lable at ScienceDirect

Anaerobe 23 (2013) 109e111

Contents lists avai

Anaerobe

journal homepage: www.elsevier .com/locate/anaerobe

Note

Segmented filamentous bacteria are a major group in terminal ileumof piglets

Kiyoshi Tajima a,*, Hideyuki Ohmori a, Masanori Tohno b, Haruhiko Ohtsu a,Takamitsu Tsukahara c, Rustam Aminov d

aNational Agriculture and Food Research Organization, National Institute of Livestock and Grassland Science, Tsukuba, Ibaraki 305-0901, JapanbNational Agriculture and Food Research Organization, National Institute of Livestock and Grassland Science, Nasushiobara, Tochigi 329-2793, JapancKyoto Institute of Nutrition and Pathology, Inc., 7-2 Furuiketani Tachikawa Ujitawara, Kyoto 610-0231, Japand The University of The West Indies, Mona, Kingston 7, Jamaica

a r t i c l e i n f o

Article history:Received 27 May 2013Received in revised form15 July 2013Accepted 17 July 2013Available online 26 July 2013

Keywords:PigletsIleal mucosal microbiotaSegmented filamentous bacteria

* Corresponding author. Tel.: þ81 (0)29 838 8648;E-mail address: ktajima@affrc.go.jp (K. Tajima).

1075-9964/$ e see front matter � 2013 Elsevier Ltd.http://dx.doi.org/10.1016/j.anaerobe.2013.07.004

a b s t r a c t

Metabolically active microbiota of the porcine terminal ileum mucosa was analyzed by RT-PCR of 16SrRNAs. The majority of 1951 sequences retrieved (24.8%) displayed the closest similarity to segmentedfilamentous bacteria (SFB). Phylogenetic analysis inferred the host-specific clusters of SFB sequencessuggesting the host-specific selection of this group of bacteria.

� 2013 Elsevier Ltd. All rights reserved.

Gut immunity development is stimulated by the intestinalmicrobiota [1,2]. The Peyer’s patches-enriched terminal ileum is afocal point of immune surveillance and response in the gut.Colostrum supplies various immunoglobulins, oligosaccharides andother immunologically active substances in the suckling period. Inthe weaning period, however, animals suffer gastrointestinal dis-orders due to cease of protective antibody supply, diet compositionchange, and drastic restructuring of the gut microbiota thereof. Tocontrol it, metaphylaxis antibiotics are used [3]. The threat ofantibiotic resistance, however, led some countries to ban thispractice. While the universal ban is not imminent, alternatives aresought to decrease reliance on antibiotics. One of these could beearlier maturation of the gut immune system to lessen the relianceon antibiotics. Some intestinal bacteria are potent immunomodu-lators helping the maturation of the immune system [4]. Immu-noglobulin A (IgA) secretion may be heightened by bacteria in themucosa of terminal ileum [5,6]. Thus the mucosal surface-associated microbiota plays a major role in the immune systemmaturation and function. Here we investigated the mucosa-associated microbiota in the terminal ileum of weaning pigs.

fax: þ81 (0)29 838 8606.

All rights reserved.

Community structure was assessed through RT-PCR to describe themetabolically active part of the ileal mucosal microbiota.

