Role of glutathione metabolism in host defenseagainst Borrelia burgdorferi infectionMariska Kerstholta,b, Hedwig Vrijmoetha,b, Ekta Lachmandasa,b, Marije Oostinga,b, Mihaela Lupsec, Mirela Flontac,Charles A. Dinarelloa,b,d,1, Mihai G. Neteaa,b,e, and Leo A. B. Joostena,b,1

aDepartment of Internal Medicine, Radboud University Medical Center, 6525 GA Nijmegen, The Netherlands; bRadboud Center for Infectious Diseases,Radboud University Medical Center, 6525 GA Nijmegen, The Netherlands; cDepartment of Infectious Diseases, University of Medicine and Pharmacy “IuliuHatieganu,” 400349 Cluj-Napoca, Romania; dDepartment of Medicine, University of Colorado Denver, Aurora, CO 80045; and eHuman GenomicsLaboratory, Craiova University of Medicine and Pharmacy, 200349 Craiova, Romania

Contributed by Charles A. Dinarello, January 18, 2018 (sent for review December 7, 2017; reviewed by Pietro Ghezzi and Georg Schett)

Pathogen-induced changes in host cell metabolism are known tobe important for the immune response. In this study, we in-vestigated how infection with the Lyme disease-causing bacteriumBorrelia burgdorferi (Bb) affects host metabolic pathways andhow these metabolic pathways may impact host defense. First,metabolome analysis was performed on human primary mono-cytes from healthy volunteers, stimulated for 24 h with Bb atlowmultiplicity of infection (MOI). Pathway analysis indicated thatglutathione (GSH) metabolism was the pathway most significantlyaffected by Bb. Specifically, intracellular levels of GSH increased onaverage 10-fold in response to Bb exposure. Furthermore, thesechanges were found to be specific, as they were not seen duringstimulation with other pathogens. Next, metabolome analysis wasperformed on serum samples from patients with early-onset Lymedisease in comparison with patients with other infections. Sup-porting the in vitro analysis, we identified a cluster of GSH-relatedmetabolites, the γ-glutamyl amino acids, specifically altered in pa-tients with Lyme disease, and not in other infections. Lastly, weperformed in vitro experiments to validate the role for GSH metab-olism in host response against Bb. We found that the GSH pathwayis essential for Bb-induced cytokine production and identified glu-tathionylation as a potential mediating mechanism. Taken together,these data indicate a central role for the GSH pathway in the hostresponse to Bb. GSH metabolism and glutathionylation may there-fore be important factors in the pathogenesis of Lyme disease andpotentially other inflammatory diseases as well.

Lyme disease | B. burgdorferi | cell metabolism | glutathione

Lyme disease, caused by Borrelia burgdorferi (Bb) sensu lato, isthe most common vector-borne disease in the Northern

hemisphere (1, 2), transmitted by ticks. Lyme disease most oftenpresents locally with a migrating skin rash called erythemamigrans (EM) but, if left untreated, can give rise to inflammatorycomplications in the joints (3), heart (4), or nervous system (5).In most cases, Lyme disease can be effectively treated by antibi-otics, yet a small percentage of patients experience persistingsymptoms even after extensive antibiotic treatment (6, 7).Interestingly, Bb is not known to produce toxic factors (8). The

majority of Lyme disease symptoms are therefore attributed to thehost’s immune response against the pathogen. In addition, it ishypothesized that persistent symptoms after treatment are not dueto continuous infection, but rather due to an aberrant inflammatoryresponse (7, 9, 10). Together, this suggests a crucial role for the hostimmune response in the initiation and outcome of the infection.An upcoming topic in the study of the immune system is

immunometabolism, which investigates the impact of cellularmetabolism on immune cell function. This is of particular in-terest in the case of Bb as the spirochete is known to have verylimited metabolic capabilities (11, 12). This might cause thespirochete to induce specific changes in host cell metabolism.Supporting this, we recently showed that Bb induces a switch in

central glucose metabolism in host mononuclear cells which wascrucial for cytokine production (13).In the present study, we aimed to further explore the metabolic

pathways induced by Bb and analyze their role in immune cellfunction. To achieve this, we performed metabolomic analysisof primary human monocytes stimulated with Bb or other in-flammatory stimuli. Identified pathways were then further validatedusing in vitro intervention experiments to elucidate their role inthe inflammatory response. Lastly, we examined the relevantmetabolites in serum samples from acute Lyme disease patients.

ResultsPrimary Human Monocytes Exposed to Bb Display Altered GlutathioneMetabolism. To determine which metabolic pathways were affectedby Bb infection, metabolome analysis was performed on primaryhuman monocytes stimulated with Bb or medium control for 24 h.Pathway analysis was performed to identify specific metabolicpathways altered by Bb exposure (Table S1). As seen in Fig. 1A, thepathways most significantly affected by Bb were glutathione (GSH)metabolism, arachidonic acid metabolism, and pyrimidine metab-olism. When analyzing individual metabolites, eight compoundsrelated to GSH metabolism were found among the top 25 most

Significance

Inflammation plays a crucial role in the pathogenesis of Lymedisease, caused by the spirochete Borrelia burgdorferi. Intracellularmetabolism is increasingly being recognized as amajor determinantof inflammation. In this study, we investigated how B. burgdorferiaffects host cell metabolism by analyzing the intracellular metab-olome in vitro, as well as the circulating metabolome in patientswith early-onset Lyme disease. We identify glutathione metabolismas the most important target of B. burgdorferi infection and dis-cover that this pathway is essential for cytokine production, likelythrough glutathionylation. These findings not only provide moreinsight into the pathogenesis of Lyme disease but also underlinehow host–pathogen interactions in metabolism can play crucialroles in host defense against pathogens.

Author contributions: M.K., C.A.D., M.G.N., and L.A.B.J. designed research; M.K. per-formed research; H.V., E.L., M.O., M.L., M.F., M.G.N., and L.A.B.J. contributed new re-agents/analytic tools; M.K., H.V., E.L., M.O., and C.A.D. analyzed data; M.K. and C.A.D.wrote the paper; and M.G.N. supervised research.

Reviewers: P.G., Brighton and Sussex Medical School; and G.S., University of Erlangen–Nuremberg.

The authors declare no conflict of interest.

Published under the PNAS license.

Data deposition: The metabolome data reported in this paper have been deposited in theMetaboLights database, https://www.ebi.ac.uk/metabolights/ (accession no. MTBLS625).1To whom correspondence may be addressed. Email: leo.joosten@radboudumc.nl orcdinare333@aol.com.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1720833115/-/DCSupplemental.

Published online February 14, 2018.

