Shoot-applied MeJA Suppresses Root Nodulation in Lotus

Shoot-applied MeJA Suppresses Root Nodulation in Lotus japonicus. Tomomi Nakagawa, Masayoshi Kawaguchi

*Corresponding author: Tomomi Nakagawa

Laboratory of Plant Physiology, Graduate School of Science, University of Tokyo, Hongo,

Tokyo, 113-0033, Japan.

Tel: +81-3-5841-4458; Fax: +81-3-5841-4458

E-mail: [email protected]

Subject areas: environmental and stress responses, growth and development,

Number of black and white figures: 3

Number of color figures: 2

Number of tables: 0

Running title: MeJA Suppresses Nodulation in Lotus japonicus

Plant and Cell Physiology 2005 The Japanese Society of Plant Physiologists (JSPP); all rights reserved.

Plant and Cell Physiology Advance Access published November 21, 2005 at Pennsylvania State U

niversity on September 12, 2016

http://pcp.oxfordjournals.org/D

ownloaded from

http://pcp.oxfordjournals.org/

Authors: Tomomi Nakagawa1,2,*, Masayoshi Kawaguchi1,3 1Department of Biological Sciences, Graduate School of Science, The University of Tokyo, 7-3-1

Hongo, Bunkyo, Tokyo 113-0033, Japan 2Research Fellowships of the Japan Society for the Promotion of Science for Young Scientists

(JSPS), Japan Society for the Promotion of Science, 8 Ichi-Ban-Cho, Chiyoda, Tokyo 102-8472

Japan. 3Core Research for Evolutional Science and Technology (CREST), Japan Science and

Technology Agency, 4-1-8 Honcho, Kawaguchi, Saitama 332-0112, Japan

Abbreviations: AUT, autoregulation of root nodulation; SAR: systemic acquired

resistance; ISR, induced systemic resistance; MeJA, methyl jasmonate; MeSA, methyl

salicylate; JA, jasmonic acid; SA, salicylic acid; ET, ethylene

at Pennsylvania State University on Septem

ber 12, 2016http://pcp.oxfordjournals.org/

Dow

nloaded from


Abstract To maintain a symbiotic balance, leguminous plants have a systemic regulatory

system called autoregulation of nodulation (AUT). Since AUT is schematically similar

to systemic resistance found in plant-pathogen interactions, we examined the effects of

methyl jasmonate (MeJA) or methyl salicylate (MeSA) on nodulation in Lotus japonicus.

Shoot-applied MeJA strongly suppressed nodulation in the wild-type and even

hyper-nodulation in the har1 mutant, whereas MeSA exhibited no effect. MeJA

inhibited early stages of nodulation, including infection thread formation and NIN gene

expression, and also suppressed lateral root formation. These findings suggest that

jasmonic acid and/or its related compounds participate in AUT signaling.

Keywords: autoregulation, ISR, MeJA, nodule, SAR, symbiosis



Dow

nloaded from


Plants survive in the environment amidst a vast amount of microorganisms,

including pathogenic bacteria. To prevent invasions by harmful microorganisms, plants

have evolved various defense systems involving preformed barriers and induced defense

mechanisms. Recognition of invaders by plants triggers induced resistance which is

locally activated at the infection site and also at uninfected tissues to systemically protect

the plant against subsequent attack.

One well-studied phenomenon is systemic acquired resistance (SAR), which

confers systemic resistance against a broad spectrum of plant pathogens and is

characterized by an accumulation of salicylic acid (SA) and pathogenesis-related proteins

(PRs) at the infection sites and in uninfected organs (for a review see Durrant and Dong

2004). The application of SA leads to the activation of SAR (for a review see Malamy

and Klessig 1992). In contrast, expression of a bacterial salicylate hydrolase (nahG)

gene, which inactivates SA by conversion to catechol, prevents the activation of SAR

(Lawton et al. 1995). Therefore, SA is an indispensable and sufficient signal molecule

for SAR induction.

Another kind of induced resistance is known as induced systemic resistance

(ISR) (for a review see Van Loon et al. 1998). A non-pathogenic bacterial strain,

Pseudomonas fluorescens WCS417r, colonizing roots, has been shown to trigger ISR in

the shoots of several plant species. Root colonization of WCS417r in Arabidopsis

systemically prevents the proliferation of pathogenic bacteria such as Pseudomonas

syringae pv. tomato, Fusarium oxysporum and Xanthomonas campestris pv. armoaciae

(Pieterse et al. 2000). Plants unable to accumulate SA by introducing the nahG gene

undergo normal WCS417r-induced ISR, whereas jasmonate (JA)- or ethylene

(ET)-insensitive plant mutants fail to elicit ISR (Pieterse et al. 1996, 2002, Ton et al.