Bacteria associated with mucosa of terminal ileum in weaning pigs.The study involved 45 LWD crossbred piglets (23 males and 22females), weaned at 26 days after the birth (Table 1). Post-weaning,the piglets were kept in individually and fed the diet consisting ofrice/corn, soybean meal, skim milk, soy oil, amino acids, vitaminsand minerals according to the Japanese feeding standard for swine.Chemically it consisted of crude protein (22%), crude fat (4.8%), theestimated TDN 90%, and was antibiotic-free. The piglets weremaintained on this diet for 3 weeks (49 days) to gain the bodyweights ca. 18 kg and slaughtered. The terminal ileum sampleswere stored in RNA later solution (Life Technologies). Total RNAfrom the tissue samples was extracted with RNAeasy mini kit(Qiagen). About 700 bp fragments of the 16S rRNA genes weregenerated by RT-PCR (Takara Bio, PrimeScript RT-PCR kit) withprimers 27f (AGAGTTTGATCCTGGCTCAG) and 785r (CTACCAGGG-TATCTAATCC) and the amplicons were cloned using the TA-Cloningkit (Life Technologies). The analyzed clone number per animal was43.6� 7.1. A total of 1951 clones were sequenced and then analyzedusing online BLAST services at NCBI [7]. The terminal ileummucosa-associated sequences were classified into 82 bacterialspecies (Table 2). Almost a quarter of all sequences (24.8%) wererelated to Candidatus Arthromitus (SFB).

Table 1Pig sampling details.

Parents (Sow � boar) (Sow � boar)

LW22-14 � D22-2 LW18-538 � D18-3LW23-218 � D22-1 LW21-197 � D21-3668LW23-216 � D21-3668 LW22-14 � D22-2LW23-215 � D23-5 LW23-216 � D21-3668

LW23-215 � D23-5

Piglets SFB-positive SFB-negative

Number of piglets 27 18SFB-positive clones

per pigleta17.9 � 9.4 NDb

Number of clonesanalyzed per piglet

44.7 � 5.5 41.9 � 8.9

Gender of piglets(male/female)

15/12 8/10

a Mean � SD.b Not detected.

Table 2Bacterial 16S rRNA gene sequences associated with the terminal ileum mucosa ofpiglets.

Nearest relatives % Ofsequences

Nearest relatives % Ofsequences

Candidatus Arthromitus 24.8 Lactobacillus delbrueckii 0.2Helicobacter rappini 7.2 Lactobacillus fermentum 0.2Clostridium colinum 5.5 Lactobacillus plantarum 0.2Clostridium disporicum 5.2 Weissella confusa 0.2Streptococcus alactolyticus 4.8 Blautia wexlerae 0.1Sarcina ventriculi 4.6 Clostridium

maritimum0.1

Lactobacillus johnsonii 4.3 Faecalibacteriumprausnitzii

0.1

Lactobacillus amylovorus 4.1 Haemophilus parasuis 0.1Lactobacillus acidophilus 3.8 Lactobacillus salivarius 0.1Clostridium beijerinckii 3.6 Roseburia sp. DJF_VR77 0.1Clostridium mayombei 3.5 Sutterella stercoricanis 0.1Bacterium Irt-JG1-68 3.2 Acinetobacter sp. CU27 0.1Clostridium leptum 3.0 Actinobacillus indolicus 0.1Actinobacillus minor 2.1 Rumen bacterium RC-2 0.1Lactobacillus reuteri 2.0 Bacteroides vulgatus 0.1Lactobacillus mucosae 1.9 Blautia sp. M25 0.1Clostridium lituseburense 1.3 Bacterium mpn-isolate

group 40.1

Actinobacillusporcitonsillarum

1.2 Clostridium glycolicum 0.1

Turicibacter sanguinis 1.2 Clostridium indolis 0.1Helicobacter trogontum 1.0 Clostridium piliforme 0.1Helicobacter pullorum 0.9 Swine fecal bacterium

SD-Pec100.1

Actinobacillus porcinus 0.8 Enterobacter sp. 4APG 0.1Mitsuokella multiacida 0.7 Enterococcus faecium 0.1Helicobacter canadensis 0.7 Enterococcus hirae 0.1Lactobacillus agilis 0.7 Gemmiger formicilis 0.1Helicobacter equorum 0.5 Klebsiella pneumoniae 0.1Helicobacter sp.