E2320–E2328 | PNAS | vol. 115 | no. 10 www.pnas.org/cgi/doi/10.1073/pnas.1720833115

Dow

nloa

ded

by g

uest

on

June

6, 2

020

significantly affected metabolites (Fig. 1B, with references to Fig.S1). Most noteworthy, Bb stimulation induced a dramatic increasein reduced GSH levels (Fig. 1C), while only modestly increasingoxidized glutathione (GSSG) (Fig. 1D). This indicates a shift in theGSH/GSSG ratio, suggesting a more antioxidative state. Othermetabolites significantly increased by Bb stimulation includedpolyamines, nucleotide metabolites, and phospholipid metabolites.Supporting the previously demonstrated role of glucose metabo-

lism in Bb infection (13), lactate was among the most significantlyaffected metabolites.Next, we compared fold changes (FCs) relative to medium

control (RPMI) in metabolite levels in monocytes exposed to Bbwith cells exposed to the TLR4 ligand LPS and the TLR2 ligandPam3Cys. Fig. 2A shows the top 50 most differentially regulatedmetabolites between the stimuli. Interestingly, one cluster of eightmetabolites (indicated in red) was identified, which were up-regulated

N6,N6,N6-Trimethyl -L-lysineCysteineglutathione disulfideN-AcetylputrescineOrotidineEicosapentaenoic acidGamma Glutamylglutamic acidHomocysteineCysteinylglycinePutrescineL-Lactic acidMaltotrioseMaltotetraoseErythronic acidL-Glutamic acidPyridoxal 5'-phosphatePhosphorylcholinePE(16:0/18:2(9Z,12Z))Gamma-GlutamylcysteineUridine diphosphategalactoseNiacinamideGlutathioneAcetylcysteineQuinolinic acid4-Guanidinobutanoic acidAdenosine monophosphate

0.0 0.2 0.4 0.6

12

34

56

Pathway impact

-log(

p)

Glutathionemetabolism

PyrimidinemetabolismArachidonicacidmetabolism

GSH

RPMI Bb

0.001

0.01

0.1

1

10 **

Relat iveGSH

lev els

GSSG

RPMI Bb

0.1

1

10

*

RelativeGSSGlevel s

B Bb RPMI

11412

13

8

96

#

A C

D

Fig. 1. Metabolome analysis of primary monocytes stimulated with Bb versus RPMI. (A) Scatter plot of KEGG metabolic pathways in primary humanmonocytes (n = 5) affected by Bb stimulation, showing log P value of the enrichment analysis (y axis and visualized by node color) and pathway impact, takinginto account the importance of the affected metabolites within a pathway (x axis and visualized by node radius; range 0 to 1, where 1 is maximal impact).(B) Heat map depicting the top 25 most significantly affected metabolites after Bb stimulation, where red indicates an increase and blue indicates a decrease.Numbers represent references to Fig. S1. #, GSH derivative, formed upon oxidative stress of GSH. (C and D) Raw data of (C) reduced glutathione (GSH) and (D) oxidizedglutathione (GSSG) levels in primary monocytes stimulated with Bb or control (RPMI). Box plot indicates median ± min/max values. Max *P > 0.05, **P > 0.01.

Kerstholt et al. PNAS | vol. 115 | no. 10 | E2321

IMMUNOLO

GYAND

INFLAMMATION

PNASPL

US

Dow

nloa

ded

by g

uest

on

June

6, 2

020

(FC > 1) by Bb, while being down-regulated (FC < 1) by LPSstimulation and Pam3Cys stimulation. From this cluster, threemetabolites could be linked to GSH metabolism (see Fig. S1 forreference): homocysteine, pyridoxal phosphate (PLP), and flavinadenine dinucleotide (FAD). The other metabolites in thiscluster were adenosine monophosphate (AMP), inosinic acid (orinosine monophosphate) (IMP), tetradecanoylcarnitine A, beta-alanine, and hypotaurine. GSH was also slightly increased inLPS- and Pam3Cys-stimulated samples. However, LPS andPam3Cys induced a twofold increase in GSH levels, while a 10-fold increase was seen after Bb stimulation (Fig. 2 B and C). Anoverview of all metabolites and enzymes involved in GSH me-

tabolism is given in Fig. S1. All together, these data indicate thatGSH metabolism is significantly and specifically influenced byBb stimulation.

Altered GSH Metabolism Affects Bb-Induced Cytokine Production, butNot Reactive Oxygen Species Production. To investigate whetheraltered GSH metabolism plays a role in immune cell function inresponse to Bb, we performed several in vitro validation exper-iments. First, we determined whether the increase in GSH levelsaffects the capacity of host cells to generate reactive oxygenspecies (ROS). To investigate this, human peripheral bloodmononuclear cells (PBMCs) were exposed for 24 h to Bb and

13

414

A

B C

Bb P3CysLPS

Fold change GSH

Bb LPSP3Cys

0.1

1

10

100

1000

Foldchange

Fold change GSSG

Bb LPSP3Cys

0

2

4

6

8

Foldchange

Adenosine monophosphatePyridoxal 5'-phosphateFADHomocysteineInosinic acidTetradecanoylcarnitineBeta-AlanineHypotaurineSphinganineCer(d18:0/16:0)SphingosineCeramide (d18:1/18:0)1-MethylnicotinamideLysoPC(18:2(9Z,12Z))LysoPC(20:4(5Z,8Z,11Z,14Z))N1-AcetylspermineCytidine2-PalmitoylglycerophosphocholineLysoPC(18:1(9Z))LysoPC(16:0)D-Glucuronic acidMesaconic acidD-FructoseQuinolinic acidCytosineCitric acidItaconic acidL-Kynurenine3-Hydroxybutyric acidAcetaminophenMyoinositolParacetamol sulfateMethionine sulfoxideDihydrothymineGuanidoacetic acidD-GlucoseL-HistidineL-ProlineL-ArginineL-TyrosineGlycineD-MannoseMaltotrioseAdenineAcetylglycineL-Aspartic acidL-Glutamic acidSerotoninCholinePseudouridine

Fig. 2. Metabolome analysis of primary monocytes stimulated with Bb versus LPS and P3cys. (A) Heat map depicting top 50 most differentially regulatedmetabolites in primary monocytes stimulated with Bb or the TLR ligands LPS or P3cys (all n = 5), based on fold changes in metabolite levels relative tounstimulated controls. Numbers represent references to Fig. S1. (B and C) Fold changes (relative to unstimulated controls) in levels of GSH (B) and GSSG (C) inprimary monocytes stimulated with Bb compared with LPS and Pam3cys. Box plot indicates median ± min/max.

E2322 | www.pnas.org/cgi/doi/10.1073/pnas.1720833115 Kerstholt et al.

