Saccharomyces cerevisiae Yta7 Regulates Histone Gene … · previously identiﬁed members of the histone regulatory pathway. In concurrence, Yta7 was found to reg- In concurrence,

Copyright � 2008 by the Genetics Society of AmericaDOI: 10.1534/genetics.107.086520

Saccharomyces cerevisiae Yta7 Regulates Histone Gene Expression

Angeline Gradolatto,* Richard S. Rogers,† Heather Lavender,* Sean D. Taverna,‡

C. David Allis,‡ John D. Aitchison† and Alan J. Tackett*,1

*Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205,†Institute for Systems Biology, Seattle, Washington 98103 and ‡The Rockefeller University, New York, New York 10065

Manuscript received December 28, 2007Accepted for publication February 22, 2008

ABSTRACT

The Saccharomyces cerevisiae Yta7 protein is a component of a nucleosome bound protein complex thatmaintains distinct transcriptional zones of chromatin. We previously found that one protein copurifyingwith Yta7 is the yFACT member Spt16. Epistasis analyses revealed a link between Yta7, Spt16, and otherpreviously identified members of the histone regulatory pathway. In concurrence, Yta7 was found to reg-ulate histone gene transcription in a cell-cycle-dependent manner. Association at the histone gene lociappeared to occur through binding of the bromodomain-like region of Yta7 with the N-terminal tail ofhistone H3. Our work suggests a mechanism in which Yta7 is localized to chromatin to establish regionsof transcriptional silencing, and that one facet of this cellular mechanism is to modulate transcription ofhistone genes.

DIFFERENT regulatory mechanisms are involved inthe cell cycle control of gene transcription. Many

of these pathways are centered around the regulationof chromatin and the histone epigenetic status (Berger

2007; Li et al. 2007). ATP-dependent and -independentchromatin remodeling provides for the physical rear-rangement of nucleosomes and accessibility to un-derlying DNA (Cairns 2005). Furthermore, histonescan be dynamically cycled out of chromatin to definechromosomal features such as active promoters andchromatin boundary elements (Dion et al. 2007; Jamai

et al. 2007; Rufiange et al. 2007). They can even bereplaced by histone variants to regulate transcription(Li et al. 2007). A more combinatorial process of tran-scriptional regulation is the post-translational modifica-tion (PTM) of histones (Goldberg et al. 2007; Kouzarides

2007). Certain histone PTMs serve as binding sitesfor recruitment of ‘‘effector’’ protein complexes thatmodulate gene transcription. For example, the Yng1component from the NuA3 histone acetyltransferasebinds to lysine 4 trimethylated histone H3 to providefor histone H3 lysine 14 acetylation and transcriptionalactivation (Taverna et al. 2006). Transcriptional regu-lation through chromatin is undoubtedly a complexsystem of events that remain to be fully explored.

In previous work, we described a novel transcriptionalrole for the yeast tat-binding analog 7 (Yta7) (Tackett

et al. 2005). We found that Yta7 maintains the transitionregion (or barrier) between heterochromatin and eu-

chromatin upstream of the silent HMR locus (Tackett

et al. 2005). Deletion of the YTA7 gene results in spread-ing of the silent state from HMR and silencing of sur-rounding genes, demonstrating that Yta7 can regulatedistinct transcriptional states. Additional work has shownthat Yta7 functions in a similar manner downstream ofthe silent region at HMR (Jambunathan et al. 2005).Yta7 contains both an AAA ATPase domain and abromodomain-like region (Yta7bd). An affinity-taggedversion of Yta7 shows avid copurification of all corehistones, suggesting that activity may be propagatedthrough nucleosome association (Tackett et al. 2005).Yta7bd can mediate the association with histones; how-ever, the precise region of histone interaction and post-translational modification status has not been established(Jambunathan et al. 2005). Yta7 also appears to beneeded for transcription of repetitive DNA sequences inCaenorhabditis elegans, where its deletion leads to embry-onic lethality (Tseng et al. 2007). Additionally, Yta7 hasbeen linked to telomere maintenance and has shownan interaction with Rad53 upon DNA damage (Askree

et al. 2004; Smolka et al. 2005). These studies suggestthat Yta7 may be associating with chromatin to modu-late transcription and to function in numerous cellularpathways.

In previous work, we observed that Yta7 copurifieswith transcriptional and chromatin modifying proteins(Tackett et al. 2005). Intriguingly, we noted that Spt16is one of many proteins that copurified with Yta7(Tackett et al. 2005). The Spt16 protein is involved intranscription and nucleosome regulation via its rolewith the yFACT complex (Formosa et al. 2002). Spt16appears to be essential for displacement of histones to

1Corresponding author: University of Arkansas for Medical Sciences, 4301W. Markham St., Slot 516, Little Rock, AR 72205.E-mail: [email protected]

Genetics 179: 291–304 (May 2008)

promote initiation of transcription (providing for pas-sage of RNA polymerase) and for reassembly of nucle-osomes after elongation (Formosa et al. 2002; Biswas

et al. 2005). Since Yta7 regulates zones of transcriptionand Spt16 plays a crucial role in transcription, we soughtto explore the functional significance of the observedYta7/Spt16 copurification.

MATERIALS AND METHODS

Yeast strains: Yeast strains are listed in Table 1. Genereplacements of YTA7 with LEU2 were done by PCR amplifi-cation of LEU2 from the pUG73 plasmid with 45 bp ofsequence upstream and downstream of the YTA7 gene,genomic incorporation by homologous recombination and

conformation by PCR. Gene replacements of YTA7 with KANwere done by PCR amplification of KAN from yta7TKANBY4742 (Open Biosystems) genomic DNA with 100 bp ofsequence upstream and downstream of the YTA7 gene,incorporation into the genome by homologous recombina-tion and confirmation by PCR. To make strain ATY146, weused marker swap plasmid M4755 to change the KAN markerfrom a bar1TKAN BY4741 strain (Open Biosystems) to a LEU2marker (Voth et al. 2003). For strains ATY223 and ATY232,YTA7 was internally tagged by insertion of PrA or Myc9 asdescribed (Gauss et al. 2005).

Epistasis analysis: Temperature sensitivity: cells were grownto saturation at 25�, 10-fold serially diluted, spotted on YEPDplates and incubated at various temperatures (25�, 30�, 32�,34�, and 37�). Damage assays: cells were grown to saturation at25�, 10-fold serially diluted and spotted on YEPD platescontaining methyl methanesulfonate (MMS, 0.01, 0.03, 0.1,

TABLE 1

S. cerevisiae strains used in this study

Strain Genotype Background Source

WT (BY4742) MATa his3D1 leu2D0 lys2D ura3D0 BY4742 Open BiosystemsWT (BY4741) MATa his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystemsrtt109D MATa rtt109TKAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystemsyta7D MATa yta7TKAN his3D1 leu2D0 lys2D ura3D0 BY4742 Open Biosystemssas3D MATa sas3TKAN his3D1 leu2D0 lys2D ura3D0 BY4742 Open BiosystemsHLY21 MATa sas3TKAN yta7TLEU2 his3D1 leu2D0 lys2D ura3D0 sas3D This studyhir1D MATa hir1TKAN his3D1 leu2D0 lys2D ura3D0 BY4742 Open BiosystemsAGY11 MATa hir1TKAN yta7TLEU2 his3D1 leu2D0 lys2D ura3D0 hir1D This studyhir2D MATa hir2TKAN his3D1 leu2D0 lys2D ura3D0 BY4742 Open BiosystemsAGY14 MATa hir2TKAN yta7TLEU2 his3D1 leu2D0 lys2D ura3D0 hir2D This studyasf1D MATa asf1TKAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open BiosystemsATY246 MATa asf1TKAN yta7TLEU2 his3D1 leu2D0 met15D0 ura3D0 asf1D This studyWT (W303) MATa ade2-1 ura3-1 his3-11,15 trp1-1 leu2-3,112 can1-100 W303 Frederick Cross