MIT 02-68990.5 Lactobacillus sp. D2-2-1 0.1

Clostridiaceae bacterium’ARUP UnID 217’

0.4 Lactobacillus gallinarum 0.1

Campylobacter jejuni 0.4 Lactobacillus helveticus 0.1Clostridium quinii 0.4 Lactobacillus pentosus 0.1Clostridium bartlettii 0.3 Lactobacillus uvarum 0.1Clostridium butyricum 0.3 Mitsuokella jalaludinii 0.1Escherichia coli 0.3 Nocardiopsis sp.

TFS73-150.1

Lactobacillus crispatus 0.3 Parabacteroides merdae 0.1Streptococcus sp.

1561-2D2-040.3 Prevotella melaninogenica 0.1

Lactobacillus rhamnosus 0.3 Bacterium mpn-isolategroup 1

0.1

Prevotella copri 0.3 Prevotella sp. DJF_LS17 0.1Lactobacillus vaginalis 0.2 Sphingomonas echinoides 0.1Prevotella sp. RS2 0.2 Streptococcus equinus 0.1Actinobacillus rossii 0.2 Streptococcus gallolyticus 0.1Clostridium sp. SH-C52 0.2 Streptococcus hyointestinalis 0.1

K. Tajima et al. / Anaerobe 23 (2013) 109e111110

Phylogeny of porcine SFB sequences. To increase the accuracy andstatistical significance of phylogenetic reconstruction, the full-length 16S rRNA gene sequences belonging to the SFB group wereretrieved. Total DNA from the terminal ileum samples was extrac-ted with DNA stool mini kit (Qiagen). 16S rRNA sequences wereamplified with the primers 27f and 1492r (GGTTACCTTGTTAC-GACTT) and with SapphireAmp Fast PCR Master Mix (Takara Bio)[8]. PCR products were cloned with the TA-cloning kit and the re-combinant clones were screened for SFB-related sequences byspecific primers [9]. SFB clones were sequenced and the sequenceswere submitted to the DDBJ (accession numbers AB822979,AB822980, AB822981, AB822982, AB822983, AB822984 andAB822985). The maximum likelihood tree demonstrated the host-specific placement of the SFB sequences (Fig. 1).

SFB play an important role in maturation of the immune system[6]. In mice they tightly adhere to the epithelial cells of the terminalileum and induce the appearance of Th17 cells that produce IL-17and IL-22 in the lamina propria [10]. The SFB-associated micedisplay higher numbers of IgA-producing cells in the laminapropria and higher concentrations of secreted IgA in feces [6]. ThusSFB are the key microbial players in intestinal immunity and ho-meostasis [11]. We used RT-PCR to target metabolically activebacteria and a quarter of sequences retrieved from the mucosalsurfaces in the terminal ileum of piglets were SFB. Thus, despite thehighly reduced genomes, extensive auxotrophy and limited meta-bolic capabilities of SFB [12], the high representation of SFB in ourlibraries points to these bacteria as a single most metabolicallyactive group in this gut compartment.

SFB have been detected microscopically in a wide range ofvertebrate species [13]. In a recent PCR-based survey the presenceof SFB has been detected in humans, mice, and chickens [9]. Theoccurrence of SFB in pigs has been investigated under the micro-scopy and found to be low (0.5%) [14]. Herewe report a much widerincidence of SFB in pigs, in 60% of animals. Interestingly, the litter ofthe same parents could display either SFB-positive or SFB-negativemicrobiota suggesting the role of environmental factors in coloni-zation by SFB (Table 1). The occurrence of SFB was also gender-independent (Table 1). Need to note here that the modest num-ber of sequences collected, 1951, has a relatively low-resolutionpower, and the occurrence of SFB in pigs may be underestimated.Nevertheless, this is a single major group in the terminal ileummucosa of pigs comprising 24.8% of all sequences. Low frequenciesfound in Ref. [14] may be due to the commercial pig production

Fig. 1. Phylogenetic placement of SFB 16S rRNA gene sequences from piglets amongother database entries. The likelihood values are given at nodes. The scale bar is infixed nucleotide substitutions per sequence position. The accession numbers ofnucleotide sequences used in this phylogenetic analysis are given in parenthesis.