Dow

nloa

ded

by g

uest

on

June

6, 2

020

then stimulated with serum-opsonized zymosan (SOZ), a potentinducer of ROS. Indeed, exposure to Bb strongly decreasedSOZ-induced ROS production (Fig. 3A). However, loweringGSH concentrations using buthionine sulfoximine (BSO) ordiethyl maleate (DEM) did not reverse the effect of Bb stimu-lation on ROS production (Fig. 3 B and C), indicating that thiseffect was independent of GSH levels.Next, we determined whether altered GSH metabolism affects

Bb-induced cytokine production. PBMCs were pretreated withmodulators of GSH metabolism and then stimulated for 24 hwith Bb. All compounds were checked for cytotoxicity, and, withthe exception of the high DEM concentration, no signs of cy-totoxicity were seen (Fig. S2). First, GSH biosynthesis was tar-geted by inhibiting γ-glutamylcysteine synthase (GCS) usingBSO. As shown in Fig. 3D, BSO showed disparate effects oncytokine production, with low concentration decreasing IL-1βproduction, while increasing TNFα. Depleting GSH with low-concentration DEM gave similar results to GCS inhibition, de-creasing IL-1β production and increasing TNFα production (Fig.3E). High concentrations of DEM strongly decreased the pro-duction of both cytokines although this may be confounded byeffects on cell viability (Fig. S2). The more potent effect of DEMon cytokine production was reflected by GSH levels as DEM ledto an earlier and stronger decrease in intracellular GSH levelsthan BSO (Fig. S3). Furthermore, DEM may have additionaleffects by reacting with other thiols and/or activating the tran-scription factor NRF2 (14). All together, these data suggest thatmodulation of GSH metabolism strongly affects cytokine pro-duction although the effect is dose-dependent.

Surprisingly, increasing GSH synthesis by the addition of theprecursor N-acetyl-cysteine (NAC) also strongly decreased pro-duction of both cytokines, as seen from Fig. 3F. This suggeststhat both inhibition and inducing GSH synthesis can decreasecytokine production.

GSH Metabolism Affects Cytokine Production Through DifferentMechanisms. To unravel how modulation of GSH metabolismaffects Bb-induced cytokine production, we first analyzed theeffect of modulators of GSH metabolism on mRNA transcrip-tion. For BSO and NAC, the highest concentrations were used todetect the maximal effect. For DEM, the lower concentrationwas selected to rule out cytotoxic effects. As seen in Fig. 4A, asubstantial increase in mRNA levels of IL1B was seen after 4 hand 24 h of stimulation with Bb. However, these mRNA levelswere unaffected by treatment with the GSH modulators.For TNF, a significant increase in mRNA expression was seen

after 4 h, but not 24 h of stimulation with Bb (Fig. 4B), suggestingthat induction of TNF mRNA is rapid but short-lasting. De-pletion of GSH by DEM was able to mildly potentiate mRNAlevels, yet the other inhibitors showed no significant effect.Taken together, these data indicate that the induction of IL1B

and TNF mRNA by Bb is largely unaltered by modulation ofGSH metabolism. This suggests that the previously shown effectson cytokine secretion mostly take place posttranscriptionally.To further elucidate this, we measured the intracellular levels

of (pro)IL-1β and TNFα to determine whether mRNA was ef-fectively being translated into protein. As shown in Fig. 4C,stimulation with Bb drastically increased levels of intracellular

A B C

D E F

Zymosan-induced ROS

RPMI Bb

0

2×106

4×106

6×106

8×106

***

luminescence(AUC)

Zymosan-induced ROS

RPMI Bb

+BSO1001000

0

2×1064×1066×1068×1061×107

luminescence(AUC) Zymosan-induced ROS

RPMI Bb

+DEM50 50

00

2×1064×1066×1068×10

6

1×107

luminescence(AUC)

IL-1β_BSO

Bb

+BSO100

1000

10

100

1000

10000

*

(pg/ml)

IL-1β_DEM

Bb

+DEM50 50

010

100

1000

10000

*****

(pg/ml)

TNFα_BSO

Bb

+BSO100

1000

10

100

1000

10000**

*

(pg/ml)

TNFα_DEM

Bb

+DEM50 50

010

100

1000

10000*

***

(pg/ml)

IL-1β_NAC

Bb

+NAC1000

10.000

10

100

1000

10000**

*

(pg/ml)

TNFα_NAC

Bb

+NAC1000

10.000

10

100

1000

10000

****

(pg/ml)

Fig. 3. Effect of inhibitors of GSH metabolism on ROS production and cy-tokine production. (A) Area under the curve (AUC) of ROS-induced lumi-nescence on serum-opsonized zymosan (SOZ)-stimulated PBMCs (n = 11)pretreated for 24 h with Bb or control (RPMI). (B and C) AUC of ROS-inducedluminescence on SOZ-stimulated PBMCs (n = 8 and n = 6, respectively) pre-treated with Bb in the presence of different doses of the GSH synthesis in-hibitor BSO (B) (n = 8) or the GSH-depleting agent DEM (C) (n = 6). (D–F)Production of IL-1β (Upper) and TNFα (Lower) by PBMCs after 24 h stimula-tion with Bb in the presence of different doses (in μM) of (D) BSO (n = 14),(E) DEM (n = 14), or (F) N-acetylcysteine (NAC, n = 15). Bar graphs representmean ± SEM. *P > 0.05, **P > 0.01, ***P < 0.001.

A B

C

E F

D

G H

IL1B

RPMI Bb

+DEM+BSO+NAC

RPMI Bb

+DEM+BSO+NAC

0.1

1

10

100

1000

10000 4hr 24hr

*

*

Relativeexpression

TNF

RPMI Bb

+DEM+BSO+NAC

RPMI Bb

+DEM+BSO+NAC

0.1

1

10

1004hr 24hr

**

Relativeexpression

IL-1β_intracellular

RPMI Bb

+DEM+BSO+NAC

100

1000

10000

100000

1000000

*

(pg/ml)

TNFα_intracellular

RPMI Bb

+DEM+BSO+NAC

0

500

1000

1500

*

(pg/ml)

IL-1β_intracellular

RPMI

Bb+Veh

+2-AAPA0.1

+2-AAPA1

100

1000

10000

100000 *

(pg/ml)

IL-1β_secreted

RPMI

Bb+Veh

+2-AAPA0.1

+2-AAPA1

10

100

1000

10000 **

(pg/ml)

TNFα_secreted

RPMI

Bb+Veh

+2-AAPA0.1

+2-AAPA1

10

100

1000

10000 **

(pg/ml)

TNFα_intracellular

RPMI

Bb+Veh

+2-AAPA0.1

+2-AAPA1

0

500

1000

1500

**

(pg/ml)

Fig. 4. Effect of modulators of GSH metabolism on cytokine transcriptionand translation. (A and B) mRNA expression of IL1B (A) and TNF (B) in PBMCsfrom healthy volunteers (n = 6) pretreated for 1 h with DEM, BSO, or NACand stimulated for 4 h and 24 h with Bb. Box plot indicates median ±min/max.(C and D) Measurement of (total) IL-1β (C) and TNFα (D) protein levels incellular lysates of PBMCs from healthy volunteers (n = 6) pretreated for 1 hwith DEM, BSO, or NAC and stimulated for 24 h with Bb. (E–H) Protein levelsof (total) IL-1β and TNFα in cellular lysates (intracellular) (G and H) or cell-freesupernatants (secreted) (E and F) of PBMCs from healthy volunteers (n = 6)pretreated for 1 h with the glutathionylation inducer 2-AAPA and stimulatedfor 24 h with Bb. Vehicle controls were included as needed (indicated by+Veh). Bar graphs represent mean ± SEM. *P > 0.05.