(RockefellerUniversity)

ATY223 MATa YTA7T1200-PrA ade2 LYS URA3-HMR ppr1THIS3 ROY508 (Isogenicto W303)a

This study

ATY232 MATa YTA7T1200-Myc9 ade2-1 ura3-1 his3-11,15 trp1-1leu2-3,112 can1-100

W303 This study

HLY26 MATa rtt109TKAN ade2-1 ura3-1 his3-11,15 trp1-1leu2-3,112 can1-100

W303 This study

HLY29 MATa yta7TKAN ade2-1 ura3-1 his3-11,15 trp1-1leu2-3,112 can1-100

W303 This study

spt16-118315-8-1

MATa spt16-11 trp1 leu2 ura3 his7 W303 Tim Formosa(Universityof Utah)

HLY34 MATa spt16-11 yta7TKAN ade2-1 ura3-1 his3-11,15 trp1-1leu2-3,112 can1-100

W303 This study

H3K56Rb MATa D(hht1-hhf1) D(hht2-hhf2) leu2-3,112 ura3-62 trp1 his3(plasmid TRP1, CEN, hht2(K56R)-HHF2)

MSY421 from M. M.Smith (Universityof Virginia)

Judith Recht(RockefellerUniversity)

ATY146 MATa bar1TLEU2 his3D1 leu2D0 met15D0 ura3D0 BY4741 This studyHLY53 MATa bar1TLEU2 yta7DTKAN his3D1 leu2D0

met15D0 ura3D0ATY146 This study

hta1D MATa hta1TKAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystemshta2D MATa hta2TKAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystemshtb2D MATa htb2TKAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystemshht1D MATa hht1TKAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystemshht2D MATa hht2TKAN his3D1 leu2D0 met15D0 ura3D0 BY4741 Open Biosystems

a Donze et al. (1999).b Recht et al. (2006).

292 A. Gradolatto et al.

and 0.3%), hydroxyurea (0.1 and 0.2 m) or 6-azauracil (6-AU,75, 100, and 200 mg/ml). All serial dilutions were performedin triplicate.

Transcriptional assays: Cells were grown to mid-log phaseand blocked with either 50 nm a-factor (bar1D and yta7Dbar1D) or 15 mg/ml nocodazole ½wild-type (BY4742), yta7D,and hir2D� for 2.5–3 hr at 30�. a-Factor showed .90% blockingefficiency, while nocodazole showed .80%. To release thecell cycle block, cells were washed twice in ice cold water andresuspended in 30� prewarmed YEPD media. Time pointsamples were taken for budding index counting, RNA extrac-tion and flow cytometer analysis.

Percent new buds was calculated as the percentage of cellsforming new buds relative to the total population. Cell shapewas classified as unbudded single cells, newly formed smallbuds or large buds. Cells arrested in nocodazole were con-sidered large budded, while those arrested in a-factor wereclassified as unbudded single cells. We plotted the formationof newly formed small buds as this is a rough visual represen-tation of the onset of histone gene transcription and S phase(Driscoll et al. 2007).

Hot acidic phenol extraction of RNA was performed aspreviously described (Tackett et al. 2005). Reverse transcrip-tion was conducted with the Invitrogen SuperScript firststrand kit according to the providers’ protocol. Transcriptionlevels of the histone genes were determined by real-time PCR.ACT1 was chosen as a housekeeping gene. CLN1 mRNA wasused as a marker of the cell cycle. Primer sequences are listedin Table 2. Primers to differentiate HHF1 and HHF2 tran-scripts could not be designed due to sequence similarity, thusboth transcripts were simultaneously monitored with a singleprimer set. Specificity of primers for HTA1, HTA2, HTB2,HHT1, and HHT2 transcripts was determined by real-timePCR. To measure primer specificity, cDNA was prepared fromgenomic deletion strains (hta1D, hta2D, htb2D, hht1D, andhht2D) and analyzed by real-time PCR with the primers cor-responding to the deleted gene. Nonspecific amplificationwith each primer set was measured relative to ACT1 mRNA.Relative mRNA levels in Figures 3 and 4 were corrected forprimer specificity. We did not determine the specificity ofHTB1 transcript primers because systematic deletion of theHTB1 gene produces inviable cells (Giaever et al. 2002).

Flow cytometer samples were fixed in 70% ethanol andstored at 4�. After sonication in 200 mm sodium citrate, cellswere treated with RNase A at 37�. SYTOX green (MolecularProbes/Invitrogen) was added to a final concentration of2 mm. Samples were analyzed with a Beckman Coulter EPICSXL-MCL flow cytometer.

Chromatin immunoprecipitation: Chromatin immuno-precipitation (ChIP) was performed as previously reportedusing an anti-H3K56ac antibody (Upstate/Millipore 07-677)(Taverna et al. 2006). ChIP to general histone H3 (AbcamAb1791) was performed to control for nucleosome occupancy(Taverna et al. 2006). Real-time PCR was used to compare theenriched levels of the intergenic region between the HTA1and HTB1 gene pair relative to ACT1.

High resolution ChIP-chip analysis of Yta7: ChIP-chipanalysis of Yta7-Myc was performed in triplicate with dye-swapping as reported (Ren et al. 2000; Taverna et al. 2006).Tiled microarrays covering the entire Saccharomyces cerevisiaegenome were utilized (50 bp resolution, NimbleGen Systems).Microarray data were independently analyzed with bothSignalMap (NimbleGen Systems) and Mpeak version 2.0software (http://www.stat.ucla.edu/�zmdl/mpeak/). Bindingregions were considered relevant if .2 SD from the mean.

We utilized a strain containing an internal Myc9 tag that wasinserted at amino acid position 1200 of Yta7 (Gauss et al.2005). The location of the tag was determined via two differentapproaches analyzing four different positions: N-terminal,insertion at position 106 (prior to the AAA ATPase andbromodomains), insertion at position 1200 (near the C ter-minus), and C-terminal. Each tagged strain was tested formaintenance of barrier activity at HMR and for immuno-purification of histones (Tackett et al. 2005). The resultsshowed that only the insertion of the tag at amino acid 1200preserved barrier maintenance and provided for histoneimmunopurification (A. J. Tackett and B. T. Chait, un-published observations).

Yta7bd binding to histones and histone H3 peptide mimics:Amino acids 999–1101 composing the Yta7 bromodomain-likeregion (Yta7bd) with a N-terminal GST fusion were expressed,purified, and confirmed by mass spectrometry (Taverna et al.2006).

