Recently,

mcl-PHA production was shown to be increased nearly two fold when the GlpR protein

(glycerol regulator) is knocked out [108].

Fermentation processes

Microorganisms can be basically grown using three different cultivation modes for PHA

production: batch, fed-batch or continuous culture. According to the objectives, one of these

fermentation systems will be chosen.

Batch process

Batch fermentation is an old process used to produce wine, beer, whiskey, pickles, or sauerkraut

and it is still the standard of most industrial bioprocesses. Batch cultivation is the simplest

process which is characterized by a constant culture volume. All necessary medium components

and the inoculum are added at the beginning of the cultivation period. The concentrations of

substrates and products are not controlled and therefore vary as the process proceeds. The

biomass concentration increases exponentially during unrestricted growth and levels off when

one of the nutrients becomes limiting. This process normally does not lead to significant

accumulation of mutations because of the low number of generations in batch cultivation cycle.

Furthermore, the contamination risk is small because few manipulations are necessary.

However, inhibitory or even toxic effects can occur due to high initial substrate concentration

or accumulation of toxic products. Moreover, many times only low cell densities are obtained

using this technique and oxygen limitation can prevent the exponential growth. This technically

simple method is usually used to produce small amounts of PHAs and to perform preliminary

studies.


40

Fed-batch process

To overcome substrate inhibition, nutrients can be supplemented into the cultivation medium

during the process; in this case the process is called fed-batch (Fig. 1.10). This process is widely

used in industry, and it is characterized by an increasing biomass over time. It starts as a normal

batch with a small volume and then concentrated fresh medium is supplemented at a specific

feeding rate to keep the cells in the required physiological state. This process is very useful to

avoid initial substrate inhibition because the feeding rate can be adjusted by pulse, linear or

exponential feeding to fit to the substrate consumption rate of the culture. In this way, the

productivity is higher than for a batch because higher cell density can be reached. Fed-batch

processes have been used to produce biopolymers at a large scale. For instance, mcl-PHAs were

synthetized using P. putida GPo1 which resulted in a final cell dry weight (CDW) of 53 g L-1

containing about 55% (w w-1) of poly(3-hydroxyoctanoate) (PHO) in a 400 L bioreactor [109].

Figure 1.10 illustrates bioreactors used for fed-batch culture.


41

Figure 1.10: Parallel Multifors benchtop bioreactors (Infors AG, Bottmingen, CH) used for fed-

batch cultivations (pulse feeding) of P. putida KT2440 (pSLM1). (Picture S. Le Meur)

Chemostat process

For investigating physiological question of PHA accumulation, the chemostat, a special type of

continuous cultivation, is the only method that allows to study microbial growth under defined

conditions for a prolonged period of time [110]. Continuous cultivation is characterized by a

constant volume, where fresh medium is supplemented at a constant flow rate and an equivalent

volume of spent medium is concomitantly removed. The system can reach a steady state

(chemostat conditions) in which concentrations of all nutrients and biomass remain constant.

This process provides controlled and reproducible conditions and allows variation of one

parameter at a time so that cause-and-effect relationships can be established. However, it is

rarely used in industry because of the difficulty of maintaining the culture uncontaminated, the

potential selection of mutants and plasmid loss during long cultivation period. Loss of substrate


42

by the outflow is inevitable which can lead to a lower product yield. Therefore, this cultivation

method is less profitable and secure for industrial PHA production than fed-batch processes.

Studies of mcl-PHA accumulation in chemostat cultures were previously described in number

of reports [111-114]. PHA production cost is also linked to productivity, i.e. the ability of a

strain to both grow fast and to convert the carbon source efficiently into product [115]. The

downstream processing seems to represent a smaller part of the total production cost which

explains why much efforts were devoted to reach higher productivity using different

fermentation systems [115] and low-cost substrate [86].

PHA applications

Initially, main applications of PHAs were considered to be in the packaging field as everyday

consumables to produce shopping bags, paper coatings and disposable items [116]. In 1990,

Wella AG sold shampoo bottles made of copolymers of 3HB and 3HV (PHBV), named

Biopol®. Over the last decades, the production of PHAs with different chemical structures

supplied us with polymers of various mechanical properties. This open the way to many more

different applications. Many medical devices were developed using PHA materials, which is

not surprising considering the favorable mechanical properties, biocompatibility and its

biodegradability. With their low crystallinity, mcl-PHAs have interesting potential as coatings

and as medical implants including scaffolds or artificial organ constructions in tissue

engineering, implantable drug carriers as well as nutritional and therapeutic composites that

exhibit a defined degradation rate [34, 117]. Furthermore, some PHA monomers and oligomers

were reported to stimulate cell proliferation [118, 119]. Due to their chirality, PHA monomers

can be also used as starting chemicals (synthons) for chemical reactions [120]. Moreover, new

mechanical properties can be obtained by blending PHA with others polymers [34].


43

P4HB is biocompatible and extremely well tolerated in vivo given that the P4HB hydrolysis

yields 4HB which is a common metabolite in the human body [38]. Not surprisingly, the first

and only PHA-based product approved by the FDA in 2007 for clinical application is an

absorbable suture from P4HB (TephaFLEX®) [53]. P4HB is a strong, biodegradable and

flexible material (Fig. 1.11) which is used also for a variety of other medical applications like

engineered issues and drug delivery systems [53].

Figure 1.11: Purified P4HB homopolymer from E. coli JM109 (pKSSE5.3) grown on xylose. (Picture S. Le Meur)

The monomer of P4HB was initially used as an intravenous anesthetic agent in Europe and

Japan because it can cross the blood and brain barrier rapidly to produce a sedative effect or to

induce a form of anesthesia with cardiovascular stability [121, 122]. In 2000, therapeutical

utilization of P4HB oligomers and 4HB monomers was patented by Williams and coworkers to

treat neuropharmacological illnesses like narcolepsy, schizophrenia and psychoses [123]. The

oligomers and monomers may be used to produce absence seizures. 4HB is an illegal drug in

many countries and known as “date rape drug” [124]. 4HB causes rapid unconsciousness at

doses above 3500 mg and with a single dose over 7000 mg often causes life-threatening

respiratory depression. Higher doses induce bradycardia and cardiac arrest [125]. However,

http://en.wikipedia.org/wiki/Illegal_drug

http://en.wikipedia.org/wiki/Date_rape_drug

http://en.wikipedia.org/wiki/Respiratory_depression

http://en.wikipedia.org/wiki/Bradycardia

http://en.wikipedia.org/wiki/Cardiac_arrest


44

lower concentrations of P4HB monomers are not be hazardous and showed some therapeutical

or nutritional benefits [126].

Taking advantage of its FDA approval, many medical applications of P4HB can be considered.

P4HB-based devices are tested in many diverse clinical applications including wound

management, tendon and ligament repair, hernia repair, and plastic and reconstructive surgery

in animal models, mainly in pigs [127]. In cardiovascular research, a tissue engineering tri-

leaflet heart valve was produced based on a PGA/P4HB composite scaffold. This engineered

tissue showed morphological features and mechanical properties of human native-heart-valve

tissue [128]. P4HB can also be used as patch material in the pulmonary circulation and after

169 days, a near-complete resorption of the biopolyester and formation of organized and

functional tissue was observed in ovine pulmonary artery [96].

To date, P4HB has both a high value and a large market potential amounting to several hundred

kilograms annually for sutures only. The current tissue engineering and regenerative medicine

global market, which represents only a fraction of the potential P4HB market, is estimated to

be about $1.5 billion and was projected to grow with a 16.2% compound annual growth rate

[129].

Aim and scope of this thesis

In this thesis, we aim to use xylose or glycerol instead of common carbohydrates such as glucose

as carbon source for growth by P. putida KT2440 (pSLM1) or E. coli JM109 (pKSSE5.3) in

combination with PHA precursors to reduce the total production cost of mcl-PHAs or P4HB,

respectively. In chapter 2, utilization of xylose as a growth carbon source in the controlled

production of mcl-PHA by recombinant P. putida KT2440 was examined. P. putida KT2440,


45

which is one of the best-characterized pseudomonads for good mcl-PHA production [130] [30]

unfortunately, cannot metabolize xylose. Therefore, the xylAB genes from E. coli W3110 were

cloned into P. putida KT2440 and the obtained recombinant was studied for its ability to grow

on xylose. Since no mcl-PHA was accumulated from xylose only, we achieved mcl-PHA

production by the addition of fatty acids. For tailor-made mcl-PHA production, a sequential

feeding strategy was applied using xylose as the growth substrate and octanoic acid as the

precursor.

Since scl-PHAs offer different material properties compared to mcl-PHAs, it is interesting to

employ xylose as growth carbon substrate to produce high added value scl-PHAs such as P4HB.

To be able to manipulate the expression of P4HB biosynthesis genes and to control

accumulation of P4HB in E. coli we constructed a numbers of inducible vectors (chapter 3).

These plasmids were constructed using an inducible pET22b vector for expression of phaC

gene from R. eutropha and orfZ gene from C. kluyveri. The three plasmids constructed through

classical DNA manipulations, containing phaC and orfZ genes with or without their respective

promoter regions, were transformed in E. coli strains. The mutants were tested in various

growth studies for their ability to produce P4HB after induction of phaC and orfZ expression.

To decrease the production cost of P4HB it was also fundamental to understand the P4HB

biosynthesis in recombinant E. coli in order to improve the key steps as well as the recombinant

host. In chapter 4, different E. coli strains were transformed with the pKSSE5.3 plasmid and

P4HB accumulations and cell growths were compared to identify the best recombinant host.

The effect of growth conditions in batch culture was studied for the following parameters:

cultivation temperature, concentration of the xylose as carbon source for growth and the

concentration of the precursor Na-4HB. Furthermore, the best physiological stage at which Na-

4HB precursor should be added was investigated. P4HB synthesis was found to be separated


46

from the cell growth, i.e. P4HB synthesis mainly took place after the end of the exponential

growth phase.

The P4HB bioprocess was further optimized in high cell density cultivations of recombinant E.

coli and results are reported in chapter 5. In this study, we analyzed the impact of different

nutrient limitations and the utilization of acetate as a stimulator to enhance P4HB accumulation

in recombinant E. coli. We observed that P4HB biosynthesis was correlated to amino acid

limitation (supplied as NZ-amines) and not to nitrogen depletion, as it is the case for many other

types of PHAs. Furthermore, it was found that addition of acetic acid at the beginning of batch

culture stimulated the P4HB accumulation in recombinant E. coli JM109 (pKSSE5.3) when

cultivated in glycerol but not on xylose. High cell density culture using glycerol was performed

to reach high P4HB productivity. Various feeding modes were investigated to reach the

maximum P4HB yield.

Chapter 6 describes the effect of molecular weight on the material properties of the

biosynthesized P4HB, in particular the crystallinity and the tensile mechanical properties. Acid-

catalyzed hydrolysis method was found to be a way to produce low molecular weight P4HB

with easier processability but with still good thermal and mechanical properties suitable for

biomedical applications.

This thesis ends with the chapter 7 where a general conclusion of the obtained results, the

encountered difficulties and the relevant findings are discussed. Then, possible routes for

further research to improve PHA production in a sustainable way are discussed and proposed.

Chapter 2

Production of medium-chain-length

polyhydroxyalkanoates by sequential feeding xylose

and octanoic acid in engineered Pseudomonas putida

KT2440

Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q.

BMC Biotechnology 2012, 12:53

doi:10.1186/1472-6750-12-53

Chapter 2: Production of mcl-PHAs using xylose

48

Abstract

Pseudomonas putida KT2440 is able to synthesize large amounts of medium-chain-length

polyhydroxyalkanoates (mcl-PHAs). To reduce the substrate cost, which represents nearly

50% of the total PHA production cost, xylose, a hemicellulose derivative, was tested as the

growth carbon source in an engineered P. putida KT2440 strain.

The genes encoding xylose isomerase (XylA) and xylulokinase (XylB) from Escherichia coli

W3110 were introduced into P. putida KT2440. The recombinant KT2440 exhibited a XylA

activity of 1.47 U mg-1 and a XylB activity of 0.97 U mg-1 when grown on a defined medium

supplemented with xylose. The cells reached a maximum specific growth rate of 0.24 h-1 and

a final cell dry weight (CDW) of 2.5 g L-1 with a maximal yield of 0.41 g CDW g-1 xylose.

Since no mcl-PHA was accumulated from xylose, mcl-PHA production can be controlled by

the addition of fatty acids leading to tailor-made PHA compositions. A sequential feeding

strategy was applied using xylose as the growth substrate and octanoic acid as the precursor

for mcl-PHA production. In this way, up to 20% w w-1 of mcl-PHA was obtained. A yield of

0.37 g mcl-PHA per g octanoic acid was achieved under the employed conditions.

Sequential feeding of relatively cheap carbohydrates and expensive fatty acids is a practical

way to achieve more cost-effective mcl-PHA production. This study is the first reported

attempt to produce mcl-PHA by using xylose as the growth substrate. Further process

optimizations to achieve higher cell density and higher productivity of mcl-PHA should be

investigated. These scientific exercises will undoubtedly contribute to the economic feasibility

of mcl-PHA production from renewable feedstock.

Keywords: mcl-PHA; xylose; octanoic acid; Pseudomonas putida KT2440; sequential-

feeding; tailor-made PHA.


49

Background

Polyhydroxyalkanoates (PHAs) are bacterial storage compounds produced widely by many

microorganisms under nutrient limited growth conditions such as a nitrogen, phosphorous or

oxygen starvation and when an excess of carbon source is present [19, 131]. PHAs gained

particular interest because they were shown to be biodegradable and biocompatible (see review

by [132]). Based on the chain length of the fatty acid monomers, PHAs can be classified into

three categories: short-chain-length (scl) PHAs with 3 to 5 carbon atoms, medium-chain-length

(mcl) PHAs with 6 to 14 carbon atoms and long-chain-length (lcl) PHAs with more than 14

carbon atoms [22]. The difference in length and/or chemical structure of the alkyl side chain of

the PHAs influences the material properties of the polymers to a great extent [29]. The

production of tailor-made mcl-PHAs enables to obtain the wanted material properties using the

appropriate fatty acid precursor. PHAs have been considered as an attractive ecofriendly

alternative to petrochemical polymers. However, the much higher production cost compared

with conventional petrochemical derived polymers has limited their widespread use.

Much effort has been devoted to reduce the price of PHAs by developing better bacterial strains,

more efficient fermentation and/or more economical recovery processes [86, 128, 133-135]. It

has been shown that the cost of raw materials (mainly the carbon source) contributes most

significantly to the overall production cost of PHAs (up to 50% of the total production cost)

[84]. The use of two kinds of carbon sources can be an attractive approach to reduce cost: the

first carbon substrate is used for cell growth to obtain biomass, while the second one (which

may be more expensive) allows the synthesis of PHA. The substrate for bacterial growth should

be inexpensive and abundant. Xylose is second only to glucose in natural abundance [136].

Thus, it is a promising candidate substrate for inexpensive bacterial growth.


50

D-Xylose is the dominant building unit of the hemicelluloses in plants of all species of the

Gramineae. Hemicellulose, the third most abundant polymer in nature, can be easily hydrolyzed

into fermentable sugars by either chemical or enzymatic hydrolysis [91]. In some plants, xylan

comprises up to 40% of the total dry material. Annually, 60 billion tons of hemicelluloses are

produced and remain almost completely unused [90]. It has been reported that the hemicellulose

hydrolysate including xylose can be used by Candida blankii for efficient protein production.

There are also reports that poly(3-hydroxybutyrate) (PHB) could be synthesized from xylose in

Pseudomonas pseudoflava or P. cepacia up to 22% (w w -1) and 50% (w w -1), respectively [93-

95]. Furthermore, Escherichia coli harboring PHA synthesis genes of Ralstonia eutropha was

reported to be able to accumulate PHB from xylose up to 74% w w -1 with a yield of 0.226 g

PHB per g xylose [137].

Up to now, no report has been published on the production of mcl-PHA by using xylose. Since

mcl-PHAs offer different material properties compared to scl-PHAs, it would be interesting to

investigate whether mcl-PHAs can be obtained from xylose. Pseudomonas putida KT2440,

whose genome sequence is available (www.ncbi.nlm.nih.gov), is one of the best-characterized

pseudomonads for mcl-PHA production [71]. It is able to synthesize and accumulate large

amounts (up to 75% w w -1) of mcl-PHAs [30], but can only ferment a narrow range of sugars,

in which xylose is not included. It has been shown that an engineered strain of P. putida S12

can utilize D-xylose and L-arabinose [97]. Introducing xylA (encoding xylose isomerase) and

xylB (encoding xylulokinase) from E. coli into P. putida S12 enabled the latter to utilize xylose

as the sole carbon source.

In this study, the possibility of using xylose as a growth carbon source and octanoic acid as

mcl-PHA precusor in the controlled production of mcl-PHA by recombinant P. putida KT2440

was examined. The xylAB genes from E. coli W3110 were cloned into P. putida KT2440 and


51

the obtained recombinant was studied for its ability to grow on xylose. For mcl-PHA production

a sequential feeding strategy of using xylose and fatty acids was applied.

Methods

Bacterial strains and plasmids

Strains and plasmids used in this study are listed in Table 2.1.

Table 2.1. Strains and plasmids used in this study.

Strain or plasmid Revelant characteristics References

Strains

P. putida KT2440 Prototrophic, reference strain [138]

E. coli W3110 Wild-type, xylAB donor [139]

E. coli JM109

endA1, glnV44, gyrA96, thi-1, mcrB+, hsdR17 (rk–, mk

+), relA1,

supE44, [F' traD36 proAB+ lacIq lacZΔM15]

[140]

E. coli HB101

F-, hsdS20 (rB- mB

-) recA13, ara-14, proA2, lacY1, galK2, xyl-

5, mtl-1, rpsL20 (SmR).

[141]

Plasmids

RK600 Cmr, ColE1, oriV, RK2, mob+, tra+ [142]

pVLT33

Kmr, Ptac, MCS of pUCP18, hybrid broad-host-range

expression vector

[143]

pSLM1 xylA and xylB cloned into pVLT33 this study


52

Chemicals

All chemicals were purchased from Sigma-Aldrich (Buchs, Switzerland). The oligonucleotides

were purchased from Microsynth (Balgach, Switzerland). The restriction enzymes were

purchased from Fermentas GmbH (Nunningen, Switzerland) or New England Biolabs

(Allschwil, Switzerland).

Cloning, characterization and expression genes involved in xylose utilization

Construction of pSLM1

The chromosomal DNA of E. coli W3110 was extracted and used as the template for cloning

of xylAB (GenEluteTM, bacterial Genomic DNA kit, Sigma-Aldrich). The fragment containing

both xylA and xylB was amplified using the following primers: PFXylA (5’

CCGAATTCTGGAGTTCAATATG 3’) and PRXylB (5’

GATAAGCTTTACGCCATTAATG 3’). The amplified fragment was purified from agarose

gel (GenEluteTM, Gel Extraction kit, Sigma Aldrich) and further digested with EcoRI and

HindIII restriction enzymes. This digested fragment was ligated into the shuttle vector pVLT33

[143], which was cut with the same restriction enzymes. The ligation solution was transformed

into E. coli JM109 and the recombinants were selected on a Luria-Bertani broth agar plate with

50 µg mL-1 kanamycin, 1 mM bromo-chloro-indolyl-galactopyranoside (X-gal), and 1 mM

isopropyl β-D-1-thiogalactopyranoside (IPTG). The obtained plasmid (insert + vector) was

named pSLM1. The nucleotide sequence of xylAB was analyzed and confirmed by GATC

Biotech AG (Konstanz, Germany).

Introduction of pSLM1 into P. putida KT2440

The obtained plasmid pSLM1 was introduced into P. putida KT2440 by triparental mating

[141]. E. coli HB101 (RK600) was used as the helper strain. E. coli JM109 (pSLM1) was the

donor strain and P. putida KT2440 was the acceptor strain. The P. putida KT2440 recombinants


53

were selected on E2 medium containing 0.2% citrate and 50 µg mL-1 kanamycin [144]. In

analogy, the empty vector pVLT33 was also introduced into P. putida KT2440 as a control.

Growth conditions

E2 minimal medium supplemented with different carbon sources (xylose, glucose or octanoic

acid) was used throughout the whole study. This medium contains the following components:

NaNH4HPO4* 4H2O 3.5 g L-1, KH2PO4 3.7 g L-1, K2HPO4 7.5 g L-1, dissolved in water and 1

mL L-1 of microelements containing: MgSO4*7H2O 246.5 g L-1, and with 1 mL L-1 of trace

element dissolved in 1M HCl and containing: FeSO4*7H2O 2.78 g L-1, CaCl2*2H2O 1.47 g L-

1, MnCl2*4H2O 1.98 g L-1, CoCl2*6H2O 2.38 g L-1, CuCl2*2H2O 0.17 g L-1, ZnSO4*7H2O 0.29

g L-1. In some experiments, the nitrogen content of the E2 medium was reduced to 20%

(0.2NE2), and also especially indicated in the results section. If necessary, 25 µg mL-1

kanamycin was added to the culture medium. The medium was theoretically nitrogen-limited

up to 2.06 g CDW L-1 for medium E2 used in the 3.7 L reactor and up to 0.41 g CDW L-1 in the

1 L minireactors for the medium 0.2NE2 , assuming a carbon yield of 1.0 g g-1 and a nitrogen

yield of 8.75 g g-1 [110].

Growth in shake flasks

The recombinant P. putida KT2440 (pSLM1) was pre-cultured in 100 mL of E2 medium

containing 10 g L-1 xylose and 25 µg mL-1 kanamycin. The preculture in the exponential growth

phase was then transferred to fresh E2 medium containing xylose and kanamycin. This transfer

was repeated twice to allow cells to adapt to xylose. P. putida KT2440 (pVLT33) was used as

control. The P. putida cells were grown at 30°C with an agitation of 150 rpm in 1 L baffled

shake flasks.


54

E. coli cells were grown at 37°C in either LB medium or E2 medium containing xylose as the

sole carbon source. Samples were taken and stored at -20°C as indicated in the Results section

for the determination of xylose isomerase and xylulokinase activities.

Batch culture in 3.7 L reactor

The bioreactor study was carried out in a 3.7 L laboratory bioreactor (KLF 2000,

Bioengineering, Wald, Switzerland) with a working volume of 2 L. Medium E2 supplemented

with 10 g L-1 xylose as the sole carbon source was used. The batch bioreactor was inoculated

with 300 mL of preculture having an OD600 of 2.10 and containing exactly the same medium

as the one present in the bioreactor. The agitation was set at 750 rpm. The temperature was

controlled at 30°C and the pH was maintained at 7.0 by automated addition of 4 M KOH or 2

M H2SO4. The dissolved oxygen tension was monitored continuously with an oxygen probe

and care was taken that it remained above 20% of air saturation (with a flow of 1 v v -1 min-1).

Batch culture in 1 L mini-reactors

In order to obtain a nitrogen-limited growth condition more rapidly, 0.2NE2 medium was used

in the following experiments. Four mini-reactor cultures (A, B, C and D) were grown in parallel

in Multifors-Multiple benchtop bioreactors (Infors AG, Bottmingen, Switzerland). Temperature

was controlled at 30°C and pH was maintained at 7.0 by automated addition of 4 M KOH or 2

M H2SO4. The dissolved oxygen tension was monitored continuously with an oxygen probe

and kept at 30% of air saturation. Each reactor was inoculated using the pre-culture which was

prepared as described above in the section “Growth in shake flasks”. The initial OD600 in

bioreactors was about 0.08. Kanamycin was added to a final concentration of 25 µg mL-1 when

a recombinant strain was cultivated. Octanoic acid with different concentrations was fed to the

bioreactors at different growth stages of the batches, as described in the Results section.


55

Enzymatic assays

The cell pellets from batch culture were washed twice with 250 mM Tris-HCl buffer pH 7.5,

and then lysed by the addition of lysis solution according to the manufacture’s instruction

(CellLytic TM B Cell Lysis Reagent, Sigma-Aldrich, St. Louis, MO, USA). The samples were

centrifuged at 20’000 g for 3 min in an Eppendorf centrifuge. The supernatant is referred as

cell-free extract (CFE).

Xylose isomerase (EC 5.3.1.5) was measured in a solution containing 0.2 mM NADH, 50 mM

xylose, 10 mM MgSO4, 0.5 U sorbitol dehydrogenase, and 30 μL CFE as it has been described

previously [145]. The assay was performed in a 96-well plate at 30°C. The total volume of the

assay was 200 µL. The consumption of NADH was measured spectrophotometrically at 340

nm using a plate reader (Bioteck Instruments GmbH, Luzern, Switzerland). One unit is defined

as 1 µmole of consumed NADH min-1 mg of total protein -1.

Xylulokinase (EC 2.7.1.17) was assayed as described previously [146]. The assay mixture

contained 0.2 mM NADH, 50 mM Tris-HCl (pH 7.5), 2 mM MgCl2, 2 mM ATP, 0.2 mM

phosphoenolpyruvate, 8.5 mM xylulose, 2.5 U pyruvate kinase, 2.5 U lactate dehydrogenase

and 30 μL CFE. The assay was performed at 30°C. The total volume was 200 µL in each well

of the 96-well plate. The consumption of NADH was measured spectrophotometrically at 340

nm (Bioteck Instruments GmbH, Luzern, Switzerland). One unit is defined as 1 µmole of

consumed NADH min-1 mg of total protein -1.

Analytical methods

Cell growth

Growth of bacterial cells was followed by measuring the optical density at 600 nm (OD600)

using a UV-visible spectrophotometer (Genesys 6, ThermoSpectronic, Lausanne, Switzerland).


56

Cell dry weight was determined using pre-weighed polycarbonate filters (pore size: 0.2 µm,

Whatman, Scheicher & Schuell, Dassel, Germany). An appropriate volume (0.5 to 5 mL) of

culture was filtered in order to obtain a biomass weight of about 2 mg per filter. The filter was

dried overnight at 105°C, cooled down to room temperature in a desiccator and then weighted.

The weight difference was used to determine the quantity of biomass per culture volume.

Measurement of carbon sources

The consumption of carbon sources was measured by HPLC-MS. Samples were diluted

between 0.01 and 0.1 mM with 50% acetic acid 50% acetonitrile (v v-1) and loaded on a reversed

phase C18 column (Gemini C18 5 micron, 250 mm x 4.60 mm, Phenomenex, U.K.). A gradient

of 100% diluted formic acid (0.1 v% in water) to 100% acetonitrile was applied as the mobile

phase. The flow rate was 0.8 mL min-1 and the gradient was completed after 25 minutes. The

peaks were detected by electrospray ionization (ESI) in negative mode [147]. The standard

curves for xylose and octanoic acid were recorded in the range of 0.01 to 1 g L-1, and 0.005 g

L-1 to 0.03 g L-1, respectively.

Ammonium concentration

NH4+-nitrogen concentration was measured using an ammonium test kit following the

manufacturer instruction (Merck KGaA, 64271 Darmstadt, Germany). The detection limit was

0.01 NH4+-N mg L-1. The method was linear up to 3.0 mg N L-1, above which dilution with

distilled water was needed.

Acetic acid measurement

A DX-500 ion chromatography system (Dionex, Sunnyvale, CA, USA) was used to analyze the

acetic acid production during the co-feeding experiments. IonPac AS 11 HC (250 mm× 4 mm)

and AG 11 HC guard (50 mm× 4 mm) columns were used. A sodium hydroxide gradient of 0.5

to 30 mM allowed the identification and the quantification of this organic acid in 15 minutes.


57

PHA content

For analysis of intracellular PHA the culture broth was centrifuged (10,000 x g; 4°C; 15 min)

and the cell pellet was lyophilized for 48 hours. Pyrex vials were weighed to determine the

exact transferred biomass, then 2 ml of 15% v v-1 H2SO4 in methanol were added. Furthermore,

2 ml of methylene chloride containing 2-ethyl-2-hydroxybutyrate (10 g L-1) were added as

internal standard. The suspension was boiled at 100°C for 2.5 h in an oven. The samples were

cooled on ice; then 1 ml of distilled water was added in order to extract the cell debris that is

soluble in the aqueous phase. The sample was mixed by vortexing for 1 min. The complete

water phase was discarded (upper phase), including droplets hanging on the tube wall and

including the top layer of the methylene chloride phase. Na2SO4 powder was added to dry the

methylene chloride phase. Two hundred µL of the chloroform phase was filtered using solvent

resistant filters (PTFE, 0.45 µm) and transferred to a GC sample tube. PHA content and

monomer composition were subsequently analyzed on a GC (A200s, Trace GC 2000 series,

Fisons Instruments, Rodano, Italy) equipped with a polar fused silica capillary column

(Supelcowax-10: length 30 m; inside diameter 0.31 mm; film thickness 0.5 µm; Supelco, Buchs,

Switzerland).

Reproducibility

All measurements for growth and PHA assays were performed at least in duplicates. The

measurements for XylAB assays were performed in triplicates. The data presented in this report

are the average numbers.


58

Results

Cloning and expression of the xylA and xylB genes encoding xylose isomerase and

xylulokinase

To clone the xylAB genes, which are organized in an operon, of E. coli W3110, DNA primers

PFXylA1 and PRXylB were designed based on the genomic sequence of E. coli W3110

(GenBank number: AP009048) [148]. These primers were used to amplify the xylAB fragment

by PCR with W3110 chromosomal DNA as the template, leading to a 2.85 kb DNA product

(xylAB). The PCR product was inserted into the shuttle vector pVLT33 as described in Materials

and Methods, resulting in pSLM1 plasmid. P. putida KT2440 (pSLM1) was grown on E2

minimal medium with either 10 g L-1 xylose or glucose, leading to a C/N ratio of 17 g g -1. P.

putida KT2440 (pVLT33) was used as a control.

When grown on glucose, KT2440 (pVLT33) exhibited a higher specific growth rate (0.32 h-1)

than KT2440 (pSLM1) (0.26 h-1) (Fig. 2.1). The maximum OD600 reached by KT2440

(pVLT33) was also higher (4.28) than KT2440 (pSLM1) (2.94) (Fig. 2.1). When xylose was

used as the sole carbon source, KT2440 (pVLT33) was not able to grow during the entire test

period (25 h), whereas the recombinant KT2440 (pSLM1) exhibited a typical bacterial growth

curve (Fig. 2.1). The maximum specific growth rate of the IPTG-induced recombinant KT2440

(pSLM1) culture was similar to the culture without induction, of µ = 0.23 h-1 and µ = 0.21 h-1,

respectively (Fig. 2.1). This demonstrates that the expression of xylAB from pSLM1 is not

tightly regulated and xylAB can be expressed even without the induction by IPTG. The

recombinant KT2440 (pSLM1) reached a maximal OD600 of 3.66 on xylose. In all experiments

the carbon substrate (either glucose or xylose) was not totally consumed at the end of the

cultivation (26 h), around 4 g L-1 was left over in the culture broth.


59

Fig. 2.1: Growth in shake flasks of the P. putida KT2440 recombinants on E2 minimal medium

containing 10 g L-1 glucose or xylose as the sole carbon source. The arrow represents the

addition of IPTG. Data points are the averages of the results of duplicate measurements.