2002), indicating that JA or ET signaling is indispensable for ISR.

Such an ISR-like system is also documented in the symbiotic interaction

between legumes and rhizobia (for a review see Caetano-Anolles and Gresshoff 1991).

In 1984, Kosslak and Bohlool demonstrated that plant resistance induced by rhizobial

infection transmits from infected roots to uninfected roots and prevents further infection

of rhizobia. This systemic regulation program in plants is called autoregulation of

nodulation (AUT; Caetano-Anolles and Gresshoff 1991), and allows leguminous plants

to keep the symbiotic balance by suppressing excessive bacterial invasion as well as

nodulation that consumes a lot of photosynthates. To date, ET has been demonstrated to



Dow

nloaded from


serve as a negative regulator of rhizobial infection. For example, an ET-insensitive

mutant of Medicago truncatula, sickle, is hyper-infected by its symbionts, Sinorhizobium

meliloti, but the nodulation zone in the sickle root is comparative to that in the wild-type

(Penmetsa and Cook 1997). In contrast, AUT-impaired mutants isolated from pea,

soybean, Lotus japonicus and M. truncatula, can be characterized by a hyper-nodulating

phenotype with a wider nodulation zone (Caetano-Anolles and Gresshoff 1991,

Szczyglowski et al. 1998, Wopereis et al. 2000, Kawaguchi et al. 2002, Penmetsa et al.

2003). Grafting experiments together with split root experiments using

hyper-nodulating mutants indicate that AUT consists of two long-distance signals, a

root-derived signal and an autoregulation signal. The former is generated in roots in

response to rhizobia (especially in response to Nod factors), whereas the latter is

produced in shoots, on receiving the root-derived signal. Recently, the first genes,

HAR1 and NTS1 (NARK), that play a central role in AUT were identified by positional

cloning in L. japonicus and soybean (Krusell et al. 2002, Nishimura et al. 2002, Searle et

al. 2003), however, none of other genes or endogenous signals related to AUT have been

identified.

See Figure 1

Like SAR and ISR, AUT is induced by bacterial infections and consequently

exhibits systemic resistance against bacteria. In addition, it has been reported that L.

japonicus har1 and soybean nts1 mutants were hyper-infected by a parasitic nematode,

Meloidogyne incognita as well as by arbuscular mycorrhizal fungi (Solaiman et al. 2000,

Lohar and Bird 2003, Meixner et al. 2005). These findings led us to speculate that SA or

JA that plays a pivotal role in SAR or ISR may be involved in AUT in legumes. Based

on the schematic similarity among these systemic resistances, we hypothesized that the

mechanism(s) preventing excessive infection of bacteria and excessive nodulation in

AUT may share some common components with SAR and ISR. To test this possibility,

MeSA or MeJA was applied to shoots that are considered to be a primary source of an

unidentified autoregulation signal for nodulation (Caetano-Anolles and Gresshoff 1991).

At first, we examined the effects of MeSA and MeJA on nodulation using L.

japonicus wild-type plants (Gifu B-129). As shown in Fig. 1A, MeSA at 10-4 M and 10-3

M did not show a marked effect on nodulation. In contrast, shoot-sprayed MeJA at 10-4

M and 10-3 M significantly suppressed nodulation (Fig. 1A). Notably, MeJA also

strongly inhibited even the hyper-nodulating phenotype of L. japonicus har1-4 mutant



Dow

nloaded from


(Fig. 1A and 2), which is a strong allele of har1 with a missense mutation in the LRR

domain of a receptor-like kinase (Nishimura et al. 2002). A dose response analysis

indicated that both wild-type and har1-4 had similar sensitivity to higher concentrations

(10-4 to 10-3 M) of MeJA on nodulation, however, MeJA at lower concentrations (10-6 to

10-5 M) significantly inhibited the formation of nodules in har1-4 than wild-type (Fig.