For histone binding studies, 40 mg of GST-Yta7bd (or GSTcontrol) was incubated with 5 mg of acid-extracted T. thermo-phila histones (purified as described in Taverna et al. 2007)and 50 mg of BSA (5 ml from a 10 mg/ml New England BioLabsstock) in binding buffer (20 mm HEPES, pH 7.9, 25% glycerol,150 mm NaCl, 1.5 mm MgCl2, 0.2 mm EDTA, 1% Triton X-100,10 mm sodium butyrate, 1:100 Sigma yeast protease inhibitorcocktail) in a final volume of 500 ml for 1 hr at roomtemperature. GST-Yta7bd or GST alone was collected for 1 hrat room temperature with EZview red glutathione affinity gel(Sigma), washed three times in binding buffer with 300 mm

NaCl, washed once with low salt buffer (4 mm HEPES, pH 7.9,10 mm NaCl), and copurifying histones were released by

TABLE 2

Sequences of the primers used for real-time PCR

Gene Forward Reverse

ACT1 GAAAAGATCTGGCATCATACCTTC AAAACGGCTTGGATGGAAACCLN1 GAAAACTGGGTTAATTGTCACTGC GTTTGATGAGGATTCATCTCCGHTB1 GGTAAGAAGAGAAGCAAGGCTAGAA GACTTCTTGTTATACGCAGCCAHTA1 TGTCTTGGAATATTTGGCCG TGGATGTTTGGCAAAACACCHTB2 GTCGATGGTAAGAAGAGATCTAAGG GTGGATTTCTTGTTATAAGCGGCHTA2 GCTGTCTTAGAATATTTGGCTGC GGCAACAAGTTTTGGTGAATGHHT1 GCTTTGAGAGAAATCAGAAGATTCC GCAGCCAAGTTGGTATCTTCAAHHT2 CTGTTGCCTTGAGAGAAATTAGAAG GCAGCCAGATTAGTGTCTTCAAACHHF1 and HHF2 TAAAGGTCTAGGAAAAGGTGGTGC TAACAGAGTCCCTGATGACGGATTIntergenic between

HTB1 and HTA1TTTGCCACTACTAAGGCCAA AGCTCGGCGAGTTCAAATTT

Yta7 Regulates Histone Gene Transcription 293

heating to 95� in SDS–PAGE sample buffer. Bound histoneswere resolved with 4–20% SDS–PAGE and individually visual-ized by immunoblotting.

For histone H3 peptide mimic binding studies, streptavidin-coated Dynabeads M280 (250 mg) were incubated with 1.2 mgof biotinylated histone H3 peptide mimics (Upstate/Milliporeor in-house synthesized). Peptide amounts were standard-ized by dot-blotting and visualization with streptavidin-HRP.Binding assays were performed by incubation of Yta7bd withthe peptide coated beads for 1 hr at room temperature in20 mm HEPES, pH 7.4, 150 mm NaCl, 0.2% Triton X-100.Beads were washed three times with 20 mm HEPES, pH 7.4,300 mm NaCl, 0.2% Triton X-100. Proteins were resolved by4–12% SDS–PAGE and visualized by Coomassie staining.Binding was quantified with ImageJ software (http://rsb.info.nih.gov/ij/).

Full-length Yta7 binding to histone H3 peptides: Yta7-PrAwas immunopurified on IgG-coated Dynabeads as previouslydescribed except that the concentration of NaCl was raisedfrom 0.3 to 1.5 m such that cellular histones no longercopurified (Tackett et al. 2005). Yta7-PrA was released fromthe resin with a nondenaturing elution peptide (Strambio-De-Castillia et al. 2005; Tackett et al. 2005). Binding studiesof Yta7-PrA were performed following the same protocol as forYta7bd binding experiments with the following biotinylatedpeptides: H3 1-20, H3 48-63, and H3 48-63 K56ac. Bound Yta7-PrA was visualized by immunoblotting for the PrA tag.

Immunopurification of Yta7-PrA and associated histones:Purification of Yta7-PrA with in vivo associated histones onIgG-coated Dynabeads was done as previously reported(Gauss et al. 2005; Tackett et al. 2005). Sodium butyrate(50 mm) was included during immunopurifications to inhibithistone deacetylases.

Mass spectrometric analysis of H3K56ac: The gel bandcontaining histone H3 (that purified with Yta7-PrA) waschemically treated with d6-acetic anhydride and digested withtrypsin as previously reported (Dilworth et al. 2005; Tackett

et al. 2005). The d6-acetic anhydride treatment converts allunmodified lysines to triply deuterated acetyl-lysines (Tackett

et al. 2005); thus allowing one to differentiate unmodifiedlysines (145 Da) from in vivo acetylated lysines (142 Da) for aquantitative measurement of histone acetylation (Tackett

et al. 2005). A mass spectrum of the histone H3 peptideswas collected with a MALDI-prOTOF mass spectrometer(PerkinElmerSciex). Peptides were confirmed by tandemmass analysis with a vMALDI-LTQ ion trap mass spectrometer(Thermo). To quantify the level of acetylation for H3K56,m-over-z software was used to extract the monoisotopic peakareas for the heavy and light versions of the histone H3 53-63peptide. Percent acetylated was the percentage of light arearelative to the total percentage of light and heavy areas.Peptides identified are listed in Table 3.

RESULTS

Yta7 activities overlaps with the activities of otherknown histone regulators: Spt16, a subunit of the yFACTcomplex, was found to coenrich with Yta7 (Tackettet al.2005). The yFACT complex plays an important role dur-ing the cell cycle, helping the passage of polymerasesthrough chromatin and nucleosome reassembly (Formosa

et al. 2002). When subunits of the yFACT are mutatedthe reassembly of nucleosomes can still be handled bythe Hir/Hpc complex, but simultaneous mutation ofproteins from each complex leads to strong syntheticdefects (Formosa et al. 2002). For instance, a combina-tion of hir1D spt16-11(T8281I P859S) caused synthetictemperature sensitivity of the cells, demonstrating de-pendence of the yFACT pathway with the Hir pathway(Sutton et al. 2001; Formosa et al. 2002). In conse-quence, we decided to investigate the effect of doubledeletions of the YTA7 gene with the point mutationspt16-11 on cell growth, as well as with complete deletionof two genes encoding proteins in the Hir/Hpc com-plex: HIR1 and HIR2. The spt16-11 mutant was chosenbecause cells carrying the genomic deletion of SPT16are inviable.

Additionally, the genes encoding Asf1 and Sas3were deleted in WT and yta7D strains and cells weresubjected to restrictive growth conditions. Asf1 is ahistone chaperone protein that is widely involved inreplication-coupled nucleosome assembly, response toDNA damage, repression of histone gene transcriptionand heterochromatic silencing (reviewed in Mousson

et al. 2007). Asf1 mediates its activity through interac-tions with proteins including the Hirs (Sutton et al.2001). The protein Sas3 is a component of the NuA3histone acetyltransferase complex and interacts withSpt16, suggesting a role in transcription and/or repli-cation (John et al. 2000; Taverna et al. 2006). Sas3 alsocopurifies with Yta7 (Tackett et al. 2005).

Cells were plated in serial dilutions and subjected toincreasing temperatures or damaging agents: hydroxy-urea (stalls DNA replication), methyl methanesulfonate(DNA damaging agent) or 6-azauracil (inhibits tran-scriptional elongation) (Figure 1). The 6-AU screen didnot show any synthetic defects (data not shown). Cellscontaining a deletion of the RTT109 gene served as asensitive control for the DNA damage agents (Driscoll

et al. 2007; Han et al. 2007).Cells harboring the spt16-11 mutation exhibited sen-

sitivity to both temperature and HU treatments as pre-viously described (Formosa et al. 2002) (Figure 1, A andB). Additional deletion of the YTA7 gene increased thegrowth defect observed for both treatments. This resultsuggests that both Yta7 and Spt16 are acting in two func-tionally overlapping pathways. No effect was observedfor sas3D and sas3D yta7D mutants under any stress con-dition (data not shown). However, deletion of the ASF1gene showed a cell growth defect under temperature

TABLE 3

Peptides from histone H3 copurifying with Yta7-PrA thatwere identified by MALDI mass spectrometry

Observed histoneH3 peptide

Extent of lysineacetylation (%)

9-KSTGGKAPR-17 018-KQLASKAAR-26 041-YKPGTVALREIR-52 053-RFQKSTELLIR-63 33117-VTIQKKDIKLAR-128 0


and HU conditions. Further deletion of the YTA7 geneincreased the HU effect only, indicating that Yta7 andAsf1 have overlapping function during times of DNAsynthesis. Furthermore, deletion of the YTA7 gene in-duced growth defects in hir1D and hir2D cells in responseto temperature increase, HU and MMS—suggesting thatHir and Yta7 pathways are functionally overlapping. Ourresults imply (1) a role of Yta7 in DNA damage responseand (2) that Yta7 operates through a functionally over-lapping pathway with the Asf1/Hir and Spt16-yFACTcomplexes.

