Russian ethnic history inferred from mitochondrial DNA diversity

Russian Ethnic History Inferred From MitochondrialDNA Diversity

Irina Morozova,* Alexey Evsyukov, Andrey Kon’kov, Alexandra Grosheva,Olga Zhukova, and Sergey Rychkov

Human Genetics Laboratory, Vavilov Institute of General Genetics, Russian Academy of Sciences, Moscow 119991, Russia

KEY WORDS Russian gene pool; early Slavs; gene pool formation; genetic differentiation

ABSTRACT With the aim of gaining insight into thegenetic history of the Russians, we have studied mitochon-drial DNA diversity among a number of modern Russianpopulations. Polymorphisms in mtDNA markers (HVS-Iand restriction sites of the coding region) of populationsfrom 14 regions within present-day European Russia wereinvestigated. Based on analysis of the mitochondrial genepool geographic structure, we have identified three differentelements in it and a vast ‘‘intermediate’’ zone between them.The analysis of the genetic distances from these elements tothe European ethnic groups revealed the main causes of theRussian mitochondrial gene pool differentiation. The inves-

tigation of this pattern in historic perspective showed thatthe structure of the mitochondrial gene pool of the present-day Russians largely conforms to the tribal structure of themedieval Slavs who laid the foundation of modern Russians.Our results indicate that the formation of the genetic diver-sity currently observed among Russians can be traced to thesecond half of the first millennium A.D., the time of the colo-nization of the East European Plain by the Slavic tribes.Patterns of diversity are explained by both the impact of thenative population of the East European Plain and by geneticdifferences among the early Slavs. Am J Phys Anthropol147:341–351, 2012. VVC 2011Wiley Periodicals, Inc.

Russians, like most modern European populations,started to develop at the time of intense migrations in thefirst millennium A.D., which is historically known as theMigration Period. As a result of these migrations, the eth-nic map of Europe has acquired a pattern similar to thatof modern civilization. In the first millennium A.D., theSlavs, who populated a vast territory from Vistula andOder in the north to the northern coast of the Black Sea inthe south, started to move east toward the East EuropeanPlain, which at that time was inhabited by Finno-Ugricand Baltic tribes (Sedov, 1994, 1995). The Slavs movedfrom different parts of their vast area, with their migra-tion continuing across several centuries (Sedov, 1994,1995). Old Russian nationality (whose descendants aremodern Russians, Ukrainians, and Byelorussians) starteddeveloping in the second half of the first millennium A.D.,because of the mixing of Slavic migrants with local resi-dents (Sedov, 1995; Alexandrov et al., 2003).Due to the complex ethnic history and extensive

human movement in time and space, the process leadingto the formation of Russian populations generated hugeintrinsic diversity, which has been described by manyauthors (Rychkov and Balanovskaya, 1988; Alekseeva,2002; Malyarchuk et al., 2004; Balanovsky et al., 2008etc.). The works devoted to unraveling the diversity ofthe Russians reflect different aspects of their ethnogene-sis. The physical appearance of the Russians retainedboth pre-Slavic, mainly Finno-Ugric and Baltic, (Bunak,1695; Alekseeva, 2002) and Slavic (Rychkov and Bal-anovskaya, 1988) features. The analysis of Y-chromo-some markers also revealed two main components in theRussian gene pool, namely Finno-Ugric and Slavic (Bal-anovsky et al., 2008). Studies of numerous artifacts andmedieval written sources have shown that Slavicmigrants had a highly heterogeneous culture (Potockiand Wozniak, 1969; Sedov, 2003). However, the issue ofgenetic differentiation of the Slavs, as well as the contri-

bution of this differentiation to the gene pool of modernRussians, remains open to debate.The present-day area of the Russians encompasses the

territory from the coasts of the Baltic and the Black seasin the west to the Pacific Ocean in the east. However, theRussians were initially formed in the center of the EastEuropean Plain. The Slavs migrated here in the secondhalf of the first millennium A.D. Later, in this region theearly Russian principalities were formed (specifically,Ryazan, Smolensk, Tver, Moscovia, Novgorod, Pskov, andRostov-Suzdal), which had become united within the bor-ders of the Russian state (Bunak, 1965; Sedov, 1995).This region represents the historical area of the Russians(Bunak, 1965; Sedov, 1995). Therefore, the center of theEast European Plain is the key region for understandinghow the Russian gene pool was formed.As our aim is to study the genetic history of the Rus-

sians, we present an overview of the diversity of themodern Russian mitochondrial gene pool within the

Additional Supporting Information may be found in the onlineversion of this article.

Grant sponsor: Russian Foundation for Basic Research; Grantnumbers: 10-06-00274-a and 11-06-12026-ofi-m-2011. Grant sponsor:Program of the Fundamental Research of the Presidium of RussianAcademy of Sciences ‘‘Biological diversity’’.

*Correspondence to: Irina Morozova, Human Genetics Laboratory,Vavilov Institute of General Genetics, Russian Academy of Sciences,Gubkina st. 3, Moscow 119991, Russia. E-mail: [email protected]

Received 21 March 2011; accepted 1 November 2011

DOI 10.1002/ajpa.21649Published online 20 December 2011 in Wiley Online Library

(wileyonlinelibrary.com).

VVC 2011 WILEY PERIODICALS, INC.

AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 147:341–351 (2012)

borders of their historical area. To accomplish this objec-tive, we analyzed polymorphic mtDNA markers (HVS-Isequences and restriction sites of the coding region) ofRussians from 14 populations, comprising the center ofthe East European Plain. In addition, we also assessedpreviously published data on mitochondrial DNA diver-sity in 29 ethnic groups of Europe. The analysis of theRussian mtDNA markers, in parallel to historical andlinguistic data, allowed us to develop a plausible sce-nario for the formation of the Russian gene pool, andinfer the main sources that generated its diversity.