K. Tajima et al. / Anaerobe 23 (2013) 109e111 111

features such as early weaning and antibiotic feeding. It may bealso due to low resolution inherent in the morphology-basedtechniques.

Phylogeny of the 16S rRNA genes from SFB indicates the hostspecificity. SFB genomes demonstrate extensive adaptations to thegastrointestinal environment with the loss of biosynthetic path-ways and with reliance on the host for a variety of nutrients [12].

Despite the large percentage of SFB in the terminal ileummucosaof piglets, no functional role for SFB can be assigned yet. In moreadvanced rodent models SFB guide the development and regulationof the immune system and a similar function can be envisaged forSFB in pigs. This needs further experimental corroborations though.

Acknowledgment

This study was supported, in part, by a grant-in-Aid for ScientificResearch (13209262) from the Ministry of Education, Science,Culture, Sports and Technology of Japan.

References

[1] Hold GL, Mukhopadhya I, Monie TP. Innate immune sensors and gastroin-testinal bacterial infections. Clin Dev Immunol 2011;2011:1e11.

[2] Ohashi Y, Ushida K. Health-beneficial effects of probiotics: its mode of action.Anim Sci J 2009;80:361e71.

[3] Cromwell GL. Why and how antibiotics are used in swine production. AnimBiotechnol 2002;13:7e27.

[4] Mazmanian SK, Liu CH, Tzianabos AO, Kasper DL. An immunomodulatorymolecule of symbiotic bacteria directs maturation of the host immune system.Cell 2005;122:107e18.

[5] Zhang J, Deng J, Wang Z, Che C, Li YF, Yang Q. Modulatory effects of Lacto-bacillus salivarius on intestinal mucosal immunity of piglets. Curr Microbiol2011;62:1623e31.

[6] Umesaki Y, Setoyama H, Matsumoto S, Imaoka A, Itoh K. Differential roles ofsegmented filamentous bacteria and clostridia in development of the intes-tinal immune system. Infect Immun 1999;67:3504e11.

[7] Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, et al. GappedBLAST and PSI-BLAST: a new generation of protein database search programs.Nucleic Acids Res 1997;25:3389e402.

[8] Tohno M, Kobayashi H, Nomura M, Kitahara M, Ohkuma M, Uegaki R, et al.Genotypic and phenotypic characterization of lactic acid bacteria isolatedfrom Italian ryegrass silage. Anim Sci J 2012;83:111e20.

[9] Yin Y, Wang Y, Zhu L, Liu W, Liao N, Jiang M, et al. Comparative analysis of thedistribution of segmented filamentous bacteria in humans, mice and chickens.ISME J 2013;7:615e21.

[10] Ivanov II, Atarashi K, Manel N, Brodie EL, Shima T, Karaoz U, et al. Induction ofintestinal Th17 cells by segmented filamentous bacteria. Cell 2009;139:485e98.

[11] Reading NC, Kasper DL. The starting lineup: key microbial players in intestinalimmunity and homeostasis. Front Microbiol 2011;2(148):1e10.

[12] Sczesnak A, Segata N, Qin X, Gevers D, Petrosino JF, Huttenhower C, et al. Thegenome of th17 cell-inducing segmented filamentous bacteria revealsextensive auxotrophy and adaptations to the intestinal environment. CellHost Microbe 2011;10:260e72.

[13] Klaasen HL, Koopman JP, Van den Brink ME, Bakker MH, Poelma FG,Beynen AC. Intestinal, segmented, filamentous bacteria in a wide range ofvertebrate species. Lab Anim 1993;27:141e50.

[14] Sanford S. Light and electron microscopic observations of a segmented fila-mentous bacterium attached to the mucosa of the terminal ileum of pigs. J VetDiagn Invest 1991;3:328e33.