0

0,05

0,1

0,15

0,2

0,25

0

1

2

3

4

5

0 10 20 30

Nitro

gen (

g L

-1)

OD

600

Time (h)

KT2440 (pSLM1) on glucose Nitrogen

0

0,05

0,1

0,15

0,2

0,25

0

1

2

3

4

5

0 10 20 30

Nitro

gen (

g L

-1)

OD

600

Time (h)

KT2440 (pSLM1) on xylose Nitrogen

0

0,05

0,1

0,15

0,2

0,25

0

1

2

3

4

5

0 10 20 30

Nitro

gen (

g L

-1)

OD

600

Time (h)

KT2440 (pSLM1) on xylose +IPTG Nitrogen

0

0,05

0,1

0,15

0,2

0,25

0

1

2

3

4

5

0 10 20 30

Nitro

gen (

g L

-1)

OD

600

Time (h)

KT2440 (pVLT33) on glucose Nitrogen

0

0,05

0,1

0,15

0,2

0,25

0

1

2

3

4

5

0 10 20 30

Nitro

gen (

g L

-1)

OD

600

Time (h)

KT2440 (pVLT33) on xylose Nitrogen

A B

C D

E


60

These results suggest that the cloned xylAB from E. coli are functionally expressed in P. putida

KT2440, and xylAB alone are sufficient to allow the growth of KT2440 on xylose. To have

better controlled growth, further experiments were performed in bioreactors.

Growth of P. putida KT2440 (pSLM1) on xylose in the bioreactor

P. putida KT2440 (pSLM1) was grown on E2 medium with 10 g L-1 xylose in a 3.7 L laboratory

bioreactor. Figure 2.2 shows that the KT2440 (pSLM1) cells utilized xylose as the sole carbon

source with a maximum specific growth rate of 0.24 h-1.

Fig. 2.2. Growth of P. putida KT2440 (pSLM1) in E2 minimal medium with 10 g L-1 xylose in

a 3.7 L bioreactor. Data points are the averages of the results of duplicate measurements.

-6

-4

-2

0

2

4

6

8

10

12

-2

-1

0

1

2

3

4

0 5 10 15 20 25 30

Xylo

se (

g L

-1)

Ln O

D;

OD

600

; C

DW

(g L

-1);

Nit

ogen

x 1

0 (

g L

-1)

Time (h)

OD LN OD Nitrogen CDW Xylose


61

The growth stopped due to nitrogen limitation after 13 hours of cultivation. Afterwards the

biomass increased only slightly from 2.2 g L-1 to maximum 2.7 g L-1 at 28 h, which is in the

range of the theoretical values calculated in Materials and Methods. Even through nitrogen-

limitation was reached, xylose was further consumed and finally only a tiny amount (< 0.01g

L-1) was left in the medium (Fig. 2.2). The consumed xylose may have been used for cell

maintenance and/or by-products such as acetic acid. Indeed, large amounts of acetic acid were

detected from the beginning of the growth in the range of several hundred milligrams per liter.

The culture was also assayed for PHA content at different time points. Only trace amounts (<

1% w w-1) of PHA were detected using xylose as the sole carbon source, which enables to use

xylose as growth substrate for the production of tailor-made mcl-PHAs.

To confirm the enzymatic activities of XylA and XylB, cells were harvested at the early

exponential growth phase (OD600 of about 0.5). Samples without substrates and samples without

cell-free extracts were used as negative controls, while E. coli W3110 cells grown on E2 with

xylose were used as the positive control. The specific activities of xylose isomerase and

xylulokinase measured in P. putida KT2440 (pSLM1) were 1.47 U mg -1 and 0.97 U mg -1,

respectively, whereas no significant activities were observed in the negative controls (Table

2.2).

Table 2.2. Enzymatic activities of XylA and XylB in P. putida KT2440 (pSLM1).

Negative control Sample

No substrate No cells E. coli W3110 P. putida (pSLM1)

XylA act. (U) 0.07 0.33 1.79 1.47

XylB act. (U) 0.26 0.12 1.39 0.97

U: One unit is defined as 1 µmole of consumed NADH minute -1 mg of total protein -1.


62

The activities obtained here were in the same range as those found in wild-type E. coli W3110

(Table 2.2). These results confirmed that both XylA and XylB were active in P. putida KT2440.

The enzymatic activities of XylA and XylB were also found for the non-induced cultures, thus,

induction by IPTG is not needed for the expression of xylA and xylB genes and was therefore

omitted in the following experiments.

PHA production in KT2440 (pSLM1) by sequential-feeding of xylose and fatty acid

Nitrogen limitation is known to promote PHA accumulation [19]. It has been demonstrated that

nitrogen limitation can lead to a strong induction of phaG encoding a transacylase, resulting in

mcl-PHA accumulation from carbohydrates in P. putida KT2440 [149]. Thus, in the

experiments performed in mini-reactors the amount of nitrogen present in E2 medium was

decreased to 20% (namely 0.2NE2 medium) to obtain the best conditions for mcl-PHA

accumulation. As expected, KT2440 (pVLT33) did not show any growth on xylose (Table 2.3,

culture A), similar as observed in Fig. 2.1. KT2440 (pSLM1) exhibited a maximal specific

growth rate of 0.24 h-1 on xylose with a maximum OD600 of 0.99 (Table 2.3, culture B). No

PHA was detected for KT2440 (pSLM1) on xylose.


63

Table 3: PHA production in batch and fed-batch fermentations. The cells were grown in 0.2NE2 minimal media supplemented with different carbon

sources in 1 L bioreactors with a working volume of 800 mL. Samples were taken regularly to measure growth, nitrogen concentration, carbon source

present in the medium and PHA contents. Data points are the averages of duplicate measurements.

Entry Strains Fermentation

type

Carbon source

Feeding type

/ duration

Feeding

phase Flow

Total

amount of

fed C8

OD600 µ max (h-1

) PHA content

(% w w -1)

growth

substrate

PHA

precusor

A KT2440 (pVLT33) Batch xylose - - - - no growth 0 0

B KT2440 (pSLM1) Batch xylose - - - - 0.99 0.24 0.3

C KT2440 (pSLM1) Batch octanoic acid - - - - 10 mM 2.77 0.35 21.0

D KT2440 (pSLM1) Fed-Batch xylose octanoic acid linear/ 12 h mid exp. (1)

0.5 mM L-1

h-1

6 mM 1.48 0.24 12.1

E KT2440 (pSLM1) Fed-Batch xylose octanoic acid linear/ 8 h end exp. (2)

0.5 mM L-1

h-1

4 mM 1.52 0.25 16.2

F KT2440 (pSLM1) Fed-Batch xylose octanoic acid linear/ 4h end exp. (2)

2 mM L-1

h-1

8 mM 1.4 0.25 20

G KT2440 (pSLM1) Batch xylose +

octanoic acid

octanoic acid - - - 10 mM 2.13 0.27 28.7

(1): Feeding started at the middle of exponential batch phase, OD600 of 0.5.

(2): Feeding started at the end of exponential batch phase, OD600 of 1.


64

To test whether the recombinant is able to accumulate mcl-PHA from a related carbon source

(e. g. octanoic acid), KT2440 (pSLM1) was pre-cultured in E2 minimal medium with xylose as

the sole carbon source and then transferred into a bioreactor containing 0.2NE2 medium with

10 mM octanoic acid as the sole carbon source (Table 2.3, culture C). Samples were taken

regularly and the cellular PHA content was determined. It was found that KT2440 (pSLM1)

was able to accumulate mcl-PHA to 21% (w w-1) after 33 hours of cultivation.

The above results demonstrate that the recombinant strain KT2440 (pSLM1) kept the ability to

synthesize PHA from fatty acids, but could not do so from xylose. This allows sequential

feeding of xylose and fatty acids to obtain tailor-made mcl-PHA biosynthesis from xylose,

namely, first using an inexpensive carbon source for cell growth and then adding the appropriate

mcl-PHA precursor to allow the polymer accumulation. The sequential feeding strategy enables

production of a tailor-made mcl-PHA according to the supplied fatty acid. Octanoic acid was

tested here as mcl-PHA precursor in order to obtain poly(3-hydroxyoctanoate) accumulation.

We first investigated the influence of linear feeding of octanoic acid at different growth stages

on PHA synthesis. Four minireactors in parallel were inoculated using the same P. putida

KT2440 (pSLM1) preculture grown in E2 medium with 1.8 g L-1 xylose. In cultures D and E

linear feeding of 0.5 mM h-1 of octanoic acid was initiated at OD600 of 0.5 (8 h of batch

cultivation) and 1.0 (10 h of batch cultivation), respectively. Both cultures showed a similar

maximum specific growth rate of 0.24 h-1 (Table 2.3). The nitrogen limitation was reached after

16 h and xylose was depleted after 12 h for both cultures. The maximum accumulation of PHA

was found to be 12.1% w w-1 and 16.2% w w-1 for D and E, respectively, after about 20 h of

cultivation (Table 2.3). The obtained results suggested that PHA can be produced in P. putida

KT2440 (pSLM1) by sequential feeding of xylose and fatty acids. The exponential phase ended

at OD600 of 1.0 due to nitrogen limitation. Linear feeding at the end of the exponential growth

phase in the batch (OD600 of 1.0) gave a better yield of PHA compared to that at the mid-


65

exponential growth phase (OD600 of 0.5). This lower yield obtained in the latter can be

explained by consumption of octanoic acid for growth rather than for PHA accumulation during

the mid-exponential phase.

To increase PHA accumulation, we increased the feeding rate from 0.5 mM h-1 to 2 mM h-1 of

octanoic acid. Culture F was grown on 1.8 g L-1 xylose and feeding started at the end of the

exponential growth phase with a feeding rate of 2 mM h-1 of octanoic acid. For comparison,

culture G was supplemented with 1.8 g L-1 xylose and 10 mM octanoic acid from the beginning

on (batch culture on mixed carbon sources). Using culture F as an example, the figure 2.3

represents a typical behavior of cells regarding growth and PHA synthesis. After 7 h and 14.5

h of cultivation, nitrogen and xylose were depleted, respectively. When cells entered the

starvation phase a linear feeding of octanoic acid was started for 4 hours and then stopped. PHA

synthesis was detected after 2 h of feeding and increased linearly to 17.6% w w-1 during the

following 14 h. Only a slight increase of PHA content to about 20% w w-1 was found after

further incubation up to 43 h. The concentration of octanoic acid measured in the culture

increased with feeding time up to 2.56 mM after 7.5 hours from the beginning of the feeding;

afterwards it continuously decreased. At the end of the cultivation, after 48.5 h, the remaining

octanoic acid was only 0.48 mM. A maximal yield of mcl-PHA from octanoic acid of 0.37 g

mcl-PHA g-1 octanoic acid was obtained.


66

Fig. 2.3: Fed-batch experiment of P. putida KT2440 (pSLM1) grown on 0.2NE2 medium

containing 1.8 g L-1 xylose with linear feeding of 2 mM h-1 octanoic acid at OD600 of 1 for 4

hours. Nitrogen (○), octanoic acid (□) and xylose (◊) concentrations were measured. The

logarithmic growth is represented by filled squares (■) and the PHA accumulation by filled

triangles (▲). Data points are the averages of the results of duplicate measurements.

GC analysis revealed that the main monomer component of the synthesized PHA was 3-

hydroxyoctanoate (87 mol %) and no 3-hydroxydecanoate was detected. These results confirm

that the detected PHA is mainly from octanoic acid. Since the main monomer unit of PHA

produced from carbohydrates is 3-hydroxydecanoate in KT2440 [79, 150] it is very unlikely

that xylose was used for PHA synthesis. The sequential feeding strategy using xylose as growth

substrate and octanoic acid as mcl-PHA precursor enabled production of a controlled mcl-PHA

0

5

10

15

20

25

30

35

40

-2

-1,5

-1

-0,5

0

0,5

1

1,5

0 5 10 15 20 25 30 35 40 45 50

Nit

rogen

(m

g L

-1);

P

HA

co

nte

nt

( %

w w

-1);

oct

ano

ic a

cid

10

x (

g L

-1)

LN

OD

600;

Xylo

se

(g L

-1)

Time(h)

LN OD600 Xylose Nitrogen PHAs Octanoic acid


67

production. The yield of PHA from octanoic acid was between 0.11 g g-1 to 0.37 g g-1, with

culture F as the highest.

Discussion

Growth of KT2440 on xylose

A recombinant P. putida KT2440 strain was constructed that could efficiently utilize

xylose. The introduction of xylose isomerase (XylA) and xylulokinase (XylB) was essential and

sufficient for the utilization of xylose and a growth rate of 0.24 h-1 was routinely obtained.

Previously, it has been reported that a so called “laboratory evolution” was necessary to

improve the growth rate of P. putida S12 (xylAB) on xylose from 0.01 h-1 to 0.35 h-1 [97]. The

laboratory evolution is an adaption process by growing the cells consecutively in a fresh

medium containing the unfavorable carbon source. The “laboratory evolution” was not needed

for the KT2440 recombinant to grow on xylose. This difference could be attributed to the

different physiological background / metabolic fluxes of KT2440 and S12. It has been reported

that in P. putida a complete pentose phosphate pathway is present [97, 151] (Fig. 2.4) as well

as the key enzymes for mcl-PHA accumulation [78]. Our study demonstrated that the enzymes

responsible for converting xylose to the entry intermediate xylulose-5-phosphate of PP pathway

are missing in P. putida. By introducing the relevant enzymes XylA and XylB, P. putida

KT2440 was able to utilize xylose.

In addition, the recombinant P. putida KT2440 appeared to have an efficient xylose uptake

system. Similarly, P. putida S12 carrying D-xylonate dehydratase has been reported to grow on

xylose without expressing any xylose transporter [152]. Since pentose and hexose transporters

have been shown to be promiscuous [92], it is possible that xylose uptake can be accomplished

by glucose uptake systems in strain KT2440 (xylAB). Many bacteria also possess non-specific

transporters. Indeed, many sugars are transported into E. coli by phosphoenolpyruvate-


68

dependent phosphotransferase systems (PTS) like glucose, mannose, fructose, and N-

acetylglucosamine [153]. In this study, no specific xylose transporters such as XylE or XylFGH

were needed for growth of KT2440 (xylAB) on xylose. Thus, it is also possible that xylose

entered the cell through the fructose PTS system present in P. putida in a similar way as reported

for fructose [154]. Xylose, after uptake into the cell, is isomerized by xylose isomerase to

xylulose, which is then converted by xylulokinase to xylulose 5-phosphate. This

phosphorylated derivative is then catabolized by the pentose phosphate pathway. In comparison

to growth on glucose, the growth of P. putida KT2440 (xylAB) on xylose exhibited a similar

specific growth rate of 0.24 h-1 (Table 2.3). This demonstrated that the catabolic rate of xylose

by the recombinant P. putida KT2440 (pSLM1) is in the same range as that of glucose.

PHA production by sequential feeding

The biosynthesis of mcl-PHA is mainly studied for fluorescent pseudomonads, e.g. P. putida

KT2440. Strain KT2440 is characterized by a wide metabolic and physiologic versatility and is

able to accumulate mcl-PHA from glucose [119]. In this study, we demonstrated that mcl-PHA

biosynthesis on xylose does not occur when xylA and xylB are expressed even under nitrogen

limitation, perhaps because the expression of xylAB channels the metabolic flux to central

metabolism such as TCA cycle for cell maintenance or/and to production of side products like

acetate, rather than to PHA synthesis (Fig. 2.4).


69

Fig. 2.4. Hypothetical pathway for mcl-PHA accumulation from xylose in P. putida. Dashed

arrows: steps absent in wild-type P. putida strains; XylA: xylose isomerase; XylB:

xylulokinase; PhaG: 3- hydroxyacyl-ACP:CoA transferase; PhaC: PHA polymerase.

Up to now, there has been no report on mcl-PHA production by using xylose as the growth

substrate. Substrate costs make up a large proportion of the total production cost of PHA. Fatty

acids are generally much more expensive than lignocellulose hydrolysates (such as xylose) and

often toxic to the cells at relatively low concentrations and, for some of them, do not support

3-Ketoacyl-CoA

D-Xylose

Pyruvate

β-D-Fructose-1,6P

Glyceraldehyde-3P

Malonyl-CoA

Malonyl-ACP

Acyl-ACP

3-Ketoacyl-ACP

R-3-Hydroxyacyl-

ACP

Enoyl-

ACP

S-3-Hydroxyacyl-

CoA

Enoyl-CoA

Acyl-CoA

mcl-PHAs

XylA XylB

PhaC

PhaG

R-3-Hydroxyacyl-

CoA

Octanoic acid

D- Xylulose β-D-Fructose-6P D- Xylulose-5P

Acetate

ATP ADP

Acetyl-CoA


70

fast growth rates. Xylose is in a similar price range like cane molasses and half the price of

glucose [155], consequently, sequential-feeding strategies are a valid option to reduce the

production cost [156, 157]. Sequential-feeding consists of using on one hand cheap

carbohydrates for achieving a large biomass and on the other hand fatty acids as mcl-PHA

precursors to produce tailor-made mcl-PHAs.

In the fed-batch experiments, xylose was used for cell growth in the first step, and then

octanoate was supplied to synthesize mcl-PHA in the second step under nitrogen limitation.

This sequential feeding process allowed a tailor-made mcl-PHA accumulation of up to 20% (w

w-1) under not-yet-optimized conditions. When 10 mM octanoate was employed alone for

growth and PHA production (Table 2.3, entry C), lower PHA content (about 21% w w-1) was

obtained than that from using both xylose and 10 mM octanoate (Table 2.3, entry G, about

28.7% w w-1), even though the growth rate and the final cell optical density reached in entry C

were higher than those in entry G. These results suggest that xylose is not a substrate as good

as octanoate for growth of KT2440, however, it can facilitate the PHA production by being a

substrate for growth and allowing only octanoate to be converted to PHA.

In this study, P. putida KT2440 (pSLM1) showed a biomass yield from xylose at 0.50 g g-1,

which is similar to what has been reported from glucose at 0.41 g g-1 [158]. Previously, Kim

and co-workers used a sequential feeding strategy to maximize the PHA production in P. putida

using glucose as growth substrate and then octanoic acid for PHA accumulation [159]. A yield

of 0.4 g mcl-PHA g-1 octanoic acid was reached [159], similar to the yield of 0.37 g mcl-PHA

g-1 octanoic acid obtained in this study by sequential feeding of xylose and octanoic acid.

However, it has also been reported that the yield of mcl-PHAs from fatty acids such as nonanoic

acid could achieve 0.66 to 0.69 g−1 mcl-PHA g nonanoic acid by co-feeding glucose [157].


71

Therefore, further optimization of the sequential-feeding process is needed to increase the yield

of tailor-made mcl-PHAs.

Conclusions

In P. putida KT2440, introduction of xylAB from E. coli were sufficient to allow the

recombinant to efficiently utilize xylose as the sole carbon source. Experiments performed in

bioreactors showed that XylA and XylB were active in P. putida KT2440. The recombinant did

not produce mcl-PHA from xylose, thus enabled production of a tailor-made mcl-PHA of up to

20% (w w-1) by sequential-feeding of xylose and octanoate. A maximal yield of mcl-PHA from

octanoic acid of 0.37 g mcl-PHA g-1 octanoic acid was obtained containing mainly 3-

hydroxyoctanoate monomers (87% w w-1). Indeed, sequential feeding of relatively cheap

carbohydrates and expensive fatty acids is a practical way to achieve more cost-effective mcl-

PHA production. Optimization of initiation, rate and duration of feeding should be performed

to achieve a higher yield and higher productivity of mcl-PHA. Furthermore, optimized growth

conditions will undoubtedly contribute to the economic feasibility of mcl-PHA production from

renewable feedstock.

Authors’ contributions

SLM carried out the experiments, and drafted the manuscript. MZ and TE participated in the

design of the study and helped to draft the manuscript. LTM helped with manuscript

preparation. QR conceived of the study, and participated in its design and coordination and

helped to draft the manuscript. All authors read and approved the final manuscript.

Acknowledgement

This study was supported by a grant from Swiss National Science Foundation (SNSF). We

thank Stéphanie Follonier for her helpful advice.

Chapter 3

Construction and expression of recombinant

plasmids encoding for orfZ and phaC genes into an

inducible vector

Chapter 3: Construction and expression of inducible plasmid

74

Abstract

Poly (4-hydroxybutyrate) is a biodegradable and biocompatible polyester with high potential in

medical applications. Two enzymes are mainly responsible for the P4HB synthesis in

recombinant Escherichia coli, PHA synthase gene (phaC) from Ralstonia eutropha and a 4-

hydroxybutyric acid-coenzyme A transferase gene (orfZ) from Clostridium kluyveri. A two-

step pathway gives the ability to E. coli to convert 4-hydroxybutyric acid to poly (4-

hydroxybutyrate) homopolyester while precursor is supplemented in the medium broth. First,

OrfZ enzyme catalyzes a coenzyme A transferase reaction from 4HB to 4HB-CoA using free

coenzyme A or acetyl-CoA as donor. Then, PhaC enzyme polymerized 4HB-CoA into P4HB

with the concomitant release of CoA. Three different plasmids containing phaC and orfZ genes

with or without their respective promoters (i.e. inducible or not) were constructed through

classical DNA manipulation. P4HB accumulation was investigated in various batch studies;

however, low P4HB accumulation was observed in all tested strains.

Introduction

Biopolymers are a versatile class of compounds, which leads to an important growth of polymer

industry, evidenced by the wide spectrum of emerging applications in every sector of the

economy. Polyhydroxyalkanoates (PHAs) can be classified according to monomer chain length

into three categories: short-chain-length (scl) PHAs with 3 to 5 carbon atoms, medium-chain-

length (mcl) PHAs with 6 to 14 carbon atoms and long-chain-length (lcl) PHAs with more than

14 carbon atoms [22]. PHAs are accumulated in bacterial cytoplasm mainly under growth

limiting conditions. Poly (4-hydroxybutyrate) (P4HB) has attracted many attentions recently

due to its interesting properties such as its biodegradability, biocompatibility and flexibility,

leading to a wide variety of medical applications like tissue engineering and drug delivery.

P4HB is the first and only PHA-based product approved by the FDA in 2007 for clinical


75

application (TephaFLEX®) as absorbable suture. In addition, P4HB is extremely well tolerated

in vivo given that the hydrolysis of P4HB yields 4HB which is already present in the human

body [38].

One of the key enzymes of PHA biosynthesis is PHA synthase (PhaC). This enzyme

polymerizes coenzyme A (CoA) thioesters of hydroxyalkanoic acids (HAs) into PHAs with the

concomitant release of CoA (Fig. 1). Another important enzyme of the P4HB biosynthesis is 4-

hydroxybutyryl-CoA transferase (OrfZ) which belongs to CoA-transferases. It catalyzes the

transfer of CoA to 4-hydroxybutyric acid (Fig. 3.1). 4-hydroxybutyryl-CoA is an acyl-CoA

resulting from the condensation of the thiol group of coenzyme A with the carboxy group of 4-

hydroxybutyric acid. Three families of CoA-transferases were described which differ in

sequence and reaction mechanism [160]. E. coli wild-type strain is not able to accumulate

P4HB. Introduction of plasmid pKSSE5.3, which carries PHA synthase gene (phaC) from

Ralstonia eutropha and a 4-hydroxybutyric acid-coenzyme A transferase gene (orfZ) from

Clostridium kluyveri, enables E. coli strains to produce P4HB when 4HB is supplied in the

culture medium [64].

These orfZ, phaC and truncated phaA’ genes were ligated into pBluescript to obtain pKSSE5.3

plasmid [64]. Previously, orfZ gene from C. kluyveri was cloned into pCK3pSK to study the

succinate degradation pathway [161]. The 1.8 kb fragment carrying orfZ gene was inserted into

pBluescript vector together with a 3.5 kb fragment containing phaC gene and partial β-

ketothiolase encoding gene phaA’ from R. eutropha isolated from pSK2665 [64, 162].

Expression of both phaC and orfZ from pKSSE5.3 is driven by their native promoters, which

are not inducible by isopropyl β-D-1-thiogalactopyranoside (IPTG).


76

Figure 3.1: Synthetic pathway of poly(4-hydroxybutyrate) in E. coli recombinant. OrfZ: 4-

hydroxybutyric acid CoA: CoA transferase from C. kluyveri; PhaC: PHB synthase from R.

eutropha.

In order to initiate the expression of phaC and orfZ at desired time, inducible expression is

needed. Three different approaches were investigated. In the first approach, orfZ and phaC

without their respective promoter regions were digested, and then these two genes were cloned

together into the selected vector. Both genes were expressed through T7 promoter present in

pET22b plasmid in recombinant E. coli BL21 (DE3). In the second approach, the fragment

containing phaC gene, orfZ promoter and orfZ gene, was cut and inserted into pET22b. phaC

gene was transcribed under the control of T7 promoter of pETT22b and then the putative orfZ

promoter initiated the transcription of orfZ gene in the recombinant E. coli BL21 (DE3). The

4-hydroxybutyric acid CoA: CoA

transferase (OrfZ)

PHB synthase (PhaC)

SH-CoA

SH-CoA

4HB

4HB-CoA

P4HB

n


77

third approach was to clone orfZ gene alone and phaC with its promoter region and to insert

them into pET22b. In the last strategy, orfZ gene is under the control of T7 promoter but phaC

was cloned with its own promoter. E. coli BL21 (DE3) was transformed with one of the three

different constructions. This E. coli strain was selected due to its ability to synthesize T7 RNA

polymerase which was mandatory to start the transcription through the T7 promoter. The three

different strategies are represented in figure 3.2.

pSLM20

pSLM21

pSLM22

Figure 3.2: Three different plasmid constructions to direct the expression of phaC and orfZ

genes in pET22b vector when expressed in E. coli BL21 (DE3).

Materials and methods

DNA manipulation

Plasmid pKSSE5.3, derived from pBluescript, carries genes encoding PHB synthase (PhaC)

from R. eutropha and 4-hydroxybutyryl-CoA transferase (OrfZ) from C. kluyveri [64]. This

phaC orfZ

NdeI BamHI EcoRI

I I I

NdeI BglII EcoRI

phaC phaA’ orfZ promoter orfZ

I I I

orfZ phaC promoter phaC

NdeI EcoRI XhoI XhoI

I I I I


78

plasmid enables E. coli to produce P4HB from 4HB precursor [64, 66]. In order to direct the

expression of both phaC and orfZ genes, three different approaches were planned.

The first approach was named “pSLM20”: First, phaC gene was amplified by PCR using the

couple of primers: ForPhaC_NdeI: 5’ GTACCATATGGCGACCGGCAAAG 3’ and

RevPhaC_BamHI: 5’ CACGGATCCAAGCGTCATGCCTTG 3’ using the pKSSE5.3 plasmid

as template. Then, the obtained PCR fragment of phaC (1.77 kb) was cut, gel purified and

digested by NdeI and BamHI. The digested fragment was purified using the “PCR clean up kit”

(Fisher Scientific, Wohlen, Switzerland). The purified plasmid pET22b was also digested using

the same enzymes. Then, phaC fragment was ligated into the pET22b plasmid. The ligation

solution was used to transform competent E. coli DH5α. The colonies obtained were used to do

“Rusconi analysis”. Rusconi analysis consists in a fast plasmid separation which allows to

differentiate the recombinants according to the size of their plasmids. The recombinant cells

were incubated at 37 °C for at least 6 hours. Then, 400 µL of culture were spin down (1 min at

13'000 rpm). The supernatant was removed completely and 25 µL Rusconi-mix containing 1.0

mL of lysozyme (10 g L-1 in H2O), 1.0 mL EDTA (0.5 M), 500 µL Tris (1M, pH 7.5), 250 µL

RNase (20 g L-1), 7.0 mL 10.3% sucrose, 250 µL bromphenol blue-solution, was added to the

pellet (S. Rusconi, unpublished method). The pellet was suspended by vortexing and incubated

for 15 min at room temperature. Then, 20 µL of neutral phenol was added and mixed by

vortexing. The mixture was centrifuged for 2 min at 13'000 rpm and 15 µL of supernatant was

loaded on an electrophoresis gel.

The colonies showing different trends than the others were used to do plasmid purifications. In

order to check the orientation of the constructs, purified plasmids from these colonies were

digested by NdeI and BamHI to detect only the phaC insert and by EcoRI to linearize the

construct. The correct plasmid containing phaC gene was used to insert the orfZ gene.


79

The orfZ gene was obtained from PCR using the following primers: ForOrfZ_BamHI (5’

CTGCTGCGTGGATCCTAGTAAGCTTAAG 3’) and RevOrfZ_EcoRI (5’

GCAGGGAATTCCCTTCATATAAAGTGTAAC 3’) (pSLM20) using pKSSE5.3 plasmid as

template or was obtained by cutting pKSSE5.3 plasmid by BglII and EcoRI (pSLM21) (Figure

3.2). The orfZ gene was ligated into pET22b+phaC plasmid which was digested by EcoRI and

NdeI. The obtained plasmid containing orfZ and phaC genes was used to transform E. coli

DH5α. Another Rusconi analysis was performed to select the right clones. Then, digestions by

NdeI and EcoRI of the obtained plasmids were done in order to confirm the orientation of the

right constructs.

For pSLM22, orfZ fragment was digested by BamHI and EcoRI and cloned into pUC18 in order

to take the NdeI restriction site from this plasmid. The fragment was then digested by NdeI and

EcoRI. The phaC gene with its promoter was cut from pKSSE5.3 plasmid by SmaI and XhoI.

Then, this 3.5 kb was inserted into pJET 1.2 blunt end and used to transform E. coli DH5α.

Plasmid purification was done and the obtained plasmid was digested by XhoI. The digested

XhoI fragment containing phaC and its promoter was ligated into pET22b which contained

already orfZ gene. The new purified plasmid was controlled by digestion with XhoI and NdeI

and by EcoRI. Finally, three different plasmids named respectively pSLM20, pSLM21 and

pSLM22 were used to transform E. coli BL21 (DE3). P4HB accumulation and growth studies

were performed according to induction of T7 promoter at various physiological stages.

Growth study

Recombinant E. coli BL21 (DE3) growth studies were performed on minimal E2 medium

supplemented with 4 g L-1 Na-4HB, 10 g L-1 glucose, 1 g L-1 NZ-amines and 100 mg L-1

ampicillin in 1 L shake flasks with an agitation of 150 rpm. The temperature was set to 37 °C,


80

32°C or 30°C. IPTG as inducer of T7 lac promoter was added to the culture broth at different

concentrations and cultivation times according to the design of the experiments.

Cell concentration

The growth of bacterial cells was estimated by measuring the optical density at 600 nm (OD600)

of samples taken periodically using a UV-visible spectrophotometer (Genesys 6,

ThermoSpectronic, Switzerland).

PHA analysis

PHA content and composition were determined according to a method described previously

[98]. Methylene chloride containing benzoic acid (0.1 g L-1) was used as internal standard.

Purified P4HB was used to obtain standard curves. Na2CO3 powder was added to dry the

extracted chlorinated solvent phase. The samples were analyzed by gas chromatography (GC)

(A200s, Trace GC 2000 series, Fisons Instruments, Rodano, Italy) equipped with a polar fused

silica capillary column (Supelcowax-10: length 30 m; inside diameter 0.31 mm; film thickness

0.5 µm; Supelco, Buchs, Switzerland) [163]. P4HB was depolymerized, esterified and

methylated, leading to three different peaks in the GC chromatogram which were usually

observed during P4HB homopolymer analysis [64].