Kerstholt et al. PNAS | vol. 115 | no. 10 | E2323

IMMUNOLO

GYAND

INFLAMMATION

PNASPL

US

Dow

nloa

ded

by g

uest

on

June

6, 2

020

(pro)IL-1β. However, similar to the transcriptome data, in-tracellular concentrations were not significantly altered by theaddition of GSH modulators. This suggests that the effects ofGSH modulation on IL-1β secretion occur posttranslationally.In contrast to the IL-1β data, intracellular TNFα levels were

substantially affected by modulation of GSH metabolism. Similarto what was seen for secreted TNFα levels, stimulation with Bbled to increased intracellular TNFα levels, which were potenti-ated by the addition of DEM and inhibited by the addition ofNAC (Fig. 4D). BSO had no significant effect on intracellularTNFα levels. The effect of DEM treatment could at least par-tially be explained by increased mRNA levels. However, NACtreatment did not significantly affect mRNA levels of TNF, whilecompletely shutting down intracellular levels. This suggests thatthe inhibitory effect of this compound is due to an effect on thetranslation of TNF mRNA into protein.Taken together, these data suggest that modulation of GSH

metabolism affects cytokine production through different mecha-nisms, for a large part taking place at the (post)translational level.Therefore, we hypothesized that the process of glutathionylationmay play a role. Glutathionylation is a posttranslational modifi-cation in which a GSH molecule binds directly to a protein. Todetermine whether glutathionylation plays a role in Bb-inducedcytokine production, we made use of 2-AAPA, an inhibitor ofglutaredoxin-1 (15), which is expected to increase gluta-thionylation. As shown in Fig. 4 E and F, a high dose 2-AAPAdecreased secretion of both IL-1β and TNFα. However, similarto the GSH modulators, intracellular levels of (pro)IL-1β re-mained unchanged (Fig. 4G), while intracellular levels of TNFαwere affected to the same extent as secreted levels (Fig. 4H).This suggests that 2-AAPA modulates cytokine production in asimilar fashion as modulators of GSH metabolism, supportingthe hypothesis that glutathionylation mediates the effect of GSHon cytokines.Overall, these data show that modulation of GSH metabolism

substantially affects the secretion of IL-1β and TNFα throughdifferent mechanisms. For IL-1β, GSH seems to affect activationand/or processing of IL-1β. For TNFα, decreasing GSH levelsappeared to induce mRNA transcription, while increasing GSHlevels interfered with mRNA translation. In both cases, these al-terations may be mediated by altered levels of glutathionylation.

GSH Metabolism Is Altered in Patients with EM. To further validateour in vitro data, we performed metabolome analysis on serumof patients with EM. First, pathway analysis was performed tocompare patients with EM to healthy controls. As shown in Fig.5A, the aminoacyl-tRNA biosynthesis pathway, involved inmRNA translation, was the most significantly affected pathwayin EM patients. Next to this, arachidonic acid metabolism wasfound to be altered in these patients, in accordance with ourmonocyte metabolome data. Further supporting our monocytemetabolome data, GSH metabolism was among the top 10 mostsignificantly affected pathways. In addition, cysteine metabolismand methionine metabolism, both upstream from GSH metabo-lism, were found in the top 10 most affected pathways. Takentogether, this suggests that our model of primary human mono-cytes exposed to Bb correlates very well to the circulating metab-olome in vivo.Next, we compared patients with EM and healthy controls to

patients with acute bacterial infection. Fig. 5B depicts the top45 most differentially expressed metabolites between the fourgroups. Notably, one cluster was seen, indicated in blue, withmetabolites significantly increased in patients with Bb infection,while remaining unchanged in patients with other infections. Thetop five metabolites in this cluster turned out to be γ-glutamylamino acids (Fig. 5B, indicated by “¥”), breakdown productsfrom γ-glutamyl transpeptidase activity (GGT). This is againsupportive of our previous data as GGT is involved in the recy-

cling of oxidized GSH (see Fig. S1 for reference). Interestingly,L-methionine, a possible precursor for GSH, was found to bestrongly decreased compared with both healthy controls and pa-tients with other infections (Fig. 5B, indicated by “#”).Apart from the γ-glutamyl amino acids, several eicosanoid

metabolites were found to be significantly elevated in EM pa-tients compared with both healthy controls and patients withother infections.Together, these findings indicate that strong and specific al-

terations in GSH metabolism, as well as eicosanoid/arachidonicacid metabolism, are found systemically after Bb infection.To further support these findings, we made use of publicly

available transcriptome data from PBMCs of patients with EMto analyze gene expression levels of GSH-related genes (16).Noteworthy, several genes in GSH metabolism were differen-tially expressed in patients with Lyme disease in the acute stage(CBS, GSS, GGT1) but also up to 3 wk (MAT2A, GSS, GGT1)and even 6 mo (CBS, GGT1) after diagnosis (Fig. S4). GGT1,the gene encoding for γ-glutamyl transpeptidase (GGT) was theonly gene significantly altered in Lyme patients at all time points.However, contrary to the increased levels of γ-glutamyl aminoacids found in serum, gene expression of GGT was consistentlydown-regulated. This suggests a feedback mechanism in whichhigh levels of breakdown products down-regulate gene expres-sion. Nevertheless, these data support the conclusion that GGTactivity is altered in patients with Bb infection.Taken together, we show that GSH metabolism is strongly

affected in patients with EM, as seen from altered metabolitelevels in serum and persistently altered transcriptional activityin PBMCs.