Yta7 is a repressor of histone gene transcription:Since we observed a genetic interaction with knownhistone gene transcriptional regulators (Hirs, Asf1, andSpt16) and since Yta7 is known to regulate transcrip-tional zones of chromatin via barrier activity, we in-vestigated whether Yta7 played a role in transcriptionalregulation of the histone genes. To assay for cell-cycle-dependent transcriptional defects, we synchronizedwild-type and yta7D cells with a-factor (G1-phase arrest)or nocodazole (M-phase arrest) and cultures weresampled at various times throughout a full cell cycle.

We first verified that the cells were growing in syn-chrony. Measurement of the late G1 cyclin CLN1 tran-script levels revealed that after release from each block,the cells progressed in a similar manner (Figure 2, A andC). However, cells containing the YTA7 gene deletionshowed a defect in CLN1 transcription at the 90 and 100min time points post-nocodazole release, which couldindicate a lost of synchrony toward the end of the firstcell cycle (Figure 2C). Following the cell cycle throughthe formation of new buds also showed a similar pro-

gression of the cells after release from the blockingagents (Figure 2, B and D), with a slight delay in theaccumulation of buds at 80 min post-release from no-codazole for yta7D cells (Figure 2D). Thus, the cellsappeared to be synchronized relative to expression ofa G1 cyclin and formation of buds. However, release ofyta7D cells from the nocodazole block did show CLN1transcription and budding defects at times consistentwith M phase (�90 min post-release).

For the time course transcriptional analyses of yta7D

cells with either a nocodazole or an a-factor block, thepeak of histone transcription appeared as expected,after the peak of CLN1 gene transcription in accordancewith previous studies (Figure 2, A and C; Figure 3;Figure 4A) (Hereford et al. 1981). However, the tran-scriptional analysis of all the histone genes revealedstrikingly different effects of YTA7 gene deletion withthe different cell cycle blocks (Figures 3 and 4A). Aftera-factor block and release, yta7D cells revealed a signif-icant higher activation of transcription for all the his-tone genes at the 20 and 30 min time points (Figure 3).Even though gene transcription seemed to start at sim-ilar times (�20 min post-release), there was an apparent20-min window where gene transcription in yta7D cellswas higher than in wild-type, but then gene transcrip-tion decreased in a similar manner to the control strain(50 and 60 min time points). This a-factor blockingexperiment was repeated three times with identicalresults. We also varied which culture (yta7D or wild-typecells) was sampled first at each time point, avoidingsampling discrepancies. One explanation of the appar-ent early transcription of each histone gene in yta7D

Figure 1.—Yta7 activity overlaps with the activities of other described histone regulators. (A) Temperature sensitivity. Indicatedcells were 10-fold serially diluted and incubated at 25� or 34� for the indicated days (d). (B) Hydroxyurea (HU) sensitivity. Cellswere 10-fold serially diluted and incubated at 25� for the indicated days. (C) Methyl methanesulfonate (MMS) sensitivity. Cellswere 10-fold serially diluted and incubated at 25� for the indicated days.


cells is that Yta7 serves as a cell-cycle-dependent tran-scriptional repressor of the histone genes.

The nocodazole block and release experiment re-vealed a different trend (Figure 4A). For each histonegene, a prolonged transcription in yta7D cells was ap-

parent after the peak (80–90 min post-release). Thisdefect in transcription was of similar magnitude to thatobserved upon the gene deletion of the known histonerepressor Hir2 at 80 min post-release (Figure 4B).Unlike the a-factor blocking experiment, a uniform

Figure 3.—Yta7 regulates histone gene transcription. bar1D (solid circles) and yta7D bar1D (open squares) cells were blockedwith a-factor, released, and samples were taken at the indicated times. For each time point, cDNA was prepared and the amount ofindicated transcript (relative to ACT1 transcript) was determined by real-time PCR. Darkly shaded regions emphasize the in-creased histone gene transcription upon gene deletion of YTA7. Error bars are the standard deviation. Asterisks show significantdifferences determined by one-tailed t-testing (P , 0.05).

Figure 2.—Timing of CLN1 gene transcriptionand new bud formation in a-factor synchronizedbar1D and yta7D bar1D cells and in nocodazolesynchronized wild-type and yta7D cells. Cells wereblocked with a-factor (A and B) or nocodazole (Cand D), released, and samples were taken at theindicated times. For each time point, the amountof late G1-cyclin CLN1 transcript relative to ACT1transcript was determined by real-time PCR (Aand C). Error bars are the standard deviation.The formation of new buds was also monitored(B and D).


defect in transcriptional regulation was not evident. Forexample, the HTA1 and HTB1 and HTA2 and HTB2gene pairs are known to be regulated in a similar man-ner (Hereford et al. 1981). In our nocodazole blockingexperiment, the defect observed upon deletion of YTA7showed a similar defect for HTA1 and HTA2 and HTB1and HTB2 (Figure 4A). Since we observed prolongedhistone gene transcription and a differential histonegene transcriptional regulation (relative to the a-factorblocking experiment), we decided to take a more de-tailed look into possible cell cycle defects in each of theblocking experiments.

In Figure 2, we showed that wild-type and yta7D cellshad similar CLN1 transcript levels and new bud forma-tion, indicative of synchronous growth. To investigatecell synchrony in a more detailed manner, we moni-tored DNA content by flow cytometry (Figure 5).

Following a-factor block, cells were released and grewin synchrony (Figure 5, A and B). This indicated that theobserved early transcriptional effect is likely not aconsequence of a cell cycle progression defect (Figure3). However, the nocodazole block and release ex-hibited slightly different results. YTA7 gene deletionimpaired the ability of the cells to exit from M phase orrecover from the nocodazole block (Figure 5, C and D).In Figure 5D, the yta7D cells showed a delay in thetransition from 2N to 1N content relative to wild-type.This led to two important conclusions. First, the pro-longed and variable histone gene transcription ob-served in Figure 4A is likely a product of asynchrony,and that the true effect of YTA7 deletion on histonegene transcription is observed in the highly synchro-nized a-factor blocking experiment in Figure 3. Second,the Yta7 protein could have an undefined role during M

Figure 4.—Nocodazole blocking alters the observed yta7D transcriptional defect in histone gene regulation. (A) Wild-type(solid circles) and yta7D (open squares) cells were blocked with nocodazole and released. Samples were taken at the indicatedtimes and analyzed as in Figure 3. Darkly shaded regions emphasize the increased histone gene transcription upon gene deletionof YTA7. Error bars are the standard deviation. (B) HTB1 gene transcription is upregulated upon deletion of HIR2. Wild-type(solid circles) and hir2D (open squares) cells were blocked with nocodazole and released. Samples were taken at the indicatedtimes and analyzed as in Figure 3. Error bars are the standard deviation. Asterisks show significant differences determined by one-tailed t-testing (P , 0.05).


phase. This could be consistent with Yta7 playing somechromosome specific role as it is a member of a histonebound protein complex during this time of the cell cycle(Tackettet al. 2005). However, a previous study showedthat Yta7 is not involved in chromosome segregationduring M phase (Dubey and Gartenberg 2007).Altogether, we believe that the data presented in Figures3–5 support Yta7 functioning as a histone gene tran-scriptional repressor.