MATERIALS AND METHODS

Samples investigated

We analyzed mtDNA polymorphism in populations ofEuropean Russia that corresponded to the historicalarea occupied by Russians (Fig. 1). The studied popula-tions were of the same (provincial) hierarchical level.Note that the modern administrative territorial divisionof European Russia originated from ancient Russianprincipalities, the localities of which were, in turn, con-nected to the dispersal of the Eastern Slav tribes duringthe early Middle Ages (Sedov, 1995; Alexandrov et al.,2003). In this study, we analyzed blood samples of indi-viduals from 10 provinces (oblasts) of the population:Ivanovo (N 5 41), Lipetsk (N 5 59), Orel (N 5 40), Rya-zan (N 5 60), Smolensk (N 5 62), Tambov (N 5 73),Tver (N 5 34), Tula (N 5 23), Novgorod (N 5 34), andVologda (N 5 39). These data were combined with previ-ously published material about the mtDNA diversity ofRussians from five oblasts (Malyarchuk et al., 2004)—Kaluga (N 5 70), Pskov (N 5 70), Tula (N 5 74), Vladi-mir (N 5 72), and Yaroslavl (N 5 47)—as well as withdata of the Russians from the Orel (N 5 75; Malyarchuket al., 2002; Malyarchuk, 2003) and Novgorod (N 5 80;Grzybowski et al., 2007) oblasts. Thus, the total samplesize of analyzed Russians was 953.The samples were collected at random from all areas of

each province (oblast), with the rural population beingconsidered as the most stable. Blood was collected fromhealthy adult donors, whose ancestors had lived in thearea for at least three generations. Questionnaires wereused to determine the ethnicity of the donors and theirancestors up to the third generation, the time of residenceof the family in the province (oblast), and the absence ofkinship among the donors. The study was approved bythe Local Ethic Committee, the Vavilov Institute of Gen-eral Genetics, Russian Academy of Sciences.For comparative analysis, we used mtDNA data to

quantify the diversity of people from six different lan-guage groups and families (N 5 4088). First, the Slavicgroup comprised 36 Ukrainians (Malyarchuk and Der-enko, 2001), 144 Bosnians, 104 Slovenians (Malyarchuket al., 2003), 436 Poles (Malyarchuk et al., 2002), and 30Bulgarians (Richards et al., 2000). Second, the Balticgroup comprised 180 Lithuanians (Kasperaviciute andKucinskas, 2002) and 299 Latvians (Pliss et al., 2005).Third, the Finno-Ugric family comprised 28 Estonians,83 Karelians (Sajantila et al., 1995), 403 Finns (Meinilaet al., 2001), 77 Hungarians (Lahermo et al., 2000), 102Mordovians, 136 Mari, 74 Komi-Permyaks, 62 Komi-Zyryans, and 101 Udmurts (Bermisheva et al., 2002).Fourth, the Turkic group comprised 228 Tatars, 221Bashkirs, 55 Chuvashes (Bermisheva et al., 2002), 48Azerbaijanians, 50 Turks, 42 Uzbeks, and 41 Turkmens(Quintana-Murci et al., 2004). Fifth, the Germanic group

comprised 300 Germans (Poetsch et al., 2003), 277 Aus-trians (Brandstatter et al., 2003), 284 Englishmen (Rich-ards et al., 2000), and 37 Swedes (Torroni et al., 1996).Finally, the Iranian group comprised 108 Ossetes (Rich-ards et al., 2000) and 102 Persians [60 people from astudy by Malyarchuk et al. (2002) and 42 from a studyby Quintana-Murci et al. (2004)].

Mitochondrial DNA analysis

The DNA was extracted from the blood by using thechloroform-phenol procedure (Maniatis et al., 1982). Thephylogenetic classification of the mtDNA haplogroupswas used, which was based on complex analysis of theHVS-I sequences and RFLPs of the mtDNA codingregion (Richards et al., 2000). HVS-I was amplifiedbetween positions 15,997 and 16,545 (Anderson et al.,1981; Andrews et al., 1999). HVS-I was sequenced usingan automated MegaBACE 500 sequencer (AmershamBiosciences, Evrogen, Russia). More than 60% of thesamples were sequenced for both strands of HVS-I(L15997, 50–ACCATTAGCACCCAAAGCT; H16545, 50–AACGTGTGGGCTATTTAGGC). Sequences between posi-tions 16,020 and 16,400 were compared with rCRS(Andrews et al., 1999). All samples with newly foundpolymorphisms were resequenced to confirm the qualityof the results. For RFLP analysis, the mtDNA codingregion was amplified using primer pairs and conditions

Fig. 1. Map showing the provinces (oblasts) of the populationsthat were investigated, which comprise the historical area of Rus-sians. Iv 5 Ivanovo oblast; li 5 Lipetsk oblast; rz 5 Ryazan oblast;sm5 Smolensk oblast; tm5 Tambov oblast; tv5 Tver oblast; Vo5Vologda oblast (present study); or 5 Orel oblast (present study anddata from Malyarchuk et al. (2002)); tu 5 Tula oblast (presentstudy and data from Malyarchuk et al. (2004)); nv 5 Novgorodoblast (present study and data from Grzybowski et al. (2007)); ka5Kaluga oblast; vl 5 Vladimir oblast; ps 5 Pskov oblast; and yr 5Yaroslavl oblast (data fromMalyarchuk et al. (2004)).

342 I. MOROZOVA ET AL.

American Journal of Physical Anthropology

describe elsewhere (Torroni et al., 1996; Finnila et al., 2000;Yao et al., 2002). To detect RFLPs that were indicative of allmajor Eurasian clusters (Supporting Information Table S1),the PCR fragments were digested using 10 restrictionenzymes: AccI (14,465), AluI (5,176, 7,025, 10,032, 10,397,13,262, and 15,606), BamHI (13,366), BstNI (13,704), HaeII(4,830, 9,052), HaeIII (663, 8,994), HinfI (12,308), HpaI(3,592, 12,406), MseI (14,766), and NlaIII (4,577) (Torroniet al., 1996; Finnila et al., 2000; Yao et al., 2002), Fermentas,Lithuania. The sequences that were assigned to the U hap-logroup, based on the mtDNA coding region restriction poly-morphism, were additionally tested for the presence of theRsaI (4,634) restriction site that marks the U4 haplogroup.With respect to the Tver oblast population, low-qualitysamples were obtained; hence, only RFLP analysis wasperformed. In addition, several samples were sequenced toverify their phylogenetic status for this population.The data on mtDNA polymorphisms in the studied Rus-

sian populations were deposited in GenBank (accessionnumbers: JF691589-JF691904 and JN254809-JN254923).The data are also presented in the Supporting Informa-tion Table S2.