DiscussionIn this study, we have shown that exposure of primary humanmonocytes to Bb results in significant and specific changes inGSH metabolism. In addition, we show that modulating GSHmetabolism significantly affects cytokine production, possiblythrough glutathionylation. Finally, we provide evidence thatGSH metabolism is altered in patients with EM and that thesealterations might persist for months after the initial infection.Previous studies have shown the important role for metabolic

pathways in the inflammatory response to pathogens. In thisstudy, we investigated which metabolic pathways are involved inthe host response against Bb. Both our metabolome analysis onmonocytes and our analysis on serum samples from patientsshowed altered GSH metabolism after Bb infection. Specifically,intracellular levels of reduced GSH were dramatically increasedin Bb-stimulated monocytes.Considering the antioxidative properties of GSH, it was in-

teresting to find that stimulation with Bb lowered ROS generationin response to a secondary stimulus. Surprisingly, this dampen-ing of the oxidative response appeared independent of GSHlevels. Nevertheless, this may have important implications asROS is an important component of the antimicrobial defenseand decreased ROS production might increase susceptibility toother pathogens.Despite not affecting ROS generation, we found that modu-

lation of GSH metabolism substantially influenced the pro-duction of IL-1β and TNFα, two crucial innate cytokines. Thesefindings are in accordance to a recent study by Diotallevi et al.(17), who showed that GSH influences cell signaling and in-flammation independent from its antioxidative properties. In-terestingly, both inducing GSH synthesis and depleting GSHstrongly decreased cytokine production while moderate inhibi-tion increased cytokine production. Multiple studies have pre-viously suggested a role for GSH levels in cytokine production(18–20), yet the underlying mechanism has so far not completelybeen elucidated.

E2324 | www.pnas.org/cgi/doi/10.1073/pnas.1720833115 Kerstholt et al.

Dow

nloa

ded

by g

uest

on

June

6, 2

020

To provide more insight into how GSH levels affect Bb-induced cytokine production, we examined the effect of GSHmodulators on cytokine mRNA levels and intracellular levels.For TNFα, we found that altering GSH levels significantly af-fected TNFA mRNA levels, in accordance to what was found byFratelli et al. (21). However, the mRNA levels could not fullyaccount for the effect of the GSH modulators, indicating that partof the effect of GSH metabolism occurs posttranscriptionally.Elaborating on this, we found that modulation of GSH metabo-lism likely also affects translation of TNF mRNA into protein asintracellular protein levels were affected by the inhibitors in asimilar fashion as secreted levels of TNFα. We hypothesize thatthis effect might be mediated by glutathionylation: the binding of

GSH to a protein as a posttranslational modification. Gluta-thionylation is increasingly being recognized as a modifica-tion with important functional consequences (22–24). A recentproteomic analysis on potential targets of glutathionylationfound a strong enrichment of proteins involved in RNA pro-cessing and translation (25). Alterations in the levels of gluta-thionylation may therefore affect mRNA translation, therebyinfluencing protein synthesis. Alternatively, glutathionylationmay affect TNFα release through peroxiredoxin-2, as shown bySalzano et al. (26)Contrary to TNFα, GSH-mediated effects on IL-1β secretion

appear to take place at the posttranslational level as intracellularlevels of (pro)IL-1β were unaffected by GSH modulation. We

Pathway impact0.0 0.2 0.4 0.6

05

0151

0252

) p( gol -

A 1345

678 910

2

B EM HCG-neg G-pos

#

¥

Sphingomyelin(d18:1/20:0)Sphingomyelin(d18:1/22:1(13Z))Sphingosine 1- phosphateSphinganine 1- phosphateStearoylcarni neLysoPC(20:4(5Z,8Z,11Z,14Z))Glycerophosphorylcholine4E,15Z-Bilirubin IXaBilirubinOxalic acidPC(18:2(9Z,12Z)/18:3(9Z,12Z,15Z))Alpha-tocopherolL-Glutaminebeta-CryptoxanthinL-MethionineL-Asparagine4-Hydroxyphenylpyruvic acidPE(P-16:0/18:1(9Z))PE(P-18:0/18:2(9Z,12Z))PE(P-16:0/18:2(9Z,12Z))PC(P-16:0/20:4(5Z,8Z,11Z,14Z))PE(O-18:1(1Z)/20:4(5Z,8Z,11Z,14Z))PE(P-16:0/20:4(5Z,8Z,11Z,14Z))Guanidoace c acidLysoPC(24:0)PC(18:2(9Z,12Z)/20:4(5Z,8Z,11Z,14Z))Vitamin A1,5-Anhydrosorbitol-Glutamyl GlutaminePC(18:2(9Z,12Z)/18:2(9Z,12Z))LysoPC(18:2(9Z,12Z))5-L-GlutamylglycineL- -glutamyl-L-valineᵞL- -glutamyl-L-leucineEpsilon-γ -Glutamyl-lysine-Glutamylglutamic acidCysteic acidLeukotriene B4Caproic acid5-HETE5-KETE7b-HydroxycholesterolIsovaleric acidLeukotriene B5Valyl-Glutamine

ᵞ

Rank Pathway -log(p) p-value(adjust) Impact

1Aminoacyl-tRNAbiosynthesis 26.2 2.68E-10 0.23

2Arachidonic acidmetabolism 26.2 2.74E-10 0.23

3 Sulfur metabolism 25.7 4.21E-10 0.044 Nitrogen metabolism 25.1 7.53E-10 0.015 Thiamine metabolism 23.7 3.02E-09 0

6 D-Glutamine and D-glutamate metabolism 21.3 3.48E-08 0.14

7

Ubiquinone and otherterpenoid-quinonebiosynthesis 21.2 3.75E-08 0.12

8

Porphyrin and

metabolismchlorophyll

20.9 5.11E-08 0.03

9Cysteine and

metabolism 20.0 1.23E-07 0.5410 Glutathione metabolism 18.3 6.52E-07 0.05

methionine

ᵞ

ᵞ

Fig. 5. Metabolome analysis on serum samples of acute EM patients compared with other infections. (A) Scatter plot of KEGG metabolic pathways in serumsamples from patients with erythema migrans (EM) (n = 10) versus healthy controls (HC) (n = 10), showing enrichment log(P) value (y axis) and pathwayimpact, determined by topological analysis (x axis). Node color is based on its P value, and the node size is based on pathway impact values. The top 10 mostsignificantly affected metabolic pathways are included for reference. (B) Heat map depicting the top 50 most differentially regulated metabolites, de-termined by ANOVA, between acute EM patients (n = 10), patients with acute Gram-negative infection (G-neg, n = 5), patients with acute Gram-positiveinfection (G-pos, n = 5), and healthy controls (HC, n = 10). #, Fig. S1, metabolite 1; ¥, Fig. S1, metabolite 11.