1B). Since the nodulation of wild-type plants are suppressed by AUT and har1-4 lacks

the AUT signal, lower concentrations of MeJA could be more effective on nodule

suppression in har1 mutants. Jasmonate and its related compounds are also known to

inhibit plant growth, decompose photosynthetic pigments and promote senescence

(Staswick et al. 1992). Nodule suppression by shoot-applied MeJA may be due to its

secondary effect via plant growth inhibition. To address this question, we examined the

effects of MeJA on plant growth and the chlorophyll content. The application of MeJA

(10-6 M to 10-3 M) to the shoots of wild-type plants reduced both shoot and root fresh

weights. In har1-4, MeJA had little inhibitory effect on plant growth at a range of 10-6 M

to 10-4 M (Fig. 1C). In contrast, the same concentrations of MeJA significantly inhibited

nodulation in har1-4. Since the growth of har1-4 was shown to be strongly inhibited by

hyper-nodulation, reduced nodulation might mask the growth defects by MeJA. We also

measured the contents of total chlorophyll after MeJA treatment. The application of

MeJA to shoots of wild-type plants reduced the chlorophyll content in a dose dependent

manner. MeJA ranging from 10-6 M to 10-5 M had apparently no effect in har1-4 (Fig.

1D) but significantly suppressed nodulation. These results suggest that nodule

suppression by MeJA may not be a secondary effect due to plant growth inhibition and

pigment degradation.

See Fig. 2

See Fig. 3

In order to define the stage of nodulation that was blocked by shoot-sprayed

MeJA, wild-type seedlings were inoculated with M. loti NZP2235 carrying the lacZ gene.

In wild-type plants without MeJA treatment, root hair curlings with infection foci

(bacterial colonization), infection threads and nodule primordia illuminated by blue

staining were found 5 days after inoculation (Fig. 3A and B). When MeJA was applied

at 10-4 M, root hair curling, infection threads and nodule primordia formation were

significantly reduced (Fig. 3C). Notably, the application of MeJA at 10-3 M almost

entirely blocked root hair deformation and curling. These results indicate that



Dow

nloaded from


shoot-applied MeJA inhibits early stages of bacterial infection as well as nodule

initiation. NIN encodes a putative transcriptional regulator required for infection thread

formation and inception of the nodule primordia. NIN is also known as one of the early

nodulin genes rapidly induced in response to Nod factors. The effects of MeJA

application on the expression of NIN after M. loti inoculation were examined (Fig. 4). In

our experimental conditions, NIN expression was highly induced at 14 hours after M. loti

inoculation in mock-treatment plants. Application of MeJA at 10-4 M reduced the

transcript level of NIN by 50% up to 40 hours following inoculation, and at 10-3 M

reduced the level by 15% in the same period. At 72 hours after inoculation, the

expression of NIN was transiently suppressed in the roots of mock-treatment plants

possibly by the action of AUT. The transcript level of NIN was fully recovered at 135

hours after inoculation, whereas, MeJA at 10-3 M still suppressed the NIN expression.

These data suggest that the inhibition of infection and nodule formation by MeJA occurs

upstream of the induction of NIN transcripts.

See Fig. 4

The lateral root is a postembryonic organ that develops endogenously, like the

root nodules. In the absence of rhizobia, har1 develops short primary roots with an

increased number of lateral roots (Szczyglowski et al. 1998, Wopereis et al. 2000,

Kawaguchi et al. 2002). Under our growth conditions, har1-4 plants formed slightly

more lateral roots than the wild-type 20 days after sowing (Fig. 5A and B). The

exogenous addition of MeJA to the shoots reduced the number of lateral roots in a dose

dependent manner in both the wild-type and har1-4 plants. Depending on the increase in

MeJA concentration, the growth of primary roots was also inhibited (Fig. 5C). The

growth of the primary root in wild-type plants was more sensitive to MeJA than har1-4,

whereas the formation of lateral roots in har1-4 was more sensitive to MeJA than

wild-type plants. Interestingly, the application of MeJA at 10-4 M reduced the number of

lateral roots by 50% whereas only a 10% reduction was found in the growth of primary

roots of har1-4 plants. These results indicate that shoot-applied MeJA does not recover

the short primary root phenotype of har1-4, but rather that increased lateral root

formation is restored.

See Fig. 5

On the basis of schematic similarity among SAR, ISR and AUT signaling, we



Dow

nloaded from


hypothesized that MeSA or MeJA may be involved in the systemic regulation of

nodulation. Paying attention to a current model in which the AUT signal is produced in

the shoots and then transmitted to the roots, we applied these substances to the aerial

portion of plants. As a result, MeJA, but not MeSA, exhibited a strong inhibitory effect

on nodulation. The effect could be observed even in the har1 hyper-nodulating mutant.