Statistical analysis

The phylogenetic relationships among the mtDNAhaplotypes were analyzed by the median joining networkmethod (Bandelt et al., 1995), which is implemented inthe NetWork 4.1.1.2 software package (available athttp://www.fluxus-engineering.com).Genetic similarity among the populations was esti-

mated using the angular distance method (Cavalli-Sforzaand Edwards, 1967; Edwards and Cavalli-Sforza, 1972).This method was successfully employed in the study ofmicroevolutionary processes in populations where migra-tions and gene drift are the main sources of genetic vari-ation. In the calculation of genetic distances, the haplo-types were combined in clusters (haplogroups) accordingto the classification of Richards et al. (2000). The matrixof pairwise genetic distances between the populationswas represented in two-dimensional space by using mul-tidimensional scaling (MDS), STATISTICA, v. 6.To analyze intra-ethnic diversity, we estimated genetic

distances, which were standardized by their meansquare deviations (Altukhov, 1998):

~D ¼ ðDi � �DÞ�S;

where Di is the genetic distance to the i-th group, �D isthe mean genetic distance to all groups, and S is themean square deviation. With this method, biases causedby sample size can be avoided in the calculation ofgenetic distances.The spatial variation of mtDNA was studied by inves-

tigating the geographic distributions of the frequency ofmtDNA markers. Digital models of the mtDNA geo-graphic distributions (i.e., genogeographic maps) weredesigned by the method of mean weighted interpolationover irregularly positioned points (Shepard, 1968; Rych-kov et al., 2003) using the original software packageMDStudio developed at the Laboratory of Human Genet-ics, Vavilov Institute of General Genetics, Russian Acad-emy of Sciences (Rychkov et al., 2003; available at http://humgenlab.vigg.ru/Programs/programs_e.htm). The soft-ware was developed using methods and approachesdescribed in Shepard (1968); Rychkov and Sheremetyeva(1977); Menozzi et al. (1978); Rychkov et al. (1990). A

previous work by Sedov (1982, 1995) identified the loca-tion of the archaeological sites for the analysis of the dis-tribution of Slavic cultures on the East European Plain.The total geographic variation of the mitochondrial

markers was analyzed using two approaches: (1) estimat-ing and mapping the first principal component (Menozziet al., 1978; Piazza et al., 1981; Cavalli-Sforza et al.,1994; Rychkov et al., 2003) and (2) estimating and map-ping the deviations of the frequencies from the meanareal values for each area. The latter method enablesregions with similar genetic variation parameters to bedetected (depending on their distance from the averagegenetic type, in our case, Russian). The calculations wereconducted according to the formula proposed by Rychkovand Balanovskaya (1988). We calculated the mean squaredeviations from the mean frequencies for each hap-logroup found in the studied Russian populations:

d2 ¼ 1

n

Xn

i¼1

ðxi � xÞ2;

where xi is the frequency of the i-th haplogroup, x is themean areal frequency of the i-th haplogroup, and n is thenumber of the haplogroups.The synthetic map of the Russian mitochondrial gene pool

was used as an additional integral characteristic of the genepool. This map was constructed as a weighted average of thefirst principal component and d2 deviation, and dispersionsof the two characteristics were used as the weights.

RESULTS

The East European Plain Russian gene pool inthe context of the total European gene pool

The mtDNA haplogroup frequencies (and their means) ofthe 14 Russian populations are listed in Table 1. Practicallyall Eurasian mtDNA clusters are present in the Russiangene pool. It should be noted that the average frequency ofthe East Eurasian haplotypes in the Russians (2.4%) ishigher than in other Slavic ethnic groups (maximum 1.8%in Poles). Figure 2 presents a median network of the EastEurasian haplotypes in the European ethnic groups, whichwas based on the analysis of haplotypes from 22 Europeanpopulations. The figure shows that the East Eurasian hap-lotypes that were detected in the Russians are close to thehaplotypes of the Finno-Ugric and Turkic people of theVolga-Ural region and Northern Europe. The regions occu-pied by these people are currently adjacent to the easternand western borders of the Russian area. In earlier centu-ries, these people populated the northern and eastern terri-tories of the East European Plain (Bunak, 1965; Sedov,1995). The sets of the East Eurasian lineages in the Rus-sians and in West Europeans are different (Fig. 2). This ob-servation suggests that the East Eurasian lineages wereacquired on the East European Plain, rather than intro-duced to the Russian gene pool from the west.This Finno-Ugric and Turkic influence is also reflected

in the relative position of the Russian gene pool amongthe European people with respect to genetic distances(Fig. 3). Here, the Russians are closer to the Volga-Uralregion. Note that this position of the Russians is in fullagreement with their geographic location. In addition,this figure shows that the closeness in the geneticdistance of the ethnic groups reflects, not only theirgeographic closeness (which plays a significant role,particularly in present-day Europe), but also their com-mon origin, which is confirmed by the similarity in lan-

343GENETIC HISTORY OF THE RUSSIANS


guage (Fig. 3). Averaging the parameters from the groupswith common origins neutralizes the differences causedby their individual development, and accentuates thecommon features shared by these groups. This providesan insight into the genetic characteristics of the commun-ities that existed before present-day ethnic groups(Rychkov, 1969). The genetic distances to these commun-ities are presented in Table 2. These distances show thecontribution of the communities to the Russian gene pool.As expected, the shortest genetic distances are found

between the Russians and the Slavs (D 3 102 5 1.24), theBalts (D 3 102 5 1.90), and the Finno-Ugrians (D 3 102 51.92; Table 2). The Germanic group is relatively farther

from the Russians (D 3 102 5 3.06), while the Turkic andthe Iranian-speaking groups are the most distant from theRussians, according to the D values (D 3 102 5 6.41 and7.13, respectively). Thus, the genetic distances betweenmodern Russians and various language groups completelyconform to the concept of Russian ethnogenesis, which isrecognized today (Sedov, 1994, 1995).

Diversity of the Russian mitochondrial gene poolin their historical area

To evaluate the genetic differentiation of Russians intheir historical area, we assessed generalized parameters

TABLE 1. mtDNA haplogroup distribution (%) in the historical Russian area

IVa

(41)KAb

(70)LIa

(59)NVc

(114)ORd

(115)PSb

(70)RZa

(60)SMa

(62)TMa

(73)TUe

(97)TVa

(34)VLb

(72)VOa

(39)YRb

(47)RUS(953)