Kerstholt et al. PNAS | vol. 115 | no. 10 | E2325

IMMUNOLO

GYAND

INFLAMMATION

PNASPL

US

Dow

nloa

ded

by g

uest

on

June

6, 2

020

believe that glutathionylation may again play a role here as oneof the proteins found to be glutathionylated was caspase-1, anenzyme known to be crucial for cleaving pro-IL-1β into active IL-1β and subsequent secretion of the cytokine. Meissner et al. (27)showed that glutathionylation of caspase-1 was an inhibitorymodification as blockade of the GSH-binding sites significantlyincreased IL-1β secretion.To confirm the role for glutathionylation in TNFα and IL-1β

production, we made use of an inhibitor of glutaredoxin-1. Thisenzyme is involved in reversal of glutathionylation, and inhibitionof glutaredoxin-1 is therefore used to increase levels of gluta-thionylation (15). Importantly, we found that inducing gluta-thionylation inhibited cytokine production in a similar fashion asGSH modulation, affecting TNFα at the level of protein synthesisand IL-1β at the posttranslational level.Taken together, these data suggest that modulation of GSH

metabolism significantly affects secretion of cytokines, possiblymediated by protein glutathionylation. As Bb exposure leads to asubstantial increase in intracellular GSH levels, this might alsoaffect the levels of glutathionylation. In fact, induction of GSHlevels by Bb may be a mechanism to down-regulate TNFα pro-duction as Bb is known to be a poor inducer of TNFα comparedwith other pathogenic stimuli (13). This is noteworthy as TNFα isknown to be a central player in the pathogenesis of many in-fections and inflammatory diseases (28). Indeed, inhibiting GSHsignificantly increased TNFα production while potentiating GSHlevels completely shut down TNFα synthesis. In contrast, bothinhibition and induction of GSH negatively affected IL-1β pro-duction, suggesting that Bb induces GSH levels to an optimallevel for IL-1β secretion. Accordingly, Bb is known to be a verypotent inducer of IL-1β, and this cytokine is known to be an im-portant driving force in Lyme arthritis (29, 30). Taken together, thissuggests that Bb-induced changes in GSH metabolism might play arole in skewing the cytokine profile from TNFα toward IL-1β.Next to our in vitro data, we found evidence for specific al-

terations in GSH metabolism in patients with a Bb infection.Metabolome analysis showed increased levels of metabolitesrelated to GSH metabolism in serum of patients with EMcompared with both healthy controls and patients with otherinfections. Supporting this, transcriptome data showed sub-stantial and long-lasting changes in mRNA expression for GSH-related genes in PBMCs from patients with EM compared withhealthy controls. Noteworthy, one of the genes most significantlyaffected in patients with EM, was GGT1, encoding γ-glutamyltranspeptidase (GGT). This corresponded well to our data as wefound increased levels of GGT breakdown products, γ-glutamylamino acids, in serum of patients with EM. Serum GGT levelsare regularly measured as a marker of liver function and havealso been studied in patients with EM although increased GGTlevels were only found in a minority of cases (31). However,standard GGT measurements only account for excreted enzymewhile GGT is mainly membrane-bound (32). Therefore, we hy-pothesize that the elevated levels of γ-glutamyl amino acids inserum of patients with EM are due to increased activity ofmembrane-bound GGT. Taken together, these findings point to-ward an important role for GGT in the response to Bb infection.Our data suggesting an important role for GSH metabolism in

Bb infection are supported by several previous studies. Recently,Casselli et al. (33) reported two GST genes (GSTT1 and GSTM1)to be among the most significantly affected genes after Bb expo-sure in primary human astrocytes. Next to this, a recent genome-wide association study (GWAS) found a genetic variant inMAT2Bassociated to Bb seropositivity (34). MAT2B encodes for theregulatory subunit of MAT2A, one of the upstream enzymes inGSH metabolism. In our study, we found gene expression ofMAT2A to be affected by Bb infection in PBMCs of patients withEM. This suggests that GSH metabolism may also play a role in

antibody production against Bb although this will require furtherinvestigation.Taken together, these data show that infection with B. burg-

dorferi strongly modulates GSH metabolism both in vitro and inpatients with EM. As we have shown that GSH metabolism playsa crucial role in B. burgdorferi-induced cytokine production,these findings provide more insight into the pathogenesis ofLyme disease and may help explain the variability in clinical signsand disease outcome.

MethodsPrimary Human Monocytes. PBMCs were isolated from blood donated byhealthy male volunteers (n = 5) after written informed consent. Ethical ap-proval was obtained from the committee on research involving humansubjects (CMO) Arnhem-Nijmegen (NL32357.091.10).

CD14+ monocytes were isolated from PBMCs by positive selection usingMACS CD14+ magnetic beads (Miltenyi Biotec) according to the manufac-turer’s instructions. Cells were resuspended in RPMI (RPMI medium 1640, noglucose; Thermo Fisher Scientific) supplemented with 5.5 mM glucose(Sigma-Aldrich), 1 mM pyruvate (sodium pyruvate; Thermo Fisher Scientific),10% pooled human serum, 1% Hepes (Sigma), and 1% gentamycin andseeded in six-well plates (3 × 106 cells per well). Cells were left to adhere for30 min and stimulated as described.

Peripheral Blood Mononuclear Cells. PBMCs were isolated from buffy coatsfrom healthy volunteers obtained from the Sanquin blood bank after in-formed consent. All human experiments were conducted according to theprinciples of the Declaration of Helsinki. The study was approved by theArnhem-Nijmegen ethical review board. Briefly, blood was diluted withsterile PBS (1:1), and a density centrifugation was applied over Ficoll-Paque(Pharmacia Biotech). Next, the interphase containing the PBMCs was col-lected and washed with ice-cold PBS, and cells were resuspended in medium(RPMI 1640, without glucose, without glutamine; MP Biomedicals) supple-mented with 5.5 mM D-glucose (Sigma-Aldrich), 0.2 mM glutamine (gluta-MAX; Thermo Fisher Scientific), and 0.1 mM pyruvate, 1% Hepes, and1% gentamycin.

B. burgdorferi Spirochetes. B. burgdorferi, ATCC strain 35210 [American TypeCulture Collection (ATCC)] was cultured at 24 °C in Barbour–Stoenner–Kelley(BSK)-H medium (Sigma-Aldrich) supplemented with 6% rabbit serum untilspirochete growth commenced. Cells were then grown at 34 °C to latelogarithmic phase, at which point the spirochetes were checked for motilityby dark-field microscopy and harvested. Spirochetes were quantified using aPetroff–Hauser counting chamber, washed with PBS, and stored at −80 °C.

Serum Sample Patients. Serum samples were obtained from patients at theUniversity Hospital of Infectious Diseases, Cluj-Napoca, Romania. The studyprotocol was approved by the local medical ethics committee of the Uni-versity Hospital of Infectious Diseases, Cluj-Napoca (2013/01). Written in-formed consent was obtained from all participants. Patients with EM (n = 10)were clinically diagnosed by an infectious disease specialist and confirmed byan independent Lyme disease expert. Serum samples were taken beforeonset of treatment. For comparison, patients with acute bacterial sepsis (n =10) from the same center were included, as well as healthy controls (n = 10).

Metabolome Analysis. For the primary monocyte analysis, cells were stimu-lated for 24 h with B. burgdorferi [multiplicity of infection (MOI) = 0.05] ormedium control. After incubation, cell-free supernatants were collected, andcells were scraped and spun down, and dry pellets were snap frozen andstored at −80 °C. Serum samples were stored at −20 °C before analysis.