Synthesis of 4HB

The simplest way to produce 4HB is by the hydrolysis of the corresponding lactone to the

desired hydroxy acid. Ester hydrolysis can be done using a base to catalyze the reaction. The

base catalyzed reaction is chosen because the reaction is not reversible. The reaction proceeds

equimolarly and there are no byproducts produced in this reaction. The sodium salt of 4HB is

obtained.


81

Gamma-butyrolactone + NaOH Sodium 4-hydroxy butyrate (Na-4HB)

Results

Cloning strategy

Three different plasmids containing phaC and orfZ genes with or without their respective

promoters were constructed through classical DNA manipulations. Digestions were performed

to check the pSLM20 and pSLM21constructions for the selected recombinants. First, phaC

ligated into pET22b was digested by NdeI and BamHI to cut the insert (Digestion n°1, Fig. 3.3).

Typically, two bands at 5.5 (size of the plasmid) and 1.8 kb (size of phaC) were seen for the

three tested colonies. The plasmid was also digested by EcoRI in order to control the total

plasmid size by linearization. Achievement of the desired plasmid was confirmed by

linearization (Digestion °2, Fig. 3.3). The colony n°1 was chosen to perform the plasmid

purification. Simultaneously, orfZ gene alone (pSLM20) or orfZ with its promoter and truncated

phaA’ (pSLM21) was amplified by PCR, digested by BamHI and EcoRI and purified.


82

Figure 3.3: Gel electrophoresis of the digestion by NdeI and BamHI (Digestion n°1) and

linearization (Digestion n°2) by EcoRI of the obtained construction for pSLM20 and pSLM21.

Then, fragment containing orfZ gene was inserted after the phaC gene into pET22b for pSLM20

and pSLM21. The construct was confirmed by digestion using NdeI and EcoRI.

Figure 3.4: Digestion by NdeI and EcoRI of the constructs resulted from pSLM20 and pSLM21

on gel electrophoresis picture.

Plasmids were digested by NdeI and EcoRI for pSLM20 (a1 and a2) and pSLM21 (b1 and b2)

in order to cut the insert meaning the ligated phaC and orfZ (Fig. 3.4). The control pET22b +

phaC was cut by NdeI and BamHI. Expected sizes of 3.3 kb (phaC + orfZ) and 5.5 kb (pET22b

+ plasmid) were observed for both clones “a”. For pSLM21, bands at 5.77 (phaC + promoter

of orfZ + orfZ) and 5.5 kb were observed for the clone b1 (Fig. 3.4). The control revealed 3

Digestion n°1 Digestion n°2

Colony: 1 14 22 1 14 22

a1 a2 b1 b2 control


83

bands: 7.3 kb (non-digested plasmid), 5.5 kb (pET22b plasmid) and 1.8 kb (phaC) as shown in

figure 3.4.

orfZ gene was amplified by PCR using different primers than for the first cloning strategies

(pSLM20 and pSLM21). For the last strategy, named pSLM22 plasmid, purified orfZ fragment

was digested by NdeI and EcoRI as well as pET22b plasmid. orfZ digested fragment and

pET22b digested plasmid were ligated leading to a new plasmid which was digested by XhoI.

pKSSE5.3 plasmid was digested by XhoI and SmaI and the resulting 3.5 kb fragment containing

phaC gene and its promoter was cut and purified. This fragment was then inserted into pJET1.2

to get two XhoI sites at both ends. Then, the inserted fragment was digested by XhoI and ligated

into pET22b containing orfZ gene. The obtained plasmid was digested by NdeI and XhoI

(digestion n°1) and by EcoRI (digestion n°2) to be linearized (Fig. 3.5). Expected fragment

sizes were observed at 5.5 kb (pET22b plasmid), 3.5 kb (phaC gene and its promoter) and 1.4

kb (orfZ gene) (Fig. 3.5). Linearized plasmid also gave the right size (10.4 kb). Then, this

plasmid was used to transform E. coli BL21 (DE3).

Figure 3.5: pSLM22 construction containing orfZ gene and phaC genes and its promoter,

digested by NdeI and XhoI (digestion n°1) or by EcoRI (digestion n°2) for linearization.

Digestion: 1 2


84

To summarize, three different genetic constructions were obtained as illustrated in the figure

3.6. Each of them should allow directing the expression of one or two genes at a specific time

point of recombinant E. coli BL21 (DE3) cultivation.

Figure 3.6: Cloning strategies for an inducible system for P4HB accumulation.

Growth studies

Growth studies were performed using recombinant E. coli BL21 (DE3) pSLM20 and pSLM21

in minimal E2 medium supplemented with 4 g L-1 Na-4HB, 10 g L-1 glucose, 1 g L-1 NZ-amines

pSLM20 pSLM21

pSLM22


85

and 100 mg L-1 ampicillin. In order to avoid lag phase, the same preculture media was used as

the main cultivation media. Recombinant cells were grown at 37°C in 1 L shake flasks.

Induction was performed using 1 mM IPTG at the beginning of the cultivation for both

recombinants.

Figure 3.7: Growth studies of recombinant E. coli BL21 (DE3) pSLM20, induced with different

IPTG concentration at 30°C or 37°C. Stars and arrows represent the sampling for SDS-PAGE

experiments and for P4HB analysis, respectively.

Cells reached a maximal OD600 of 2 with a growth rate of 0.28 h-1 at 37°C. No significant

P4HB accumulation was observed for induced and non-induced (data not shown). It seems that

induction with 1 mM IPTG may lead to inclusion body formation, leading to inactive PhaC

and/or OrfZ. In order to study this hypothesis, further growth studies were performed with

0

0,5

1

1,5

2

2,5

0 5 10 15 20 25

OD

600

Time (h)

37°C OD - 0 mM IPTG OD - 0.1 mM IPTG OD - 0.2 mM IPTG OD - 0.5 mM IPTG

0

0,5

1

1,5

2

0 5 10 15 20 25

OD

600

Time (h)

30°C OD - 0 mM IPTG OD - 0.1 mM IPTG OD - 0.2 mM IPTG

OD - 0.5 mM IPTG OD - 1 mM IPTG

*

*

µ= 0.24 h-1

µ= 0.28 h-1


86

different IPTG concentrations and at two different temperatures: 30°C and 37°C. The growth

conditions mentioned above were identical as those used in the following experiments.

Table 3.1: P4HB content for the different E. coli BL21 (DE3) pSLM20 cultures performed at

37°C and 30°C with various inducer concentrations.

IPTG concentration

% P4HB w w-1 0 µM 100 µM 200 µM 500 µM 1 mM

37°C 0.20 0.20 0.20 0.30 -

30°C 0.20 0.30 0.30 0.40 0.40

All the tested IPTG concentrations did not influence the growth of the recombinant strain

pSLM20. Only the temperature decreased the growth rate from 0.28 h-1 at 37°C to 0.24 h-1 at

30°C. Recombinant E. coli BL21 (DE3) pSLM20 reached a maximal OD600 of 2 at 37°C and a

maximal OD600 of 1.8 at 30°C. Furthermore, only trace amounts of P4HB were detected in any

of the samples by GC analysis (Table 3.1). SDS-PAGE was performed using the soluble

fraction and the non-soluble fraction of the cell extracts after 6.5 h cultivation, meaning 1.5 h

induction. The theoretical size of PhaC is about 67 kDa and OrfZ is about 55 kDa.


87

Non-soluble fraction

Soluble fraction

Figure 3.8: SDS gels from the non-soluble and soluble fractions using the different cultivations

performed with various IPTG concentrations.

In the soluble fraction, a band was observed at around 70 kDa and seems to correspond to PhaC

size (67 kDa). Another band was detected at 55 kDa which could correspond to OrfZ. However,

these bands did not increase with the IPTG concentration (Fig. 3.8). Furthermore, these bands

are also present for the non-induced sample.

The fact that only trace amounts of P4HB were detected when E. coli recombinants were grown

on glucose as growth carbon substrate, suggests that induction of T7 promoter from pET22b

did not result in active PhaC and OrfZ. To investigate this influence of the growth carbon

30°C 37°C

0 µM 100 µM 200 µM 500 µM 1mM 0 µM 100 µM 200 µM 500 µM

37°C 30°C

0 µM 100 µM 200 µM 500 µM 0 µM 100 µM 200 µM 500 µM 1mM


88

substrate on orfZ and phaC expression as well as on the P4HB accumulation, another growth

study was performed using exactly the same conditions as previously used for 37 °C, but using

glycerol instead of glucose as the carbon source. Utilization of glycerol should allow to

counteract the possible inhibition applied on the Lac promoter by glucose. E. coli BL21 (DE3)

pSLM20 was grown at 37°C in E2 medium with 10 g L-1 glycerol, 1 g L-1 NZ-amines, 4 g L-1

Na4HB and 100 mg L-1 ampicillin. Different concentrations of IPTG were added to the cultures

at the end of the exponential phase to induce the expression of phaC and orfZ.

Figure 3.9: Growth study of the recombinant E. coli BL21 (DE3) pSLM20 induced by different

IPTG concentrations while growing on glycerol at 37°C.

E. coli BL21 (DE3) pSLM20 grew on glycerol without lag phases until a maximal OD600 of 5.5

with a growth rate of 0.35 h-1. Once again, only trace amounts of P4HB were detected by GC

analysis.

-1,5

-1

-0,5

0

0,5

1

1,5

2

0 5 10 15 20 25 30

Ln O

D600

Time (h)

a1-A1 a1-B1 a1-C1 a1-D1 a1-E1

Addition of IPTG

[IPTG] 0 µM 100 µM 200 µM 500 µM 1mM


89

Further growth studies were performed with strain pSLM21 under the same conditions in order

to confirm the obtained results (OD, growth rate, PHA content). Two temperatures were tested:

37°C and 30°C, with a non-induced culture and an induced culture with 500 µM of IPTG. This

study showed exactly the same trend as the previous one. An SDS-PAGE was performed using

total proteins extracts from 8 h of cultivation (3.5 h after induction) and 24 h of cultivation (19.5

h after induction) for each temperature. No differences were observed for the induced and the

non-induced cultures at 37°C and 30°C; all the protein bands were similar. It seems that the

phaC and orfZ genes were not expressed even with glycerol as carbon source. Furthermore, no

P4HB was detected for both cultivations.

Another growth study with E. coli BL21 (DE3) pSLM22 was performed on xylose using the

same experimental conditions as previously used for 37 °C. To compare the growth, negative

control containing no Na4HB was performed. E. coli BL21 (DE3) pSLM22 grew on xylose

directly without lag phase until a maximal OD600 of 5.2. As expected, no biopolymer

accumulation was detected by GC (P4HB < 0.5% w w-1) for the induced and non-induced

cultures (Fig 3.10).


90

Figure 3.10: Growth studies in shake flasks of E. coli BL21 (DE3) pSLM22 on xylose with and

without induction at 37°C.

It may be possible that E. coli strain BL21 (DE3) as host strain is not suitable for P4HB

production. In order to prove this hypothesis, experiments using E. coli BL21 (DE3) with the

original pKSSE5.3 plasmid were performed with identical growth conditions at 37°C in E2

medium with 10 g L-1 glucose or xylose, 1 g L-1 NZ-amines, 4 g L-1 Na4HB and 100 mg L-1

ampicillin.

E. coli BL21 (DE3) (pKSSE5.3) was able to accumulate up to 7.02% w w-1 P4HB on glucose

which demonstrated that this strain is able to produce biopolymers (Table 3.2). It is possible

that an expression problem led to inactive enzymes for the three tested plasmids. Table 2

summarized the obtained results for recombinant transformed with different cloning strategies

and for E. coli BL21 (DE3) pKSSE5.3 control. However, the maximal P4HB content

accumulated by this strain was not high compare with previous E. coli pKSSE5.3 recombinants

[66].

-2,5

-2

-1,5

-1

-0,5

0

0,5

1

1,5

2

0 10 20 30 40 50 60

Ln O

D600

Time (h)

No Na4HB + 100 µM IPTG(A) No induction + Na4HB (B)

20 µM IPTG (C) 100 µM IPTG (D)

500 µM IPTG (E) 1 mM IPTG (F)


91

Table 3.2: Summary of P4HB content obtained from different recombinants of E. coli BL21

(DE3) grown on glucose, glycerol or xylose at different temperatures. Results presented in this

table were average values of at least two experiments.

% P4HB (w w-1)

Induction by IPTG

Strain Temperature 0 µM 20 µM 100 µM 200 µM 500 µM 1 mM

Glucose

E.

coli

BL

21 (

DE

3)

pSLM20

37°C 1.30 - 0.20 0.30 0.30 0.90

30°C 0.20 - 0.30 0.30 0.40 0.40

pSLM21 37°C 0.85 - - - - 0.75

pSLM22

32°C 0.40 0.17 0.13 - 0.20 0.20

30°C 0.55 0.05 0.15 - 0.15 0.20

pKSSE5.3 37°C 6.84 - - 7.02 1.00 -

Glycerol

pSLM20 37°C 0.30 - 0.40 0.20 1.00 0.80

Xylose

pKSSE5.3 37°C 3.98 - 1.00 5.77 1.70 -

Conclusions

The inducible expression of phaC and orfZ genes from the constructed plasmids did not lead to

meaningful amounts of P4HB, whereas the plasmid pKSSE5.3 introduced into E. coli BL21

(DE3) allowed synthesis of about 7% (w w-1) P4HB. In our previous studies [66], the best E.

coli strain was JM109 which was able to synthesize up to 22% (w w-1) of P4HB on glucose

when transformed with pKSSE5.3 plasmid. E. coli JM109 (pKSSE5.3) is K12 strain bacterium

while E. coli BL21 (DE3) is B strain bacterium with DE3, a λ prophage carrying the T7 RNA

polymerase gene and lacIq allowing to constitutively express the lac inhibitor and to bind to T7


92

promoter specifically. More than half of the 3793 proteins of their basic genomes of the B and

K-12 E. coli genomes are predicted to be identical, although about 310 appear to be functional

in either B or K-12 but not in both [43]. These genomic differences may impact the expression

levels of the phaC or orfZ genes needed for P4HB accumulation. It is not clear yet why the new

inducible plasmids (pSLM20, pSLM21 and pSLM22) do not allow P4HB synthesis. If inactive

PhaC and/or OrfZ inclusion bodies were formed after induction, analysis of the cell free extracts

by SDS-PAGE should highlight these protein bands, but it was not the case in the present work.

Moreover, no expression differences were observed between induced and non-induced cultures

for the three recombinants.

In order to gain deeper insights into this expression problem, transformation of E. coli JM109

(DE3) by the original plasmid as well as by each of the three inducible systems should be

performed to state on the ability of E. coli strain of accumulating high amounts of P4HB while

induced by IPTG. Furthermore, it seems also possible that both phaC and orfZ genes need their

own promoter systems. Expression of orfZ and phaC can be verified using quantitative real-

time PCR (qRT-PCR) in the different recombinants.

Chapter 4

Poly(4-hydroxybutyrate) (P4HB) production in

recombinant Escherichia coli: P4HB synthesis is

uncoupled with cell growth

Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q,

Microbial Cell Factories 2013, 12:123

doi:10.1186/1475-2859-12-123

Chapter 4: P4HB production by recombinant E. coli using xylose

94

Abstract

Poly(4-hydroxybutyrate) (P4HB), belonging to the family of bacterial polyhydroxyalkanoates

(PHAs), is a strong, flexible and absorbable material which has a large variety of medical

applications like tissue engineering and drug delivery. For efficient production of P4HB

recombinant Escherichia coli has been employed. It was previously found that the P4HB

synthesis is correlated to the cell growth. In this study, we aimed to investigate the physiology

of P4HB synthesis, and to reduce the total production cost by using cheap and widely available

xylose as the growth substrate and sodium 4-hydroxybutyrate (Na-4HB) as the precursor for

P4HB synthesis.

Six different E. coli strains which are able to utilize xylose as carbon source were compared for

their ability to accumulate P4HB. E. coli JM109 was found to be the best strain regarding the

specific growth rate and the P4HB content. The effect of growth conditions such as temperature

and physiological stage of Na-4HB addition on P4HB synthesis was also studied in E. coli

JM109 recombinant in batch cultures. Under the tested conditions, a cellular P4HB content in

the range of 58 to 70% (w w-1) and P4HB concentrations in the range of 2.76 to 4.33 g L-1 were

obtained with a conversion yield (YP4HB/Na-4HB) of 92% w w-1 in single stage batch cultures.

Interestingly, three phases were identified during P4HB production: the “growth phase”, in

which the cells grew exponentially, the “accumulation phase”, in which the exponential cell

growth stopped while P4HB was accumulated exponentially, and the “stagnation phase”, in

which the P4HB accumulation stopped and the total biomass remained constant. P4HB

synthesis was found to be separated from cell growth, i.e. P4HB synthesis mainly took place

after the end of the exponential cell growth. High conversion rates and P4HB contents from

xylose and Na-4HB were achieved here by simple batch culture, which was only possible

previously through fed-batch high cell density cultures on glucose.


95

Background

Natural polyhydroxyalkanoates (PHAs) are synthesized by many microorganisms as carbon

and energy storage compounds and deposited as granules in their cytoplasm. PHA accumulation

takes place when bacterial cells grow under conditions where nutrients other than carbon

source, such as nitrogen or phosphorus, are limiting growth. Depending on the carbon substrate

supplied, PHAs with different composition are produced. They are classified as short-chain-,

medium-chain- and long-chain- length PHAs according to the number of carbon atoms of the

monomeric units [22]. Over a hundred different carboxylic acid monomers were reported to be

incorporated into PHAs [22], resulting in polymers with a wide range of material properties.

These natural polymers have attracted particular attention due to their biodegradability and

biocompatibility [164-166]. Among them, poly(4-hydroxybutyrate) (P4HB) is a highly

interesting polymer for various biomedical applications [53].

P4HB biosynthesis has been studied for about 20 years and it was, and still is, the first and only

PHA-based product approved by the FDA as an absorbable suture for clinical application. It is

a strong, flexible thermoplastic material that can be processed easily to scaffolds, heart valves

or cardiovascular tissue supports [53]. The most remarkable property of P4HB is its very high

elasticity and molecular weight, as both benchmark closely to ultra-high molecular weight

polyethylene [167]; it can be stretched 10-times its original length before breaking [53]. In

addition, P4HB is biocompatible and extremely well tolerated in vivo because biological

hydrolysis of P4HB yields 4HB, which is a common metabolite in the human body [38]. When

used in vivo, the degradation of P4HB implant takes place via surface erosion and does not lead

to a burst release of acid, which is an immense advantage for medical applications [53]. Thus,

it is highly desired to obtain P4HB in large scale at a competitive cost. It was reported that up

to 50% of the total cost of poly(3-hydroxybutyrate) (P3HB) arises from the carbon source [84].


96

Therefore, to reduce the cost of the carbon source used for large scale P4HB production,

agricultural derived feedstock such as processed hemicelluloses may be employed as a co-

substrate to produce the bacterial biomass.

Annually, 60 billion tons of hemicelluloses are produced and remain mostly unused [90].

Hemicellulose is the third most abundant polymer in nature and can be hydrolyzed into simple

sugars by either chemical or enzymatic hydrolysis [91]. The dominant building unit of

hemicelluloses is xylose. In some plants, xylose polymer (xylan) comprises up to 40% of the

total dry plant material. Xylose can be used as an industrially relevant carbon source for

bacterial growth, for example, by Escherichia coli strains [92].

Up to now, several wild-type bacterial strains have been reported to be able to produce P(3HB-

co-4HB) copolymer: Ralstonia eutropha, Alcaligenes latus, Comamonas acidovorans,

Comamonas testosteroni and Hydrogenophaga pseudoflava [168]. Saito and coworkers

reported the production of P(3HB-co-4HB) copolymers by R. eutropha using different carbon

sources with or without 4HB as precursor, however, only very low cellular polymer contents

were obtained [169]. It was also reported that a maximum of 21% w w-1 of P4HB can be

achieved by C. acidovorans when using 4HB or 1,4-butanediol as precursor [169]. Kim and

colleagues performed fed-batch experiments with R. eutropha supplying in the first step

fructose and in the second step only 4HB. They obtained a cell concentration of 33.6 g L-1 and

a P(3HB-co-4HB) copolymer content of 41.7% w w-1 with 25 mol.% 4HB [168]. To produce

P4HB homopolymers recombinant strains were mainly used.

It has been shown previously that microorganisms that do not produce PHA naturally are ideally

suited for the manipulation of the levels of the PHA biosynthetic enzymes and, hence, allow to

increase polymer productivity [170]. Wild-type E. coli strains cannot synthesize any type of

PHA, including P4HB. By introducing the P4HB synthesizing genes, recombinant E. coli


97

strains are able to produce P4HB through the newly acquired biosynthetic pathway. It has been

reported that the overexpression of PHA synthase (phaC) and β-ketothiolase (phaA) genes from

R. eutropha allowed C. acidovarans to produce up to 51% w w-1 P4HB [171]. By introducing

phaC from R. eutropha and a 4-hydroxybutyric acid-coenzyme A transferase gene (orfZ) from

Clostridium kluyveri, E. coli strain XL1-Blue was able to produce P4HB when 4HB was

supplied as a precursor in the culture medium [64]. A P4HB content of 58.5% w w -1 was

achieved in 100 mL shake flasks, however, information on the biomass concentration was not

provided [64]. Recently, Zhou et al. reported that E. coli JM109 mutant carrying two plasmids

reached about 1.9 g L-1 P4HB and 35% (w w-1) P4HB using LB medium containing glucose in

a batch culture [67]. There, LB rich medium was applied and two antibiotics were needed to

keep the plasmids, which might be too expensive for large-scale production.

The importance of choosing a suitable E. coli host strain for recombinant culture cultivation

was demonstrated by Luli and Strohl [172], who showed that specific growth rate, biomass

yield, and acetate formation varied significantly among different strains tested. It has also been

reported that among different E. coli strains E. coli JM109 was the only strain that allowed good

production of poly(L-aspartyl-L-phenylalanine) [173]. Up to now, little effort has been made

to understand the physiology of P4HB synthesis in E. coli.

In this study, we compared P4HB production in different E. coli recombinants and identified

the best E. coli strain regarding cell growth and P4HB accumulation. The effect of growth

conditions in batch culture was studied for following parameters: temperature, the carbon

source, and Na-4HB concentrations. Furthermore, the best physiological stage at which Na-

4HB precursor should be added was investigated. P4HB productivity of 0.027 w w-1 h-1 with

excellent conversion yield YP4HB/Na-4HB of 92% w w-1 was achieved.


98

Methods

Bacterial strains and plasmids

The E. coli strains used in this study are listed in Table 4.1. Among them, XL1-Blue, S17-1 and

JM109 were previously used for P4HB production [64, 65, 174], and thus were selected here

for comparison purpose. The previously constructed plasmid pKSSE5.3 carrying a PHA

synthase gene (phaC) from R. eutropha and a 4-hydroxybutyric acid-coenzyme A transferase

gene (orfZ) from C. kluyveri was used in this study [64].

Table 4.1: E. coli strains used in this study.

Strains Relevant characteristics References

DH5α

F–, ø80dlacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1,

endA1, hsdR17(rK–, mK+), glnV44, supE44, λ-, thi-1, gyrA96,

relA1, nupG

[175]

JM109

endA1, glnV44, thi-1, relA1, gyrA96, recA1, mcrB+, Δ(lac-

proAB), e14-, [F' traD36, proAB+, lacIq, lacZΔM15],

hsdR17(rK-mK

+)

[176]

XL-1 Blue endA1, gyrA96(nalR), thi-1, recA1, relA1, lac, glnV44,

F'[ ::Tn10, proAB+, lacIq, Δ(lacZ)M15], hsdR17(rK- mK

+) [177]

S17-1 tmpR, spcR, strR, recA pro hsdR RP4-2-Tc::Mu-Km::Tn7 [178]

W3110 F,- λ-, rph-1, INV(rrnD, rrnE) [139]

BL21(DE3) F-, ompT, gal, dcm, lon, hsdSB(rB

- mB-), λ(DE3), [lacI lacUV5-

T7 gene 1 ind1 sam7 nin5]) [179]

Plasmid

pKSSE5.3 phaC, orfZ, Ampr [64]


99

Chemicals, media and cultivation conditions

Chemicals

All chemicals were purchased from Sigma-Aldrich (Buchs, Switzerland).

Synthesis of Na-4HB

One of the simplest and low-cost ways to obtain 4HB is by hydrolysis of the corresponding

lactone to the desired hydroxy acid. The reaction was proceeded with equal molar of gamma-

butyrolactone and NaOH [180]. In detail: 4 M NaOH solution was prepared and mixed slowly

to 4 M of gamma-butyrolactone on ice. After the reaction mixture was cooled down to room

temperature, it was analyzed by HPLC/MS ([147], also see below). An almost 100% conversion

of gamma-butyrolactone to Na-4HB was achieved.

Media

E. coli strains were cultivated overnight in LB medium with 100 µg mL-1 ampicillin. This

culture was used to inoculate the preculture containing modified E2 medium [23]. Modified E2

medium contained the following constituents: NaNH4HPO4· 4H2O 3.5 g L-1, KH2PO4 3.7 g L-

1, K2HPO4 7.5 g L-1, dissolved in 1 L of water. One mL L-1 of 1 M MgSO4·7H2O was added to

the medium. One mL L-1 of trace elements (TE) dissolved in 1 M HCl was also added. TE

contained: FeSO4·7H2O 2.78 g L-1, CaCl2·2H2O 1.47 g L-1, MnCl2·4H2O 1.98 g L-1,

CoCl2·6H2O 2.38 g L-1, CuCl2·2H2O 0.17 g L-1, ZnSO4·7H2O 0.29 g L-1. Xylose, glucose or

glycerol (10 g L-1) was used as the sole carbon source.

Growth in shake flasks

Growth studies were performed in 1 L shake flasks containing 200 mL of modified E2 medium

and 10 g L-1 of a carbon source. One g L-1 of NZ-amines and 100 µg mL-1 of ampicillin were


100

added to the minimal medium. Na-4HB (1 to 6 g L-1 according to the experiment) was added

as P4HB precursor as indicated in individual experiments.

Culture in 1 L bioreactors

Four 800 mL reactor cultures were grown in parallel in 1 L Multifors benchtop bioreactors

(Infors AG, Bottmingen, Switzerland). Temperature was controlled at 32°C with an external

circulating water bath, and pH was maintained at 7.0 +/- 0.1 by automatic addition of 25%

NaOH or 30% H3PO4. Dissolved oxygen tension was monitored continuously with an oxygen

probe (Infors AG, Bottmingen, Switzerland) and kept always above 30% oxygen saturation.

The agitation was set at 500 rpm. Each reactor was inoculated using a preculture prepared as

described above in “Growth in shake flasks”. The initial OD600 value in bioreactors was

between 0.10 and 0.30. The modified E2 medium was used to perform all the growth studies in

1 L reactors supplemented with 10 g L-1 of carbon source, 1 g L-1 of NZ-amines, 4 g L-1 of Na-

4HB and 0.015 g L-1 of thiamine. Ampicillin was added to a final concentration of 100 µg mL-

1 to maintain the pKSSE5.3 plasmid.

Analytical methods

Cell concentration

Growth of bacterial cells was followed by measuring optical density at 600 nm (OD600) using a

UV spectrophotometer (Genesys 6, ThermoSpectronic, Switzerland).

Cell dry weight was determined either by using pre-weighed polycarbonate filters (pore size

0.2 µm, Whatman, Scheicher & Schuell, Dassel, Germany) or by pre-weighed 2 mL Eppendorf

tubes. In the first method, an appropriate volume (0.5 to 5 mL) of culture was filtered in order

to obtain a biomass dry weight of about 2 mg per filter. The filter was dried overnight at 100

°C, cooled down to room temperature in a desiccator and then weighed. In the second method,

2 mL of culture broth was centrifuged at 12’000 g for 2 min in a 2 mL pre-weighed Eppendorf


101

tube. The supernatant was discarded and the cell pellet was dried overnight at 100 °C and cooled

down to room temperature in a desiccator. The 2 mL Eppendorf tube was then weighed. For

both methods, the weight difference was used to determine the dry biomass.

PHA content

PHA content and composition were determined according to a method described previously

[98]. Methylene chloride containing benzoic acid (0.1 g L-1) was used as internal standard. Own

lab purified P4HB was used for obtaining standard curves. Na2CO3 powder was added to dry

the extracted chlorinated solvent phase. The samples were analyzed by gas chromatography

(GC) (A200s, Trace GC 2000 series, Fisons Instruments, Rodano, Italy) equipped with a polar

fused silica capillary column (Supelcowax-10: length 30 m; inside diameter 0.31 mm; film

thickness 0.5 µm; Supelco, Buchs, Switzerland) [163]. P4HB was depolymerized, esterified

and methylated, leading to three different peaks in the GC chromatogram. These three peaks

were also observed by Hein and coworkers when P4HB homopolymers were analyzed [64].

Nitrogen concentration

NH4+-nitrogen consumption was detected using an ammonium test kit following the

manufacturer instruction (Merck KGaA, 64271 Darmstadt, Germany). The detection limit was

0.01 NH4+-nitrogen mg L-1. The method was linear up to 3.0 mg L-1, above which dilution with

distilled water was needed. The results obtained are in mg L -1 of nitrogen.

Measurement of xylose, Na-4HB, acetate, pyruvate and lactate

Concentrations of xylose, Na-4HB and acetate in the culture medium were measured by

HPLC/MS. Supernatant resulting from culture centrifugation at 12’000 g for 2 min was diluted

to a concentration between 0.01 and 0.1 mM with distilled water, filtrated through a Titan HPLC

filter (0.45 µm, Infochroma AG, Zug, Switzerland), and loaded on a reversed phase C18 column

(Gemini C18 5 micron, 250 mm x 4.60 mm, Phenomenex, U.K.). A gradient of 100% of diluted

formic acid (0.1 v % in water) to 100% of acetonitrile was applied as the mobile phase. The


102

flow rate was 0.8 mL min-1 and the gradient was completed after 25 minutes. The peaks were

detected by electrospray ionization (ESI) in negative mode [147]. Standard curves for xylose,

Na-4HB and acetate were recorded in the range of 0.01 to 1.00 g L-1, 0.01 g L-1 to 0.20 g L-1

and 0.01 to 1.00 g L-1, respectively.

Pyruvate and lactate in the culture supernatant were measured by ion chromatography (IC)

(Metrosep A SUPP 5 250, 4 x 250 mm). A flow of 0.7 mL min-1 of eluent containing 1 mM

NaHCO3 was used. Both acids were detected using a conductivity detector. A volume of 20 µL

of sample diluted with water to a range of 50 to 250 ppm was injected and analyzed by IC

system. Pure pyruvate and lactate were used to generate standard curves.

Calculation of conversion rate

Consumed Na-4HB was determined by the difference between the Na-4HB amount supplied at

the beginning of a cultivation and Na-4HB content left over in the medium after the cultivation.

The concentration of P4HB (g L-1) was determined from cell dry weight (CDW) in g L-1 and

the cellular content of P4HB (w w-1) obtained at the end the cultivation. The conversion rate

was calculated by dividing the mass of carbon in gram from P4HB with the mass of carbon in

gram from Na-4HB (w w-1).