West Eurasian haplogroupsH 43.9 37.14 35.59 37.72 44.35 42.86 33.33 40.32 38.36 54.64 38.24 34.72 43.59 42.55 40.53HV* 2.44 2.86 1.69 2.63 0.87 0 0 0 2.74 1.03 0 1.39 2.56 4.26 1.62pre-HV 0 0 1.69 0 0.87 0 0 0 0 0 0 0 0 0 0.18V 0 2.86 1.69 5.26 2.61 5.71 8.33 0 4.11 1.03 0 0 0 0 2.27pre*-V 2.44 0 0 0 0 0 1.67 0 0 1.03 0 0 2.56 2.13 0.70J 9.76 4.29 11.86 8.77 10.43 11.43 11.67 14.52 13.70 8.25 14.71 8.33 2.56 6.38 9.73T 2.44 14.29 13.56 7.02 7.83 7.14 10.00 11.29 10.96 8.25 2.94 19.44 7.69 2.13 8.89JT 0 0 0 0 1.74 0 0 0 0 0 0 0 0 0 0.12K 2.44 4.29 0 0.88 3.48 0 5.00 9.68 8.22 3.09 5.88 6.94 5.13 6.38 4.40U 29.27 25.72 23.73 27.19 19.13 27.15 16.67 14.52 9.59 16.49 23.53 13.89 25.64 19.16 20.82U* 2.44 0 1.69 1.75 0.87 4.29 0 1.61 2.74 4.12 n/a 0 2.56 4.26 1.98U1 0 1.43 0 0 0.87 0 0 0 0 0 n/a 0 0 0 0.18U2 0 2.86 3.39 2.63 0.87 2.86 0 0 0 1.03 n/a 1.39 0 0 1.16U3 0 1.43 0 0.88 0.87 0 1.67 0 0 2.06 n/a 1.39 2.56 0 0.85U4 7.32 8.57 3.39 1.75 5.22 2.86 1.67 6.45 4.11 5.15 n/a 2.78 5.13 4.26 4.52U5 17.07 11.43 15.25 17.54 10.43 15.71 13.33 6.45 2.74 4.12 n/a 6.94 10.26 10.64 10.93U6 0 0 0 0 0 0 0 0 0 0 n/a 0 0 0 0.00U7 2.44 0 0 0 0 0 0 0 0 0 n/a 1.39 0 0 0.29U8 0 0 0 2.63 0 1.43 0 0 0 0 n/a 0 5.13 0 0.71I 0 1.43 3.39 2.63 3.48 0 0 0 2.74 2.06 5.88 5.56 7.69 2.13 2.63N1a 0 0 0 0 0 0 0 0 0 1.03 0 1.39 0 2.13 0.33N1b 0 0 0 0 0.87 0 1.67 0 0 1.03 0 1.39 0 2.13 0.51N* 0 0 0 0.88 0 0 0 0 0 0 0 0 0 0 0.06W 4.88 0 1.69 0.88 0.87 2.86 3.33 1.61 4.11 0 2.94 4.17 0 0 1.95X 0 2.86 3.39 0.88 0.87 0 1.67 4.84 1.37 0 2.94 1.39 0 4.26 1.72R1 0 0 0 0 0 1.43 0 0 0 0 0 0 0 0 0.10R* 0 0 0 0.88 0.87 0 0 0 2.74 0 0 0 0 0 0.33Total 97.57 95.73 98.30 95.62 98.26 98.57 93.33 96.77 98.63 97.94 97.06 98.61 97.42 93.63 96.91

East Eurasian haplogroupsA 0 0 0 0.88 0 0 1.67 3.23 0 0 0 0 0 0 0.40B 0 0 0 0 0 0 0 0 0 0 0 0 0 2.13 0.15C 2.44 2.86 0 0 0 0 0 0 0 0 2.94 0 0 2.13 0.74D 0 0 0 0 0 0 0 0 0 1.03 0 0 2.56 2.13 0.40D5 0 0 0 0.88 0.87 0 0 0 0 0 0 0 0 0 0.13G 0 0 0 0.88 0 1.43 0 0 1.37 0 0 0 0 0 0.27F 0 0 1.69 0 0 0 0 0 0 0 0 0 0 0 0.12Z 0 0 0 0.88 0 0 0 0 0 0 0 0 0 0 0.06M* 0 0 0 0.88 0 0 0 0 0 0 0 1.39 0 0 0.16Total 2.44 2.86 1.69 4.39 0.87 1.43 1.67 3.23 1.37 1.03 2.94 1.39 2.56 6.39 2.44L1a 0 0 0 0 0 0 1.67 0 0 0 0 0 0 0 0.02L1b 0 0 0 0 0 0 0 0 0 1.03 0 0 0 0 0.08L2 0 0 0 0 0 0 1.67 0 0 0 0 0 0 0 0.12L3b 0 1.43 0 0 0 0 0 0 0 0 0 0 0 0 0.10Othersf 0 0 0 0 0.87 0 1.67 0 0 0 0 0 0 0 0.19

The sample sizes are in the parentheses.a This study.b Malyarchuk et al. (2004).c This study (N 5 34) plus Grzybowski et al., 2007 (N 5 80).d This study (N 5 40) plus Malyarchuk et al., 2002 (N 5 75).e This study (N 5 23) plus Malyarchuk et al., 2004 (N 5 74).f 7025AluI(2), 13704BstNI(2).Population names are as in Figure 1.n/a: Not analyzed.



of the mitochondrial gene pool (i.e., deviations from theareal mean and the first principal component), whichwere estimated from the analysis of the mtDNA hap-logroup frequencies in each of the 14 studied populations(see Table 1).Analysis of the deviations from the areal mean (d2)

indicated groups of Russian populations exhibiting simi-lar genetic variation (depending on their distance fromthe areal mean, or ‘‘average Russian’’ genetic type). Thevalues of d2 for all studied populations are shown inTable 3. In the pool of studied samples, there are popula-tions with similar deviations from the areal mean. Wecombined the populations in groups based on the simi-larity of these parameters. The criterion for the differ-ence between the groups was the statistical significanceof the differences between the corresponding d2 values(P \ 0.05). The deviations from the areal mean in thestudied area are presented on a map (Fig. 4). The groupsthat were formed by this analysis are mainly repre-sented by geographically neighboring populations. Thus,

the mitochondrial gene pool of the Russians proved tohave a distinct structure.Within the framework of this structure, the historical

Russian area is divided into several sections (Fig. 4).The entire northern section of the East European Plainis close to the ‘‘average Russian’’ genetic type. The south-ern section of the historical Russian area is divided intotwo diametrically opposed characteristics, which arefound side by side (Fig. 4). The Southwestern Russiansare close to the ‘‘average Russian’’ values (blue colors),whereas deviations from the mean areal values are max-imal in the southeastern territories (brown colors; Table3, Fig. 4). The northern and southern sections of the his-torical Russian area are divided by a territory character-ized by intermediate d2 values. This territory mainlyencompasses the central area. The d2 values for thisgroup, which we will call Central Russians, show no sig-nificant difference from the d2 values in the previouslydefined groups. Consequently, the Central Russians can-not be assigned to any of these groups.

Fig. 2. Median-joining network of East Eurasian mtDNA lineages in European populations. Note: circle sizes are proportionalto lineage frequencies, in which the smallest circle represents single-copy lineages and the largest circle represents 16 copies of thesame lineage. Transversions are in italics. RFLP markers are in bold, a 5 AluI, b 5 HaeIII, c 5 HaeII, d 5 del 8 bp, and e 5HincII. For haplogroups C, E, G, and M*, restriction site 10,397 AluI (1) marking macrohaplogroup M is not shown. 1 5 Russians;2 5 populations of Finno-Ugric and Turkic origin, now inhabiting the northeastern and eastern East European Plain (Volga-Uralregion); 3 5 populations of Cisbaltic-Finnish origin (Estonians, Karelians, and Finns), now inhabiting the northwestern East-Euro-pean Plain; 4 5 populations of Western and Central Europe; and 5 5 Iranian-speaking populations from the Caucasus (Ossetes).