Metabolomic analysis was performed by Metabolon Inc. In short, proteinswere precipitated with methanol, and the resulting extract was divided intofive fractions: two for analysis by two separate reverse phase (RP)/ultra-performance liquid chromatography (UPLC)-tandem mass spectrometry(MS/MS) methods with positive ion mode electrospray ionization (ESI), onefor analysis by RP/UPLC-MS/MS with negative ion mode ESI, one for analy-sis by hydrophilic interaction chromatography (HILIC)/UPLC-MS/MS withnegative ion mode ESI, and one sample reserved for backup. Briefly, sampleswere placed on a TurboVap (Zymark) to remove the organic solvent. Allmethods utilized Waters ACQUITY ultra-performance liquid chromatogra-phy (UPLC) and a Thermo Scientific Q-Exactive high resolution/accuratemass spectrometer interfaced with a heated electrospray ionization (HESI-II)source and Orbitrap mass analyzer operated at 35,000 mass resolution. The

E2326 | www.pnas.org/cgi/doi/10.1073/pnas.1720833115 Kerstholt et al.

Dow

nloa

ded

by g

uest

on

June

6, 2

020

sample extract was dried and then reconstituted in solvents compatible toeach of the four methods. One aliquot was analyzed using acidic positive ionconditions, chromatographically optimized for more hydrophilic compounds.The second aliquot was also analyzed using acidic positive ion conditions;however, it was chromatographically optimized for more hydrophobic com-pounds. The third aliquot was analyzed using basic negative ion optimizedconditions using a separate dedicated C18 column. The fourth aliquot wasanalyzed via negative ionization following elution from a HILIC column (WatersUPLC BEH Amide 2.1 × 150 mm, 1.7 μm) using a gradient consisting of waterand acetonitrile with 10 mM ammonium formate, pH 10.8. Raw data wereextracted, peak-identified, and quality control processed using Metabolon’shardware and software. Compounds were identified by comparison with libraryentries of purified standards or recurrent unknown entities. Peaks werequantified using area-under-the-curve values, which were rescaled to the me-dian and normalized by Bradford protein concentration. Missing values wereimputed with the minimum.

Stimulation Experiments. For measurements of cytokines and metabolic pa-rameters, cells were seeded in duplicate in round-bottom 96-well plates (5 ×105 cells per well). Cells were pretreated with one of the following inhibi-tors: 3-deazaneplanocin A (Cayman Chemical), DL-buthionine-sulfoximine(Sigma), di-ethyl maleate (Sigma), N-acetyl cysteine (Sigma), mercapto-succinic acid (Sigma), OU749 (Cayman Chemical), 2-AAPA hydrate (Sigma), orvehicle control [i.e., RPMI or dimethyl sulfoxide (DMSO) (WAK-ChemieMedical GmbH)] for 1 h and then stimulated with B. burgdorferi for 24 h,unless otherwise indicated. After incubation, plates were spun down, andcell-free supernatants were collected and stored at −20 °C until assayed. Forintracellular cytokine measurements, cells were lysed in 0.5% Triton-X (20 μLper well), and lysates were stored at −20 °C until assayed.

Measurement of Reactive Oxygen Species. Generation of reactive oxygenspecies by PBMCs was measured using a luminol-based chemiluminescentassay. Briefly, PBMCs were collected after stimulation and added in sixfold toa white 96-well plate (1 × 105 cells per well). ROS production was induced infour wells by the addition of 3 mg/mL serum-opsonized zymosan in HBSS;the two remaining wells served as controls. Luminol (10 mM), which wasadded to all wells, is oxidized by ROS to produce the luminescent in-termediate luminophore. Luminescence, correlating to total ROS production(both intra- and extracellular), was measured continuously at 425 nM for 1 husing an Infinite 200 PRO microplate reader (Tecan).

Cytokine Measurements. Cytokine concentrations in cell culture supernatantswere measured by sandwich ELISA using commercial kits specific for IL-1β andTNFα (R&D Systems) according to the manufacturer’s instructions. Cell lysateswere spun down before measuring to remove insoluble material. Absor-bance was measured using an Infinite 200 PRO microplate reader (Tecan).

mRNA Isolation and RT-PCR.After stimulation, cells were lysed and homogenizedin TRIzol (Thermo Fischer), and RNAwas isolated according to themanufacturer’s

instructions. Isolated RNA was checked for purity and transcribed using aniScript cDNA Synthesis Kit (Bio-Rad). For quantitative polymerase chainreaction (qPCR), Power Sybr Green PCR Master Mix (Applied Biosystems)was used with a 7300 Real-time PCR system (Applied Biosystems). Primersused were as follows: B2M (housekeeping gene) [forward (Fw): ATGAG-TATGCCTGCCGTGTG, reverse (Rv): CCAAATGCGGCATCTTCAAAC], IL1B (Fw:GCCCTAAACAGATGAAGTGCTC, Rv: GAACCAGCATCTTCCTCAG), and TNF(Fw: GAGGCCAAGCCCTGGTATG, Rv: CGGGCCGATTGATCTCAGC).

Transcriptome Analysis. Previously published RNA sequencing data of PBMCsfrom patients (n = 29) with EM and healthy controls (n = 13) (16) wereobtained from the publicly available National Center for BiotechnologyInformation (NCBI) Gene Expression Omnibus (GEO) database (accessionnumber GSE63085). Expression of selected genes was compared between EMpatients at different time points and healthy controls by Kruskal–Wallis one-way ANOVA with Dunn’s post hoc test using R Software for StatisticalComputing, version 3.2.4.

Analysis of Metabolome Data. Pathway analysis and statistical analysis wereperformed using Metaboanalyst 3.0 (33) on 332 metabolites (monocytes) or638 metabolites (serum samples) with available Human Metabolome Data-base (HMDB) identifiers. For pathway analysis, metabolites were mapped toKyoto Encyclopedia of Genes and Genomes (KEGG) metabolic pathways, andquantitative pathway enrichment and pathway topology analysis wereperformed. For comparison of Bb-induced metabolic changes to metabolicchanges induced by other TLR-ligands, a parallel dataset of primary mono-cytes stimulated with LPS and Pam3Cys was used (34). Samples were acquiredin an identical manner, and sample analysis was performed simultaneously. Forall conditions, fold changes in metabolite levels relative to untreated control(RPMI) were calculated. Further statistical details can be found in the appro-priate figure legends.

Statistics. Statistics for measurements of cytokines and metabolic parameterswere performed using GraphPad Prism version 5.03 for Windows (GraphPadSoftware). Data represent mean ± SEM of n different donors. Unless otherwisestated, means were compared using the nonparametric Wilcoxon matched-pairs signed ranks test, with two-tailed significance level set as P > 0.05. Fur-ther statistical details can be found in the appropriate figure legends.