Yta7 associates with histone loci: In order to betterunderstand the mechanism by which Yta7 regulateshistone gene transcription, we utilized a chromatinimmunopurification with high resolution DNA micro-array readout strategy (ChIP-chip) to determine whetherthe Yta7 protein associates with these loci (Ren et al.2000; Tavernaet al. 2006). We chose this technique overconventional ChIP because we were interested in ob-serving the distribution profile of Yta7 across the loci athigh resolution, and because uncovering additionalbinding sites could provide further information fordefining the mechanism of Yta7 activity. The ChIP-chipanalysis of Yta7-Myc showed significant binding at 177discrete regions (supplementary Table S1). We did notobserve any obvious trend toward the type of genes Yta7was associating with.

We show the array data as a composite profile of theYta7-associated DNA occupancy (relative occupancy)plotted as a function of relative coordinates on anaverage gene flanked with intergenic regions as waspreviously done in Taverna et al. (2006) (Figure 6A).Figure 6A revealed that on average the Yta7 protein hadpreferential association with intergenic regions of chro-matin as well as with the extreme 59- and 39-ends of anORF. In contrast, a component of the NuA3 histoneacetyltransferase complex, Yng1, was recently showed tobe preferentially enriched at the 59 half of an ORF, whileminimal association is observed in the intergenic re-gions (Taverna et al. 2006). The averaged localizationof Yng1 is consistent with the role of NuA3 in stimu-lating transcription via H3K14 acetylation, which is aPTM localized to 59-ends of actively transcribing genes(Pokholok et al. 2005). Our data in Figure 6A suggestthat the mechanism of Yta7 activity may be mediatedthrough non ORF associations and that Yta7 binding tointergenic regions could be a mechanism for transcrip-tional silencing.

Six of the top 10 binding sites from the ChIP-chipanalysis were pairings of histone genes (HTB1 andHTA1, HHF1 and HHT1, HHT2 and HHF2) (Figure6B, supplemental Table S1). In addition to these histone

Figure 5.—FACS analysis of DNA content for bar1D and bar1Dyta7D or wild-type and yta7D cells. (A) bar1D and bar1Dyta7D cellswere blocked with a-factor, released, and samples were taken at the indicated times for FACS analysis. (B) Histograms of FACS datafrom A showing 1N and 2N DNA contents as a percentage of gated cells. (C) Wild-type and yta7D cells were blocked with nocodazole,released, and samples were taken at the indicated times for FACS analysis. The asterisks highlight the key differences between theWT and yta7D cells. (D) Histograms of FACS data from C showing 1N and 2N DNA contents as a percentage of gated cells.


loci, the other genomic pair of histone genes (HTA2and HTB2) was also a significant Yta7 binding site(Figure 6B and supplemental Table S1). Consistent withthe average plot (Figure 6A), the HTB1 and HTA1histone locus showed peak Yta7 association at the inter-genic region, even though the Yta7 protein was alsobinding to the genes themselves (Figure 6B). Yta7bound the other histone loci HHF1 and HHT1, HHT2and HHF2, and HTA2 and HTB2 with a similar profileexcept that peak association occurred within the ORFs.

Since the transcription of all histone genes is similarlymodified in yta7D cells (Figure 3), the exact nature ofthis slightly different binding profile among the lociremains to be elucidated. Our observed interaction ofthe Yta7 protein with the histone loci is suggestive of adirect transcriptional regulatory mechanism.

Yta7 interacts with chromatin via the N-terminal tailof histone H3: The above results show that Yta7 asso-ciated with and transcriptionally regulated histonegenes. Yta7 has also been shown to immunopurify with

Figure 6.—The Yta7 protein localizes to histone gene loci. ChIP-chip analysis of Yta7-Myc from asynchronous cells using 50-bpresolution tiled arrays (NimbleGen Systems). (A) Yta7 associated DNA occupancy is plotted as a function of relative coordinates onan average gene flanked with intergenic regions. (B) Shown is Yta7-Myc binding at the four histone loci: HTB1 and HTA1, HHF1and HHT1, HHT2 and HHF2, and HTA2 and HTB2. The log2 intensity ratio of immunoprecipitated to control DNA is plotted as afunction of genomic position. Error bars are the standard deviation of triplicate array analyses.


histone proteins (Tackett et al. 2005). One chromatin-based regulative pathway that precedes histone genetranscription is the acetylation of histone H3 Lys56(H3K56ac) at histone loci (Xu et al. 2005). The Yta7protein also contains a bromodomain-like region thatshows histone association, but the PTM specificity hasnot been determined (Jambunathan et al. 2005).Therefore, we sought to investigate if the Yta7 proteinassociation with histones was PTM dependent, andparticularly H3K56ac dependent.

We purified a recombinant version of the Yta7 bromo-domain-like region (Yta7bd). We first investigatedwhether the recombinant version of Yta7bd specificallybound to a particular histone. An Yta7bd-GST fusion orGST alone was incubated with acid-extracted histones,and interacting proteins were isolated on glutathioneresin. Histones associated with Yta7bd were visualized byimmunoblotting (Figure 7A). GST alone showed mini-mal nonspecific affinity for the histones when compar-ing the input (I) and bound (B) samples. However, the

Figure 7.—Yta7bd interacts with histone H3. (A) Yta7 protein preferentially interacts with histone H3. Yta7bd-GST fusion, orGST alone, was incubated with purified histones and isolated on glutathione resin. Histones associated with Yta7 were visualized byimmunoblotting. Input (I) and bound (B) lanes are shown. (B) Yta7bd interacts with the N-terminal tail of histone H3. Recombi-nant Yta7bd, or GST alone, was incubated with streptavidin Dynabeads coated with biotinylated peptides representing differentregions and modification states of histone H3 (methylation and acetylation). Bound Yta7bd was resolved by SDS–PAGE and vi-sualized by Coomassie staining. (C) Quantification of Yta7bd binding from B. Yta7bd binding is shown as a percentage relative toH3 1-20 binding. (D) Full-length Yta7 protein interacts with the N-terminal tail of histone H3. Purified Yta7-PrA was incubated withstreptavidin Dynabeads coated with biotinylated peptides representing different regions and modification states of histone H3.Bound Yta7-PrA was resolved by SDS–PAGE and visualized by immunoblotting for the PrA tag. (E) Yta7 associated histone H3 wasacetylated at Lys56. Yta7-PrA was immunopurified and coenriching proteins were resolved by SDS–PAGE/Coomassie staining.Copurifying histone H3 was treated in-gel with d6-acetic anhydride to isotopically mark unmodified lysines and then digestedwith trypsin. Shown is a section of a mass spectrum containing the H3K56 peptide as either acetylated (K56ac) or unacetylated(K56). In accordance to the monoisotopic peak areas, H3K56 was 33% acetylated.


GST-Yta7bd fusion protein showed significant bindingof histone H3 as well as minor affinity for H2B.