Results

Comparison of different E. coli recombinants for and influence of 4HB concentrations on

P4HB production

Six different E. coli strains were transformed with plasmid pKSSE5.3 carrying the necessary

genes for P4HB synthesis, namely a PHA synthase gene (phaC) from R. eutropha and a 4-

hydroxybutyric acid-coenzyme A transferase gene (orfZ) from C. kluyveri. An initial screening


103

on the performance of the obtained recombinant strains was conducted in shake flasks

containing modified E2 medium with xylose as the growth substrate and Na-4HB for P4HB

synthesis. Specific growth rate, maximum optical density (OD600) and P4HB accumulation

were measured with time. For comparison, the same experiments were performed with glucose

as the growth substrate. The tested E. coli recombinants exhibited different specific growth

rates and accumulated different amounts of P4HB (Fig. 4.1). On both glucose and xylose, the

W3110 and BL21 (DE3) recombinants displayed a high specific growth rate, but accumulated

only negligible amounts of P4HB. Specific growth rates of DH5α and XL1-Blue recombinants

were much lower on xylose than on glucose, and the P4HB content in the range of 11% to 18%

(w w-1) was measured during growth on both sugars. On xylose the best performer for P4HB

production was the recombinant JM109, which exhibited a specific growth rate of 0.28 h-1 and

accumulated P4HB up to 19% (w w-1). E. coli JM109 (pKSSE5.3) was thus selected for further

studies.


104

Fig. 4.1: Comparison of P4HB accumulation in six recombinant E. coli strains. Cultures were

grown in shake flasks at 37°C in modified E2 minimal medium containing either glucose or

xylose (10 g L-1). Standard deviations in the table were obtained from four independent

measurements. There is a significant difference from t-test in the P4HB accumulation between

the strains growing on glucose and on xylose with t (5) value of 3.71 and p < 0.01.

In parallel, under the same conditions as described above and using glucose as growth substrate,

the effect of the 4HB concentration on cell growth and P4HB production was investigated.

When the modified E2 medium was supplemented with Na-4HB as the sole carbon source, no

growth was observed for E. coli JM109 (pKSSE5.3), demonstrating that Na-4HB cannot be

utilized by E. coli JM109 as carbon source for growth. The optimum concentration of Na-4HB

0

5

10

15

20

25

Glucose Xylose

% P

4H

B (

w w

-1)

DH5α JM109 W3110 XL-1 Blue S17-1 BL21(DE3)


105

for P4HB production was found to be between 2 g L-1 and 4 g L-1. Outside this range either low

amounts of P4HB were obtained, or growth inhibition took place (Table 4.2). Therefore, 4 g L-

1 Na-4HB was used in subsequent experiments.

Table 4.2: Influence of Na-4HB concentrations on P4HB accumulation in E. coli JM109

(pKSSE5.3). The cells were grown at 37°C for 30 h in shake flasks containing modified E2

medium supplemented with 10 g L-1 glucose, 1 g L-1 NZ-amines and 100 µg mL-1 ampicillin.

The standard deviations were obtained from three independent measurements.

1 g L-1 Na-4HB 2 g L-1 Na-4HB 4 g L-1 Na-4HB 6 g L-1 Na-4HB

OD600nm 1.77 ± 0.08 1.88 ± 0.02 1.94 ± 0.04 1.93 ± 0.06

% P4HB (w w-1) 2 ± 0.1 21 ± 0.4 23 ± 0.7 21 ± 0.9

µ (h-1) 0.32 ± 0.01 0.34 ± 0.02 0.33 ± 0.01 0.22 ± 0.01

Comparison of carbon sources for P4HB synthesis in JM109 (pKSSE5.3)

To produce P4HB under better controlled conditions, the selected JM109 (pKSSE5.3) was

cultivated in a 1 L bioreactor using modified E2 minimal medium containing xylose and 4HB.

For comparison, glucose and glycerol were used as growth substrates, respectively.

Table 4.3 shows that the cells grown on xylose and glucose reached a similar maximal OD600

with a similar specific growth rate. More P4HB was produced on xylose (32% w w-1) than on

glucose (19% w w-1). Grown on glycerol, the recombinant strain reached a much higher biomass

than on glucose or xylose. This difference cannot be caused by P4HB accumulation because

the cells synthesized only 12% (w w-1) of P4HB on glycerol, which is much lower than those

found during growth on either glucose or xylose. This result indicates that more carbon source

is channeled to biomass when grown on glycerol under the used conditions. The achieved P4HB

concentration of 0.41 g L-1 from glycerol was also lower than that from xylose (0.65 g L-1

P4HB).


106

Table 4.3: Comparison of carbon sources for growth and P4HB accumulation of E. coli JM109

(pKSSE5.3). The cells were cultivated in 1 L bioreactors at 37 °C with an agitation of 500 rpm

in modified E2 minimal medium supplemented with 4 g L-1 Na-4HB, 1 g L-1 NZ-amines, 100

µg mL-1 ampicillin and 0.015 g L-1 thiamine. Xylose, glucose or glycerol was used as the growth

substrate. The growth was followed over time and samples were taken after 25 h for P4HB

analysis. The data were obtained from two independent cultivations.

Carbon source Xylose Glucose Glycerol

OD600 3.4 ± 1.4 3.9 ± 1.1 7.6 ± 0.4

CDW (g L-1) 2.16 ± 0.37 2.04 ± 0.60 3.80 ± 0.18

µ (h-1) 0.32 ± 0.09 0.38 ± 0.04 0.35 ± 0.01

P4HB content % (w w-1) 32 ± 3.7 19 ± 6.4 12 ± 3.6

P4HB concentration (g L-1) 0.65 ± 0.11 0.36 ± 0.05 0.41 ± 0.00

Influence of temperature on growth and P4HB accumulation

Optimal temperature should support cell growth as well as product formation. Therefore, the

influence of temperatures at 30, 32, 34 and 37°C on growth and P4HB accumulation was

investigated. As expected, with the increase of temperature the specific growth rate increased

correspondingly (Fig. 4.2). Temperature also displayed a significant impact on P4HB

accumulation and the best temperature was found to be 32°C where about 37% (w w-1) of P4HB

was produced after 24 h of cultivation. Temperatures below or above 32°C resulted in

considerable decrease in P4HB content (Fig. 4.2). Thus, cultivation temperature was set to 32°C

for subsequent experiments.


107

Fig. 4.2: Influence of temperature on the growth and P4HB accumulation of E. coli JM109

(pKSSE5.3). The cells were grown in modified E2 minimal medium supplemented with 10 g

L-1 xylose, 4 g L -1 Na-4HB, 1 g L-1 NZ-amines, 100 µg mL-1 ampicillin and 0.015 g L-1

thiamine. Four different temperatures were tested: 30°C (♦), 32 °C (■), 34°C (▲) and 37°C (●).

Error bars represent the deviations from two independent measurements.

Impact of the precursor addition at different physiological growth stages on P4HB synthesis

Previously, it was found that addition of the precursor 4HB at the beginning of cultivation was

best for P4HB synthesis [65]. The authors stated that addition of 4HB at the late exponential

growth phase led to considerably lower cell mass reached and less P4HB accumulation due to

the limited availability of CoA [65]. To investigate whether P4HB synthesis in the E. coli

JM109 recombinant is related to cell growth (i.e., CoA availability), we conducted the

following experiment: E. coli JM109 (pKSSE5.3) was grown on modified E2 medium

containing xylose in a 1 L bioreactor at 32°C, and 4 g L-1 of Na-4HB was added to the culture

at the beginning (culture I), at the end of the exponential phase (culture II), or by a combination

-3

-2

-1

0

1

2

3

0 5 10 15 20 25

lnO

D600

Time (h)

30°C 32°C 34°C 37°C

0

10

20

30

40

0,2

0,3

0,4

0,5

0,6

28 30 32 34 36 38

% P

4H

B (

w w

-1)

µ (

h-1

)

Temperature (°C)

µ % P4HB


108

of 2 g L-1 at the beginning and 2 g L-1 at the end of the exponential phase (culture III) (Fig.

4.3A). The results obtained demonstrate that addition of 4HB at different growth phases

influenced neither specific growth rate of the culture nor P4HB synthesis (Fig. 4.3A). Cells in

all cultures exhibited a specific growth rate of about 0.34 h-1 in the first 8 h of cultivation. In all

cultures the initiation of P4HB synthesis was only at the end of the exponential growth phase,

even when 4HB was provided at the beginning (cultures I and III). During the accumulation

phase, P4HB content increased exponentially with a similar rate in all three cultures and to the

same extent for about 24 h in all cultures (Fig. 4.3B). Afterwards the P4HB accumulation

slowed down until the end of cultivation (55 h), where the P4HB content increased to a

maximum of about 70% in cultures I and III and about 60% in culture II. It seems that P4HB

content in culture II could potentially increase further, however, it was not possible likely due

to a limitation of certain nutrients. The concentration of P4HB increased exponentially for 18

h, starting from the initiation of P4HB synthesis at the end of the first exponential growth phase

(Fig. 4.3B). Afterwards the increase of the P4HB concentration slowed down and maximal

about 3.7, 3.3 and 4.3 g L-1 of P4HB was obtained in cultures I, II and III, respectively, at the

end of the cultivation (Fig. 4.3B).


109


110

Fig. 4.3: Influence of the physiological stage of 4HB addition on P4HB synthesis. E. coli JM109

(pKSSE5.3) was grown in a 1 L bioreactor at 32 °C on modified E2 medium supplemented with

10 g L-1 xylose, 4 g L -1 Na-4HB, 1 g L-1 NZ-amines, 100 µg mL-1 ampicillin and 0.015 g L-1

thiamine. The black arrows represent the addition of Na-4HB.

Panel A: addition of Na-4HB at different growth stages. I: Addition of Na-4HB at the beginning

of the culture; II: Addition of Na-4HB at the end of the exponential growth phase; III:

Combination of addition of Na-4HB at the beginning and at the end of exponential growth

phase. Panel B: Time courses of P4HB content and concentration presented in log-scale. Panel

C: P4HB productivity. The P4HB accumulation rate is obtained for the described conditions

from three independent cultivations.

Correspondingly, cell density in all cultures also increased exponentially with the exponential

increase of P4HB synthesis (Fig. 4.3A). The accumulation rate of P4HB per cell dry weight

was linear and similar in all three cultures with a value of about 0.025 g g -1 h-1 (Fig. 4.3C).

The results obtained here demonstrate the following: 1) P4HB synthesis only started at the end

of the exponential growth phase, regardless of the stage the precursor 4HB was added (i.e.,

either at the beginning or at the end of the exponential growth phase); 2) P4HB content and

concentration increased exponentially once the P4HB synthesis was initiated; 3) The P4HB

accumulation rate per cell dry weight was similar regardless when the precursor 4HB was added

(i.e. at the beginning or the end of the exponential growth phase); 4) The increase of biomass

after the exponential growth phase was mainly due to the P4HB accumulation; and 5) P4HB

accumulation stopped due to either nutritional limitation and/or product(s) inhibition. To obtain

more information, a more detailed analysis on substrate consumption and product formation

was performed.

Batch culture for P4HB production

E. coli JM109 (pKSSE5.3) was grown in a 1 L bioreactor on modified E2 medium containing

xylose and Na-4HB. The cells behaved in the same manner as described above (see Fig. 4.3)

and three phases were observed (Fig. 4.4). Phase 1: Growth phase (0 - 11 h). Cells grew

exponentially with a specific growth rate of 0.28 h-1 for 11 h. In this phase, xylose and nitrogen

were consumed but were still in excess in the medium. No excretion of acids such as acetic,


111

pyruvic or lactic acid was observed during this phase. Na-4HB was hardly consumed and only

a small amount of P4HB was detected (below 3% w w-1). The observed termination of the

exponential phase can be caused either by a limited availability of nutrient(s) or by product(s)

inhibition under our experimental conditions. This limitation or inhibition appears to promote

P4HB synthesis. O2 limitation can be ruled out due to automatic control of the dissolved oxygen

which was never below 30% as described in Method section. Phase 2: P4HB accumulation

phase (11 – 35 h). Similar to what found before, cells started to accumulate P4HB exponentially

after phase 1 and Na-4HB was consumed and decreased in the culture from 3.8 to 1.4 g L-1.

During this time, P4HB content increased from 3% to 58% (w w-1) and the P4HB concentration

increased from 0.024 to 2.76 g L-1 (Fig. 4.4). The residual biomass kept almost constant during

this phase. Xylose and nitrogen were further consumed and the culture reached carbon (xylose)

limitation after 35 h of incubation, whereas there was still enough nitrogen left. In this phase,

pyruvic acid and lactic acid were produced and reached maximal concentrations of 113 mg L-1

and 11 mg L-1, respectively, after 27 h of incubation. Both acids were further consumed and

depleted from the medium after 35 h of incubation. Accumulation of pyruvic acid and lactic

acid cannot be the reason for the transition from Phase 1 to Phase 2 because the concentrations

of both acids were too low to be inhibiting [181]. Phase 3: Stagnation phase (35 – 54 h).

Upon depletion of xylose no significant change in biomass and P4HB content took place. The

cells consumed neither the nitrate provided nor the Na-4HB completely. The P4HB

accumulation rate was in the range of 0.027 g g-1 h-1, similar to that found in Fig. 4.3. The

consumed Na-4HB was almost completely converted into polymer with a yield YP4HB/Na-4HB of

92% g of carbon from P4HB per g of carbon from Na-4HB.


112

Fig. 4.4: P4HB production in batch culture in 1 L bioreactors. E. coli JM109 (pKSSE5.3) were

grown in modified E2 medium with 10 g L-1 xylose and 4 g L-1 Na-4HB at 32°C with an

agitation of 500 rpm. The substrate consumption and product formation were followed with

time. Error bars represent measurement errors of the same sample in triplicates.

0

10

20

30

40

50

60

70

0

1

2

3

4

5

6

0 10 20 30 40 50 60

P4

HB

con

ten

t (%

w w

-1)

Na-

4H

B c

on

cen

trat

ion

(g L

-1);

P4

HB

con

cen

trat

ion

(g L

-1)

Time (h)

Na-4HB P4HB concentration PHA content

-5

-3

-1

1

3

5

7

9

11

-2

-1

0

1

2

3

4

5

0 10 20 30 40 50 60

Xylo

se (

g L

-1);

OD

60

0

lnO

D6

00;

Nit

rogen

(g L

-1)

; C

DW

(g L

-1)

Time (h)

LN OD600 CDW Xylose concentration OD

0

0,1

0,2

0,3

0,4

0

30

60

90

120

0 10 20 30 40 50 60

Nit

rogen

(g L

-1)

Pyru

vic

aci

d (

mg L

-1);

Lac

tic

acid

(m

g L

-1)

Time (h)

Pyruvic acid Lactic acid Nitrogen

0,01

0,1

1

0 10 20 30 40 50 60

Pro

du

ctiv

ity

(g P

4H

B g

CD

W -1

)

Time (h)

1

10

100

0,01

0,1

1

10

0 20 40 60

P4

HB

con

ten

t (%

w w

-1)

P4

HB

(g L

-1)

Time (h)

P4HB

concentration


113

Discussion

Despite the fact that bioprocesses for recombinant production of P3HB in E. coli have been

studied extensively [182, 183], the biosynthesis of P4HB in E. coli has not been yet investigated

in depth. Several reports have described the P4HB synthesis and accumulation in E. coli [64,

65, 174]. However, neither physiological and cultivation conditions, nor the external factors

that may influence P4HB accumulation have been studied yet in detail. For this reason, we

attempted to address two issues in this work. The first issue was whether or not P4HB can be

produced from Na-4HB efficiently in combination with xylose as growth substrate. The second

issue was to tackle how P4HB synthesis can be stimulated. Our results demonstrate that P4HB

can be synthesized efficiently by combining xylose and 4HB and its production can be enhanced

reproducibly by an unknown factor, either nutrient depletion or product inhibition.

To reach efficient P4HB production, cultures exhibiting high specific growth rate, high biomass

concentration and high levels of P4HB content are desired. Since the metabolic status, including

the concentrations of metabolites and the rate of metabolite formation may be different from

one strain to another, it is very understandable that rates of P4HB synthesis and levels of P4HB

accumulation will be different from one to another. Previously, it has been reported that P3HB

production can differ dramatically by using different E. coli strains, e.g. the wild-type E. coli

K12 synthesized 0.4 g L-1 P3HB, whereas XL1-Blue produced 7.2 g L-1 P3HB under the same

conditions [182, 183]. In this study, we have chosen six E. coli strains originated from B strain

(BL21(DE3)) and K12 strains including the wild-type (W3110) and the K12 derivatives (DH5α,

JM109, XL1-Blue, S17-1). JM109 seems to have the best physiological background for P4HB

synthesis, whereas the worst performers were W3110 and BL21(DE3). The latter two strains

grew fast, and used the carbon source mainly for biomass formation but produced little amount

of P4HB (Fig. 4.1).


114

Previously it has been reported that using E. coli XL1-Blue carrying pKSSE5.3, a P4HB

concentration of about 4.0 g L-1 and P4HB content of 36% (w w-1) could be obtained by a fed-

batch culture on M9 medium containing glucose and yeast extract and 18 g L-1 of 4HB [65].

The conversion yield of the precursor 4HB to P4HB (g carbon : g carbon) was about 24%.

Recently, Zhou et al. reported that E. coli JM109 mutant carry two plasmids reached about 1.9

g L-1 P4HB and 35% (w w-1) P4HB using LB rich medium containing glucose in a batch culture

[67]. Two antibiotics were needed to keep the plasmids and LB rich medium is costly. The

authors also showed that in a fed-batch fermentation 7.5 g L-1 P4HB could be achieved by using

LB medium containing a total of 90 g L-1 glucose after 52 hours [67]. The conversion yield of

the precursor glucose to P4HB (g carbon : g carbon) was about 10.5%. In the current study, we

achieved 4.3 g L-1 P4HB and 67% (w w-1) P4HB in a batch culture using the described medium.

The consumption of the precursor 4HB was almost complete with a conversion yield YP4HB/Na-

4HB of 92% g g -1. Even though the cost of 4HB is higher than glucose, the price of 4HB can be

significantly reduced by using gamma-butyrolactone as the precursor for chemical synthesis of

4HB (see Methods section). Hence, the process developed here is an efficient for P4HB

production.

In earlier studies, addition of 4HB at the beginning of a cultivation was found to be the best for

cell growth and P4HB production [65]. Here, we observed no difference in cell growth and

P4HB synthesis between adding 4HB at the beginning and at the end of the exponential growth

phase (Fig. 4.3). P4HB synthesis was initiated only at the end of exponential growth, even when

4HB was supplied right at the start. In contrast to P3HB accumulation in E. coli, where the

polymer is synthesized during cell growth [184], P4HB production has been found to be

distinctly separated from exponential cell growth in our experiments. The end of exponential

growth caused by either product inhibition or nutrient limitation stimulated P4HB synthesis. It


115

seems that the cell growth and P4HB production compete with each other for the same nutrients.

As indicated from the results shown in Figure 4.1, both W3110 and BL21(DE3) strains grew

fast and reached high final biomass but accumulated only a negligible amount of P4HB.

Furthermore, when the conditions are favored for cell growth e.g. at 37°C, P4HB is

disadvantaged (Fig. 4.2). These results suggest that nutrients are directed mainly into the

tricarboxylic acid (TCA) cycle for cell growth rather than into P4HB synthesizing pathway. We

also did not observe the accumulation of acetic acid during the whole cultivation period. This

seems to be due to the efficient utilization of excessive acetyl-CoA for the synthesis of P4HB,

which would otherwise form acetic acid [185].

Taking advantage of the knowledge acquired previously and our findings in this study, we

propose a model to explain the metabolism of P4HB synthesis in recombinant E. coli:

Introducing PHA synthase (PhaC) from R. eutropha and 4-hydroxybutyrate CoA-transferase

(OrfZ) from C. kluyveri into E. coli would result in the establishment of a new metabolic

pathway, which competes with several existing pathways leading to citrate and acetate

formation and to fatty acid synthesis (Fig. 4.5). When the available nutrients and energy are

used for cell growth, P4HB would hardly be synthesized. When the cell growth slows down /

stops due to nutrient limitation other than carbon starvation, P4HB synthesis can then be

initiated. The reduction or stop of cell growth cannot be caused by carbon limitation because


116

the cells still need the essential nutrients for maintenance. When xylose limitation occurred,

P4HB synthesis also terminated (Fig. 4.4).

Fig 4.5: Hypothetic metabolic pathway of P4HB synthesis from Na-4HB in recombinant E. coli

JM109 (pKSSE5.3). Green color represents growth phase, blue color represents P4HB

synthesis phase.

Conclusions

In this study, we compared for the first time the cell physiology of different E. coli strains

hosting the same plasmid pKSSE5.3 with respect to their growth on xylose and P4HB

accumulation under different growth conditions. Unlike what has been reported previously, the

P4HB synthesis was found to be separated from the cell growth, namely P4HB synthesis mainly

takes place after the end of the exponential growth phase. Under the tested conditions, P4HB

Acetyl-CoA

4HB-CoA

HS-CoA

P4HB

Acetate

4HB

Fatty acid

synthesis Pyruvate

Biomass / CO2

TCA cycle

Glucose Xylose

Growth phase

P4HB accumulation phase

OrfZ

PhaC


117

contents in the range of 58 to 70% (w w-1) and P4HB concentrations in the range of 2.8 to 4.3

g L-1 were obtained with a conversion yield YP4HB/Na4HB of 92% w w-1. These results were

achieved here by simple batch cultures, which was only possible previously through fed-batch

high cell density cultures. However, to further improve the productivity of the P4HB production

process for industrial applications, high-cell density cultures will need to be investigated and

employed.


SLM designed and performed the experiments, prepared and revised the manuscript. MZ and

TE participated in designing the experiment and in revising the final manuscript. LTM revised

the final manuscript. QR designed and supervised the experiments, prepared and revised the

manuscript. All authors read and approved the final manuscript.

Acknowledgement

We thank Karl Kehl for IC measurements and Melisa Novelli for technical assistances. We

thank Prof. Guoqiang Chen (Tsinghua University) for kindly providing the plasmid pKSSE5.3.

Chapter 5

Improved productivity of poly(4-hydroxybutyrate)

(P4HB) in recombinant Escherichia coli using

glycerol as the growth substrate with fed-batch

culture

Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q

Microbial Cell Factories 2014, 13:131

doi:10.1186/s12934-014-0131-2

Chapter 5: Improved productivity of P4HB using glycerol

120

Abstract

The most successful polyhydroxyalkanoate (PHA) in medical applications is poly(4-

hydroxybutyrate) (P4HB), which is due to its biodegradability, biocompatibility and

mechanical properties. One of the major obstacles for wider applications of P4HB is the cost of

production and purification. It is highly desired to obtain P4HB in large scale at a competitive

cost.

In this work, we studied the possibility to increase P4HB productivity by using high-cell density

culture. To do so, we investigated for the first time some of the most relevant factors influencing

P4HB biosynthesis in recombinant Escherichia coli. We observed that P4HB biosynthesis

correlated more with limitations of amino acids and less with nitrogen depletion, contrary to

the synthesis of many other types of PHAs. Furthermore, it was found that using glycerol as the

primary carbon source, addition of acetic acid at the beginning of a batch culture stimulated

P4HB accumulation in E. coli. Fed-batch high cell density cultures were performed to reach

high P4HB productivity using glycerol as the sole carbon source for cell growth and 4HB as

the precursor for P4HB synthesis. A P4HB yield of 15 g L-1 was obtained using an exponential

feeding mode, leading to a productivity of 0.207 g L-1 h-1, which is the highest productivity for

P4HB reported so far.

We demonstrated that the NZ-amines (amino acids source) in excess abolished P4HB

accumulation, suggesting that limitation in certain amino acid pools promotes P4HB synthesis.

Furthermore, the enhanced P4HB yield could be achieved by both the effective growth of E.

coli JM109 (pKSSE5.3) on glycerol and the stimulated P4HB synthesis via exogenous addition

of acetic acid. We have developed fermentation strategies for P4HB production by using

glycerol, leading to a productivity of 0.207 g L-1 h-1 P4HB. This high P4HB productivity will

decrease the total production cost, allowing further development of P4HB applications.


121

Background

Polyhydroxyalkanoates (PHAs) are natural polyesters that have gained special interest due to

their biodegradability and biocompatibility [34, 132, 165, 186]. PHAs can be stored by a wide

variety of microorganisms as intracellular reserve materials. They are accumulated when the

bacterial cells experience nutrient-limited growth conditions other than carbon. Up to now,

more than one hundred different monomers have been reported to be incorporated as building

blocks into bacterial PHAs, resulting in different material properties of the polymers [22, 46,

187, 188].

One of the most promising PHAs for medical applications is poly(4-hydroxybutyrate) (P4HB)

[53]. This homopolymer is a strong and flexible material, which can be employed for instance

for tissue engineering and drug delivery. In addition, P4HB is biocompatible and extremely

well tolerated in vivo due to the fact that hydrolysis of P4HB yields 4HB, which is a common

metabolite in the human body [38]. This biopolymer was the first and so far only PHA-

based material approved for clinical application as absorbable suture (TephaFLEX®) by the

FDA. Other applications of P4HB are currently under investigation, for example, Opitz and

coworkers successfully produced an ovine, aortic blood vessel substitute using bioabsorbable

P4HB scaffolds [189]. However, the high cost of P4HB hinders its wider applications [132]. In

order to have sufficient material available for application studies and to reduce production cost,

much research has been focused on the efficient production of P4HB by increasing the amount

of biopolymer accumulated in the cells. Surprisingly, there are no reports in the literature

documenting the use of high cell density (higher than 20 g L-1) processes to reach high P4HB

productivities. High productivity can be obtained by combining cultivation procedures to

achieve maximum polymer accumulation per cell with those allowing fast growth to reach high

cell densities. High cell density processes allow increasing the productivity of accumulated


122

metabolites with simultaneously decreasing the production cost as a result of a lower culture

volume (smaller bioreactors) and shorter fermentation time. So far there is no generally

accepted value to be defined as high cell density [190]. Different studies have considered

different values of cell dry weight (CDW), for example, Restaino and coworkers reported a

high cell density of 22 g CDW per liter for E. coli culture [122], whereas Yamanè and Shimizu

mentioned that high cell density cultivation is achieved when reaching about cell concentrations

of 50 g CDW per liter [118].

Generally, high cell densities are reached by fed-batch cultures using a pulse, linear or

exponential feed of the limiting carbon substrate. It was reported that exponential feeding

allows to achieve cell concentrations up to 148 g L-1 using glycerol as carbon source with

Escherichia coli TG1 cells [191]. To increase productivity, it is important to understand the

factors stimulating P4HB accumulation. In earlier work using recombinant E. coli, we identified

three physiological phases during P4HB production: i) the “growth phase”, in which cells grew

exponentially, ii) the “accumulation phase”, in which cells stopped dividing and started to

accumulate P4HB, and iii) the “stagnation phase”, in which both cell proliferation and P4HB

accumulation stopped while the total biomass remained constant [66]. Hence, under this

condition P4HB synthesis was found to be distinctly separated from cell growth and to occur

after exponential cell growth stopped. This is different from the synthesis of other types of

PHAs in recombinant E. coli [186, 192].

While the development of a highly efficient fermentation process constitutes one part of the

optimization procedure, the use of a cheap carbon substrate is another crucial factor that allows

reducing production costs significantly. For example, the hemicellulose derivative xylose can

be used as an industrially relevant carbon source for growth of E. coli strains in general [92]

and for P4HB homopolymer production in particular [66]. Glycerol is another interesting


123

carbon source because it currently accumulates as a waste byproduct during biodiesel

production [99], and therefore, production of higher value products from crude glycerol is of

primary interest. Glycerol, which can be used both as carbon and energy source, enables cheap

production of valuable synthons, for example 1,3-propanediol, dihydroxyacetone, ethanol,

succinate, and propionate [103] and has been tested as growth substrate for E. coli in fed-batch

processes to reach high cell density [193]. Advancements in metabolic engineering made it

possible to produce many heterologous products such as proteins [194], biofuels [195], and

PHAs [132, 186] in E. coli strains at high cell density. A recent study demonstrated that crude

and refined glycerol from biodiesel industry can be used as carbon substrate to accumulate

medium-chain-length PHAs by Pseudomonas mediterranea and P. corrugate [196].

In this study we investigated the influence of different nutrient concentrations on P4HB

synthesis in E. coli JM109 (pKSSE5.3), a strain harboring the genes essential for P4HB

production from 4HB. We further tested whether or not refined glycerol can be used as the

growth substrate for P4HB production in high cell density cultures. It was found that acetate

can stimulate P4HB synthesis in recombinant E. coli grown on glycerol. Based on this study,

an efficient process was developed to reach high productivity of P4HB by using high cell

density cultures combined with acetic acid addition.

Methods

Bacterial strain and plasmid

Escherichia coli JM109 [176] carrying plasmid pKSSE5.3 was used throughout the whole

study. pKSSE5.3 harbors the PHA synthase gene (phaC) from Ralstonia eutropha and a 4-

hydroxybutyric acid-coenzyme A transferase gene (orfZ) from Clostridium kluyveri [64], and


124

enables E. coli strains to produce P4HB when 4HB is supplied in the culture medium. The

expression of phaC and orfZ on pKSSE5.3 is driven by their native promoter(s) [64].

Chemicals

All chemicals were purchased from Sigma-Aldrich (Buchs, Switzerland).

Synthesis of sodium 4-hydroxybutyrate (Na-4HB)

Na-4HB was synthesized by hydrolysis of the corresponding lactone. The synthesis was

performed as described previously [66]. In detail, a 4 M NaOH solution was prepared and mixed

slowly with 4 M of -butyrolactone on ice. The reaction mixture was cooled down to room

temperature and analyzed by HPLC/MS [66, 147]. An almost 100% conversion of -

butyrolactone to Na-4HB was achieved.

Media and cultivation conditions

Shake flasks experiments

Growth studies were performed in 1 L shake flasks containing 200 mL of modified E2 medium

and 10 g L-1 of carbon source glycerol. One g L-1 of NZ-amines, 100 µg mL-1 ampicillin and 4

g L-1 of Na-4HB were added at the beginning of the cultivation. NZ-amines are casein

enzymatic hydrolysates with a total amino acid content of approximately 0.89 g g-1. Cultures

were incubated at 32°C and 150 rpm based on our previous study [66]. Modified E2 medium

was composed of the following components: NaNH4HPO4·4H2O 3.5 g L-1, KH2PO4 3.7 g L-1

and K2HPO4 7.5 g L-1 dissolved in distilled water. One mL L-1 of 1 M MgSO4·7H2O and 1 mL

L-1 of trace elements (TE) dissolved in 1 M HCl were added. TE contains FeSO4·7H2O 2.78 g

L-1, CaCl2·2H2O 1.47 g L-1, MnCl2·4H2O 1.98 g L-1, CoCl2·6H2O 2.38 g L-1, CuCl2·2H2O 0.17

g L-1, and ZnSO4·7H2O 0.29 g L-1. LB was used as the preculture medium to inoculate the main

culture to an initial OD600 between 0.2 and 0.3.