In addition, MeJA also inhibited lateral root initiation. These findings indicate that

HAR1 may possibly mediate the systemic regulation of nodule and lateral root

development via activation of the production of endogenous JAs in the shoots. Since

JAs have a vital role in ISR and systemic wound signaling to suppress subsequent

invasion, it is possible that JA and/or its derivatives act as an AUT signal.

One way to examine this hypothesis is to compare endogenous JAs between the

wild-type and the har1 mutant during the rhizobial infection process. It should be noted,

however, that the analysis of endogenous JA and ET levels in the leaves of

ISR-expressing plants revealed no changes in the production of these signal molecules

(Pieterse et al. 2000). In addition, Verhagen et al. surveyed the transcriptional response

of over 8,000 Arabidopsis genes none of which showed an altered expression pattern in

the leaves of ISR-induced plants (Verhagen et al. 2004). Therefore, we consider that

isolation of JA-deficient and -insensitive mutants and/or treatment of wild-type plants

with a JA-biosynthetic inhibitor that was developed recently would be promising way to

investigate involvement of JA signaling in nodulation and ISR studies. Finally, it should

be noted that the effect of JA on nodulation contrasts with that on tuber formation in

potato, which is positively regulated by JA-derivatives such as tuberonic acid and its

glucosides (Koda et al. 1988; Yoshihara et al. 1989).

Materials and Methods In our all experiments, surface-sterilized seeds of L. japonicus B-129 Gifu and

har1-4 were sown into sterile plastic growth boxes with sterilized? vermiculite moistened

with liquid B&D medium with or without 0.5 mM KNO3. All plants were grown in a

Biotron LH-100 (Nihon Ika Co., Ltd., Japan) under a 16-h light (100 uEm-1s-2)/8-h dark

cycle at 23ûC. Rhizobia inoculation was performed as previously described (Nishimura

et al. 2002). For treatments, one ml of MeJA (Wako, Japan) or MeSA (Wako, Japan)

diluted in 10% ethanol was sprayed to shoots at indicated concentrations. Chlorophyll

content was quantified by the method of Kirk and Allen (1965). Quantification of



Dow

nloaded from


infection events was examined according to the method of Wopereis et al. (2000).

Total RNAs were isolated using RNeasy Plant Mini Kit (Qiagen, Japan).

Following DNase I treatment, reverse transcription was carried out with QuantiTect

Reverse Transcription Kit (Qiagen, Japan). Semi- quantitative PCR was performed on

an ABI PRISM® 7000 Sequence Detection System (Applied Biosystems) using

QuantiTect� SYBR® green PCR kit (Qiagen) to amplify the target transcripts from

diluted cDNA. Sample volumes were normalized for equal amplification of DNA

fragments with primers specific for ATP synthase gene (AW719841). It was reported

that ATP synthase has a constitutive expression profile (Radutoiu et al. 2003). PCR

cycling conditions comprised an initial denaturation step at 95ûC for 15 min followed by

40 cycles at 94ûC for 15 s, 60ûC for 30 s, and 72ûC for 45 s. The primers used for

transcript amplification were: LjATPsyn-F, 5'- ACATGCTTGCACCATACCAA -3';

LjATPsyn-F, 5'- TCCCCAACTCCAGCAAATAC -3'; LjNIN1-F, 5'-

CAATGCTCTTGATCAGGCTGTTGA -3'; LjNIN1-R, 5'-

GAGTGCTAATGGCAAATTGTGTGTC -3'. Melting curve analysis was used to

determine their identity.

Acknowledgments We thank Yuko Ohashi and Shigemi Seo for helpful advice; Hiroshi Kouchi

and Asuka Kuwabara for advice and comments on the manuscript. This work was

carried out with support by the Core Research for Evolutional Science and Technology

(CREST) fund, Reserch Fellowships from the Japan Society for the Promotion of Science

for Young Scientists, and the Special Coordination Funds for Promoting Science and

Technology from the Ministry of Education, Culture, Sports, Science and Technology,

Japan.

References

Caetano-Anolles, G. and Gresshoff, P.M. (1991) Plant genetic control of nodulation. Annu.

Rev. Microbiol. 45: 345-382.

Durrant, W.E. and Dong, X. (2004) Systemic acquired resistance. Annu. Rev. Phytopathol.

42: 185-209.



Dow

nloaded from


Kawaguchi, M., Imaizumi-anraku, H., Koiwa, H., Niwa, S., Ikuta, A., Syono, K. and

Akao, S. (2002) Root, root hair, and symbiotic mutants of the model legume Lotus

japonicus. MPMI 15: 17-26.