We then investigated if the Yta7bd interaction withhistone H3 was directed by H3K56ac (or another his-tone H3 PTM). Binding of Yta7bd to a series of dif-ferentially modified histone H3 peptide mimics wasperformed (Figure 7B). We observed that Yta7bd didnot associate with a peptide corresponding to the regionof histone H3 containing H3K56 or H3K56ac (Figure7B, lanes 13–16). However, Yta7bd showed a preferen-tial interaction with the N-terminal 20-amino-acid tail ofhistone H3 (Figure 7B, lanes 3 and 4). The interactionof Yta7bd with the N-terminal tail was favored for theunmodified or singly modified peptide as demonstratedby the decreased association observed with the additionof two or three PTMs (Figure 7B, lanes 5–6 and 17–20 vs.lanes 7–12). Addition of H3K4me3 reduced the bindingcapacity .30%, and further acetylation reduced it�50–70%, while single acetylation caused a binding reduc-tion of �20–40% (Figure 7C). The ability of Yta7bd topreferentially bind the unmodified histone H3 tail andto tolerate various single PTMs suggests that the Yta7protein interaction with chromatin is mediated by ageneral interaction with the N-terminal tail of histoneH3. This is not surprising because the bromodomain-like region of Yta7 is missing amino acids that are requiredfor acetyl-lysine specificity in other bromodomains, butdoes retain many of the amino acids needed for bind-ing to the histone peptide backbone (Jambunathan

et al. 2005). These results suggest that the Yta7 proteinassociates with chromatin through an interaction withthe N-terminal tail of histone H3. It is possible that Yta7binding could be stimulated by combinations of differ-ent PTMs. A similar analysis with full-length Yta7 alsoshowed enrichment for the N-terminal tail of histoneH3 and no stimulated binding with an H3K56ac peptide(Figure 7D).

Our findings in Figure 7 revealed that Yta7 associationwith histones was H3K56ac independent. However,we hypothesized that these two histone gene transcrip-tional regulation signals could simultaneously coexist

on chromatin to provide for independent, overlappingtranscriptional regulation. To test whether H3K56acand Yta7 could be found simultaneously on chromatin,we isolated an ex vivo complex of full-length Yta7 withcopurifying histones as previously reported (Tackett

et al. 2005). We performed a quantitative PTM analysisof histone H3 using isotope labeling and MALDI-massspectrometry (Tackett et al. 2005). The analysis ofthe H3 peptides mass spectrum revealed peptides thatcorresponded to 41% sequence coverage of histoneH3 (Table 3). Of particular interest, we observed pep-tide 53-63, which contained Lys56 (Figure 7E). Weobserved two peaks that corresponded to the unacety-lated and the acetylated peptide. These peptides wereconfirmed by tandem MS. The peak areas from themass spectrum were used to determine that the popu-lation of histone copurifying with Yta7 was 33% acety-lated at H3K56, thus demonstrating that Yta7 couldassociate with both H3K56 acetylated or unmodifiedchromatin. Other detected histone H3 peptides did notshow significant acetylation (Table 3). These data sug-gest that Yta7 and H3K56ac can coexist on a given pieceof chromatin.

The data in Figure 7 show that Yta7 binding tochromatin is not stimulated by H3K56ac, but the twoentities can coexist. We wanted to test whether acetyla-tion of H3K56 was dependent on Yta7. To monitor forthis dependence, we utilized ChIP to H3K56ac at theintergenic region between HTA1 and HTB1 (Figure 8A)(Xu et al. 2005). H3K56ac ChIP on wild-type and yta7D

cells showed no significant difference (P-value ¼ 0.19).Cells harboring a H3K56R mutation were used as acontrol (Recht et al. 2006). In addition to performingChIP to this one region of known H3K56ac, we cor-related our genomewide Yta7 ChIP-chip data to thereported sites of H3K56ac, using only enrichments $2SD from the mean (Xu et al. 2005). Only 6.8% of the 177Yta7-binding sites correlated to sites of H3K56ac (Figure8B). This low correlation is in agreement with resultsfrom Figure 7B that showed no direct affinity of Yta7bdfor H3K56ac. The results in Figures 7 and 8 suggest that

Figure 8.—Yta7 does not direct orcorrelate with general H3K56 acetyla-tion. (A) H3K56ac is not dependenton Yta7. ChIP to histone H3K56ac wasperformed in wild-type, yta7D, andH3K56R cells. Real-time PCR was usedto measure enrichment at the inter-genic region between HTA1 and HTB1relative to ACT1. ChIP to unmodifiedH3 was used to control for nucleosomeoccupancy. Error bars are the standarddeviation of the mean. The asteriskshows the significant difference deter-mined by t-testing (P , 0.01). (B) Ge-nomewide Yta7 binding does not

correlate with H3K56ac. Over the 177 sites identified from ChIP-chip analysis of Yta7, only 6.8% were overlapping with previouslyreported H3K56ac-binding sites (Xu et al. 2005).


Yta7- and H3K56ac-mediated regulation of histone geneexpression are independent.

DISCUSSION

Chromatin remodeling and epigenetic regulation aretightly linked to histone gene expression. Maintainingthe proper dosage level of histone transcripts is a crucialcellular mechanism that is protected through multiplepathways. These histone gene regulatory pathways ex-hibit various levels of redundancy and crosstalk ofprotein interactions. Our work describes how Yta7, aprotein initially identified as a component of a barrierchromatin complex, is also involved in histone geneexpression and is connected to other histone regulatorypathways.

S. cerevisiae contains two copies of the four core his-tones, which are transcribed during S phase. Thesecopies exist as pairs on chromosomes 2, 4, and 14.Preceding transcriptional activation of the histonegenes is a rapid cycle of acetylation on histone H3 lysine56 (H3K56ac) (Xu et al. 2005). H3K56ac coats thepromoter and extends into the open-reading frameregions of these genes in a Spt10-dependent manner,and is needed for proper histone gene transcription(Xu et al. 2005). In addition to H3K56ac, histone genetranscription is regulated by the Asf1/Hir complex andSpt16 containing yFACTcomplex pathways (Sherwood

et al. 1993; Spector et al. 1997; Sutton et al. 2001;Formosa et al. 2002; Recht et al. 2006; Mousson et al.2007). Asf1/Hir and yFACT complexes appear to func-tion through separate pathways to regulate histone genetranscription, with both being needed for proper S-phase transcription of histone genes. The Asf1/Hircomplex functions to maintain cell-cycle-dependentand hydroxyurea-induced repression of histone genetranscription (Sutton et al. 2001). The Spt16 yFACTcomplex aids in transcriptional initiation and providesfor the proper reassembly of chromatin after polymer-ase passage (Formosa et al. 2002). Mutations of theAsf1/Hir and yFACT transcriptional regulators alter,but do not abolish S-phase histone gene transcription,suggesting that other mechanisms of gene regulationexist. Our work links the Yta7 protein to one of thesenovel mechanisms of histone gene transcriptional regu-lation. We favor the hypothesis that Yta7 functions inconcurrence with a multi-pathway cellular program thatregulates histone gene transcription during the cellcycle. Evidence for our hypothesis is demonstrated atthe level of cellular pathway crosstalk, transcriptionalcontrol and chromatin association.