125

Bioreactor experiments

Experiments of identification of influencing factors in batch culture

E. coli JM109 (pKSSE5.3) cells were grown at 32°C in 1 L bioreactors (Infors AG, Bottmingen,

Switzerland) containing modified E2 medium supplemented with 10 g L-1 xylose, 4 g L-1 Na-

4HB, 1 g L-1 NZ-amines and 0.015 g L-1 thiamine. Preculture medium had the same composition

as the one for the main culture. The initial OD600 value in bioreactors was always between 0.1

and 0.3 units. Temperature was controlled at 32°C and pH was maintained at 7.0 by automated

addition of 25% NaOH or 2 M H2SO4. The dissolved oxygen tension was monitored

continuously with an oxygen probe and maintained at 30% of oxygen saturation.

High cell density culture experiments

In order to improve the productivity, high cell density cultivations were performed using E. coli

JM109 (pKSSE5.3). Modified M9 medium instead of modified E2 medium was used in these

studies because modified M9 medium was reported to be suitable for high cell density culture

of E. coli JM109 [197]. Modified M9 medium contained (NH4)2HPO4 4 g L-1, KH2PO4 13.3 g

L-1, (NH4)2SO4 1 g L-1, glycerol 20 g L-1, Na-4HB 6 g L-1, and NZ-amines 0.5 g L-1. After

autoclaving the medium, 10 mL L-1 of trace elements composed of CaCl2 2.5 g L-1, CuCl2·4H2O

0.075 g L-1, FeCl3·4H2O 3.525 g L-1, Zn(CH3COO)2 0.65 g L-1, MnCl2·4H2O 0.75 g L-1,

CoCl2·6H2O 0.125 g L-1, H3BO3 0.15 g L-1, NaMoO4·2H2O 0.125 g L-1 and Na2EDTA 0.625 g

L-1 were added to the medium. In addition, 5 mL L-1 of MgSO4·7H2O 1 M, thiamine 0.015 g L-

1, and ampicillin 100 mg L-1 were filter sterilized separately and added to the bioreactors before

inoculation. Preculture medium had the same composition as the one for the main culture. The

initial OD600 value in bioreactors was always between 0.1 and 0.3 units. Temperature was

controlled at 32°C and pH was maintained at 7.0 by automated addition of NH4OH 7.7 M or


126

H2SO4 2 M. The dissolved oxygen tension was monitored continuously with an oxygen probe

and maintained at 30% of oxygen saturation.

For exponential feedings, the substrate feeding rate (F) for controlling the specific growth rate

(µ) was determined as follows with neglecting the carbon substrate consumption for cell energy

maintenance. To get a time-dependent exponential feed, it is necessary to achieve a constant µ

that is lower than µmax. We started from the mass balance on the limiting substrate, which in

our case is the growth carbon substrate (glycerol). The consumption of growth limiting substrate

concentration according to the time can be expressed by:

𝑑𝑆

𝑑𝑡=

𝐹

𝑉 (𝑠0 − 𝑠) − 𝑞𝑠 𝑥 (1)

where s0 is the limiting substrate concentration (g L-1) in feeding medium and s is the actual

growth limiting substrate concentration (g L-1) in culture broth, x is the actual biomass

concentration (g L-1), YX/S is the growth yield (g g-1) for the limiting substrate and qs is the

specific substrate consumption rate (g g-1 h-1).

Because the cell density in the fed-batch is very high and s0 therefore consumed rapidly, it can

be stated that s << s0 and 𝑑𝑠

𝑑𝑡 ≈ 0. Consequently, equation 1 can be modified to:

𝐹(𝑡) =𝑞𝑠 (𝑥𝑉)𝑡

𝑠0 (2)

The biomass concentration (x) and the volume of the culture (V) increased with time, leading

to:

(𝑥𝑉)𝑡 = (𝑥0 𝑉0)𝑒µ𝑡 (3)

Where x0 and Vo are starting biomass concentration and the initial volume of culture,

respectively. Hence, the flow rate which enables recombinant E. coli to grow at a constant µ is

obtained in equation (4) by combining the equations (2) and (3).

𝐹(𝑡) =𝑞𝑠

𝑠0 (𝑥0𝑉0)𝑒µ𝑡 (4)


127

This is equivalent to:

𝐹(𝑡) = 𝐹0𝑒µ𝑡 (5)

This means one can formulate the starting flow condition Fo at t = 0 h as follows:

𝐹0 =µ

𝑠0 𝑌𝑋/𝑆 𝑥0 (6)

𝐹0 = µ 𝑉 (7)

The exponential feeding technique allows controlling the overflow metabolism of recombinant

E. coli in a fed-batch process. This technique makes it possible to grow the culture at a constant

specific growth rate and consequently the yield coefficient YX/S remains constant.

Test of plasmid stability

Cells at the end of cultivation were collected and a serial dilution of the cell suspension was

prepared. The suspensions were plated on the LB agar plate with or without ampicillin. The

plates were incubated overnight at 37°C and the colony numbers on plates with and without

ampicillin were counted and compared.

Analytical methods

Cell concentration

Growth of bacterial cells was followed by measuring optical density at 600 nm (OD600) using a

UV-visible spectrophotometer (Genesys 6, ThermoSpectronic, Switzerland).

Cell dry weight (CDW) was determined using 2 mL pre-weighed Eppendorf tubes. Two mL

culture broth were added into the tube and centrifuged at 10’000 g for 2 min. The cell pellet

was washed once with water. Cells were spun down again and the cell pellet was dried overnight

at 100°C, cooled down to room temperature in a desiccator and weighed. The weight difference

was used to determine the quantity of biomass per culture volume.


128

PHA content

To determine the PHA content and composition, the culture was centrifuged (8'500 g, 4°C, 15

min) and the cell pellet was washed once with water and lyophilized for 48 hours. Biomass in

the range of 20 - 50 mg was added to Pyrex vials. Then, 2 ml of 15% v v-1 H2SO4 in methanol

was added and mixed. Furthermore, 2 ml of methylene chloride containing benzoic acid (0.1 g

L-1) as internal standard were added. The suspension was boiled at 100°C for 2.5 h in an oven.

The samples were cooled on ice, and 1 ml of distilled water was added in order to extract the

cell debris into the aqueous phase. The solution was mixed by vortexing for 1 min. The

complete (upper) water phase was discarded, including droplets hanging on the tube wall. The

remaining methylene chloride phase was dried and neutralized by adding Na2SO4 and Na2CO3

powder, and 200 µl of the organic phase were filtered using a solvent resistant filter (PTFE,

0.45 µm) and transferred to a GC sample vial. Samples were analyzed using gas

chromatography (GC) (A200s, Trace GC 2000 series, Fisons Instruments, Rodano, Italy)

equipped with a polar fused silica capillary column (Supelcowax-10: length 30 m; inside

diameter 0.31 mm; film thickness 0.5 µm; Supelco, Sigma-Aldrich, Buchs, Switzerland) [163].

The methylation of P4HB resulted in 3 distinct peaks representing the methylester of 4HB, -

butyrolactone and the methyl ether of 4HB, respectively, which were also obtained if only Na-

4HB was subjected to methanolysis. These three peaks were also observed by others when

analyzing P4HB homopolymers [64, 66, 198].

Evaluation of glycerol limitation

The dissolved oxygen tension (pO2) was used as an indicator for glycerol consumption during

fed-batch cultures [199]. This is based on the fact that whenever the substrate in the medium is

about to run out and thus becomes a limiting factor, the pO2 increases rapidly. When the carbon

substrate is added to the culture, pO2 decreases to its former level.


129

Measurement of nitrogen

NH4+-nitrogen content was measured using an ammonium test kit following the manufacturer

instruction (Merck KGaA, 64271 Darmstadt, Germany). The detection range was from 0.01 to

3.0 NH4+-N mg L-1, above which dilution with distilled water was needed.

Acetate and Na-4HB measurements

Acetate and Na-4HB were measured by HPLC/MS (Agilent 1000 Series, Santa Clara, United

States for the HPLC unit, and Bruker Daltonics esquire HCT, Bremen, Germany for the MS

unit). Supernatant resulting from culture centrifugation at 10’000 g for 2 min was diluted to

0.01 to 0.1 mM with distilled water and loaded on a reversed phase C18 column (Gemini C18

5 micron, 250 mm x 4.60 mm, Phenomenex, U.K.). A gradient of diluted formic acid (0.1% v

v-1 in water) to 100% acetonitrile mixed with 0.1% v v -1 formic acid was applied as the mobile

phase. The flow rate was 0.8 mL min-1 and the gradient was completed after 25 minutes. The

peaks were detected by electrospray ionization (ESI) in negative mode [147]. The standard

curves for acetate and Na-4HB were recorded in the range of 0.01 to 1 g L-1 and 0.01 to 0.2 g

L-1, respectively.

Reproducibility

In this study, for each batch culture at least two independent experiments were performed, for

each fed-batch culture at least three independent experiments were performed. The absolute

values of cell density and P4HB content obtained from the independent experiments varied,

which is not surprising for biological systems. This could be caused by slight differences in

inoculum, cultivation conditions, sampling, and etc. However, the cell growth and P4HB

synthesis exhibited same patterns in the same set of independent experiments. In this report the

results obtained from one independent experiment were presented. Each individual sample was

measured in duplicates. The data presented here are the average numbers.


130

Results and Discussion

Previously, we observed that the recombinant E. coli strain JM109 (pKSSE5.3) synthesized

only small amounts of P4HB (about 10%) when glycerol was offered as carbon source [66]. In

this study, we attempted to utilize this inexpensive carbon source as the growth substrate for

P4HB synthesis by high cell density cultivation. To enhance P4HB production, we first set out

to identify the influencing factors for P4HB synthesis. It is difficult to conclude whether a factor

plays a significantly influencing role or not when the base value is low such as 10%, especially

when the factor has a negative impact. Thus, xylose, which could lead to 30-70% of P4HB [66],

was used as the growth carbon source for the investigation.

Identification of factors influencing P4HB synthesis

E. coli JM109 (pKSSE5.3) was cultivated in 1 L bioreactors containing modified E2 minimal

medium. Various factors were tested for their influence on P4HB synthesis: carbon, nitrogen

and amino acid source, trace elements and magnesium. As described previously [66], three

phases (growth, accumulation and stagnation phase) were observed for cultures A (with

standard medium containing modified E2 medium containing 10 g L-1 xylose, 4 g L-1 Na-4HB,

1 g L-1 NZ-amines and 1 mL L-1 trace elements), B (two times more xylose), C (five times more

nitrogen source NaNH4HPO4·4H2O), E (three times more trace elements), and F (three times

more magnesium), whereas culture D (five times more NZ-amines) exhibited no accumulation

phase (Fig. 5.1). Culture D reached a maximal OD600 and a maximal P4HB content of about

8.6 and 3% (w w-1), respectively. Culture A with the standard medium led to highest maximal

P4HB content of 65% (w w-1), while Cultures B, C, E and F reached a slightly lower maximal

P4HB content of 52%, 52%, 59%, 45%, respectively.


131

These results showed that NZ-amines (amino acids) in excess blocked P4HB synthesis, whereas

increased concentrations of carbon source, nitrogen source NaNH4HPO4·4H2O, trace elements

or magnesium did not impact P4HB synthesis significantly. Normally, PHAs accumulate in the

bacterial growth phase under nitrogen, phosphorous or oxygen limited conditions with an

excess of carbon source [34, 200].

It has been reported that recombinant E. coli does not require any nutrient limitation for

synthesis of poly(3-hydroxybutyrate) (P3HB) and produces P3HB in a growth-associated

manner even under nutrient-sufficient conditions [192]. In this study with a recombinant E. coli

strain, neither nitrogen nor carbon source in excess led to a significant reduction of P4HB

content, whereas excess of amino acids (NZ-amines) almost abolished P4HB synthesis (Fig.

5.1). It seems that amino acid limitation caused a halt of cell growth and triggered P4HB

accumulation.

Previously, we have tested a defined medium without addition of any amino acids for P4HB

synthesis and found that the chemically defined medium resulted in hardly any P4HB synthesis

[201]. Addition of a small amount of complex nitrogen sources such as NZ-amines promoted

considerably P4HB accumulation [201]. Therefore, other means than omitting amino acids in

the medium are needed to limit the intracellular amino acid pool for promoting P4HB synthesis.


132

Figure 5.1: Influence of various factors on growth and P4HB accumulation. E. coli JM109

(pKSSE5.3) was grown in 1 L bioreactors in modified E2 medium containing 10 g L-1 xylose,

4 g L-1 Na-4HB, 1 g L-1 NZ-amines, and 1 mL L-1 trace elements was used as standard medium.

Culture A: standard medium; Culture B: two times more xylose was added to the standard

medium, leading to 20 g L-1 xylose; Culture C: five times more nitrogen source

NaNH4HPO4·4H2O was added to the standard medium, leading to a final NaNH4HPO4·4H2O

concentration of 17.5 g L-1; Culture D: NZ-amine amount was increased by 5 fold, leading to 5

g L-1; Culture E: three times more trace elements were added, leading to 3 mL L-1; Culture F:

three times more magnesium was added, leading to 3 mM of MgSO4·7H2O. The data are the

average numbers of duplicates.

0

10

20

30

40

50

60

70

-3

-2

-1

0

1

2

3

0 20 40 60

% P

4H

B (

w w

-1)

LN

OD

600

Time (h)

LN OD % P4HB

Standard conditions A

0

10

20

30

40

50

60

70

-3

-2

-1

0

1

2

3

0 20 40 60

% P

4H

B (

w w

-1)

LN

OD

600

Time (h)

LN OD P4HB

NZ-amines influence D

0

10

20

30

40

50

60

70

-3

-2

-1

0

1

2

3

0 20 40 60

% P

4H

B (

w w

-1)

LN

OD

600

Time (h)

LN OD P4HB

Trace elements influence E

0

10

20

30

40

50

60

70

-3

-2

-1

0

1

2

3

0 20 40 60

% P

4H

B (

w w

-1)

LN

OD

600

Time (h)

LN OD P4HB

Xylose influence B

0

10

20

30

40

50

60

70

-3

-2

-1

0

1

2

3

0 20 40 60

% P

4H

B (

w w

-1)

LN

OD

600

Time (h)

LN OD % P4HB

Nitrogen influence C

0

10

20

30

40

50

60

70

-3

-2

-1

0

1

2

3

0 20 40 60

% P

4H

B (

w w

-1)

LN

OD

600

Time (h)

LN OD % P4HB

Magnesium influence F


133

Influence of acetate on P4HB synthesis

To artificially obtain amino acid limitation, one possibility is to add weak organic acids to the

culture medium. It has been reported that the growth inhibitory effect of acetic acid on E. coli

is due to its influence on the amino acid (e.g. methionine) pool in the cells: the more acetic acid

produced, the smaller the methionine pool becomes, leading to restriction of cell growth [202].

Recently we have reported that addition of propionic acid to the culture medium stimulates

P4HB accumulation in recombinant E. coli grown on glycerol. This stimulating effect was

significantly weakened by addition of exogenous methionine but not by cysteine, suggesting

that propionic acid enhances P4HB synthesis at least partially by reducing the intracellular

methionine pool [201]. Whether propionic acid also influences other amino acid pools is not

not known. In this study, we further investigated whether the extracellular addition of acetic

acid would enhance P4HB synthesis. Glycerol is a simple polyol compound and a side product

from the biodiesel industries. E. coli grown on glycerol generates lower amounts of acetic acid

than on xylose or glucose [172, 191]. E. coli JM109 (pKSSE5.3) was grown in 1 L shake flasks

containing modified E2 medium. A concentration of 10 g L-1 of glycerol was added with or

without 2 g L-1 acetic acid at the beginning of the cultivation. With acetic acid a maximal

content of 23% w w-1 P4HB was obtained, whereas without only 12% w w-1 was achieved (Fig.

5.2A). To confirm that the observed enhanced P4HB content was not caused by a reduced

growth rate due to the addition of acetic acid, 1 g L-1 instead of 2 g L-1 acetic acid was added at

the beginning of the cultivation on glycerol. The cultures with or without 1 g L-1 acetic acid

showed the same growth rate of 0.31 h-1 (Fig. 5.2B); however, the culture with addition of acetic

acid accumulated much more P4HB than the one without (Fig. 5.2B). Thus, it can be speculated

that the P4HB synthesis is stimulated by acetic acid addition through reduction of the

intracellular amino acid pool rather than a reduction in specific growth rate, similar to the

findings reported previously [201].


134

Figure 5.2: E. coli JM109 (pKSSE5.3) grown in modified E2 medium supplemented with or

without acetate in shake flasks. 10 g L-1 glycerol was used as the main carbon source. A: 2 g L-

1 acetate was added to the culture; B: 1 g L-1 acetate was added to the culture. The data are the

average numbers of duplicates.

Previously, it has been reported that the molar fraction of 4HB in the P(3HB-co-4HB)

biosynthesis by R. eutropha was increased significantly from 38 to 54 mol% by the addition of

a small amount of acetic acid or propionate [168]. The authors suggested that acetate is able to

increase acetyl-CoA pool, inhibit the ketolysis of 4-hydroxybutyryl-CoA to two molecules of

acetyl-CoA, and consequently increase 4HB fraction. If this hypothesis is valid for E. coli, E.

coli (pKSSE5.3) would be able to utilize 4HB as a sole carbon source for cell growth. However,

E. coli JM109 (pKSSE5.3) is not able to grow on medium containing 4HB as the sole carbon

source and cannot use 4HB as a growth substrate even when combined with another growth C-

source [66]. Furthermore, we have recently showed that propionic acid enhances P4HB

synthesis by reducing the intracellular methionine pool [201]. Therefore, the hypothesis that

addition of acetate stabilizes 4-hydroxybutyryl-CoA from ketolysis and consequently leads to

a higher 4HB fraction in polymers is not valid here. The results obtained further confirmed the

0

10

20

30

40

50

-2

-1

0

1

2

3

0 10 20 30 40 50

% P

4H

B (

w w

-1)

LN

OD

600

Time (h)

LN OD (without acetate)LN OD (with 2 g/L acetate)P4HB (without acetate)P4HB (with 2 g/L acetate)

A B

0

10

20

30

-2

-1

0

1

2

3

0 10 20 30 40 50

% P

4H

B (

w w

-1)

LN

OD

600

Time (h)

LN OD (without acetate)LN OD (with 1 g/L acetate)% P4HB (without acetate)% P4HB (with 1 g/L acetate)


135

hypothesis reported in our previous work [66] that the pathways for cell growth and P4HB

synthesis compete with each other. When the available nutrients and energy are used for cell

growth, P4HB can hardly be synthesized. When the cell growth slows down / stops due to

nutrient limitation (e.g. amino acids) other than carbon starvation, P4HB synthesis can be

initiated. It has been reported that exogenous addition of acetic acid increases the acetyl-CoA

synthetase (ACS) activity in order to reach the equilibrium between the concentration of acetate

and acetyl-CoA, following the equation ATP + Acetate + CoA ACS AMP + Pyrophosphate +

Acetyl-CoA [203]. An overflow of acetyl-CoA, which is the donor of CoA to 4HB, increases

the accumulation of P4HB.

Influence of acetate addition on P4HB synthesis at different physiological growth stages

The influence of acetic acid addition at different physiological growth stages was studied during

high cell density cultivation. E. coli JM109 (pKSSE5.3) was grown on modified M9 medium.

Glycerol and Na-4HB were pulsed when needed during cell growth, which was indicated by an

increase of dissolved oxygen tension (pO2) signal. In culture A (Fig. 5.3), 2 g L-1 of acetic acid

was added at the beginning of the cultivation. The cells reached a maximal OD600 of 57.5 with

a P4HB content of 31% w w-1 at 64 h of cultivation. In culture B, 1 g L-1 acetic acid was added

twice, first at the beginning and again at the end of the growth phase (66 h). The cells reached

a maximal OD600 of 92.6 with a P4HB content of 30% w w-1 at 63 h. In culture C, 2 g L-1 acetic

acid was added at 48 h of cultivation. The cells reached a maximal OD600 of 53.5 at 66.25 h

with a P4HB content of 9% w w-1. The culture without any addition of acetic acid (culture D)

reached a maximal OD600 of 45.5 with a P4HB content of 10% w w -1 (Fig. 5.3). These results

demonstrated that the addition of acetic acid at the beginning of the cultivation enhances P4HB


136

A

accumulation dramatically, leading to a three-fold higher P4HB content than without acetic

improvement of P4HB production compared to the culture without any acetic acid.

Figure 5.3: Fed-batch strategy using acetic acid as stimulator for P4HB synthesis in E. coli

JM109 (pKSSE5.3) grown on modified M9 medium supplemented with 20 g L-1 glycerol, 6 g

L-1 Na-4HB, 0.5 g L-1 NZ-amine, 0.015 g L-1 thiamine and 100 mg L-1 ampicillin. Acetic acid

was added at different physiological states. For all cultures pulse-feeding started at 40 h of

cultivation: T = 40.5 h, addition of 12 g L-1 glycerol and 6 g L-1 Na-4HB; T = 45.75 h, addition

of 20 g L-1 glycerol; T = 63.75 h, addition of 10 g L-1 glycerol and 3 g L-1 Na-4HB; T = 72.25

h, addition of 20 g L-1 glycerol and 6 g L-1 Na-4HB; T = 76.75 h, addition of 10 g L-1 glycerol.

Culture A, addition of 2 g L-1 acetic acid at the beginning of the cultivation; Culture B, addition

of 1 g L-1 acetic acid at beginning and at the end of growth phase (66 h), respectively; Culture

C, addition of 2 g L-1 acetic acid after 48 h of cultivation; Culture D, no addition of acetic acid

to the culture. Arrows represent the addition of acetic acid. The data are the average numbers

of duplicates.

0

10

20

30

40

50

60

0

20

40

60

80

100

0 20 40 60 80 100

% P

4H

B (

ww

-1)

OD

600

Time (h)

OD P4HB

0

10

20

30

40

50

60

0

20

40

60

80

100

0 20 40 60 80 100

% P

4H

B (

ww

-1)

OD

600

Time (h)

OD P4HB

0

10

20

30

40

50

60

0

20

40

60

80

100

0 20 40 60 80 100

% P

4H

B (

ww

-1)

OD

600

Time (h)

OD P4HB

0

10

20

30

40

50

60

0

20

40

60

80

100

0 20 40 60 80 100

% P

4H

B (

ww

-1)

OD

600

Time (h)

OD P4HB

A C

B D


137

The reason why addition of acetic acid at the end of growth phase did not promote P4HB

synthesis could be that cell metabolism at the stationary phase is not active enough to convert

acetic acid to acetyl-CoA. When acetic acid is added at the beginning of the growth phase, it

can be converted to acetyl-CoA which can be further channelled to cell growth and maintenance

(during the growth phase) or P4HB synthesis (during the accumulation phase).

Influence of the feeding mode on P4HB product during fed-batch culture

Based on the above results, different nutrient feeding strategies were compared for P4HB

production in recombinant E. coli JM109 (pKSSE5.3) using glycerol as the carbon substrate

and acetic acid as the stimulator.

Pulse-feeding

The batch culture was performed using modified M9 medium. Glycerol, Na-4HB and acetic

acid were added when the carbon source glycerol was limited. Glycerol limitation was

monitored by pO2 signal as described in Materials and Methods. This culture grew with an

initial specific growth rate of 0.11 h-1 (Fig. 5.4). The concentration of Na-4HB was never

limiting and did not exceed 7 g L-1. The maximal Na-4HB consumption rate was 0.43 g L-1 h-1,

leading to a maximal specific consumption rate of 0.05 g g-1 h-1. The initially fed acetic acid

was not totally consumed when the first pulse of acetic acid was added to the culture broth after

30 h of cultivation. No visible impact on the cell growth was observed after this addition. After

39 h of cultivation, acetic acid was added once more, which was consumed quickly with a

specific consumption rate of 0.032 g g-1 h-1.


138

Figure 5.4: Time course of cell dry weight (CDW), P4HB content and P4HB concentration

during a pulse feeding fed-batch culture of E. coli JM109 (pKSSE5.3). Glycerol and 4-

hydroxybutyric acid were used as carbon source and precursor, respectively. Cultivation was

conducted at 32°C in a 1 L bioreactor with an initial volume of 600 mL of modified M9 medium

plus 20 g L-1 glycerol, 6 g L-1 Na-4HB, 2 g L-1 acetic acid, 0.5 g L-1 NZ-amines, 0.015 g L-1

thiamine and 100 mg L-1 ampicillin. Feeding solution was added to the bioreactor when glycerol

in the medium was close to depletion, indicated by pO2 signal.

Arrow #1, feeding of 12.5 g L-1 glycerol + 2.5 g L-1 Na-4HB + 1.1 g L-1 acetate at 30 h; Arrow

#2, feeding of 25.0 g L-1 glycerol + 2.1 g L-1 acetate at 39 h; Arrow #3, feeding of 2.5 g L-1 Na-

4HB at 41 h; Arrow #4, feeding of 25.0 g L-1 glycerol + 2.1 g L-1 acetate + 2.5 g L-1 Na-4HB at

44 h; Arrow #5, feeding of 25.0 g L-1 glycerol + 2.1 g L-1 acetate + 6 g L-1 Na-4HB at 49.5 h.

The data are the average numbers of duplicates.

The P4HB content decreased after 40 h of cultivation along with cell growth. However, the

P4HB concentration continuously increased, for example, during 9 h of cultivation from 40 h

to 49 h 2.63 g L-1 P4HB was accumulated, leading to a P4HB accumulation rate of 0.25 g L-1

0

2

4

6

8

10

12

0

10

20

30

40

50

60

70

80

90

0 10 20 30 40 50 60 70 80A

ceta

te (

g L

-1);

P4

HB

(g L

-1);

Na-

4H

B(g

L-1

)

OD

600;

CD

W (

g L

-1);

% P

4H

B (

w w

-1)

Time (h)

OD CDW

% P4HB Acetate concentration

Na-4HB concentration P4HB concentration

1

2

3

4 5


139

h-1. The OD600 increased continuously to 86 within 53 h, afterwards decreased to 75 during

prolonged cultivation from 53 h to 69 h (Fig. 5.4).

Linear-feeding

The cells were grown in modified M9 medium. A feeding solution containing 200 g L-1 acetic

acid and 200 g L-1 glycerol was used for the first 65 h of cultivation and then exchanged with a

feeding solution of 100 g L-1 acetic acid and 400 g L-1 glycerol for the next 69 h. Different feed

rates were compared: 0.5, 1, 2 and 3 mL h-1. It was found that the best feed rate for P4HB

synthesis was between 1 and 2 mL h-1 under the conditions used in this study. Below or above

this range P4HB content decreased. Thus, the feed rates of 1 and 2 mL h-1 were studied in more

details.

Fig. 5.5 shows that with the feeding rate of 1 mL h-1 (Culture A) the cells reached a maximal

OD600 value of 63.8, a CDW of 22.4 g L-1 and a P4HB content of 30% w w-1 after 119 h, leading

to a final product concentration of about 7 g L-1 P4HB. In Culture B (feeding rate of 2 mL h-1),

the cells reached a maximal OD600 value, a CDW and a P4HB content of 80.9, 32.9 g L-1, and

19% w w-1 after 119 h, respectively, leading to a yield of about 6 g L-1 P4HB. For both cultures,

the Na-4HB precursor was not limiting, however, the P4HB content decreased dramatically

after 40 h of cell growth.


140

Figure 5.5: High cell density cultivation with linear feeding mode of E. coli JM109 (pKSSE5.3). The feeding solution contained 200 g L-1 acetic acid

and 200 g L-1 glycerol for 65 h and then 100 g L-1 acetic acid and 200 g L-1 glycerol. Panel A: feeding rate of 1 mL h-1; B: feeding rate of 2 mL h-1.

Arrows represent the start of feeding. The data are the average numbers of duplicates.

0

3

6

9

12

15

0

20

40

60

80

100

0 30 60 90 120 150

P4

HB

(g L

-1);

Na-

4H

B(g

L-1

)

OD

60

0;

% P

4H

B(w

w-1

); C

DW

(g L

-1)

Time (h)

CDW

OD

% P4HB

Na-4HB concentration

P4HB concentration

B

0

3

6

9

12

15

0

20

40

60

80

100

0 30 60 90 120 150

P4

HB

(g L

-1);

Na-

4H

B (

g L

-1)

OD

600;

% P

4H

B (

w w

-1);

CD

W (

g L

-1)

Time (h)

CDW

OD

% P4HB


P4HB concentration

A


141

It seems that most of the cells generated during the late stage had difficulty to accumulate

P4HB; leading to a dilution of the P4HB content caused by cell divisions even if the overall

P4HB concentrations were increased. Previously, Song and co-workers have reported similar

phenomenon that almost no P4HB accumulated in newly-produced cells in the late stage during

a fed-batch experiment [65]. No explanation could be given. It cannot be caused by the plasmid

instability because at the end of the cultivations cells were taken and plated on LB agar with or

without ampicillin and were found to maintain at least 90% of the plasmid (data not shown).

Exponential feeding

The batch culture was conducted using modified M9 medium. Three different feeding rates of

0.02 h-1, 0.04 h-1 and 0.08 h-1 were tested in cultures A, B and C, respectively. The feeding

solution used for all three cultures was composed of 40 g L-1 Na-4HB, 300 g L-1 glycerol and

20 g L-1 acetic acid. The culture A reached a higher maximal OD600 of about 80 after 72.5 h of

cultivation (Fig. 5.6). Cultures B and C showed a similar maximal OD600 of about 100 after

72.5 h of cultivation (Fig. 5.6). No Na-4HB precursor limitation was observed for any of the

three cultivations. The exponential growth stopped at about 53 h, even though glycerol,

nitrogen, acetic acid and Na-4HB were found to be still available in the medium based on the

measurement described in the Materials and Methods (data not shown). A maximal P4HB

content of 34% w w-1 and a P4HB concentration of 15 g L-1 were obtained for culture A after

72.5 h of cultivation. These results demonstrate that concomitant addition of acetic acid,

glycerol and Na-4HB precursor in E. coli JM109 (pKSSE5.3) can lead to a high productivity

by using a slow exponential feeding.


142

0

4

8

12

16

0

20

40

60

80

100

120

0 20 40 60 80 100 120

P4

HB

(g L

-1);

Na-

4H

B (

g L

-1)

OD

600;

% P

4H

B(w

w-1

); C

DW

(g L

-1)

Time (h)

OD

% P4HB

CDW

P4HB concentration


0

4

8

12

16

0

20

40

60

80

100

120

0 20 40 60 80 100 120

P4

HB

(g L

-1);

Na-

4H

B(g

L-1

)

OD

600;

% P

4H

B(w

w-1

); C

DW

(g L

-1)

Time (h)

OD

% P4HB

CDW

P4HB concentration


A B

0

4

8

12

16

0

20

40

60

80

100

120

0 20 40 60 80 100 120

P4

HB

(g L

-1);

Na-

4H

B (

g L

-1)

OD

60

0;

% P

4H

B (

w w

-1);

CD

W (

g L

-1)

Time (h)

OD

% P4HB

CDW

P4HB concentration


C

Figure 5.6: High cell density cultivations of E.

coli JM109 (pKSSE5.3) with exponential feeding

mode. The feeding solution contained 40 g L-1

Na-4HB, 300 g L-1 glycerol, and 20 g L-1 acetic

acid. Controlled feeding rate was set for the

cultures A, B and C at 0.02, 0.04 and 0.08 h-1,

respectively. Arrows represent the start of

feeding. The data are the average numbers of

duplicates.