The main direction of mitochondrial DNA variation inthe Russian populations is represented by the first prin-cipal component in the map, which accounts for morethan a quarter (27.7%) of the total diversity of the stud-ied markers (Fig. 5). The previously described geo-graphic structure also appears here (Figs. 4 and 5).Overall, the two maps are highly similar, except for theTula oblast area. Such similarity implies that the ele-ments found in the analysis of the deviations from theareal mean are of great importance in the structure ofthe Russian mitochondrial gene pool.Of note, we revealed the same divisions in the histori-

cal Russian area by using the analysis of Y-chromosomalmarkers (Morozova et al., 2007). In fact, Balanovsky etal. (2008) demonstrated an analogous structure for thepatrilinear component of the Russian gene pool.

The genetic distances from the Russians to the Euro-pean language groups indicate that the gene pool of pres-ent-day Russians bears the influence of Slavic, Baltic,Finno-Ugric and, to a lesser extent, Germanic groups, aswell as Iranian and Turkic groups. To evaluate the effectsof these groups in different sections of the historical Rus-sian area, we estimated the genetic distances of the Rus-sian groups to the identified language groups. These

Fig. 3. Multidimensional scaling of genetic distances between European populations. Note: unfilled points indicate populationsof Western and Central Europe; filled points indicate populations of the Volga-Ural region and Caucasus. Circles indicate the Slaviclanguage group; squares indicate the Baltic language group; rhombs indicate the Finno-Ugric language family; crosses indicate theGermanic language group; triangles indicate the Turkic language group; and inverted triangles indicate the Iranian languagegroup.

TABLE 2. Genetic distances (D 3 102) from the Russiansto the European language groups

Linguistic group/Family D 3 102

Slavic 1.24 6 0.01Baltic 1.90 6 0.02Finno-Ugric 1.92 6 0.01Germanic 3.06 6 0.01Turkic 6.41 6 0.01Iranian 7.13 6 0.01

The populations included in the language groups and familiesare described in Material and Methods.

TABLE 3. The deviations from the areal mean(d2) in the historical area of the Russians

Population (oblast) d2 3 104

NorthPskov 5.899 6 0.0006Novgorod 3.798 6 0.0003Tver 5.840 6 0.0006Yaroslavl 5.821 6 0.0006

SouthwestOrel 1.662 6 0.00001Kaluga 6.296 6 0.0007Lipetsk 4.836 6 0.0004

SoutheastTambov 10.506 6 0.0019Tula 13.803 6 0.0032Vladimir 12.978 6 0.0029

CenterSmolensk 7.609 6 0.0010Vologda 7.525 6 0.0010Ivanovo 9.183 6 0.0014Ryazan 7.437 6 0.0010



genetic distances, which were standardized by theirsquare deviations, are presented in Table 4 and Figure 6.As expected, the general delineation of the individual

groups corresponds to that described earlier in this studyfor the total Russian gene pool. Thus, all the Russiangroups are close to the Slavic, Baltic, and Finno-Ugricgroups (the genetic distances are close to minimum),whereas the Turkic- and Iranian-speaking groups weredistant from all of the Russian groups, the geneticdistances are close to maximum (Fig. 6). However, theRussian groups showed significant differences. Thesedifferences were particularly pronounced between theNorthern Russians and the two Southern Russiansgroups. The distances of the Russian groups to the Ger-manic group generated the most differentiation. Forexample, the Northern Russians were considerably dis-tant from the Germanic group, whereas the SouthernRussians were close to it (Fig. 6). The plots of the geneticdistances exhibit the maximum difference in the ‘‘Ger-manic’’ point (Fig. 6). The differences between the north-ern and the southern sections were also significant rela-

tive to the Finno-Ugric group. While the Russians aregenerally close to the Finno-Ugrians, the Northern Rus-sians are much closer to the Finno-Ugrians than theSouthern Russians (Fig. 6). Of the two groups in south-ern Russia, the Southwestern group was more similar tothe Northern Russians, whereas the Southeastern groupwas more different from them (Fig. 6).The Central Russians are represented by intermediate

values of the generalized parameters of the mitochon-drial gene pool. In the context of genetic distances, theCentral Russians combine the characteristics of all ofthe above groups.

DISCUSSION

Our study results indicate that the historical Russianarea is divided into three sections. These sections exhibitdifferent amounts of genetic closeness compared to thelanguage groups described in this study. Hence, we con-sidered the historical perspective to explain this pattern.The closeness between the Northern Russians and the

Finno-Ugric group may have resulted from a prolonged

Fig. 5. The structure of the mitochondrial gene pool of Rus-sians in their historical area, which was revealed by first princi-pal component analysis. Note: Population names are listed inFigure 1.

TABLE 4. Genetic distances, standardized by their square deviations, from the isolated groups of the Russians to theEuropean language groups

Groups of the Russians

Language groups

Slavic Baltic Finno-Ugric Germanic Turkic Iranian

North 20.984 20.495 21.060 0.359 0.806 1.373Center 20.894 20.640 20.673 20.287 0.979 1.515Southwest 20.850 20.760 20.532 20.403 1.185 1.360Southeast 20.836 20.741 20.193 20.729 1.424 1.075

North: Pskov, Novgorod, Tver, and Yaroslavl oblasts; Center: Smolensk, Vologda, Ivanovo, and Ryazan oblasts; Southwest: Orel,Lipetsk, and Kaluga oblasts; Southeast: Tambov, Tula, and Vladimir oblasts.

Fig. 4. The structure of the mitochondrial gene pool of Rus-sians in their historical area, which was revealed by the analy-sis of deviations from the areal mean (d2). Note: Populationnames are listed in Figure 1.



and intense interaction between the two. In fact, in thesecond half of the first millennium A.D. until the disper-sal of the Slavs to the north of the East European Plain,these territories were occupied by aboriginal Finno-Ugrictribes (Bunak, 1965; Sedov, 1994, 1995). The results ofthis study strongly suggest that the impact of the pre-Slavic (Finno-Ugric) population on the East EuropeanPlain is the most important factor for the northward andsouthward differentiation of the present-day Russian

gene pool. This explanation supports the view proposingthe genetic influence of Finno-Ugrians on the formationof the northern regions of Russia, which was inferredfrom mtDNA marker studies of some Russian popula-tions (Grzybowski et al., 2007) and Y-chromosome analy-sis (Balanovsky et al., 2008).Being quite distant from the Finno-Ugric group, the