An epistasis analysis provided evidence that Yta7 ac-tivity genetically interacts with other known cellularpathways that regulate histone gene transcription,namely the Asf1/Hir and Spt16/yFACT pathways (Fig-ure 1). The synthetic nature of the observed growth

defects indicated that Yta7, Asf1/Hir, and Spt16/yFACThave overlapping cellular functions. Thus, we identifieda functional significance for our observed copurifica-tion of Yta7 and Spt16 proteins (Tackett et al. 2005).The synthetic growth defects with yta7D cells were de-tectable only under stressful growing conditions (tem-perature, DNA synthesis inhibition, and DNA damage),suggesting that Yta7 is linked to mechanisms of DNArepair. Under stress conditions, such as hydroxyureatreatment, cells shut down histone gene transcription(Sutton et al. 2001). Deletions in histone transcrip-tional regulators, such as Hir1 and Asf1, prevent theproper deactivation of histone gene transcription inthe presence of hydroxyurea, thus highlighting the sig-nificance of the observed synthetic growth defects withyta7D cells under stress (Figure 1) (Sutton et al. 2001).Our MMS studies are in accordance with previousstudies showing that Yta7 interacted with Rad53 underDNA damage conditions (Smolka et al. 2005). More-over, the Yta7 human homolog ATAD2 was down-regulated in a colon cancer cell line arrested in S phaseafter 5-fluorouracil treatment, suggesting a role in DNAdamage and repair (De Angelis et al. 2006). The epis-tasis analysis revealed that the cellular pathway(s) con-taining Yta7 were overlapping with known pathways thatcan modulate histone transcript levels, thereby linkingYta7 to a possible role in histone gene transcription.

A direct test of the involvement of Yta7 in the tran-scriptional regulation of histone gene expression dem-onstrated that Yta7 functioned as a transcriptionalrepressor (Figure 3). Deletion of the YTA7 gene led toelevated transcript levels for all histone genes prior topeak transcription. Histone gene transcription was thendownregulated in a similar manner relative to wild-typecells. In this experiment, we observed a similar mis-regulation of transcription at each gene, which wasconsistent with Yta7 serving a similar repressive role ateach locus (Figure 3). The areas under the peaks ofhistone gene transcription showed that deletion of theYTA7 gene produced more histone transcripts; however,the peak level was not higher—rather the peak wasbroader. With the decline of both peaks overlapping,Yta7 appeared to be involved in some early step oftranscriptional regulation. The evidence in Figure 3showing that Yta7 served as a repressor of histone genetranscription is in agreement with the epistasis analysisthat linked Yta7 to the histone gene transcriptionalregulatory network (Figure 1). As may be expected,double deletion of the repressor Yta7 with hydroxyurea-dependent histone gene repressors (namely Hir1 andAsf1) caused a synthetic growth defect in cells (Figure1B). This growth defect could be the consequence ofpotentially toxic levels of free histone proteins as pre-viously suggested (Gunjan and Verreault 2003; Sharp

et al. 2005). Our time course transcriptional data didnot indicate whether this repressive effect was direct orindirect. It is possible that Yta7 acts in an indirect


manner to modulate histone transcript levels. Ratherthan acting as a direct repressor of gene transcription,Yta7 could play a role in the post-transcriptional turn-over of histone mRNA (Hereford et al. 1982). However,since Yta7 has a putative bromodomain, transcriptionalgene regulatory activity, and associates with chromatin,we favor a direct mechanism that would involve theYta7 protein binding to the histone loci (Tackett et al.2005).

To determine if the Yta7 protein indeed directlyassociated with the histone loci, we performed a seriesof in vivo and in vitro binding studies. GenomewideChIP-chip of Yta7 revealed direct chromatin associationat 177 novel sites (Figure 6). Six of the top 10 bindingsites were the histone loci (Figure 6B). Yta7 binding wasobserved across each ORF and intergenic region at thehistone loci. It is possible that such a binding profilecould provide for formation of a chromatin state thatrepresses transcription. Binding of Yta7 to the histoneloci further strengthens the hypothesis that Yta7 is di-rectly regulating histone gene transcription. Since Yta7contains a histone H3 binding bromodomain-like region(Figure 7A), we investigated whether there was a partic-ular histone H3 PTM code that promoted Yta7 associa-tion. Full-length Yta7 and Yta7bd were found to engagehistone H3 at the N terminus with a preferential asso-ciation in the absence of tested PTMs (Figure 7, B–D).Purification of in vivo associated histone H3, revealedsignificant levels of H3K56ac, but this PTM did notstimulate Yta7 protein association nor was H3K56acdependent upon Yta7 (Figure 7, C and E; Figure 8).The in vivo purification of H3K56ac with Yta7 would bepredicted because both are associated with the intergenicregions at histone loci (Figure 6; Xu et al. 2005). Ourchromatin association studies are consistent with thehypothesis that Yta7 mediated transcriptional repressionoccurs through direct association at the histone loci.

The results presented shed light on the cellular pro-gram needed for transcriptional regulation of the his-tone genes. There appear to be multiple levels ofregulation that provide for proper histone dosage,which is not surprising for a key cellular process. Wefind that Yta7 serves a key role in a previously unchar-acterized branch of the histone gene transcriptionalregulatory pathway. Our findings also provide for abroader understanding of the function of Yta7, whichseems to regulate transcription not only at transitionzones between silent and active chromatin, but also via adynamic mechanism at other chromosomal regions.

We thank Lauren Blair and Cagdas Tazearslan for critical reading,Piotr Zimniak for access to real-time PCR instrumentation, AndrewKrutchinsky and Markus Kalkum for assistance with mass spectromet-ric hardware/software development, Cecile Artaud and AnastasPashov for flow cytometry analysis, Tim Formosa for the spt16-11strain, and Judith Recht for the H3K56R strain. The following NationalInstitutes of Health (NIH) grants supported this work: P20RR015569(A.J.T., co-investigator), GM63959 (C.D.A.), RR022220 and

GM076547 (J.D.A.). A.J.T. acknowledges support from the ArkansasBiosciences Institute and recognizes mass spectrometric support fromSam Mackintosh and Chris Warthen funded through an NIH IDeANetwork of Biomedical Research Excellence grant (P20RR016460).

LITERATURE CITED

Askree, S. H., T. Yehuda, S. Smolikov, R. Gurevich, J. Hawk et al.,2004 A genome-wide screen for Saccharomyces cerevisiae dele-tion mutants that affect telomere length. Proc. Natl. Acad. Sci.USA 101: 8658–8663.

Berger, S. L., 2007 The complex language of chromatin regulationduring transcription. Nature 447: 407–412.

Biswas, D., Y. Yu, M. Prall, T. Formosa and D. J. Stillman,2005 The yeast FACT complex has a role in transcriptional ini-tiation. Mol. Cell. Biol. 25: 5812–5822.

Cairns, B. R., 2005 Chromatin remodeling complexes: strength indiversity, precision through specialization. Curr. Opin. Genet.Dev. 15: 185–190.

De Angelis, P. M., D. H. Svendsrud, K. L. Kravik and T. Stokke,2006 Cellular response to 5-fluorouracil (5-FU) in 5-FU-resis-tant colon cancer cell lines during treatment and recovery.Mol. Cancer 5: 20.

Dilworth, D. J., A. J. Tackett, R. S. Rogers, E. C. Yi, R. H. Christmas

et al., 2005 The mobile nucleoporin Nup2p and chromatin-bound Prp20p function in endogenous NPC-mediated transcrip-tional control. J. Cell Biol. 171: 955–965.

Dion, M. F., T. Kaplan, M. Kim, S. Buratowski, N. Friedman et al.,2007 Dynamics of replication-independent histone turnover inbudding yeast. Science 315: 1405–1408.

Donze, D., C. R. Adams, J. Rine and R. T. Kamakaka, 1999 Theboundaries of the silenced HMR domain in Saccharomyces cerevi-siae. Genes Dev. 13: 698–708.