143

In summary, with the pulse feed strategy an addition of acetic acid at the beginning of the

cultivation led to a multi-fold increase in P4HB yield from 9% to 31% (w w-1) (Fig. 5.3). A

yield of 11.1 g L-1 and a P4HB productivity of 0.173 g L-1 h-1 within 64 h could be achieved.

With a linear feeding mode a lower yield was obtained than with pulse feeding (Table 5.1). The

best feeding rate was 1 mL h-1, leading to a P4HB yield of 6.8 g L-1 and a volumetric

productivity of 0.058 g L-1 h-1 over 118 h. Exponential feeding led to the maximal yield of 15

g L-1 P4HB in about 72.5 h with a feeding rate of 0.02 h-1, resulting in a volumetric productivity

of 0.207 g L-1 h-1 (Table 5.1). Previously, it has been reported that the production of P4HB

homopolymer using glucose as growth substrate and Na-4HB as precursor can reach a final

yield of 4.0 g L-1 and a P4HB productivity of 0.065 g L-1 h-1 in 62 h via a pulse feeding strategy

[65]. A recent publication showed that an E. coli recombinant JM109SG carrying two plasmids

could utilize solely glucose for P4HB production [67], and a P4HB yield of 7.8 g L-1 and a

productivity of 0.150 g L-1 h-1 were obtained by using LB medium containing yeast extract in a

pulse feeding fed-batch culture [67]. The productivity of 0.207 g L-1 h-1 obtained in this study

is the highest reported so far.

In this study, we also demonstrated that even though the cost of Na-4HB is relative high, it can

be significantly reduced by using gamma-butyrolactone as a low-cost precursor for chemical

synthesis of Na-4HB (see Methods section). Furthermore, Na-4HB was not used as the growth

substrate but the precursor for P4HB, thus only low amount was needed, e.g. a total of about

19 g L-1 Na-4HB was added to produce 11 g L-1 P4HB in the case of pulse feeding fed-batch

culture (Fig. 5.4).


144

Table 5.1: Summary of different feeding modes and their effect on P4HB production during fed-batch cultivations. The data are the average numbers

of duplicates.

Growth substrate /

stimulator /

precursor / Media

Feeding strategy

Culture

time (h)

OD600max

CDW

(g L-1

)

P4HB

content %

(w w-1)

Volumetric

yield P4HB

(g L-1

)

Volumetric

productivity

(g L-1 h-1)

References

Glycerol / acetate /

Na-4HB / modified

M9 medium

Pulse feed 64 77.9 42.8 26 11.5 0.180

This study

Linear feed 118 63.8 33.8 30 6.8 0.058

Exponential feed 73 81.5 43.2 33 15.0 0.207

Glucose / - /4HB /

M9 medium

Pulse feed 62 24.5 13.0 31 4.0 0.065 [65]

Glucose / - /yeast

extract / LB medium

Pulse feed 52 21.7 11.5 68 7.8 0.150 [67]


145

To further improve the productivity and reduce the cost of P4HB one of the imperative tasks is

to achieve P4HB accumulation in newly-produced cells in the late stage during a fed-batch

experiment, thus avoiding the dilution of P4HB content.

Conclusions

In this study, we demonstrated that the NZ-amines (amino acids source) in excess abolished

P4HB accumulation, suggesting that limitation in certain amino acid pools promotes P4HB

synthesis. This was validated by providing exogenous acetic acid to the cells, which most likely

resulted in the reduction of the intracellular amino acid pool. Furthermore, the enhanced P4HB

yield was achieved by both the effective growth of E. coli JM109 (pKSSE5.3) on glycerol and

the stimulated P4HB synthesis via exogenous addition of acetic acid. We have developed

fermentation strategies for P4HB production by using glycerol, leading to a productivity of

0.207 g L-1 h-1 P4HB with a yield of 15 g L-1, which is the highest yield for P4HB production

reported so far. This high P4HB productivity will decrease the total production cost, allowing

further development of P4HB applications.

Competing interests

The authors declare that they have no competing interest.


SLM designed and performed the experiments, prepared and revised the manuscript. MZ and

TE participated in designing the experiment and in revising the final manuscript. LTM revised

the final manuscript. QR designed and supervised the experiments, prepared and revised the

manuscript. All authors read and approved the final manuscript.


146

Acknowledgement

We thank Melisa Novelli for technical assistances. We thank Prof. Guoqiang Chen (Tsinghua

University) for kindly providing the plasmid pKSSE5.3. The Swiss Commission for Technology

and Innovation (CTI) is acknowledged for the financial support of this work through project

number 12409.2 PFLS-LS.

Chapter 6

The effect of molecular weight on the material

properties of biosynthesized poly(4-

hydroxybutyrate)

Boesel L F, Le Meur S, Thöny-Meyer L, Ren Q

International Journal of Biological Macromolecules 2014, 71:124

doi:10.1016/j.ijbiomac.2014.04.015

Sylvaine Le Meur has carried out following parts: the biosynthesis of P4HB and the polymer

extraction.

Chapter 6: Material properties of P4HB

148

Abstract

Poly(4-hydroxybutyrate) (P4HB) is a bacterial polyhydroxyalkanoate with interesting

biological and physico-chemical properties for the use in biomedical applications. The

synthesis of P4HB through a fermentation process often leads to a polymer with a too high

molecular weight, making it difficult to process it further by solvent- or melt-processing. In this

work P4HB was degraded to obtain polymers with a molecular weight ranging from 1.5 × 103 g

mol-1 to 1.0 × 106 g mol-1 by using a method established in our laboratory. We studied the effect

of the change in molecular weight on thermal and mechanical properties. The decrease of the

molecular weight led to an increase in the degree of crystallinity of the polymer. Regarding the

tensile mechanical properties, the molecular weight played a more prominent role than the

degree of crystallinity in the evolution of the properties for the different polymer fractions. The

method presented herein allows the preparation of polymer fractions with easier processability

and still adequate thermal and mechanical properties for biomedical applications.

Introduction

Poly(4-hydroxybutyrate) (P4HB) is a natural polyester that has been approved for use as an

absorbable suture by the FDA in 2007. P4HB is a polyhydroxyalkanoate, a family of polymers

synthesized by microorganisms as carbon and energy storage compounds.

The chemical synthesis of P4HB has been attempted; however, it is generally considered

impossible to produce the polyester by this method with sufficiently high molecular weight

necessary for most applications [204]. Furthermore, the chemically produced P4HB may

contain residual metal catalysts that are used in the chemical synthesis of the polymer. Thus,

P4HB is produced through a fermentation rather than a chemical process. To produce P4HB

homopolymers, recombinant Escherichia coli strains were used. By introducing the PHB


149

synthase gene (phbC) from Ralstonia eutropha and a 4-hydroxybutyric acid-coenzyme A

transferase gene (orfZ) from Clostridium kluyveri, E. coli strains XL1-Blue and JM109 were

able to produce P4HB when 4-hydroxybutyric acid (4HB) was supplied as a precursor in the

culture medium [64, 66]. It was also reported that an E. coli JM109 mutant carrying two

plasmids was able to synthesize P4HB using Lysogeny broth (LB) medium containing only

glucose without P4HB related precursor such as 4HB [67].

The interest on using P4HB in medical applications derives from its inherent biocompatibility

and adequate physical properties. Research has focused on heart valves, vascular grafts,

scaffolds, and sutures [53, 66]. Besides being biocompatible, the degradation process of P4HB

is also milder than that of other biomedical polymers: P4HB degrades via surface erosion,

which minimizes the burst release of acids [53]. Moreover, the degradation product, 4-

hydroxybutyrate, is a metabolite commonly found in the human body [38]. Recent studies have

shown that both fiber monofilaments [205] and fiber meshes [206] made of P4HB degraded

without causing any adverse reactions to the surrounding soft tissue (muscle and abdominal

wall, respectively). Regarding physical and chemical properties, P4HB provides a combination

of properties that makes it very useful in biomedical applications: solubility in a range of polar

solvents (e.g., acetone), elastomeric character at room and body temperature, low melt

temperature (that is, easy melt processability), high molecular weight, very high ductility

(>200%), and a moderate resorption rate in vivo [53].

Despite these characteristics and the large amount of data on in vivo animal studies [53, 205-

207], there has been little attention dedicated to the physical properties of P4HB. Specifically,

no work has concentrated on studying changes in mechanical and thermal properties of P4HB

as a function of molecular weight. Given that the bacterial synthesis of these polymers usually

leads to very high molecular weight (Mn ∼106 g mol-1) and that at such high values the melt


150

and solvent processability are compromised, we report in this study how the acid-catalyzed

hydrolysis affects the mechanical and thermal properties of the biosynthesized P4HB.

Experimental

Biosynthesis of P4HB

All chemicals were purchased from Sigma-Aldrich (Buchs, Switzerland). Escherichia coli

JM109 carrying plasmid pKSSE5.3 was used in this study for P4HB production. pKSSE5.3

contains a PHA synthase gene (phaC) from Ralstonia eutropha and a 4-hydroxybutyric acid-

coenzyme A transferase gene (orfZ) from Clostridium kluyveri [64]. The JM109 recombinant

cells were used to inoculate a 10 mL LB culture in a 50 mL flask. The cells were incubated at

37 °C and 150 rpm overnight. The culture was then used to inoculate 200 mL of preculture

using modified E2 medium in a 1 L shake flask with a dilution of 1:20 (v v−1). Modified E2

medium contained the following constituents: NaNH4HPO4 · 4H2O 3.5 g L−1, KH2PO4

3.7 g L−1, and K2HPO4 7.5 g L−1, dissolved in 1 L of water. One mL L−1 of 1 M MgSO4 · 7H2O

was added to the medium. One mL L−1 of trace elements (TE) dissolved in 1 M HCl was also

added. TE contained: FeSO4 · 7H2O 2.78 g L−1, CaCl2 · 2H2O 1.47 g L−1, MnCl2 · 4H2O

1.98 g L−1, CoCl2 · 6H2O 2.38 g L−1, CuCl2 · 2H2O 0.17 g L−1, ZnSO4 · 7H2O 0.29 g L−1.

10 g L−1 of xylose and 4 g L−1 of Na-4HB were used as the growth substrate and the precursor

for P4HB synthesis, respectively. One g L−1 of NZ-amines and 0.015 g L−1 of thiamine were

supplemented to support the growth and 100 μg mL−1 of ampicillin was added to maintain the

plasmid. The preculture was incubated at 150 rpm and 32 °C for 16 h. It was then transferred

to 600 mL modified E2 medium in a total volume 1.4 L bioreactor (Infors AG, Bottmingen,

CH) equipped with standard control units. The initial optical density (OD600) value in the

bioreactor was between 0.10 and 0.30. Temperature was controlled at 32 °C with an external


151

circulating water bath, and pH was maintained at 7.0 ± 0.1 by automatic addition of 25% NaOH

or 30% H3PO4. Dissolved oxygen tension was monitored continuously with an oxygen probe

(Infors AG, Bottmingen, Switzerland) and kept always above 30% oxygen saturation. The

agitation was set at 500 rpm.

Extraction of P4HB

P4HB was extracted directly from the lyophilized cells (1 mbar, 48–144 h). Cells were

transferred into pure dichloromethane (50 g dried cell biomass in 1.5 L solvent). After the

suspension was stirred at 60 °C for 90 min or at room temperature for 16 h, the solution was

filtered with pressure and concentrated by distillation at 40 °C and 400 mbar in a rotary

evaporator until the solution became viscous. The viscous solution was added dropwise under

stirring to a 6-fold quantity of ice-cold methanol. P4HB was precipitated and dried in a vacuum

dryer (VTR 5036, Heraeus, Hanau, Germany) for at least 24 h at 30 °C and 30 mbar. The

polymer was stored at −20 °C.

Degradation procedure

A solution of 1% P4HB in chloroform was prepared by dissolving the polymer overnight at

room temperature in the solvent. The catalyst solution was prepared by adding 66 μL of

sulphuric acid (95–97%) in 10 mL methanol. Afterwards, the polymer solution was heated in

reflux at 55 °C until evaporation of chloroform started, at which point the catalyst solution was

added (t = 0). At each predefined degradation time point, 500 mL of the degradation solution

were added to 500 mL pre-cooled water in a separation funnel, mixed, and allowed to separate.

The bottom phase, containing the degraded polymer, was then dropped into 1 L of stirred, ice-

cold methanol in order to precipitate it. The polymer was subsequently removed from the

methanol, dried overnight under vacuum at 40 °C and stored at −20 °C until further use.


152

Characterization

The native and degraded polymers were characterized by gel permeation chromatography

(GPC), differential scanning calorimetry (DSC) and tensile tests. GPC was performed using a

differential refractive index detector (Viscotek, Houston, USA). Each polymer sample was

dissolved in chloroform (0.1%), and aliquots of 100 μL of the polymer solution were injected

and separated on three sequentially coupled size exclusion chromatography (SEC) columns

(300 mm × 8 mm, pore sizes of 103, 105, and 107 Å, Polymer Standard Services - PSS, Mainz,

Germany) at 35 °C, applying a flow rate of 0.5 mL min-1 of chloroform. Calibration was

performed with 10 narrow standard polystyrene (PS) samples supplied by PSS (from 2 × 103 g

mol-1 to 2.13 × 106 g mol-1). Both number–average (Mn) and weight-average (Mw) molar masses

were determined, as well as the polydispersity index (PI = Mw/Mn).

DSC was performed using a Mettler-Toledo DSC822e apparatus. The following 3-step program

was applied to all specimens: first heating from −100 °C to 100 °C at 10 °C min-1; cooling to

−100 °C at a cooling rate of −10 °C min-1; second heating to 100 °C at 10 °C min-1. The glass

transition temperature (Tg) was obtained during the cooling run, while the melting temperature

(Tm) and the enthalpy of fusion (ΔHm) were obtained from both the first and the second heating

runs.

Mechanical tests were performed in tensile mode with dog-bone specimens in a Zwick Z100

equipped with a 100 N load cell. The specimens (3 mm width and 18 mm parallel length) were

prepared by solvent casting solutions of the polymers in chloroform. Due to the high ductility

of most specimens, two loading speeds were used: 8.33 × 10−5 m s-1 (corresponding to 5 mm

min-1) up to an elongation of 2% for a more accurate determination of tensile modulus, and

8.33 × 10−4 m s-1 (corresponding to 50 mm min-1) for higher elongations. The following


153

mechanical properties were determined: tensile strength (σt), yield stress (σy), tensile modulus

(Et), elongation at yield (ϵy), and elongation at break (ϵb).

Statistical data analysis was performed with the “R” program and the “R-commander” package

[208, 209]. One-way analysis of variance (ANOVA) was used to test for differences in means

of groups of samples, with Tukey Contrasts being subsequently used for the multiple

comparisons of means.

Results and discussion

We have previously optimized the biosynthesis of P4HB [66]. However, the material properties

of the polymer have not been investigated. In this paper, we measured thermal and mechanical

properties of both the synthesized polymer and the degraded ones.

Evolution of the molecular weight

Table 6.1 displays the evolution of molecular weight of P4HB degraded for the specified period

of time. Samples degraded for more than 16 h could not be collected at amounts sufficient to

allow further testing. The main reason was the increased difficulty in precipitating such short

oligomers in methanol, resulting in a too low yield of low molecular weight fragments. This is

evidenced by the morphology changes and mass reduction of the obtained polymers with

degradation (Fig. 6.1).


154

Table 6.1: Evolution of the molecular weight (in 103 g mol-1) during degradation.

Batch 1

Time (h) 0 0.25 0.5 1 2 4 8 16

Mw 2500 920 170 93 55 30 17 9.5

Mn 870 290 89 49 30 17 10 6

Batch 2

Time (h) 0 0.25 0.85 1.5 3 6

Mw 2000 350 60 30 10 5

Mn 1000 260 30 15 5 1.5

Batch 3

Time (h) 0 0.25 1 3 16 22

Mw 2100 250 60 38 27 17

Mn 520 170 29 19 51 9.2

Figure 6.1: Morphology change of the obtained P4HB after degradation. (a), (b), (c), (d), (e),

(f), (g) and (h) represent the P4HB after degradation of 0, 0.25, 0.5, 1, 2, 4, 8, and 16 h,

respectively.


155

As shown in Fig. 6.2, the methodology is also sensitive to the operating conditions: changes in

some of those lead to clear changes in the curve profile. However, the general tendency of decay

of molecular weight with degradation time was kept: the degradation followed a random chain

scission mechanism, where degradation time is proportional to the reciprocal of the molecular

weight (t ∝ 1 Mn-1) [210]. This mechanism is well described in literature for synthetic or bio-

based polymers [210, 211]. We have investigated in detail the effects of process parameters

(temperature, acid and/or methanol concentration) on the molecular weight evolution of

medium-chain-length PHAs for such polymers, whose degradation products are more

hydrophobic than ours, the linearity of a t × 1 Mn-1 curve is kept for the whole degradation time.

(P. Ketikidis, “Modeling molecular weight evolution of methanolyzed medium-chain-length

Poly(3-hydroxyalkanoates)”, personal communication). In the current study, and mainly due to

an increased methanol-solubility of short oligomers of P4HB when compared to mcl-PHA, the

curve deviates from the linearity for longer degradation times; accordingly, the curve profile

was also found to be more sensitive to the process parameters for longer times. Nevertheless,

the optimization of the degradation procedure was not the object of this study; the goal, instead,

was to determine changes in thermal and mechanical properties of our P4HB as a function of

molecular weight.


156

Figure 6.2: Evolution of the molecular weight with degradation time. Differences in the curve

profile arise from differences in operator, volume of the aliquot removed at each time point, or

in the method used to recover the polymer, showing the sensitivity of the degradation protocol

to the process parameters. Lines are only to guide the eyes.

Change of thermal properties and crystallinity

Table 6.2 shows the thermal properties of polymers obtained during batch 2. P4HB is a rubbery

polymer, with a Tg well below room temperature and low crystallinity. That means it may

crystallize even when stored at sub-zero temperatures. To account for this effect, we extracted

melting data (Tm and ΔHm) from both the first and second heating runs, while Tg was measured

during cooling.


157

Table 6.2: Thermal properties of original and degraded P4HB.

First heating run Second heating run Cooling

Mn (103 g mol-1) Tm (°C) −ΔHm (J g-1) Tm (°C) −ΔHm (J g-1) Tg (°C)

1000 69 63.8 57 36.5 -52

260 69 64.7 61 37.6 -52

30 69 70.5 63 42.5 -51

15 66 78.5 63 51.1 -49

5 69 85.5 61 56.4 -50

In the polymer range, Tm is usually independent of molecular weight, because the contribution

of the molecular weight-independent entropic and enthalpic terms are largely exceeded by those

of each repeating unit [212]. For example, in the case of P3HB, Yu and Marchessault have

shown that Tm is independent of the molecular weight of P3HB for Mn > 30, 000 g mol-1 [213].

In our case, the melting point was rather independent of the Mn for the whole range; there was

only a tendency to lower Tm for the original polymer (highest molecular weight) during the

second heating. Regarding the enthalpy of fusion (and, consequently, the degree of

crystallinity), two important trends are clearly visible: a monotonic increase in the enthalpy of

fusion for both heating runs, and a much higher value of the enthalpy in the first heating run as

compared to the second one. This is also accompanied by higher values of Tm for the first run.

The differences in Tm and ΔHm between the first and second cycles may be explained by the

preparation method: as described in section “Materials and Methods”, specimens were prepared

by precipitation in methanol, vacuum-drying at 40 °C, and storage at −20 °C. Therefore, enough

time and thermal energy has been supplied to allow a much higher extent of crystallization and,

simultaneously, the formation of crystals with less defects and/or thicker lamellae (what

increases the Tm). On the other hand, crystals melting during the second heating had less than

25 min (approximately the total time expended between Tg and Tm during cooling and second


158

heating) to be formed. Therefore, only a smaller amount of material could crystallize, resulting

in lower ΔHm. Moreover, during the melt crystallization, the chains do not have as high a

mobility as when in the dissolved state, which contributes both to a lower degree of crystallinity

(that is, lower enthalpy of fusion) and to the formation of crystals with thinner lamellae or more

defects (lower Tm). This effect is especially relevant for polymers of high molecular weight,

because the melt viscosity and chain entanglements are too high and chain mobility is too low.

This results in imperfect packing of the chains and less perfect crystals and could explain the

slightly lower Tm for the original P4HB, with Mn ∼ 106 g mol-1. It also leads to the decrease of

the enthalpy of fusion with increase in molecular weight for both heating runs: the easiness of

the large-scale molecular motions needed for chain folding and lamellae formation decreases

with increasing molecular weight.

Change of mechanical properties

We also determined the evolution of mechanical properties of degraded P4HB. Figure 6.3

shows a representative curve of each sample. Original P4HB (sample “t0”) shows a typical

behaviour for a semi-crystalline polymer, with a well-defined yield point, followed by

necking/cold-drawing and a last region of strain hardening [214]. With decreasing molecular

weight both the yield point and the necking region become less evident. The most degraded

sample (“t4”) was very brittle due to inhomogenity in the specimens. In fact, it was not possible

to prepare a defect-free film of this sample.


159

Figure 6.3: Tensile curves of a representative specimen of each sample of original and degraded

P4HB.

Table 6.3 displays a summary of the main mechanical parameters obtained from the curves.

Table 6.3: Mechanical properties of original and degraded P4HB.

Sample Mn (103 g mol-1) σt (MPa) Et (GPa) ϵb (%) σy (MPa) ϵy (%)

t0 520 28a 0.17a 520a 13a 17a

t1 290 17b 0.12b 450ab 9.6b 12b

t2 90 16b 0.12b 470ab 8.4b 10bc

t3 50 11bc 0.13b 220b 7.8bc 10bc

t4 30 5.3c 0.10b 10 5.3c 6.1c

The superscripts identify samples in the same column with significantly different values (at

p < 0.05) for the corresponding property. Tensile strength (σt), tensile modulus (Et), elongation

at break (ϵb), yield stress (σy), and elongation at yield (ϵy).

Different mechanical properties are influenced differently by the structure of the polymer. For

example, tensile strength depends on the number of ends of polymer chains and should therefore

follow a relation of the type: σt=a−b/Mn (1)


160

even if Mn is in the polymer range [212]. The modulus, on the other hand, is mainly influenced

by the degree of crystallinity; and elongation at break depends on both the degree of crystallinity

and molecular weight [212, 215]. Our data in Table 6.3 indicates for P4HB a higher sensitivity

of mechanical properties on the molecular weight than on the degree of crystallinity. Tensile

strength, for example, agrees fairly well with a relation of the type shown in equation (1) (Fig.

6.4). In fact, even the yield strength which, according to the discussion above should be more

dependent on the degree of crystallinity, follows the same trend (Fig. 6.4), being strongly

influenced by the molecular weight. Moreover, the modulus was roughly constant for all

degraded samples (no significant differences were observed among these samples). The main

reason for this is the small change in degree of crystallinity of degraded fractions when

compared to the original P4HB, as inferred from the enthalpy of fusion in Table 6.2. The

increase in crystallinity achieved by the decrease of Mn from 106 to 3 × 104 g mol-1 was of only

about 11%. This relatively small increase in crystallinity was therefore masked by the 17-fold

decrease in molecular weight of samples shown in Table 6.3.

Figure 6.4: Tensile (σt) and yield (σy) strength as a function of the molecular weight. The fitting

of each dataset with Eq. (1) is also shown: σt = 23.574 − 581103x (r2 = 0.81), and

σy = 11.703 − 217927x (r2 = 0.85).


161

Influence on solution and melt processing

As mentioned previously, the melt and solvent processability of bacterial synthesized P4HB is

compromised by its ultra-high molecular weight. With a Mn close to or even above 106 g mol-

1, P4HB is only soluble at low concentration in chlorinated solvents, and the molten polymer

does not flow, even at temperatures well above the Tm (Fig. 6.5 a). The degraded fractions, on

the other hand, show a typical polymeric behaviour: a viscous fluid when molten (Fig. 6.5 a)

and solubility in common solvents such as acetone (Fig. 6.5b). Fractions with Mn between ca.

50 × 106 g mol-1 and 300 × 106 g mol-1 had both suitable mechanical properties (Table 6.3) and

melt/solvent processability to allow their processing by standard polymer processing

techniques.

Figure 6.5: (a) Molten original and degraded P4HB at 100 °C. (b) Solubility of original and

degraded P4HB in acetone after 24 h at room temperature. There is a clear precipitate in the

solution of the two original P4HB specimens; all others are clear solutions. For both images,

the molecular weight (Mn, in 103 g/mol) is (from left to right): 520 (foam), 520 (film), 290, 90,

50, 30, and 17.


162

Conclusions

We showed here that the degradation of P4HB through random chain scission has clear effects

on both thermal and mechanical properties. The decrease of molecular weight induced an

increase in the degree of crystallinity, but neither the melt nor the glass transition temperature

were affected. Despite this increase in crystallinity, the decrease of the molecular weight was

the predominant factor controlling the mechanical properties of the degraded fractions: both the

tensile strength and the modulus decreased with the decrease of molecular weight. By carefully

controlling the molecular weight of the degraded polymer, materials with adequate mechanical,

thermal and processability properties may be obtained to allow their use in biomedical

applications as a strong yet ductile polymer.

Acknowledgement

The authors acknowledge Bernhard Henes and Eric Falk for performing the degradation

experiments, Karl Kehl for the GPC, E. Falk for the DSC experiments, and Prof. Guoqiang

Chen (Tsing Hua University) for providing the plasmid pKSSE5.3. KTI (“Komission für

Technologie und Innovation”) is acknowledged for the partial financial support of this work

through project number 12409.2 PFLS-LS.

Chapter 7

General discussion

Chapter 7: General discussion

164

Agricultural waste

Overview of the main research topics of this thesis

The main goal of this thesis was to identify and render inexpensive carbon sources accessible

for the biosynthesis of high added-value biopolymers such as mcl-PHAs or P4HB by genetic

engineering and bioprocess optimization. Different recombinant strains were constructed and

cultivated in bioreactors on low-cost growth carbon substrates such as xylose, a hemicellulose

derivative and glycerol, a waste byproduct from the biodiesel industry (Fig. 7.1). This strategy

to reduce costs has to be followed in order that PHA biopolymers can compete with petroleum-

based plastics. However, current fluctuation of oil price makes it difficult to predict at which

price PHAs will become cheaper than conventional plastics. Despite this, there is no doubt that

utilization of renewable resources to produce bioplastics is essential for our environment and

society.

Figure 7.1: Overview of the main research topics of this thesis

As mentioned above, costs of production of PHAs needs to be reduced. In order to reach this

objective, various scientific studies were initiated and their results described in the different

chapters.

GGTGAGGTGGTTGCTTCGC

AAACGGAAAAGCTGACCGT

TTCGCGCCCGCATCCACTC

TGGTCGGAACAAGACCCGG

AACAGTGGTGGCAGGCAAC

TGATCGCGCAATGAAAGCT

CTGGGCGATCAGCATTCTC

TGCAGGACGTTAAAGCATT

ww

w.tru

ckingin

fo

.com

http

://ecuriechezso

i.blo

gspo

t.fr

OR

Zinn M

. /Emp

a

Le Me

ur S. /Emp

a

Le Me

ur S. /Emp

a

Le Me

ur S. /Emp

a

Le Me

ur S. /Emp

a

OR

Le Me

ur S. /Emp

a

5 µm

Side-products from

biodiesel industries

Cultivation under optimized

growth conditions

Cells with

accumulated

PHAs

P4HB “bioplastic”

mcl-PHA “bioplastic”

Selected strains

Genetic modifications


165

Mcl-PHAs from xylose

In a first approach, accumulation of mcl-PHAs was examined using xylose as carbon source.

As mentioned in Chapter 2, Pseudomonas putida KT2440 is unable to use xylose as a carbon

source. In order to enable this strain to grow with xylose, the xylAB genes from Escherichia

coli W3110 were cloned into P. putida KT2440 resulting in the recombinant strain P. putida

KT2440 (pSLM1). Efficient xylose uptake was observed in the recombinant without including

any specific transporter system such as XylE or XylFGH. Hence, xylose seems to enter the cell

through the PTS system present in P. putida in a similar way as reported for fructose [154].

Pentose and hexose transporters have been shown to be promiscuous [92], thus xylose uptake

may be accomplished by glucose uptake systems in P. putida KT2440 (pSLM1).

The maximum specific growth rate of P. putida KT2440 (pSLM1) found with 10 g L-1 of xylose

was similar to that with 10 g L-1 of glucose. However, P. putida KT2440 (pSLM1) did not

accumulate mcl-PHAs from xylose even though the parental strain P. putida KT2440 produces

mcl-PHAs from “ PHA-unrelated” carbon sources (e.g. gluconate) under nitrogen limitation

[119]. Huijberts and coworkers also demonstrated that P. putida KT2442, a spontaneous

rifampicin mutant of KT2440, was able to produce mcl-PHAs from “PHA-unrelated” carbon

sources such as glucose, fructose or glycerol when cultured under nitrogen-limited conditions

[79]. In our study using batch cultivation, nitrogen limitation was reached after 13 hours of

growth of P. putida KT2440 (pSLM1) (see Fig. 2.2) and although ample xylose was still

available, no mcl-PHA was accumulated for another 15 h. It is possible that a xylose

concentration of less than 10 g L-1 was insufficient to induce mcl-PHA accumulation under our

cultivation conditions, because PHA biosynthesis is favored in batch cultures in response to

unbalanced growth conditions and the amount of accumulated polymer becomes larger with the

increase of the C/N ratio the culture medium [16, 114]. Another strain of P. putida was isolated


166

from soil and studied by Diniz and coworkers for its ability to accumulate large amounts of

mcl-PHAs from carbohydrates. P. putida IPT 046 cultured on a minimal medium with

equimolar mixture of glucose and fructose as carbon sources either limited by nitrogen or

phosphorus. In nitrogen-limited fed-batch experiments, P. putida IPT 046 accumulated only

21% (w w-1) mcl-PHAs, whereas in the phosphorous-limited one, 63% (w w-1) mcl-PHA was

obtained [216]. This suggests that the recombinant P. putida KT2440 (pSLM1) should also be

grown on phosphorous-limited media to verified whether this has a beneficial effect on mcl-

PHA production.

Interestingly, an enzymatic link seems to be missing to convert xylose to mcl-PHA in the

recombinant Pseudomonas putida KT2440 (pSLM1). It is known that P. putida GPo1

(previously known as P. oleovorans GPo1) accumulates only trace amounts of mcl-PHAs from

glucose [69]. PhaG (3-hydroxy-acyl carrier protein (ACP)-CoA transacylase) is the key enzyme

that links fatty acid de novo synthesis with the β-oxidation pathway in Pseudomonas for the

accumulation of mcl-PHAs from unrelated carbon sources (see Chapter 1, Fig. 1.9) [69]. It is

known that P. putida GPo1 misses a functional PhaG enzyme which hinders production of mcl-

PHAs from unrelated carbon sources [75]. Hence, we can suppose that the expression of xylAB

genes may interact with this key enzyme and may lead to a non-functional PhaG. To confirm

this hypothesis under the conditions tested, expression levels of PHA synthesis genes such as

phaG or phaC (PHA synthase) should be measured.

Adaptation of the bioprocess, namely the sequential feeding of P. putida KT2440 (pSLM1)

cultures using xylose as growth substrate and octanoic acid as mcl-PHA precursor allowed

reaching a yield of 0.37 g of tailor-made mcl-PHAs per g of octanoic acid. This approach is a

pragmatic way to achieve more cost-effective mcl-PHA production, because the cells grew first

on the cheap xylose for cell proliferation and second on the more expensive fatty acid that leads

to mcl-PHA biosynthesis.