Southern Russians consequently differ from the North-ern Russians in their closeness to the Germanic group.This difference indicates that the Germanic peopleplayed a significant role in the development of the south-ern, but not the northern segment of the Russian genepool. In general, the Germanic influence on the forma-tion of the Russians is not as obvious as the impact ofthe Slavic, Baltic, and Finno-Ugric people. However,strong interactions between the Germanic and Slavictribes have been found in archeological materials datingfrom the mid-first millennium B.C. to the early first mil-lennium A.D. These interactions were the strongest onthe northern coast of the Black Sea, in the area of themultiethnic Chernyakhov archeological culture (secondto fifth centuries A.D.). In the second half of the firstmillennium A.D., the descendants of this culture colon-ized the southern regions of the historical Russian area(Sedov, 1994, 1995). However, there is no evidence in thehistorical literature of the interaction between the Ger-manic tribes and the Slavs (and later, the Russians) af-ter the Slavic colonization of the East European Plain.Therefore, the Germanic influence could not haveoccurred after the early part of the first millenniumA.D., which was before the eastward Slavic migration(Sedov, 1994, 1995). Apparently, the impact of the Ger-manic people on the Chernyakhov Slavs affected thegene pool of modern Southern Russians, consequentlydifferentiating them from the Northern Russians(Fig. 6).

Fig. 7. Dispersal of Slavic archaeological cultures across theEast European Plain in the 5th–10th centuries A.D. (by Sedov,1982, 1995). Note: l 5 culture of Smolensk-Polotsk barrows(Smolensk-Polotsk Kriviches); n 5 group of bracelet-shapednon-tied hair-rings (Kriviches); Northern Slavic branch: n 5culture of Pskov long barrows (Pskov Kriviches); ! 5 culture ofNovgorod Sopkis (high barrows) (Ilmen Slavs); Southern Slavicbranch: n 5 Borschev culture; ~ 5 culture of Upper Oka (Vya-tiches).

Fig. 8. Genetic and archaeological zones in the historicalarea of Russian populations.

Fig. 6. Genetic distances between the isolated Russiansgroups and the European language groups. Note: 1 5 North(Pskov, Novgorod, Tver, and Yaroslavl oblasts); 2 5 Center(Smolensk, Vologda, Ivanovo, and Ryazan oblasts); 3 5 South-west (Orel, Lipetsk, and Kaluga oblasts); and 4 5 Southeast(Tambov, Vladimir, and Tula oblasts).



It is also worth noting that haplotypes belonging tothe African haplogroup L (Lla, Llb, L2, and L3b) werefound in the southern, but not the northern section ofthe historical Russian area (i.e., in Tula and the neigh-boring Ryazan and Kaluga oblasts; Table 1). It is difficultto infer exactly when and how the L haplotypes weretransferred into Europe. Both the late glacial expansionfrom West Africa, and more recent gene flow, may havebeen responsible (Chen et al., 1995; Watson et al., 1997;Malyarchuk et al., 2008). The most similar L haplotypesto the ‘‘Russian’’ ones were found to occur in populationsof West and South Europe (i.e., the Germans, Bosnians,Italians, Spaniards, and Albanians). In contrast, the Lhaplotypes were not recorded in the Volga-Uralic andBaltic people (Rienzo and Willson, 1991; Richards et al.,1996; Belledi et al., 2000; Malyarchuk et al., 2003, 2008).Despite the low frequencies of these L haplotypes, theymay be regarded as another feature of the SouthernRussian gene pool, which was apparently introducedfrom the west, rather than acquired in the East Euro-pean Plain.According to current views, the early Slavic coloniza-

tion routes of the northern and southern sections of theEast European Plain, in the second half of the first mil-lennium A.D., were independent (Trubachev, 1985;Sedov, 1994, 1995). The archeological artifacts of Slavsfrom that period indicate the presence of at least twoconsiderably different traditions, northern and southern.The differences between the two traditions may betraced to the two early Slavic branches, the territorialand cultural division of which began at the end of thefirst millennium B.C. in the area of modern Western andCentral Europe, with later intensification. As a result,the northern regions of the East European Plain (i.e.,present-day Pskov, Novgorod, Yaroslavl, and Tveroblasts) were colonized from the Vistula-Oder interfluvein the west, while the southern regions (present-dayOrel, Kaluga, Tula, and Lipetsk oblasts) were colonizedfrom the area of the Chernyakhov culture in the south(Sedov, 1994, 1995). However, the question about thegenetic differences between the northern and southernSlavic branches is still open to debate.Figure 7 is a map showing the distribution of the

Slavic archaeological cultures belonging to these two(northern and southern) branches. Researchers relatecarriers of these cultures to the Slavic tribes describedin The Russian Primary Chronicle, which is the earliestextant source providing evidence on the formation of theancient Russian state (The Russian Primary Chronicle,1953). It is believed that the Slavic tribes described inthis chronicle (Pskov Kriviches, Ilmen Slavs, Smolensk-Polotsk Kriviches, Vyatiches, Kriviches, etc.) formed thebasis of modern Russian people. In this study, we havecombined the archaeological and synthetic map of theRussian mitochondrial gene pool (Fig. 8).Note that the location of the groups that were isolated

based on mtDNA variability largely corresponds to thedistributional areas of the Slavic tribes. For instance,the area occupied by modern Northern Russians practi-cally coincides with the distributional area of northernSlavic artifacts. In parallel, the distribution of modernSouthwestern Russian groups coincides with the area ofsouthern Slavic archeological findings. The Central Rus-sian territory corresponds to the Slavic group, whichcombines features of the Slavs from the northern sectionof the East European Plain and the Slavs from the southof the region (Udolph, 1981; Sedov, 1995). Thus, the mi-

tochondrial genetic structure of present-day Russianslargely complies with the tribal structure of the Slavsfrom the early Middle Ages. This result is in accordancewith the conclusion based on the analysis of anthropologi-cal data (Rychkov and Balanovskaya, 1988). Thereby, thegene pool of the modern Russians bears the traces of me-dieval Slavs. This fact, along with the pattern of thegenetic differences between the Russian groups, suggeststhat the differences between the northern and the south-ern sections of the Russian area were caused by geneticdifferentiation between the northern and the southernbranches of the early Slavs. The later influence of the abo-riginal Finno-Ugric population in the northern section ofthe region apparently intensified the genetic differentia-tion between the Northern and Southern Russians.Being maximally different from other Russians, the