Driscoll, R., A. Hudson and S. P. Jackson, 2007 Yeast Rtt109 pro-motes genome stability by acetylating histone H3 on lysine 56.Science 315: 649–652.

Dubey, R. N., and M. R. Gartenberg, 2007 A tDNA establishes co-hesion of a neighboring silent chromatin domain. Genes Dev. 21:2150–2160.

Formosa, T., S. Ruone, M. D. Adams, A. E. Olsen, P. Eriksson et al.,2002 Defects in SPT16 or POB3 (yFACT) in Saccharomyces cerevi-siae cause dependence on the Hir/Hpc pathway: polymerase pas-sage may degrade chromatin structure. Genetics 162: 1557–1571.

Gauss, R., M. Trautwein, T. Sommer and A. Spang, 2005 New mod-ules for the repeated internal and N-terminal epitope tagging ofgenes in Saccharomyces cerevisiae. Yeast 22: 1–12.

Giaever, G., A. M. Chu, L. Ni, C. Connelly, L. Riles et al.,2002 Functional profiling of the Saccharomyces cerevisiae ge-nome. Nature 418: 387–391.

Goldberg, A. D., C. D. Allis and E. Bernstein, 2007 Epigenetics: alandscape takes shape. Cell 128: 635–638.

Gunjan, A., and A. Verreault, 2003 A Rad53 kinase-dependentsurveillance mechanism that regulates histone protein levels inS. cerevisiae. Cell 115: 537–549.

Han, J., H. Zhou, B. Horazdovsky, K. Zhang, R. M. Xu et al.,2007 Rtt109 acetylates histone H3 lysine 56 and functions inDNA replication. Science 315: 653–655.

Hereford, L. M., M. A. Osley, T. R. Ludwig, II and C. S. McLaughlin,1981 Cell-cycle regulation of yeast histone mRNA. Cell 24: 367–375.

Hereford, L., S. Bromley and M. A. Osley, 1982 Periodic tran-scription of yeast histone genes. Cell 30: 305–310.

Jamai, A., R. M. Imoberdorf and M. Strubin, 2007 Continuous his-tone H2B and transcription-dependent histone H3 exchange inyeast cells outside of replication. Mol. Cell 25: 345–355.

Jambunathan, N., A. W. Martinez, E. C. Robert, N. B. Agochukwu,M. E. Ibos et al., 2005 Multiple bromodomain genes are involvedin restricting the spread of heterochromatic silencing at the Saccha-romyces cerevisiae HMR-tRNA boundary. Genetics 171: 913–922.

John, S., L. Howe, S. T. Tafrov, P. A. Grant, R. Sternglanz et al.,2000 The something about silencing protein, Sas3, is the cata-lytic subunit of NuA3, a yTAF(II)30-containing HAT complexthat interacts with the Spt16 subunit of the yeast CP (Cdc68/Pob3)-FACT complex. Genes Dev. 14: 1196–1208.


Kouzarides, T., 2007 Chromatin modifications and their function.Cell 128: 693–705.

Li, B., M. Carey and J. L. Workman, 2007 The role of chromatinduring transcription. Cell 128: 707–719.

Mousson, F., F. Ochsenbein and C. Mann, 2007 The histone chap-erone Asf1 at the crossroads of chromatin and DNA checkpointpathways. Chromosoma 116: 79–93.

Pokholok, D. K., C. T. Harbison, S. Levine, M. Cole, N. M. Hannett

et al., 2005 Genome-wide map of nucleosome acetylation andmethylation in yeast. Cell 122: 517–527.

Recht, J., T. Tsubota, J. C. Tanny, R. L. Diaz, J. M. Berger et al.,2006 Histone chaperone Asf1 is required for histone H3 lysine56 acetylation, a modification associated with S phase in mitosisand meiosis. Proc. Natl. Acad. Sci. USA 103: 6988–6993.

Ren, B., F. Robert, J. J. Wyrick, O. Aparicio, E. G. Jennings et al.,2000 Genome-wide location and function of DNA binding pro-teins. Science 290: 2306–2309.

Rufiange, A., P. E. Jacques, W. Bhat, F. Robert and A. Nourani,2007 Genome-wide replication-independent histone h3 ex-change occurs predominantly at promoters and implicates h3k56 acetylation and asf1. Mol. Cell 27: 393–405.

Sharp, J. A., G. Rizki and P. D. Kaufman, 2005 Regulation of histonedeposition proteins Asf1/Hir1 by multiple DNA damage check-point kinases in Saccharomyces cerevisiae. Genetics 171: 885–899.

Sherwood, P. W., S. V.-M. Tsang and M. A. Osley, 1993 Char-acterization of HIR1 and HIR2, two genes required for regulationof histone gene transcription in Saccharomyces cerevisiae. Mol. Cell.Biol. 13: 28–38.

Smolka, M. B., C. P. Albuquerque, S. H. Chen, K. H. Schmidt, X. X.Wei et al., 2005 Dynamic changes in protein-protein interactionand protein phosphorylation probed with amine-reactive isotopetag. Mol. Cell. Proteomics 4: 1358–1369.

Spector, M. S., A. Raff, H. DeSilva, K. Lee and M. A. Osley,1997 Hir1p and Hir2p function as transcriptional corepressors

to regulate histone gene transcription in the Saccharomyces cer-evisiae cell cycle. Mol. Cell. Biol. 17: 545–552.

Strambio-de-Castillia, C., J. Tetenbaum-Novatt, B. S. Imai, B. T.Chait and M. P. Rout, 2005 A method for the rapid and effi-cient elution of native affinity-purified protein A tagged com-plexes. J. Proteome Res. 4: 2250–2256.

Sutton, A., J. Bucaria, M. A. Osley and R. Sternglanz, 2001 YeastASF1 protein is required for cell cycle regulation of histone genetranscription. Genetics 158: 587–596.

Tackett, A. J., D. J. Dilworth, M. J. Davey, M. O’Donnell, J. D.Aitchison et al., 2005 Proteomic and genomic characterizationof chromatin complexes at a boundary. J. Cell Biol. 169: 35–47.

Taverna, S. D., S. Ilin, R. S. Rogers, J. C. Tanny, H. Lavender et al.,2006 Yng1 PHD finger binding to histone H3 trimethylated atlysine 4 promotes NuA3 HAT activity at lysine 14 of H3 and tran-scription at a subset of targeted ORFs. Mol. Cell 24: 785–796.

Taverna, S. D., B. M. Ueberheide, Y. Liu, A. J. Tackett, R. L. Diaz

et al., 2007 Long-distance combinatorial linkage between meth-ylation and acetylation on histone H3 N termini. Proc. Natl.Acad. Sci. USA 104: 2086–2091.

Tseng, R. J., K. R. Armstrong, X. Wang and H. M. Chamberlin,2007 The bromodomain protein LEX-1 acts with TAM-1 tomodulate gene expression in C. elegans. Mol. Genet. Genomics278: 507–518.

Voth, W. P., Y. W. Jiang and D. J. Stillman, 2003 New ‘marker swap’plasmids for converting selectable markers on budding yeastgene disruptions and plasmids. Yeast 20: 985–993.

Xu, F., K. Zhang and M. Grunstein, 2005 Acetylation in histone H3globular domain regulates gene expression in yeast. Cell 121:375–385.

Communicating editor: F. Winston


Documents

Saccharomyces cerevisiae Yta7 Regulates Histone Gene … · previously identiﬁed members of the histone regulatory pathway. In concurrence, Yta7 was found to reg- In concurrence,