DataAvailability. Themetabolomedata in this paper have been deposited in thepublicly availableMetaboLights database (https://www.ebi.ac.uk/metabolights/,accession no. MTBLS625).

ACKNOWLEDGMENTS. We thank Carla Bartels (Medical Microbiology De-partment, Radboudumc) for culturing Bb spirochetes. M.G.N. was supportedby a Spinoza Grant of the Netherlands Organization for Scientific Researchand a Competitiveness Operational Programme Grant from the RomanianMinistry of European Funds (FUSE).

1. Rizzoli A, et al. (2011) Lyme borreliosis in Europe. Euro Surveill 16:19906.2. Bacon RM, Kugeler KJ, Mead PS; Centers for Disease Control and Prevention (CDC) (2008)

Surveillance for Lyme disease–United States, 1992-2006. MMWR Surveill Summ 57:1–9.3. Weinstein A, Britchkov M (2002) Lyme arthritis and post-Lyme disease syndrome. Curr

Opin Rheumatol 14:383–387.4. Sigal LH (1995) Early disseminated Lyme disease: Cardiac manifestations. Am J Med

98:25S–28S, discussion 28S–29S.5. Pachner AR, Steiner I (2007) Lyme neuroborreliosis: Infection, immunity, and in-

flammation. Lancet Neurol 6:544–552.6. Cairns V, Godwin J (2005) Post-Lyme borreliosis syndrome: A meta-analysis of re-

ported symptoms. Int J Epidemiol 34:1340–1345.7. Berende A, et al. (2016) Randomized trial of longer-term therapy for symptoms at-

tributed to Lyme disease. N Engl J Med 374:1209–1220.8. Barbour AG, Hayes SF (1986) Biology of Borrelia species. Microbiol Rev 50:381–400.9. Steere AC, et al. (2006) Antibiotic-refractory Lyme arthritis is associated with HLA-DR

molecules that bind a Borrelia burgdorferi peptide. J Exp Med 203:961–971.10. Carlson D, et al. (1999) Lack of Borrelia burgdorferi DNA in synovial samples from

patients with antibiotic treatment-resistant Lyme arthritis. Arthritis Rheum 42:2705–2709.

11. von Lackum K, Stevenson B (2005) Carbohydrate utilization by the Lyme borreliosisspirochete, Borrelia burgdorferi. FEMS Microbiol Lett 243:173–179.

12. Fraser CM, et al. (1997) Genomic sequence of a Lyme disease spirochaete, Borreliaburgdorferi. Nature 390:580–586.

13. Oosting M, et al. (2016) Functional and genomic architecture of Borrelia burgdorferi-induced cytokine responses in humans. Cell Host Microbe 20:822–833.

14. Itoh K, et al. (1999) Keap1 represses nuclear activation of antioxidant responsive elementsby Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev 13:76–86.

15. Sadhu SS, Callegari E, Zhao Y, Guan X, Seefeldt T (2013) Evaluation of a di-

thiocarbamate derivative as an inhibitor of human glutaredoxin-1. J Enzyme Inhib

Med Chem 28:456–462.16. Bouquet J, et al. (2016) Longitudinal transcriptome analysis reveals a sustained dif-

ferential gene expression signature in patients treated for acute Lyme disease. MBio

7:e00100-16.17. Diotallevi M, et al. (2017) Glutathione fine-tunes the innate immune response toward

antiviral pathways in a macrophage cell line independently of its antioxidant prop-

erties. Front Immunol 8:1239.18. Peristeris P, et al. (1992) N-acetylcysteine and glutathione as inhibitors of tumor ne-

crosis factor production. Cell Immunol 140:390–399.19. Haddad JJ, Harb HL (2005) L-γ-Glutamyl-L-cysteinyl-glycine (glutathione; GSH) and

GSH-related enzymes in the regulation of pro- and anti-inflammatory cytokines: A

signaling transcriptional scenario for redox(y) immunologic sensor(s)? Mol Immunol

42:987–1014.20. Brigelius-Flohé R, Banning A, Kny M, Böl G-F (2004) Redox events in interleukin-

1 signaling. Arch Biochem Biophys 423:66–73.21. Fratelli M, et al. (2005) Gene expression profiling reveals a signaling role of gluta-

thione in redox regulation. Proc Natl Acad Sci USA 102:13998–14003.22. Fratelli M, et al. (2002) Identification by redox proteomics of glutathionylated pro-

teins in oxidatively stressed human T lymphocytes. Proc Natl Acad Sci USA 99:

3505–3510.23. Lim SY, Raftery MJ, Goyette J, Geczy CL (2010) S-glutathionylation regulates in-

flammatory activities of S100A9. J Biol Chem 285:14377–14388.24. Shelton MD, Mieyal JJ (2008) Regulation by reversible S-glutathionylation: Molecular

targets implicated in inflammatory diseases. Mol Cells 25:332–346.

Kerstholt et al. PNAS | vol. 115 | no. 10 | E2327

IMMUNOLO

GYAND

INFLAMMATION

PNASPL

US

Dow

nloa

ded

by g

uest

on

June

6, 2

020

25. Samarasinghe KT, et al. (2016) A clickable glutathione approach for identification ofprotein glutathionylation in response to glucose metabolism. Mol Biosyst 12:2471–2480.

26. Salzano S, et al. (2014) Linkage of inflammation and oxidative stress via release ofglutathionylated peroxiredoxin-2, which acts as a danger signal. Proc Natl Acad SciUSA 111:12157–12162.

27. Meissner F, Molawi K, Zychlinsky A (2008) Superoxide dismutase 1 regulates caspase-1 and endotoxic shock. Nat Immunol 9:866–872.

28. Bradley JR (2008) TNF-mediated inflammatory disease. J Pathol 214:149–160.29. Oosting M, et al. (2012) Murine Borrelia arthritis is highly dependent on ASC and

caspase-1, but independent of NLRP3. Arthritis Res Ther 14:R247.

30. Miller LC, et al. (1993) Balance of synovial fluid IL-1 β and IL-1 receptor antagonist andrecovery from Lyme arthritis. Lancet 341:146–148.

31. Horowitz HW, et al. (1996) Liver function in early Lyme disease. Hepatology 23:1412–1417.

32. Tate SS, Meister A (1981) γ-Glutamyl transpeptidase: Catalytic, structural and func-tional aspects. Mol Cell Biochem 39:357–368.

33. Casselli T, et al. (2017) MicroRNA and mRNA transcriptome profiling in primary hu-man astrocytes infected with Borrelia burgdorferi. PLoS One 12:e0170961.

34. Hammer C, et al. (2015) A coding variant of ANO10, affecting volume regulation ofmacrophages, is associated with Borrelia seropositivity. Mol Med 21:26–37.

E2328 | www.pnas.org/cgi/doi/10.1073/pnas.1720833115 Kerstholt et al.

Dow

nloa

ded

by g

uest

on

June

6, 2

020