Southeastern Russians represent a special group. Basedon archaeological data, there were several migrationwaves to the Southeastern section; and later ones camefrom different parts of the historical Russian area, fromthe southwest, from the north, and from the center(Sedov, 1982, 1995). Complex scenario of the settlement,as well as the inclusion of additional genetic elements,probably caused the formation of highest genetic origi-nality of the Southeastern Russians among other Rus-sian groups.Therefore, the results of our study indicate the core

features that resulted in the formation of the Russiangene pool; specifically, the mixture of two genetically dif-ferent groups, the northern and the southwestern, whichare apparently related to the two major inflows of Slavicsettlers from Western Europe to the East EuropeanPlain. This statement supports the genetic position ofthe central zone located between the two ‘‘average Rus-sian’’ extremes, with the central zone probably acting asthe transgression area between the two. The later east-ward movement of heterogeneous Slavic groups, followedby the inclusion of additional genetic elements into thegene pool, probably resulted in the formation of the moregenetically different population of the southeastern sec-tion of the historical Russian area.In conclusion, the sources of genetic differentiation of

the modern Russian populations may be traced back toat least one and a half or even 2,000 years ago. Further-more, the heterogeneity of the Russian populace iscaused by influences of both the pre-Slavic people fromthe East European Plain and by genetic differencesbetween the early Slavic branches that colonized thisregion in the second half of the first millennium A.D.

ACKNOWLEDGMENTS

The authors thank all the donors who provided bloodsamples for the analysis and the personnel of the provin-cial medical institutions for their assistance in samplecollection. They are grateful to Dr. Vera Kovalevskaya(Institute of Archaeology, Russian Academy of Sciences)for her invaluable consultation.

LITERATURE CITED

Alekseeva TI. 2002. Ethnogenesis and ethnic history of EasternSlavs. In: Alekseeva TI, editor. Eastern Slavs. Anthropologyand ethnic history. Moscow: Nauchny Mir. p 307–315 (in Rus-sian).

Alexandrov VA, Vlasova IV, Polischuk NS, editors. 2003. Rus-sians. Moscow: Nauka (in Russian).



Altukhov YuP. 1998. Allozyme heterozygosity, sexual maturationrate, and longevity. Genetika 34:751–760.

Anderson S, Bankier AT, Barrell BG, de Bruijn MH, CoulsonAR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F,Schreier PH, Smith AJ, Staden R, Young IG. 1981. Sequenceand organization of the human mitochondrial genome. Nature290:2524–2525.

Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turn-bull DM, Howell N. 1999. Reanalysis and revision of the Cam-bridge reference sequence for human mitochondrial DNA. NatGenet 23:147.

Balanovsky O, Rootsi S, Pshenichnov A, Kivisild T, ChurnosovM, Evseeva I, Pocheshkhova E, Boldyreva M, Yankovsky N,Balanovska E, Villems R. 2008. Two sources of the Russianpatrilineal heritage in their Eurasian context. Am J HumGenet 82:236–250.

Bandelt H-J, Forster P, Sykes BC, Richards MV. 1995. Mito-chondrial portraits of human populations using median net-works. Genetics 141:743–753.

Belledi M, Poloni ES, Casalotti R, Conterio F, Mikerezi I,Tagliavini J, Excoffier L. 2000. Maternal and paternal line-ages in Albania and the genetic structure of Indo-Europeanpopulations. Eur J Hum Genet 8:480–486.

Bermisheva M, Tambets K, Villems R, Khusnutdinova E. 2002.Diversity of mitochondrial DNA haplotypes in ethnic popula-tions of the Volga-Ural region of Russia. Mol Biol (Mosk)36:990–1001.

Brandstatter A, Parsons TJ, Parson W. 2003. Rapid screening ofmtDNA coding region SNPs for the identification of west Eu-ropean Caucasian haplogroups. Int J Legal Med 117:291–298.

Bunak VV, editor. 1965. The origin and ethnic history of theRussian ethnos. Moscow: Nauka (in Russian).

Cavalli-Sforza LL, Edwards AWF. 1967. Phylogenetic analysismodels and estimation procedures. Evolution 21:550–570.

Cavalli-Sforza LL, Menozzi P, Piazza A. 1994. The history andgeography of human genes. Princeton: Princeton UniversityPress.

Chen YS, Torroni A, Excoffier L, Santachiara-Benerecetti AS,Wallace DC. 1995. Analysis of mtDNA variation in Africanpopulations reveals the most ancient of all human continent-specific haplogroups. Am J Hum Genet 57:133–149.

Edwards AWF, Cavalli-Sforza LL. 1972. Affinity as revealed bydifferences in gene frequencies. In: Weiner JS, Huizinga J,editors. The assessment of population affinities in man. Lon-don: Oxford University Press.

Finnila S, Hassinen IE, Ala-Kokko L, Majamaa K. 2000. Phylo-genetic network of the mtDNA haplogroup U in northern Fin-land based on sequence analysis of the complete coding regionby conformation-sensitive gel electrophoresis. Am J HumGenet 66:1017–1026.

Grzybowski T, Malyarchuk BA, Derenko MV, Perkova MA, Bed-narek J, Wozniak M. 2007. Complex interactions of the East-ern and Western Slavic populations with other Europeangroups as revealed by mitochondrial DNA analysis. ForensicSci Int Genet 1:141–147.

Kasperaviciute D, Kucinskas V. 2002. Variability of the humanmitochondrial DNA control region sequences in the Lithua-nian population. J Appl Genet 43:255–260.

Lahermo P, Laitinen V, Sistonen P, Beres J, Karcagi V, Savon-taus ML. 2000. MtDNA polymorphism in the Hungarians:comparison to three other Finno-Ugric-speaking populations.Hereditas 132:35–42.

Malyarchuk BA. 2003. Variability of human mitochondrial ge-nome and genetic history of the Slavs. Ph.D. thesis. VavilovInstitute of General Genetics RAS, Moscow

Malyarchuk B, Derenko M, Grzybowski T, Lunkina A, RychkovS, Morozova I, Denisova G, Miscicka-Sliwka D. 2004. Differ-entiation of mitochondrial DNA and Y chromosome in Rus-sian populations. Hum Biol 76:877–900.

Malyarchuk BA, Derenko MV. 2001. Mitochondrial DNA vari-ability in Russians and Ukrainians: implication to the originof the Eastern Slavs. Ann Hum Genet 65:63–78.

Malyarchuk BA, Derenko M, Perkova M, Grzybowski T, Vane-cek T, Lazur J. 2008. Reconstructing the phylogeny of African

mitochondrial DNA lineages in Slavs. Eur J Hum Genet16:1091–1096.

Malyarchuk BA, Grzybowsky T, Derenko MV, Czarny J, DrobnicK, Miscicka-Sliwka D. 2003. Mitochondrial DNA variability inBosnians and Slovenians. Ann Hum Genet 67:412–425.

Malyarchuk BA, Grzybowski T, Derenko MV, Czarny J, WozniakM, Miscicka-Sliwka D. 2002. Mitochondrial DNA variabilityin Poles and Russians. Ann Hum Genet 66:261–283.