Kirk, J.T., Allen, R.L. (1965) Dependence of chloroplast pigment synthesis on protein

synthesis: effect of actidione. Biochem. Biophys. Res. Commun. 21: 523-530.

Krusell, L., Madsen, L.H., Sato, S., Aubert, G., Genua, A., Szczyglowski, K., Duc, G.,

Kaneko, T., Tabata, S., de Bruijn, F., Pajuelo, E., Sandal, N. and Stougaard, J. (2002)

Shoot control of root development and nodulation is mediated by a receptor-like kinase.

Nature 420: 422-426.

Koda, Y., Omer, E.-S.A., Yoshihara, T. Shibata, H., Sakamura, S. and Okazawa, Y.

(1988) Isolation of a specific tuber-inducing substance from potato leaves. Plant Cell

Physiol. 29: 1047-1051.

Kosslak, R.M. and Bohlool, B.B. (1984) Suppression of nodule development of one side

of a split root system of soybeans caused by prior inoculation of the other side. Plant

Physiol. 75: 125-130.

Lawton, K., Weymann, K., Friedrich, L., Vernooij, B., Uknes, S. and Ryals, J. (1995)

Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene.

MPMI 8: 863-870.

Lohar, D.P. and Bird, D.M. (2003) Lotus japonicus: A new model to study Root-Parasitic

Nematodes. Plant Cell Physiol. 44: 1176-1184.

Malamy, J. and Klessig, D.F. (1992) Salicylic acid and plant disease resistance. Plant J. 2:

643-654.

Meixner, C., Ludwig-Muller, J., Miersch, O., Gresshoff, P.M., Staehelin, C. and

Vierheilig, H. (2005) Planta: Online published only at on Sept. 1, 2005



Dow

nloaded from


Nishimura, R., Hayashi, M., Wu, G.-J., Kouchi, H., Imaizumi-Anraku, H., Murakami, Y.,

Kawasaki, S., Akao, S., Ohmori, M., Nagasawa, M., Harada, K. and Kawaguchi, M.

(2002) HAR1 mediates systemic regulation of symbiotic organ development. Nature 420:

426-429.

Penmetsa, R.V. and Cook, D.R. (1997) A legume ethylene-insensitive mutant

hyperinfected by its rhizobial symbiont. Science 275: 527-530.

Penmetsa, R.V. Frugoli, J.A., Smith, L.S., Long, S.L. and Cook, D.R. (2003) Dual genetic

pathway controlling nodule number in Medicago truncatula. Plant Physiol. 131:

998-1008.

Pieterse, C.M.J., van Pelt, J.A., Ton, J., Parchmann, S., Mueller, M.J., Budhala, A.J., M é

traux, J.P. and van Loon, L.C. (2000) Rhizobacteria-mediated induced systemic

resistance (ISR) in Arabidopsis requires sensitivity to jasmonate and ethylene but is not

accompanied by an increase in their production. Physiol. Mol. Plant Pathol. 57: 123-134.

Pieterse, C.M.J., van Wees, S.C.M., Ton, J., van Pelt, J.A. and van Loon, L.C. (2002)

Signaling in rhizobacteria-induced systemic resistance in Arabidopsis thaliana. Plant

Biol. 4: 535-544.

Radutoiu, S., Madsen, L.H., Madsen, E.B., Felle, H.H., Umehara, Y., Grenlund, M., Sato,

S., Nakamura, Y., Tabata, S., Sandal, N. and Stougaard, J. (2003) Plant recognition of

symbiotic bacteria requires two LysM receptor-like kinases. Nature 425: 585-592.

Searle, I.R., Men, A.E., Laniya, T.S., Buzas, D.M., Iturbe-Ormaetxe, I., Carroll, B.J. and

Gresshoff, P.M. (2003) Long-distance signaling in nodulation directed by a

CLAVATA1-like receptor kinase. Science 299: 109-112.

Solaiman, M.Z., Senoo, K., Kawaguchi, M., Imaizumi-Anraku, H., Akao, S., Tanaka, A.

and Obata, H. (2000) Characterization of mycorrhizas formed by Glomus sp. on root of

hypernodulating mutants of Lotus japonicus. J. Plant Res.: 113: 443-448.



Dow

nloaded from


Staswick, P.E., Su, W. and Howell, S.H. (1992) Methyl jasmonate inhibition of root

growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant.

PNAS 89: 6837-6840.