167

Inducible vectors for P4HB production

In Chapter 3, the PHA-accumulation ability of genetically engineered E. coli strains were

assessed for their capacity of poly(4-hydroxybutyrate) (P4HB) accumulation. In order to enable

P4HB biosynthesis in E. coli, IPTG-inducible vectors allowing expression of genes for a PHA

synthase (phaC) from Ralstonia eutropha (DSM 428) and a 4-hydroxybutyric acid-CoA

transferase (orfZ) from Clostridium kluyveri (DSM 555) were constructed (pSLM20, pSLM21

and pSLM22 plasmids). However, growth studies revealed that none of the three plasmids led

to intracellular accumulation of significant amounts of P4HB and was investigated in detail.

SDS-PAGE did not reveal formation of inclusion bodies of PhaC or OrfZ upon induction by

IPTG. Furthermore, no differences in expression levels were observed between induced and

non-induced cultures for the three recombinant strains (E. coli BL21 (DE3) (pSLM20), E. coli

BL21 (DE3) (pSLM21) and E. coli BL21 (DE3) (pSLM22)). Problems of codon usage and

instability of the PhaC and OrfZ enzymes produced in E. coli can be excluded because these

genes were already expressed by integrating the plasmid pKSSE5.3 in E. coli XL1-Blue [64],

and S17-1 [174]. However, frame shift mutations may have taken place during subcloning and

could explain the non-functionality of PhaC and OrfZ. Catabolite repression due to growth on

glucose can be excluded as an explanation for the very low P4HB accumulation because E. coli

BL21 (DE3) strain was used, which has three point mutations that differ from the wild-type lac

promoter. In detail, this mutation of the lambda DE3 prophage encoding T7 RNA polymerase

in pET expression hosts carries the L8-UV5 promoter and thus allows a strongly IPTG-

dependent induction of T7 RNA polymerase and high expression even in the presence of

glucose [217]. When glycerol or xylose were used as carbon substrates for growth instead of

glucose, very low polymer amounts were accumulated. To verify, whether the newly

constructed plasmids pSLM20, pSLM21 and pSLM22 were able to induce the transcription of


168

phaC and orfZ, they should be transformed in another E. coli strain that contains a plasmid with

T7 expression genes, such as E. coli JM109 (DE3) as well as the original plasmid.

The key enzyme in P4HB biosynthesis is PhaC which catalyzes the polymerization of 4-

hydroxybutyryl with the hydroxylgroup of the PHA polymer chain with the release of CoA.

Langenbach and coworkers subcloned the coding region of P. aeruginosa PHA synthase

(phaC1) into the vector pBluescript SK- under lac promoter control and transformed it into E.

coli K12, JM109 and XL1-Blue exhibiting wild-type fatty acid metabolism [218]. Only a very

weak mcl-PHA accumulation (1% w w-1) was obtained when glucose was used as growth

substrate [218]. Sim and coworkers also demonstrated only tight control of phaC transcription

through trc promoter when 0.4 mM IPTG was added to the culture broth [219]. The reason for

the insufficient expression may be that both genes require their own promoter systems. To

confirm or disprove this hypothesis, new plasmids with their own promoters should be

constructed and tested in order to verify whether phaC and orfZ genes are being expressed

efficiently.

In addition to ensure the induction of PHA biosynthesis genes, optimization of bioprocesses

can play an important part for reducing the cost of PHA production. Various steps can be

optimized and are discussed in the next section.

Bioprocess optimization approaches

To reach high specific PHA productivity and yield, many factors have to be considered such as

the type of production strain, the efficient expression of relevant genes, and the nature of carbon

source selected for favoring PHA biosynthesis.


169

To identify good PHA-producing strains, various environmental niches were screened to isolate

wild-type strains [117, 121, 220]. For example, marine strains isolated from mangrove

sediments, were able to accumulate PHAs when cultivated on a range of different carbon

sources including acetate, glycerol, succinate, glucose and sucrose. All isolated and

characterized species belonged to Vibrio spp., and accumulated P3HB with a maximum content

of 41% (w w-1) [117]. As an another example, exotic microbiological samples from sediment

of an atoll of Rangiroa located in French Polynesia allowed the isolation of a new bacterial

strain, Pseudomonas guezennei, able to accumulate mcl-PHAs mainly composed of 3-

hydroxydecanaote (64 mol%) and 3-hydroxyoctanoate (24 mol%) from a single, nonrelated

carbon substrate, i.e. glucose [121].

Another approach is to search for a strain able to produced PHAs from a certain cheap carbon

source. For example, water, sediments and garden soil samples from India allowed the isolation

of 41 strains capable of utilizing Jatropha oil, a biodiesel byproduct. From this selection, two

bacteria, identified as Bacillus sonorensis and Halomonas hydrothermalis were able to

accumulate 72% and 75% (w w-1) of P3HB, respectively [116].

In Chapter 4, we followed a different strategy for the biosynthesis of P4HB, namely the genetic

recombination of the E. coli laboratory strains (W3110, DH5α, JM109, S17-1, BL21 (DE3) and

XL1-Blue) with the pKSSE5.3 plasmid. The goal of this study was to compare different host

strains for the expression of genes needed for P4HB biosynthesis, an interesting task since these

strains differed in their metabolic background [66].

This study was limited to E. coli strains because they exhibit several advantages which make

them ideal candidates for the production of PHAs. Firstly, extensive knowledge on E. coli

genetics and biochemistry is available. Secondly, this bacterium grows fast and is able to utilize


170

a broad range of carbon sources. Thirdly, the fragility of E. coli cells allows to easily recover

the intracellularly accumulated polymer. Furthermore, E. coli does not possess any PHA

depolymerases which avoids intracellular degradation of accumulated PHAs [128, 221].

Recombinant E. coli strains harboring R. eutropha PHA biosynthesis genes responsible for

P3HB production were shown to accumulate up to 73% (w w-1) of P3HB in fed-batch

cultivation, leading to a P3HB concentration of 149.7 g L-1 with a volumetric productivity of

3.4 g L-1 h-1 [200]. By cloning the biosynthesis genes from Alcaligenes latus, Choi and

coworkers succeeded to reach a final P3HB concentration of 141 g L-1 using fed-batch strategy

as well and reaching the very high volumetric productivity of 4.63 g L-1 h-1 [96].

As mentioned in Chapter 1 (section 6, Production of PHAs), the carbon substrate used to grow

the selected strain needs to be inexpensive and abundant. Furthermore, the fermentation process

has to be efficient to satisfy the cost issues. Finally, the PHA purification method needs to be

optimal to recover the maximal amount of polymer from the biomass while not altering the

material properties of the polymer.

Potential strategies to further optimize P4HB production

A crucial factor in using recombinant E. coli strains for P4HB biosynthesis is the stable gene

expression of phaC or orfZ. This problem can be avoided when the genes are inserted into the

chromosome. As a benefit, the addition of antibiotics which are usually needed to stabilize

plasmids in recombinant strains, can be avoided; this also improves the cost-efficiency.

However, the use of recombinant strains for bioplastic production is not well received by the

agro-food industries when they should be used for packaging of food. This conception urges

some scientists to use wild-type strains such as A. latus and to optimize PHA accumulation in

different ways [222].


171

A further increase of performance can be achieved by optimizing the culture medium and by

selecting appropriate growth conditions. A suitable approach when very little information or

experience is available, is an optimization technique referred to as “design of experiments”

(DOE) [223]. Here the interaction of parameters that are considered to generate the process

response primarily are taken into account. Evaluation of the results can be done using statistical

analysis system (SAS) software run under MATLAB®. Typically, the influence of various

parameters is analyzed, like pH, carbon-to-nitrogen ratio in the feed, concentration of

substrates, concentration of trace elements, agitation intensity as dissolved oxygen tension. As

mentioned above, this approach only helps to understand the flexibility of the system and to

indicate the direction of optimization. Further experiments then have to be carried out in order

to establish an optimal feed strategy of Na-4HB in fed-batch cultivations. In addition, also

bioprocess studies have to be performed that address the question of high cell density cultures

in order to achieve a high volumetric productivity.

The productivity and yield differ considerably depending on the synthesized polymer (e.g. scl-

PHAs vs mcl-PHAs) even when using the same carbon substrate. A comparison of the

productivities for different kinds of PHAs is tricky and complex because the biosynthetic

pathways involved are sometimes peculiar as well as strains and the growth conditions. Even

when we compare the productivity for two scl-PHAs e.g. P3HB and P4HB, under so-called

“optimized conditions”, the highest reported yields are actually quite distinct. Wang and co-

workers have succeeded in achieving a P3HB content of 88% of CDW with the highest P3HB

productivity (4.94 g L-1 h-1) reported to date using sucrose as the carbon source in a fed-batch

process. In our study, a P4HB productivity of 0.207 g L-1 h-1 was reached using glycerol as the

carbon source under fed-batch conditions, which is the highest productivity for P4HB reported

so far. The achieved productivity by Lee’s group is 23-times higher; however, not only the


172

selling price but also the applications and properties of P3HB and P4HB are very different,

which makes a comparison very difficult.

Sustainable PHA production: an outlook

Knowing that microalgae accumulate fatty acids to more than 60% (w w-1) of their dry biomass

and exhibit rapid growth and high productivity, the strategy to employ carbon source from

marine feedstocks might be a feasible option for the production of the PHAs investigated in this

thesis. Microalgae are photosynthetic microorganisms that convert sunlight, water and carbon

dioxide to algal biomass which could be used as a source of a sustainable carbon substrate for

PHA accumulation [224]. The yield of fatty acid from algal cultivations is over 200-times the

yield of the best-performing plant [224]. Moreover, industrial reactors for algal cultures are

available, allowing the production of very high amounts of oil that may be needed to support

hypothetically the industry-scale production of PHAs using wild-type strains fed with algal

fatty acids [130, 224].

Also marine bacteria, such as the free-living, photoautotrophic prokaryotic cyanobacteria are

good candidates for PHA production. They get energy from sunlight and use carbon dioxide as

the primary source of carbon. Some cyanobacteria are also able to fix atmospheric nitrogen

[225] and consequently the cultivation medium could be simplified. The genomes of 65

cyanobacteria have already been sequenced, which means that a variety of genetic

manipulations can be conducted in order to achieve production of different high added-value

PHAs such as mcl-PHAs and P4HB (http://www.ncbi.nlm.nih.gov/genomes). Moreover, much

experience in cultivation of cyanobacteria is now available as they have been studied for a long

time as bioremediation agents [226]. For example, wastewater from food and brewery industries

may be a suitable carbon source for PHA production with cyanobacteria such as Spirulina

platensis and Synechocystis species. This should result in a reduction of costs for nutrients as


173

well as for the clean-up of the wastewater [227]. Various cyanobacterial species were already

studied for their ability to accumulate PHAs [35]. Up to now, only reports on the biosynthesis

of P3HB polymers by wild-type and recombinant cyanobacteria are available [35].

Recombinant Synechococcus sp. PCC7002, harboring phaCAB (GenBank Acc. No.

AM260479) and recA genes from E. coli was shown to accumulate up to 52% (w w-1) of P3HB

under nitrogen-limited conditions [32]. Under optimized conditions, a P3HB accumulation of

up to 85% (w w-1) was reported for Aulosira fertilissima cultures but with a low polymer

concentration of only 1.59 g L-1 after a cultivation of 5 days [28]. Consequently, this bioprocesss

needs to be improved to reach a high volumetric productivity which is required for industrial

production. Currently, the types of biosynthesized PHAs is restricted to P3HB in cyanobacteria,

but it may be expanded to mcl-PHAs by the exchange of the P3HB synthase with an appropriate

mcl-PHA synthase. PHA accumulation by recombinant cyanobacteria would be an attractive

option in the future allowing the remediation of wastes and at the same time reduction of the

nutrient costs.

Conclusions

The results obtained in this doctoral thesis demonstrate that high added-value PHAs can be

efficiently biosynthesized and that inexpensive carbon sources combined with optimized

fermentation processes can be used to reduce the production cost. A bioprocess for the tailor-

made mcl-PHAs production in E. coli with xylose as the growth carbon substrate and fatty acids

as polymer precursors are reported for the first time [98]. Novel is also the finding that

biosynthesis of P4HB in E. coli JM109 (pKSSE5.3) is separated from growth and that it takes

place mainly after the end of the exponential growth phase. Production of P4HB by simple

batch culture using xylose and Na-4HB was achieved with a high conversion rate, a process

that previously was only possible through fed-batch cultures with glucose [66]. Furthermore,


174

the use of glycerol, an inexpensive carbon source and waste product from biodiesel production,

allowed efficient P4HB accumulation from Na-4HB which was further stimulated by amino-

acid limitation and addition of acetic acid. This fed-batch process, using exponential feeding,

allows to reach a P4HB concentration of 15 g L-1, leading to a productivity of 0.207 g L-1 h-1,

which is the highest productivity for P4HB reported so far [68]. The fermentation processes

described in this doctoral thesis provides new prospects for industrial production of high added-

value PHAs.

175

References

1. American Chemistry Council: Life cycle of a plastic product. 2011. Accessed on

9.3.2014 from : http://plastics.americanchemistry.com/Education-Resources/Plastics-

101/Lifecycle-of-a-Plastic-Product.html.

2. Vert M, Doi Y, Hellwich K-H, Hess M, Hodge P, Kubisa P, Rinaudo M, Schué F:

Terminology for biorelated polymers and applications (IUPAC recommendations

2012). Pure Appl Chem 2012, 84(2):377.

3. Last year, new year, next year. Picture accessed on 9.3.2014 from:

https://journeytotheplasticocean.wordpress.com/2013/01/13/last-year-new-year-next-

year/

4. Yamamoto Biology: Rare sea turtles eating plastic at record rate. 2013. Picture

accessed on 9.3.2014 from: https://yamamotobiology.wikispaces.com/Tai+Manu-

Olevao.

5. Barnes DKA, Galgani F, Thompson RC, Barlaz M: Accumulation and fragmentation

of plastic debris in global environments. Philos Trans R Soc Lond B Biol Sci 2009,

364(1526):1985-1998.

6. Knight GD: Plastic Pollution, Edited by Raintree, Heinemann Library ; 2012.

7. Association of Plastic Europe: The compelling facts about plastics: An analysis of

European plastics production, demand and recovery for 2008. 2009. Accessed on

9.5.2014 from: http://www.plasticseurope.org/Documents/Document/

20100225141556-Brochure_UK_FactsFigures_2009_22sept_6_Final-20090930-001-

EN-v1.pdf.

8. European bioplastics: Fivefold growth of the bioplastics market by 2016. 2012.

Accessed on 9.5.2014 from: http://en.european-bioplastics.org/blog/2012/10/10/pr-

bioplastics-market-20121010/

9. SRI Consulting: Biodegradable polymers report. 2010. Accessed on 9.5.2014 from:

www.sriconsulting.com/CEH/Public/Reports/580.0280.

10. European commission: Techno-economic feasibility of large-scale production of bio-

based polymers in Europe. 2005. Accessed on 9.5.2014 from:

http://ftp.jrc.es/EURdoc/eur22103en.pdf.

11. Barker M, Safford R: Industrial use for crops: Markets for bioplastics, project

report no. 450. Accessed on 9.12.2014 from: http://www.hgca.com/media/408426/

pr450-final-project-report.pdf.

12. Metabolix Bioplastics. Accessed on 9.12.2014 from: http://www.mirelplastics.com/

13. European commission: PD CEN/TR 15932 Plastics – Recommendations for

terminology and characterisation of bio-plastics. 2010.

14. Bordes P, Pollet E, Avérous L: Nano-biocomposites: Biodegradable

polyester/nanoclay systems. Prog Polym Sci 2009, 34(2):125-155.

15. Lemoigne M: Produits de déshydration et de polymerisation de l’acide β-

oxobutyrique. Bull Soc Chem Biol (Paris) 1926, 8:770–782.

http://www.mirelplastics.com/

176

16. Macrae RM, Wilkinson JF: Poly-β-hyroxybutyrate metabolism in washed

suspensions of Bacillus cereus and Bacillus megaterium. J Gen Microbiol 1958,

19(1):210-222.

17. Wallen LL, Rohwedder. WK: Poly-β-hydroxyalkanoate from activated sludge.

Environ Sci Technol 1974, 8:576–579.

18. Howells E: Opportunities in biotechnology for the chemical industry. Chem Ind

1982, 8:508–511.

19. Anderson AJ, Dawes EA: Occurrence, metabolism, metabolic role, and industrial

uses of bacterial polyhydroxyalkanoates. Microbiol Rev 1990, 54(4):450-472.

20. Steinbüchel A: Polyhydroxyalkanoic acids. In: Biomaterials. Edited by Byrom D.

MacMillan: Basingstoke 1991: 125–213.

21. Rehm BHA, Steinbüchel A: Biochemical and genetic analysis of PHA synthases and

other proteins required for PHA synthesis. Int J Biol Macromol 1999, 25(1–3):3-19.

22. Steinbüchel A, Valentin HE: Diversity of bacterial polyhydroxyalkanoic acids.

FEMS Microbiol Lett 1995, 128(3):219-228.

23. Lageveen RG, Huisman GW, Preusting H, Ketelaar P, Eggink G, Witholt B: Formation

of polyesters by Pseudomonas oleovorans: Effect of substrates on formation and

composition of poly-(R)-3-hydroxyalkanoates and poly-(R)-3-hydroxyalkenoates.

Appl Environ Microbiol 1988, 54(12):2924-2932.

24. Kim YB, Lenz RW, Fuller RC: Poly(β-hydroxyalkanoate) copolymers containing

brominated repeating units produced by Pseudomonas oleovorans. Macromolecules

1992, 25(7):1852-1857.

25. Fritzsche K, Lenz RW, Fuller RC: An unusual bacterial polyester with a phenyl

pendant group. Makromol Chem 1990, 191(8):1957-1965.

26. Kim DY, Kim YB, Rhee YH: Evaluation of various carbon substrates for the

biosynthesis of polyhydroxyalkanoates bearing functional groups by Pseudomonas

putida. Int J Biol Macromol 2000, 28(1):23-29.

27. Kai D, Loh XJ: Polyhydroxyalkanoates: Chemical modifications toward

biomedical applications. ACS Sustainable Chem Eng 2013, 2(2):106-119.

28. Samantaray S, Mallick N: Production and characterization of poly-β-

hydroxybutyrate (PHB) polymer from Aulosira fertilissima. J Appl Phycol 2012,

24(4):803-814.

29. Hartmann R, Hany R, Pletscher E, Ritter A, Witholt B, Zinn M: Tailor-made olefinic

medium-chain-length poly[(R)-3-hydroxyalkanoates] by Pseudomonas putida

GPo1: Batch versus chemostat production. Biotechnol Bioeng 2006, 93(4):737-746.

30. Sun Z, Ramsay J, Guay M, Ramsay B: Carbon-limited fed-batch production of

medium-chain-length polyhydroxyalkanoates from nonanoic acid by Pseudomonas

putida KT2440. Appl Microbiol Biotechnol 2007, 74(1):69-77.

31. Sawada H: ISO standard activities in standardization of biodegradability of

plastics-development of test methods and definitions. Polym Degrad Stabil 1998,

59(1–3):365-370.

177

32. Akiyama H, Okuhata H, Onizuka T, Kanai S, Hirano M, Tanaka S, Sasaki K, Miyasaka

H: Antibiotics-free stable polyhydroxyalkanoate (PHA) production from carbon

dioxide by recombinant cyanobacteria. Bioresour Technol 2011, 102(23):11039-

11042.

33. Doi Y, Kanesawa Y, Kunioka M, Saito T: Biodegradation of microbial copolyesters:

Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) and poly(3-hydroxybutyrate-co-4-

hydroxybutyrate). Macromolecules 1990, 23(1):26-31.

34. Zinn M, Witholt B, Egli T: Occurrence, synthesis and medical application of

bacterial polyhydroxyalkanoate. Adv Drug Deliv Rev 2001, 53(1):5-21.

35. Samantaray S, Bhati R, Mallick N: Cyanobacterial polyhydroxyalkanoates: An

alternative source for plastics. In: Cyanobacteria. John Wiley & Sons, Ltd; 2014: 227-

244.

36. Jendrossek D, Schirmer A, Schlegel HG: Biodegradation of polyhydroxyalkanoic

acids. Appl Microbiol Biotechnol 1996, 46(5-6):451-463.

37. Williams SF, Martin DP: Applications of polyhydroxyalkanoates (PHA) in medicine

and pharmacy. In: Biopolymers Online. Wiley-VCH Verlag GmbH & Co. KGaA;

2005.

38. Nelson T, Kaufman E, Kline J, Sokoloff L: The extraneural distribution of γ-

hydroxybutyrate. J Neurochem 1981, 37(5):1345-1348.

39. Lee SY: Bacterial polyhydroxyalkanoates. Biotechnol Bioeng 1996, 49(1):1-14.

40. Nebe B, Forster C, Pommerenke H, Fulda G, Behrend D, Bernewski U, Schmitz KP,

Rychly J: Structural alterations of adhesion mediating components in cells cultured

on poly-β-hydroxybutyric acid. Biomaterials 2001, 22(17):2425-2434.

41. Rivard CH, Chaput C, Rhalmi S, Selmani A: Bioabsorbable synthetic polyesters and

tissue regeneration: A study on the three-dimensional proliferation of ovine

chondrocytes and osteoblasts. Ann Chir 1996, 50(8):651-658.

42. Yao Y-C, Zhan X-Y, Zhang J, Zou X-H, Wang Z-H, Xiong Y-C, Chen J, Chen G-Q: A

specific drug targeting system based on polyhydroxyalkanoate granule binding

protein PhaP fused with targeted cell ligands. Biomaterials 2008, 29(36):4823-4830.

43. Lenz RW, Marchessault RH: Bacterial polyesters: Biosynthesis, biodegradable

plastics and biotechnology. Biomacromolecules 2004, 6(1):1-8.

44. Holmes PA: Biologically produced (R)-3-hydroxy-alkanoate polymers and

copolymers. In: Developments in Crystalline Polymers. Edited by Bassett DC: Springer

Netherlands; 1988: 1-65.

45. Eggink G, De waard P, Huijberts GNM: Formation of novel poly(hydroxyalkanoates)

from long-chain fatty acids. Can J Microbiol 1995, 41(1):14-21.

46. Chen G-Q, Wu Q: The application of polyhydroxyalkanoates as tissue engineering

materials. Biomaterials 2005, 26(33):6565-6578.

47. Sudesh K, Abe H, Doi Y: Synthesis, structure and properties of

polyhydroxyalkanoates: biological polyesters. Prog Polym Sci 2000, 25(10):1503-

1555.

48. Doi Y: Microbial Polyesters. New York VCH Publishers; 1990.

178

49. Saito Y, Doi Y: Microbial synthesis and properties of poly(3-hydroxybutyrate-co-

4-hydroxybutyrate) in Comamonas acidovorans. Int J Biol Macromol 1994, 16(2):99-

104.

50. Gross RA, DeMello C, Lenz RW, Brandl H, Fuller RC: Biosynthesis and

characterization of poly(β-hydroxyalkanoates) produced by Pseudomonas

oleovorans. Macromolecules 1989, 22(3):1106-1115.

51. Brandrup J, Immergut EH: Polymer. New York: handbookWiley; 1975.

52. Speight JG: Handbook of industrial hydrocarbon processes: Elsevier Science; 2010.

53. Martin DP, Williams SF: Medical applications of poly-4-hydroxybutyrate: A strong

flexible absorbable biomaterial. Biochem Eng J 2003, 16(2):97-105.

54. Repaske R, Repaske AC: Quantitative requirements for exponential growth of

Alcaligenes eutrophus. Appl Environ Microbiol 1976, 32(4):585-591.

55. Dawes EA, Senior PJ: The role and regulation of energy reserve polymers in micro-

organisms. In: Advances in microbial physiology. Edited by Rose AH, Tempest DW,

vol. Volume 10: Academic Press; 1973: 135-266.

56. Ward AC, Rowley BI, Dawes EA: Effect of oxygen and nitrogen limitation on poly-

β-hydroxybutyrate biosynthesis in ammonium-grown Azotobacter beijerinckii. J

Gen Microbiol 1977, 102(1):61-68.

57. Strange RE: Bacterial "Glycogen" and Survival. Nature 1968, 220(5167):606-607.

58. Obst M, Steinbüchel A: Cyanophycin-an ideal bacterial nitrogen storage material

with unique chemical properties. In: Inclusions in Prokaryotes. Edited by Shively J,

vol. 1: Springer Berlin Heidelberg; 2006: 167-193.

59. Pallerla SR, Knebel S, Polen T, Klauth P, Hollender J, Wendisch VF, Schoberth SM:

Formation of volutin granules in Corynebacterium glutamicum. FEMS Microbiol

Lett 2005, 243(1):133-140.

60. Henrysson T, McCarty PL: Influence of the endogenous storage lipid poly-β-

hydroxybutyrate on the reducing power availability during cometabolism of

trichloroethylene and naphthalene by resting methanotrophic mixed cultures. Appl

Environ Microbiol 1993, 59(5):1602-1606.

61. Senior PJ, Dawes EA: The regulation of poly-β -hydroxybutyrate metabolism in

Azotobacter beijerinckii. Biochem J 1973, 134(1):225-238.

62. Schubert P, Steinbüchel A, Schlegel HG: Cloning of the Alcaligenes eutrophus genes

for synthesis of poly-β-hydroxybutyric acid (PHB) and synthesis of PHB in

Escherichia coli. J Bacteriol 1988, 170(12):5837-5847.

63. Peoples OP, Sinskey AJ: Poly-beta-hydroxybutyrate (PHB) biosynthesis in

Alcaligenes eutrophus H16. Identification and characterization of the PHB

polymerase gene (phbC). J Biol Chem 1989, 264(26):15298-15303.

64. Hein S, Söhling B, Gottschalk G, Steinbüchel A: Biosynthesis of poly(4-

hydroxybutyric acid) by recombinant strains of Escherichia coli. FEMS Microbiol

Lett 1997, 153:411-418.

179

65. Song S, Hein S, Steinbüchel A: Production of poly(4-hydroxybutyric acid) by fed-

batch cultures of recombinant strains of Escherichia coli. Biotechnol Lett 1999,

21(3):193-197.

66. Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q: Poly(4-hydroxybutyrate) (P4HB)

production in recombinant Escherichia coli: P4HB synthesis is uncoupled with cell

growth. Microb Cell Fact 2013, 12(1):123.

67. Zhou X-Y, Yuan X-X, Shi Z-Y, Meng D-C, Jiang W-J, Wu L-P, Chen J-C, Chen G-Q:

Hyperproduction of poly(4-hydroxybutyrate) from glucose by recombinant

Escherichia coli. Microb Cell Fact 2012, 11(1):54.

68. Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q: Improved productivity of poly

(4-hydroxybutyrate) (P4HB) in recombinant Escherichia coli using glycerol as the

growth substrate with fed-batch culture. Microb Cell Fact 2014, 13(1):131.

69. Rehm BH, Kruger N, Steinbüchel A: A new metabolic link between fatty acid de novo

synthesis and polyhydroxyalkanoic acid synthesis. The phaG gene from

Pseudomonas putida KT2440 encodes a 3-hydroxyacyl-acyl carrier protein-

coenzyme a transferase. J Biol Chem 1998, 273(37):24044-24051.

70. Nomura CT, Taguchi K, Gan Z, Kuwabara K, Tanaka T, Takase K, Doi Y: Expression

of 3-ketoacyl-acyl carrier protein reductase (fabG) genes enhances production of

polyhydroxyalkanoate copolymer from glucose in recombinant Escherichia coli

JM109. Appl Environ Microbiol 2005, 71(8):4297-4306.

71. Witholt B, Kessler B: Perspectives of medium-chain-length

poly(hydroxyalkanoates), a versatile set of bacterial bioplastics. Curr Opin

Biotechnol 1999, 10(3):279-285.

72. Kellerhals MB, Kessler B, Witholt B: Closed-loop control of bacterial high-cell-

density fed-batch cultures: Production of mcl-PHAs by Pseudomonas putida

KT2442 under single-substrate and cofeeding conditions. Biotechnol Bioeng 1999,

65(3):306-315.

73. Ouyang S-P, Luo RC, Chen S-S, Liu Q, Chung A, Wu Q, Chen G-Q: Production of

polyhydroxyalkanoates with high 3-hydroxydodecanoate monomer content by

fadB and fadA knockout mutant of Pseudomonas putida KT2442.

Biomacromolecules 2007, 8(8):2504-2511.

74. Wang HH, Zhou XR, Liu Q, Chen GQ: Biosynthesis of polyhydroxyalkanoate

homopolymers by Pseudomonas putida. Appl Microbiol Biotechnol 2011, 89(5):1497-

1507.

75. Hoffmann N, Steinbüchel A, Rehm BH: Homologous functional expression of cryptic

phaG from Pseudomonas oleovorans establishes the transacylase-mediated

polyhydroxyalkanoate biosynthetic pathway. Appl Microbiol Biotechnol 2000,

54(5):665-670.

76. Kessler B, Witholt B: Factors involved in the regulatory network of

polyhydroxyalkanoate metabolism. J Biotechnol 2001, 86(2):97-104.

77. Chen G-Q: Plastics completely synthesized by bacteria: Polyhydroxyalkanoates. In:

Plastics from Bacteria. Edited by Chen GG-Q, vol. 14: Springer Berlin Heidelberg;

2010: 17-37.

180

78. Ren Q, de Roo G, Ruth K, Witholt B, Zinn M, Thöny-Meyer L: Simultaneous

accumulation and degradation of polyhydroxyalkanoates: Futile cycle or clever

regulation? Biomacromolecules 2009, 10(4):916-922.

79. Huijberts GN, Eggink G, Waard Pd, Huisman GW, Witholt B: Pseudomonas putida

KT2442 cultivated on glucose accumulates poly(3-hydroxyalkanoates) consisting

of saturated and unsaturated monomers. Appl Environ Microbiol 1992, 58(2):536-

544.

80. Eggink G, van der Wal H, Huijberts GNM, de Waard P: Oleic acid as a substrate for

poly-3-hydroxyalkanoate formation in Alcaligenes eutrophus and Pseudomonas

putida. Ind Crop Prod 1992, 1(2–4):157-163.

81. de Smet MJ, Eggink G, Witholt B, Kingma J, Wynberg H: Characterization of

intracellular inclusions formed by Pseudomonas oleovorans during growth on

octane. J Bacteriol 1983, 154(2):870-878.

82. Ashby RD, Foglia TA: Poly(hydroxyalkanoate) biosynthesis from triglyceride

substrates. Appl Microbiol Biotechnol 1998, 49(4):431-437.

83. Brandl H, Knee EJ, Jr., Fuller RC, Gross RA, Lenz RW: Ability of the phototrophic

bacterium Rhodospirillum rubrum to produce various poly (β-hydroxyalkanoates):

Potential sources for biodegradable polyesters. Int J Biol Macromol 1989, 11(1):49-

55.

84. Choi JI, Lee SY: Process analysis and economic evaluation for poly(3-

hydroxybutyrate) production by fermentation. Bioprocess Eng 1997, 17(6):335-342.