Maniatis T, Fritsch EE, Samrook J. 1982. Molecular cloning: alaboratory manual. New York: Cold Spring Harbor Lab.

Meinila M, Finnila S, Majamaa K. 2001. Evidence for mtDNAadmixture between the Finns and the Saami. Hum Hered52:160–170.

Menozzi P, Piazza A, Cavalli-Sforza LL. 1978. Synthetic maps ofhuman gene frequencies in Europeans. Science 281:786.

Morozova I, Fechner A, Evsyukov A, Naumova O, Nasidze I,Zhukova O, Rychkov S, Stoneking M. 2007. The populationgenetics and ethnic history of the Russians. In: PopulationGenetics Group Meeting (abstracts of the conference). Man-chester, Great Britain. p 33.

Piazza A, Menozzi P, Cavalli-Sforza LL. 1981. Synthetic maps ofman and selective effects of climate. Proc Natl Acad Sci USA78:2638–2642.

Pliss L, Tambets K, Loogvali E-L, Pronina N, Lazdins M, Kru-mina A, Baumanis V, Villems R. 2005. Mitochondrial DNAportrait of Latvians: towards the understanding of the geneticstructure of Baltic-speaking populations. Ann Hum Genet69:1–20.

Poetsch M, Wittig H, Krause D, Lignitz E. 2003. Mitochondrialdiversity of a northeast German population sample. ForensicSci Int 137:125–132.

Potocki J, Wozniak Z. 1969. Niekotore zagadnienia zwiazane zpobytem Celtow w Polsce. In: Spravozdania archeologiczne.T. VIII. Warszava. p 81–98.

Quintana-Murci L, Chaix R, Wells RS, Behar DM, Sayar H,Scozzari R, Rengo C, Al-Zahery N, Semino O, Santachiara-Benerecetti AS, Coppa A, Ayub Q, Mohyuddin A, Tyler-SmithC, Qasim Mehdi S, Torroni A, McElreavey K. 2004. WhereWest meets East: the complex mtDNA landscape of theSouthwest and Central Asian Corridor. Am J Hum Genet74:827–845.

Richards M, Corte-Real H, Forster P, Macaulay V, Wilkinson-Herbots H, Demaine A, Papiha S, Hedges R, Bandelt HJ,Sykes B. 1996. Paleolithic and Neolithic lineages in the Euro-pean mitochondrial gene pool. Am J Hum Genet 59:185–203.

Richards M, Macaulay V, Hickey E, Vega E, Sykes B, Guida V,Rengo C, Sellitto D, Cruciani F, Kivisild T, Villems R, ThomasM, Rychkov S, Rychkov O, Rychkov Yu, Gogle M, Dimitrov D,Hill E, Bradley D, Romano V, Cali F, Vona G, Demaine A,Papiha S, Triantaphyllidis C, Stefanescu G, Hatina J, BellediM, Di Rienzo A, Noveletto A, Oppenheim A, Norby S, Al-Zaheri N, Santachiara-Benerecetti S, Scozzari R, Torroni A,Bandelt H-J. 2000. Tracing European founder lineages in theNear Eastern mtDNA pool. Am J Hum Genet 67:1251–1276.

Rienzo AD, Willson AC. 1991. Branching pattern in the evolu-tionary tree for human mitochondrial DNA. Proc Natl AcadSci USA 88:1597–1601.

Rychkov YuG. 1969. Some population-genetic approaches to inves-tigation of Siberia. Voprosy antropologii 33:16–33 (in Russian).

Rychkov YuG, Balanovskaya EV. 1988. Generalized cartographicanalysis in the anthropology. Traces of the chronicle Slavs inanthropological geography of the modern Russians. Voprosyantropologii 80:3–37.

Rychkov IuG, Rychkov AV, Balanovskaya EV, Batssur’ Zh, Bel-kovski AN, Budilova EV, Terekhin AT. 1990. Genogeographyof human populations: computer mapping of population genet-ics data. Genetika 26:204–210.

Rychkov YuG, Sheremetyeva VA. 1977. The genetic process inthe system of ancient human isolates in North Asia. In: Har-rison GA, editor. Population structure and human variation.Cambridge: Cambridge University Press. p 47–108.

Rychkov YuG, Zhukova OV, Evsyukov AN, Naumova OYu,Rychkov SYu, Sheremetyeva VA, Shneider YuV. 2003. Genepool and genegeography of population. Vol.II. Genegeographi-



cal atlas of population of Russia and contiguous countries .St. Petersburg: Nauka (in Russian).

Sajantila A, Lahermo P, Anttinen T, Lukka M, Sistonen P,Savontaus ML, Aula P, Beckman L, Tranebjaerg L, Gedde-Dahl T, Issel-Tarver L, DiRienzo A, Paabo S. 1995. Genes andlanguages in Europe: an analysis of mitochondrial lineages.Genome Res 5:42–52.

Sedov V. 1982. The eastern Slavs at 6-13 centuries A.D. Mos-cow: Nauka (in Russian).

Sedov V. 1994. Slavs in antiquity. Moscow: Archaeology Fund(in Russian).

Sedov V. 1995. Slavs in the early Middle Ages. Moscow: Archae-ology Fund (in Russian).

Sedov V. 2003. Ethnogenesis of the early Slavs. Herald of RAS73:594–605.

Shepard DA. 1968. A two-dimensional interpolation function forirregularly spaced data. Proc 23rd Natl Conf Assoc Comput-ing Machinery, New York. p 517–524.

The Russian Primary Chronicle. 1953. Cambridge: MediaevalAcademy of America.

Torroni A, Huoponen K, Francalacci P, Petrozzi M, Morelli L,Scozzari R, Obinu D, Savontaus ML, Wallace DC. 1996. Clas-sification of European mtDNAs from an analysis of three Eu-ropean populations. Genetics 144:1835–1850.

Trubachev ON. 1985. Linguistics and ethnogenesis of the Slavs:the ancient Slavs as evidenced by etymology and onomastics.JIES 13:203–256.

Udolph J. 1981. Landnahme der Ostslaven im Lichte der Nah-menforschung. Jahrlicher fur Geschichte Osteuropas. Wiesba-den. p 321–336.

Watson E, Forster P, Richards M, Bandelt H-J. 1997. Mitochon-drial footprints of human expansions in Africa. Am J HumGenet 61:691–704.

Yao YG, Kong QP, Bandelt HJ, Kivisild T, Zhang YP. 2002. Phy-logeographic differentiation of mitochondrial DNA in HanChinese. Am J Hum Genet 70:635–651.



Documents

Russian ethnic history inferred from mitochondrial DNA diversity