Szczyglowski, K., Shaw, R.S., Wopereis, J., Copeland, S., Hamburger, D., Kasiborski, B.,

Dazzo, F.B. and de Bruijn, F.J. (1998) Nodule organogenesis and symbiotic mutants of

the model legume Lotus japonicus. MPMI 11: 684-697.

Ton, J., de Vos, M., Robben, C., Buchala, A.J., M é traux, J.-P., van Loon, L.C. and

Pieterse, C.M.J. (2002) Characterisation of Arabidopsis enhanced disease susceptibility

mutants that are affected in systemically induced resistance. Plant J. 29: 11-29.

van Loon, L.C., Bakker, P.A. and Pieterse, C.M.J. (1998) Systemic resistance induced by

rhizosphere bacteria. Annu. Rev. Phytopathol. 36: 453-483.

Verhagen, B.W.M., Glazebrook, J., Zhu, T., Chang, H.-S., van Loon, L.C. and Pieterse,

C.M.J. (2004) The transcriptome of rhizobacteria-induced systemic resistance in

Arabidopsis. MPMI 17; 895-908.

Wopereis, J., Pajuelo, E., Dazzo, F.B., Jiang, Q., Gresshoff, P.M., de Bruijn, F.J.,

Stougaard, J. and Szczyglowski, K. (2000) Short root mutant of Lotus japonicus with a

dramatically altered symbiotic phenotype. Plant J. 23: 97-114.

Yoshihara, T., Omer, E.-L.A., Koshino, H., Sakamura, S., Kikuta, Y. and Koda, Y.

(1989) Structure of a tuber-inducing stimulus from potato leaves (Solanum tuberosum

L.). Agric. Biol. Chem. 53: 2835-2837.



Dow

nloaded from


Fig. 1 Effect of MeJA on nodulation in Lotus japonicus. (A) Wild-type Gifu and

har1-4 plants were inoculated with M. loti MAFF30-3099 and then sprayed with MeJA or

MeSA on the aerial portion of seedlings 2 and 6 days after inoculation. (B) MeJA effect

on nodulation. MeJA was sprayed 1 day before, and 1 and 6 days after inoculation.

Fresh weight (C) and the chlorophyll content (D) of plants shown in (B) were determined.

Plants were harvested at 12 days after inoculation. Values shown represent the mean ±

standard deviation (SD) of at least 10 seedlings. Open bar: wild-type, solid bar: har1-4.

Fig. 2 MeJA suppressed the hyper-nodulation phenotype of har1-4 roots. Wild-type

(A) and har1-4 (B and C) plants were inoculated with M. loti NZP2235 carrying the lacZ

gene. The aerial portion of these plants was sprayed with mock (A and B) or 10-4M

MeJA 1, 5 and 8 days after inoculation. Plants were harvested 10 days after inoculation.

Bar: 1cm.

Fig. 3 MeJA effect on early nodulation response. Wild-type plants were inoculated

with M. loti NZP2235 carrying the lacZ gene and shortly after, aerial portions of seedlings

were sprayed with MeJA. Plants were harvested 5 days after inoculation. The number

of curled root hairs (A), infection threads (B, arrowhead) and nodule primordia (B) were

counted (C). Bar: 50 μm in (A) and 200 μm in (B). Hac: root hair curling, IF:

infection thread, NP: nodule primordia. Values shown represent the mean ± SD of at

least 10 seedlings.

Fig. 4 Effect of MeJA on expression of NIN. Wild-type plants were sprayed with mock

(open bar), 10-4 M (solid bar) or 10-3 M (shaded bar) of MeJA 24 hours prior to and 0 and

72 hours after M. loti inoculation. Results are shown as fold increase compared to roots

at time zero. Values shown represent the mean ± SD of three experiments.

Fig. 5 MeJA effect on lateral root formation under non-symbiotic conditions. Plants

were grown in B&D medium containing 0.5 mM KNO3 for twenty days, and then

harvested. MeJA was sprayed 7, 12 and 17 days after germination. Values shown

represent the mean ± SD of at least 10 seedlings. (A) Photograph of MeJA-treated roots.

Bar: 1 cm (B) Effect of MeJA on lateral root formation. (C) Effect of MeJA on primary



Dow

nloaded from


root growth. Open bar: wild-type, solid bar: har1-4.



Dow

nloaded from




Dow

nloaded from




Dow

nloaded from




Dow

nloaded from




Dow

nloaded from




Dow

nloaded from


Documents

Shoot-applied MeJA Suppresses Root Nodulation in Lotus