85. Chen GQ, Zhang G, Park SJ, Lee SY: Industrial scale production of poly(3-

hydroxybutyrate-co-3-hydroxyhexanoate). Appl Microbiol Biotechnol 2001, 57(1-

2):50-55.

86. Solaiman DK, Ashby RD, Foglia TA, Marmer WN: Conversion of agricultural

feedstock and coproducts into poly(hydroxyalkanoates). Appl Microbiol Biotechnol

2006, 71(6):783-789.

87. Lee SY: Plastic bacteria? Progress and prospects for polyhydroxyalkanoate

production in bacteria. Trends Biotechnol 1996, 14(11):431-438.

88. Ashby RD, Solaiman DKY, Foglia TA: Synthesis of short-/medium-chain-length

poly(hydroxyalkanoate) blends by mixed culture fermentation of glycerol.


89. Ashby R, Solaiman DY, Foglia T: Bacterial poly(hydroxyalkanoate) polymer

production from the biodiesel co-product stream. J Polym Environ 2004, 12(3):105-

112.

90. Xu F, Sun JX, Liu CF, Sun RC: Comparative study of alkali- and acidic organic

solvent-soluble hemicellulosic polysaccharides from sugarcane bagasse.

Carbohydrate research 2006, 341(2):253-261.

91. Sun Y, Cheng J: Hydrolysis of lignocellulosic materials for ethanol production: A

review. Bioresour Technol 2002, 83(1):1-11.

92. Song S, Park C: Utilization of D-ribose through D-xylose transporter. FEMS

Microbiol Lett 1998, 163(2):255-261.

181

93. Bertrand JL, Ramsay BA, Ramsay JA, Chavarie C: Biosynthesis of poly-β-

hydroxyalkanoates from pentoses by Pseudomonas pseudoflava. Appl Environ

Microbiol 1990, 56(10):3133-3138.

94. Ramsay JA, Hassan M-CA, Ramsay BA: Hemicellulose as a potential substrate for

production of poly(β-hydroxyalkanoates). Can J Microbiol 1995, 41(13):262-266.

95. Young FK, Kastner JR, May SW: Microbial production of poly-β-hydroxybutyric

acid from D-xylose and lactose by Pseudomonas cepacia. Appl Environ Microbiol

1994, 60(11):4195-4198.

96. Choi JI, Lee SY, Han K: Cloning of the Alcaligenes latus polyhydroxyalkanoate

biosynthesis genes and use of these genes for enhanced production of poly(3-

hydroxybutyrate) in Escherichia coli. Appl Environ Microbiol 1998, 64(12):4897-

4903.

97. Meijnen JP, de Winde JH, Ruijssenaars HJ: Engineering Pseudomonas putida S12 for

efficient utilization of D-xylose and L-arabinose. Appl Environ Microbiol 2008,

74(16):5031-5037.

98. Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q: Production of medium-chain-

length polyhydroxyalkanoates by sequential feeding of xylose and octanoic acid in

engineered Pseudomonas putida KT2440. BMC Biotechnol 2012, 12(1):53.

99. Thompson JC, He BB: Characterization of crude glycerol from biodiesel production

from multiple feedstocks. Appl Eng Agric 2006, 22(2):261-265.

100. Hill J, Nelson E, Tilman D, Polasky S, Tiffany D: Environmental, economic, and

energetic costs and benefits of biodiesel and ethanol biofuels. Proc Natl Acad Sci U

S A 2006, 103(30):11206-11210.

101. REN21 (Renewable Energy Policy Network for the 21st Century) : Renewables global

status report. Accessed on 10.6.2014 from: http://www.ren21.net/ren21activities/

globalstatusreport.aspx .

102. Braunegg G, Lefebvre G, Renner G, Zeiser A, Haage G, Loidl-Lanthaler K: Kinetics

as a tool for polyhydroxyalkanoate production optimization. Can J Microbiol 1995,

41(13):239-248.

103. da Silva GP, Mack M, Contiero J: Glycerol: A promising and abundant carbon

source for industrial microbiology. Biotechnol Adv 2009, 27(1):30-39.

104. Heller KB, Lin ECC, Hastings Wilson T: Substrate specificity and transport

properties of the glycerol facilitator of Escherichia coli. J Bacteriol 1980,

144(1):274-278.

105. Voegele RT, Sweet GD, Boos W: Glycerol kinase of Escherichia coli is activated by

interaction with the glycerol facilitator. J Bacteriol 1993, 175(4):1087-1094.

106. Darbon E, Ito K, Huang HS, Yoshimoto T, Poncet S, Deutscher J: Glycerol transport

and phosphoenolpyruvate-dependent enzyme I- and HPr-catalysed

phosphorylation of glycerol kinase in Thermus flavus. Microbiology 1999,

145(11):3205-3212.

107. Lee SY, Choi J-i, Wong HH: Recent advances in polyhydroxyalkanoate production

by bacterial fermentation: Mini-review. Int J Biol Macromol 1999, 25(1–3):31-36.

182

108. Escapa IF, del Cerro C, Garcia JL, Prieto MA: The role of GlpR repressor in

Pseudomonas putida KT2440 growth and PHA production from glycerol. Environ

Microbiol 2013, 15(1):93-110.

109. Elbahloul Y, Steinbüchel A: Large-scale production of poly(3-hydroxyoctanoic

acid) by Pseudomonas putida GPo1 and a simplified downstream process. Appl


110. Pirt SJ: Principles of microbe and cell cultivation. Oxford; London; Edinburgh:

Blackwell Scientific; 1975.

111. Huijberts GNM, Eggink G: Production of poly(3-hydroxyalkanoates) by

Pseudomonas putida KT2442 in continuous cultures. Appl Microbiol Biotechnol

1996, 46(3):233-239.

112. Preusting H, Kingma J, Witholt B: Physiology and polyester formation of

Pseudomonas oleovorans in continuous two-liquid-phase cultures. Enzyme Microb

Technol 1991, 13(10):770-780.

113. Ramsay BA, Saracovan I, Ramsay JA, Marchessault RH: Continuous production of

long-side-chain poly-β-hydroxyalkanoates by Pseudomonas oleovorans. Appl


114. Durner R, Zinn M, Witholt B, Egli T: Accumulation of poly[(R)-3-

hydroxyalkanoates] in Pseudomonas oleovorans during growth in batch and

chemostat culture with different carbon sources. Biotechnol Bioeng 2001, 72(3):278-

288.

115. Lee SY, Choi JI: Effect of fermentation performance on the economics of poly(3-

hydroxybutyrate) production by Alcaligenes latus. Polym Degrad Stab 1998, 59(1–

3):387-393.

116. Shrivastav A, Mishra SK, Shethia B, Pancha I, Jain D, Mishra S: Isolation of promising

bacterial strains from soil and marine environment for polyhydroxyalkanoates

(PHAs) production utilizing Jatropha biodiesel byproduct. Int J Biol Macromol

2010, 47(2):283-287.

117. Chien CC, Chen CC, Choi MH, Kung SS, Wei YH: Production of poly-β-

hydroxybutyrate (PHB) by Vibrio spp. isolated from marine environment. J

Biotechnol 2007, 132(3):259-263.

118. Yamanè T, Shimizu S: Fed-batch techniques in microbial processes. In: Bioprocess

Parameter Control. vol. 30: Springer Berlin Heidelberg; 1984: 147-194.

119. Follonier S, Panke S, Zinn M: A reduction in growth rate of Pseudomonas putida

KT2442 counteracts productivity advances in medium-chain-length

polyhydroxyalkanoate production from gluconate. Microb Cell Fact 2011, 10(1):25.

120. Lee SY, Lee Y, Wang F: Chiral compounds from bacterial polyesters: Sugars to

plastics to fine chemicals. Biotechnol Bioeng 1999, 65(3):363-368.

121. Simon-Colin C, Alain K, Colin S, Cozien J, Costa B, Guezennec JG, Raguénès GHC:

A novel mcl PHA-producing bacterium, Pseudomonas guezennei sp. nov., isolated

from a ‘kopara’ mat located in Rangiroa, an atoll of French Polynesia. J Appl

Microbiol 2008, 104(2):581-586.

183

122. Restaino OF, Bhaskar U, Paul P, Li L, De Rosa M, Dordick JS, Linhardt RJ: High cell

density cultivation of a recombinant E. coli strain expressing a key enzyme in

bioengineered heparin production. Appl Microbiol Biotechnol 2013, 97(9):3893-

3900.

123. Williams SF, Martin DP: Therapeutic uses of polymers and oligomers comprising

γ-hydroxybutyrate. In. Edited by Tepha I, Metabolix, Inc., vol. US Patent Appl

661948: Google Patents; 2000.

124. GHB, GBL and 1,4BD as date rape drugs. Edited by Administration UDE; 2012.

Accessed on 10.11.2014 from: http://web.archive.org/web/20120510

151441/http://www.justice.gov/dea//ongoing/daterapep.html.

125. Schep LJ, Knudsen K, Slaughter RJ, Vale JA, Mégarbane B: The clinical toxicology

of γ-hydroxybutyrate, γ-butyrolactone and 1,4-butanediol. Clin Toxicol 2012,

50(6):458-470.

126. Braunegg G, Lefebvre G, Genser KF: Polyhydroxyalkanoates, biopolyesters from

renewable resources: Physiological and engineering aspects. J Biotechnol 1998,

65(2–3):127-161.

127. Williams Simon F, Rizk S, Martin David P: Poly-4-hydroxybutyrate (P4HB): A new

generation of resorbable medical devices for tissue repair and regeneration.

Biomed Tech 2013, 58(5): 439-452.

128. Lee SY: E. coli moves into the plastic age. Nat Biotechnol 1997, 15(1):17-18.

129. Life Science Intelligence: Worldwide markets and emerging technologies for tissue

engineering and regenerative medicine. 2009. Accessed on 10.11.2014 from:

http://lifescienceintelligence.com/market-reports-page.php?id=IL600.

130. Chisti Y: Biodiesel from microalgae. Biotechnol Adv 2007, 25(3):294-306.

131. Senior PJ, Dawes EA: The regulation of poly-β-hydroxybutyrate metabolism in

Azotobacter beijerinckii. Biochem J 1973, 134(1):225-238.

132. Chen G: A microbial polyhydroxyalkanoates (PHA) based bio- and materials

industry. Chem Soc Rev 2009, 38(8):2434-2446.

133. Lokesh BE, Hamid ZAA, Arai T, Kosugi A, Murata Y, Hashim R, Sulaiman O, Mori

Y, Sudesh K: Potential of oil palm trunk sap as a novel inexpensive renewable

carbon feedstock for polyhydroxyalkanoate biosynthesis and as a bacterial growth

medium. CLEAN 2012, 40(3):310-317.

134. Lee WH, Loo CY, Nomura CT, Sudesh K: Biosynthesis of polyhydroxyalkanoate

copolymers from mixtures of plant oils and 3-hydroxyvalerate precursors.

Bioresour Technol 2008, 99(15):6844-6851.

135. Solaiman DK, Swingle BM: Isolation of novel Pseudomonas syringae promoters and

functional characterization in polyhydroxyalkanoate-producing pseudomonads. N

Biotechnol 2010, 27(1):1-9.

136. Beall DS, Ohta K, Ingram LO: Parametric studies of ethanol production form xylose

and other sugars by recombinant Escherichia coli. Biotechnol Bioeng 1991,

38(3):296-303.

137. Yup Lee S: Poly(3-hydroxybutyrate) production from xylose by recombinant

Escherichia coli. Bioprocess Eng 1998, 18(5):397-399.

184

138. Franklin FC, Bagdasarian M, Bagdasarian MM, Timmis KN: Molecular and

functional analysis of the TOL plasmid pWWO from Pseudomonas putida and

cloning of genes for the entire regulated aromatic ring meta cleavage pathway. P

Natl Acad Sci USA 1981, 78(12):7458-7462.

139. Bachmann B: Derivations and genotypes of some mutant derivatives of Escherichia

coli K12, In: Escherichia coli and Salmonella: cellular and molecular biology, vol. 2.

Washington DC: ASM Press; 1987.

140. Yanisch-Perron C, Vieira J, Messing J: Improved M13 phage cloning vectors and

host strains: Nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 1985,

33(1):103-119.

141. Sambrook J, Fritsch EF, Maniatis T: Molecular cloning, vol. 1: Cold spring harbor

laboratory press New York; 1989.

142. Kessler B, de Lorenzo V, Timmis KN: A general system to integrate lacZ fusions into

the chromosomes of gram-negative eubacteria: Regulation of the Pm promoter of

the TOL plasmid studied with all controlling elements in monocopy. Mol Gen Genet

1992, 233(1-2):293-301.

143. de Lorenzo V, Eltis L, Kessler B, Timmis KN: Analysis of Pseudomonas gene

products using lacIq/Ptrp-lac plasmids and transposons that confer conditional

phenotypes. Gene 1993, 123(1):17-24.

144. Durner R, Witholt B, Egli T: Accumulation of Poly[(R)-3-hydroxyalkanoates] in

Pseudomonas oleovorans during growth with octanoate in continuous culture at

different dilution rates. Appl Environ Microbiol 2000, 66(8):3408-3414.

145. Callens M, Kersters-Hilderson H, Van Opstal O, De Bruyne CK: Catalytic properties

of D-xylose isomerase from Streptomyces violaceoruber. Enzyme Microb Technol

1986, 8(11):696-700.

146. Eliasson A, Boles E, Johansson B, Osterberg M, Thevelein JM, Spencer-Martins I,

Juhnke H, Hahn-Hagerdal B: Xylulose fermentation by mutant and wild-type strains

of Zygosaccharomyces and Saccharomyces cerevisiae. Appl Microbiol Biotechnol

2000, 53(4):376-382.

147. Ren Q, Grubelnik A, Hoerler M, Ruth K, Hartmann R, Felber H, Zinn M: Bacterial

poly(hydroxyalkanoates) as a source of chiral hydroxyalkanoic acids.


148. Hayashi K, Morooka N, Yamamoto Y, Fujita K, Isono K, Choi S, Ohtsubo E, Baba T,

Wanner BL, Mori H et al: Highly accurate genome sequences of Escherichia coli K-

12 strains MG1655 and W3110. Mol Syst Biol 2006, 2(1):2006.0007.

149. Hoffmann N, Rehm BHA: Regulation of polyhydroxyalkanoate biosynthesis in

Pseudomonas putida and Pseudomonas aeruginosa. FEMS Microbiol Lett 2004,

237(1):1-7.

150. Timm A, Steinbüchel A: Formation of polyesters consisting of medium-chain-length

3-hydroxyalkanoic acids from gluconate by Pseudomonas aeruginosa and other

fluorescent Pseudomonads. Appl Environ Microbiol 1990, 56(11):3360-3367.

151. Fuhrer T, Fischer E, Sauer U: Experimental identification and quantification of

glucose metabolism in seven bacterial species. J Bacteriol 2005, 187(5):1581-1590.

185

152. Meijnen JP, de Winde JH, Ruijssenaars HJ: Establishment of oxidative D-xylose

metabolism in Pseudomonas putida S12. Appl Environ Microbiol 2009, 75(9):2784-

2791.

153. Saier MH: Bacterial phosphoenolpyruvate: Sugar phosphotransferase systems:

Structural, functional, and evolutionary interrelationships. Bacteriol Rev 1977,

41(4):856-871.

154. Sawyer MH, Baumann P, Baumann L, Berman SM, Cánovas JL, Berman RH:

Pathways of D-fructose catabolism in species of Pseudomonas. Arch Microbiol 1977,

112(1):49-55.

155. Koller M, Atlić A, Dias M, Reiterer A, Braunegg G: Microbial PHA production from

waste raw materials. In: Plastics from Bacteria. Edited by Chen GG-Q, vol. 14:

Springer Berlin Heidelberg; 2010: 85-119.

156. Sun Z, Ramsay JA, Guay M, Ramsay B: Increasing the yield of mcl-PHA from

nonanoic acid by co-feeding glucose during the PHA accumulation stage in two-

stage fed-batch fermentations of Pseudomonas putida KT2440. J Biotechnol 2007,

132(3):280-282.

157. Sun Z, Ramsay J, Guay M, Ramsay B: Enhanced yield of medium-chain-length

polyhydroxyalkanoates from nonanoic acid by co-feeding glucose in carbon-

limited, fed-batch culture. J Biotechnol 2009, 143(4):262-267.

158. Sun Z, Ramsay JA, Guay M, Ramsay BA: Automated feeding strategies for high-

cell-density fed-batch cultivation of Pseudomonas putida KT2440. Appl Microbiol

Biotechnol 2006, 71(4):423-431.

159. Kim GJ, Lee IY, Yoon SC, Shin YC, Park YH: Enhanced yield and a high production

of medium-chain-length poly(3-hydroxyalkanoates) in a two-step fed-batch

cultivation of Pseudomonas putida by combined use of glucose and octanoate.

Enzyme Microb Technol 1997, 20(7):500-505.

160. Heider J: A new family of CoA-transferases. FEBS Letters 2001, 509(3):345-349.

161. Söhling B, Gottschalk G: Molecular analysis of the anaerobic succinate degradation

pathway in Clostridium kluyveri. J Bacteriol 1996, 178(3):871-880.

162. Schubert P, Krüger N, Steinbüchel A: Molecular analysis of the Alcaligenes

eutrophus poly(3-hydroxybutyrate) biosynthetic operon: Identification of the N

terminus of poly(3-hydroxybutyrate) synthase and identification of the promoter.

J Bacteriol 1991, 173(1):168-175.

163. Braunegg G, Sonnleitner B, Lafferty R: A rapid gas chromatographic method for the

determination of poly-3-hydroxybutyric acid in microbial biomass. Appl Microbiol

Biotechnol 1978, 6:29-37.

164. Gogolewski S, Jovanovic M, Perren SM, Dillon JG, Hughes MK: Tissue response and

in vivo degradation of selected polyhydroxyacids: Polylactides (PLA), poly(3-

hydroxybutyrate) (PHB), and poly(3-hydroxybutyrate-co-3-hydroxyvalerate)

(PHB/PHV). J Biomed Mater Res 1993, 27(9):1135-1148.

165. Brandl H, Bachofen R, Mayer J, Wintermantel E: Degradation and applications of

polyhydroxyalkanoates. Can J Microbiol 1995, 41:143-153.

186

166. Rathbone S, Furrer P, Lubben J, Zinn M, Cartmell S: Biocompatibility of

polyhydroxyalkanoate as a potential material for ligament and tendon scaffold

material. J Biomed Mat Res 2010, 93A(4):1391-1403.

167. Engelberg I, Kohn J: Physico-mechanical properties of degradable polymers used

in medical applications: A comparative study. Biomaterials 1991, 12(3):292-304.

168. Kim JS, Lee BH, Kim BS: Production of poly(3-hydroxybutyrate-co-4-

hydroxybutyrate) by Ralstonia eutropha. Biochem Eng J 2005, 23(2):169-174.

169. Saito Y, Nakamura S, Hiramitsu M, Doi Y: Microbial synthesis and properties of

poly(3-hydroxybutyrate-co-4-hydroxybutyrate). Polym Int 1996, 39(3):169-174.

170. Choi JI, Lee SY: High-level production of poly(3-hydroxybutyrate-co-3-

hydroxyvalerate) by fed-batch culture of recombinant Escherichia coli. Appl

Environ Microb 1999, 65(10):4363-4368.

171. Sudesh K, Fukui T, Taguchi K, Iwata T, Doi Y: Improved production of poly(4-

hydroxybutyrate) by Comamonas acidovorans and its freeze-fracture morphology.

Int J Biol Macromol 1999, 25(1–3):79-85.

172. Luli GW, Strohl WR: Comparison of growth, acetate production, and acetate

inhibition of Escherichia coli strains in batch and fed-batch fermentations. Appl


173. Murata T, Horinouchi S, Beppu T: Production of poly(L-aspartyl-L-phenylalanine)

in Escherichia coli. J Biotechnol 1993, 28(2–3):301-312.

174. Zhang L, Shi Z-Y, Wu Q, Chen G-Q: Microbial production of 4-hydroxybutyrate,

poly-4-hydroxybutyrate, and poly(3-hydroxybutyrate-co-4-hydroxybutyrate) by

recombinant microorganisms. Appl Microbiol Biotechnol 2009, 84(5):909-916.

175. Hanahan D: Studies on transformation of Escherichia coli with plasmids. J Mol Biol

1983, 166(4):557-580.

176. YanischPerron C, Vieira J, Messing J: Improved M13 phage cloning vectors and host

strains: Nucleotide sequences of the M13mp18 and Puc19 vectors. Gene 1985,

33(1):103-119.

177. Bullock W, Fernandez J, Short J: XL1-blue: High efficiency plasmid transforming

recA Escherichia coli strain with β-galactosidase selection. BioTechniques 1987,

5(376-378).

178. Simon R, Priefer U, Puhler A: A broad host range mobilization system for in vivo

genetic engineering: Transposon mutagenesis in gram-negative bacteria. Nat

Biotechnol 1983, 1(9):784-791.

179. Daegelen P, Studier FW, Lenski RE, Cure S, Kim JF: Tracing ancestors and relatives

of Escherichia coli B, and the derivation of B strains REL606 and BL21(DE3). J

Mol Biol 2009, 394(4):634-643.

180. Marvel CS, Birkhimer ER: The preparation of the sodium salts of ω-

hydroxybutyric,-valeric and-caproic acids. J Am Chem Soc 1929, 51(1):260-262.

181. Chang DE, Shin S, Rhee JS, Pan JG: Acetate metabolism in a pta mutant of

Escherichia coli W3110: Importance of maintaining acetyl coenzyme a flux for

growth and survival. J Bacteriol 1999, 181(21):6656-6663.

187

182. Wang FL, Lee SY: High cell density culture of metabolically engineered Escherichia

coli for the production of poly(3-hydroxybutyrate) in a defined medium. Biotechnol

Bioeng 1998, 58(2-3):325-328.

183. Lee SY, Chang HN: Production of poly(3-hydroxybutyric acid) by recombinant

Escherichia coli strains: Genetic and fermentation studies. Can J Microbiol 1995,

41(13):207-215.

184. Li ZJ, Cai L, Wu Q, Chen GQ: Overexpression of NAD kinase in recombinant

Escherichia coli harboring the phbCAB operon improves poly(3-hydroxybutyrate)

production. Appl Microbiol Biotechnol 2009, 83(5):939-947.

185. Riesenberg D: High cell-density cultivation of Escherichia coli. Curr Opin Biotechnol

1991, 2(3):380-384.

186. Madison LL, Huisman GW: Metabolic engineering of poly(3-hydroxyalkanoates):

From DNA to plastic. Microbiol Mol Biol R 1999, 63(1):21-53.

187. Ren Q, Ruth K, Thöny-Meyer L, Zinn M: Enatiomerically pure hydroxycarboxylic

acids: Current approaches and future perspectives. Appl Microbiol Biotechnol 2010,

87(1):41-52.

188. Ward PG, O'Connor KE: Bacterial synthesis of polyhydroxyalkanoates containing

aromatic and aliphatic monomers by Pseudomonas putida CA-3. Int J Biol

Macromol 2005, 35(3-4):127-133.

189. Opitz F, Schenke-Layland K, Richter W, Martin DP, Degenkolbe I, Wahlers T, Stock

UA: Tissue engineering of ovine aortic blood vessel substitutes using applied shear

stress and enzymatically derived vascular smooth muscle cells. Ann Biomed Eng

2004, 32(2):212-222.

190. Shojaosadati SA, Kolaei SMV, Babaeipour V, Farnoud AM: Recent advances in high-

cell-density cultivation for production of recombinant protein. Iran J Biotechnol

2008, 6(2):63-84.

191. Korz DJ, Rinas U, Hellmuth K, Sanders EA, Deckwer WD: Simple fed-batch

technique for high cell-density cultivation of Escherichia coli. J Biotechnol 1995,

39(1):59-65.

192. Lee SY, Lee KM, Chan HN, Steinbuchel A: Comparison of recombinant Escherichia

coli strains for synthesis and accumulation of poly-(3-hydroxybutyric acid) and

morphological changes. Biotechnol Bioeng 1994, 44(11):1337-1347.

193. Lee SY: High cell-density culture of Escherichia coli. Trends Biotechnol 1996,

14(3):98-105.

194. Waegeman H, Soetaert W: Increasing recombinant protein production in

Escherichia coli through metabolic and genetic engineering. J Ind Microbiol

Biotechnol 2011, 38(12):1891-1910.

195. Clomburg J, Gonzalez R: Biofuel production in Escherichia coli: The role of

metabolic engineering and synthetic biology. Appl Microbiol Biotechnol 2010,

86(2):419-434.

196. Palmeri R, Pappalardo F, Fragalà M, Tomasello M, Damigella A, Catara AF:

Polyhydroxyalkanoates (PHAs) production through conversion of glycerol by

188

selected strains of Pseudomonas mediterranea and Pseudomonas corrugata. Chem

Eng 2012, 27.

197. Ren Q, Henes B, Fairhead M, Thöny-Meyer L: High level production of tyrosinase in

recombinant Escherichia coli. BMC Biotechnol 2013, 13(1):1-10.

198. Valentin HE, Zwingmann G, Schonebaum A, Steinbüchel A: Metabolic pathway for

biosynthesis of poly(3-hydroxybutyrate-co-4-hydroxybutyrate) from 4-

hydroxybutyrate by Alcaligenes eutrophus. Eur J Biochem FEBS 1995, 227(1-2):43-

60.

199. Cutayar JM, Poillon D: High-cell-density culture of E. coli in a fed-batch system

with dissolved oxygen as substrate feed indicator. Biotechnol Lett 1989, 11(3):155-

160.

200. Wang F, Lee SY: Production of poly(3-hydroxybutyrate) by fed-batch culture of

filamentation-suppressed recombinant Escherichia coli. Appl Environ Microbiol

1997, 63(12):4765-4769.

201. Kämpf MM, Thöny-Meyer L, Ren Q: Biosynthesis of poly(4-hydroxybutyrate) in

recombinant Escherichia coli grown on glycerol is stimulated by propionic acid. Int

J Biol Macromol 2014, 71:8-13.

202. Roe AJ, O'Byrne C, McLaggan D, Booth IR: Inhibition of Escherichia coli growth by

acetic acid: A problem with methionine biosynthesis and homocysteine toxicity.

Microbiol-Sgm 2002, 148:2215-2222.

203. Lin H, Castro N, Bennett G, San K-Y: Acetyl-CoA synthetase overexpression in

Escherichia coli demonstrates more efficient acetate assimilation and lower acetate

accumulation: A potential tool in metabolic engineering. Appl Microbiol Biotechnol

2006, 71(6):870-874.

204. Hori Y, Yamaguchi A, Hagiwara T: Chemical synthesis of high molecular weight

poly(3-hydroxybutyrate-co-4-hydroxybutyrate). Polymer 1995, 36(24):4703-4705.

205. Odermatt EK, Funk L, Bargon R, Martin DP, Rizk S, Williams SF: MonoMax suture:

A new long-term absorbable monofilament suture made from poly-4-

hydroxybutyrate. Int J Polym Sci 2012, 2012:12.

206. Martin DP, Badhwar A, Shah DV, Rizk S, Eldridge SN, Gagne DH, Ganatra A, Darois

RE, Williams SF, Tai H-C et al: Characterization of poly-4-hydroxybutyrate mesh

for hernia repair applications. J Surg Res 2013, 184(2):766-773.

207. Mendelson K, Aikawa E, Mettler BA, Sales V, Martin D, Mayer JE, Schoen FJ: Healing

and remodeling of bioengineered pulmonary artery patches implanted in sheep.

Cardiovasc Pathol 2007, 16(5):277-282.

208. Team RC: R: A language and environment for statistical computing. Edited by

Computing RFfS: http://www.R-project.org/; 2012.

209. Fox J: Getting started with the R commander: A basic-statistics graphical user

interface to R. J Stat Softw 2005, 14(9):1-42.

210. Martens AA, Besseling NAM, Rueb S, Sudhölter EJR, Spaink HP, De Smet LCPM:

Random scission of polymers: Numerical simulations, and experiments on

hyaluronan hydrolosis. Macromolecules 2011, 44(8):2559-2567.

http://www.r-project.org/;

189

211. Majid MIA, Ismail J, Few LL, Tan CF: The degradation kinetics of poly(3-

hydroxybutyrate) under non-aqueous and aqueous conditions. Eur Polym J 2002,

38(4):837-839.

212. Billmeyer Jr. FW: Textbook of polymer science. Edited by Sons JW; 1984: 261-360.

213. Yu G-e, Marchessault RH: Characterization of low molecular weight poly(β-

hydroxybutyrate)s from alkaline and acid hydrolysis. Polymer 2000, 41(3):1087-

1098.

214. Ward IM: Mechanical properties of solid polymers. In: Mechanical Properties of

Solid Polymers. John Wiley & Sons; 1985: 329-373.

215. Callister Jr. WD: Materials science and engineering: An introduction. Edited by

Sons JW; 1997: 466-485.

216. Diniz SC, Taciro MK, Cabrera Gomez JG, Pradella JGC: High-cell-density cultivation

of Pseudomonas putida IPT 046 and medium-chain-length polyhydroxyalkanoate

production from sugarcane carbohydrates. Appl Biochem Biotechnol 2004,

119(1):51-69.

217. Grossman TH, Kawasaki ES, Punreddy SR, Osburne MS: Spontaneous cAMP-

dependent derepression of gene expression in stationary phase plays a role in

recombinant expression instability. Gene 1998, 209(1-2):95-103.

218. Langenbach S, Rehm BH, Steinbüchel A: Functional expression of the PHA synthase

gene phaC1 from Pseudomonas aeruginosa in Escherichia coli results in poly(3-

hydroxyalkanoate) synthesis. FEMS Microbiol Lett 1997, 150(2):303-309.

219. Sim SJ, Snell KD, Hogan SA, Stubbe J, Rha C, Sinskey AJ: PHA synthase activity

controls the molecular weight and polydispersity of polyhydroxybutyrate in vivo.

Nat Biotech 1997, 15(1):63-67.

220. Quillaguamán J, Guzmán H, Van-Thuoc D, Hatti-Kaul R: Synthesis and production

of polyhydroxyalkanoates by halophiles: Current potential and future prospects.

Appl Microbiol Biotechnol 2010, 85(6):1687-1696.

221. Fidler S, Dennis D: Polyhydroxyalkanoate production in recombinant Escherichia

coli. FEMS Microbiol Rev 1992, 9(2-4):231-235.

222. Wang F, Lee SY: Poly(3-hydroxybutyrate) production with high productivity and

high polymer content by a fed-batch culture of Alcaligenes latus under nitrogen

limitation. Appl Environ Microbiol 1997, 63(9):3703-3706.

223. Fisher RA: The design of experiments, 9th edition edn. New York Macmillan; 1935.

224. Demirbas A, Fatih Demirbas M: Importance of algae oil as a source of biodiesel.

Energ Convers Manage 2011, 52(1):163-170.

225. Carr NG, Whitton BA: The biology of cyanobacteria, vol. 19: Univ of California Press;

1982.

226. de-Bashan LE, Bashan Y: Immobilized microalgae for removing pollutants: Review

of practical aspects. Bioresour Technol 2010, 101(6):1611-1627.

227. Abed RM, Dobretsov S, Sudesh K: Applications of cyanobacteria in biotechnology.

J Appl Microbiol 2009, 106(1):1-12.

190