Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

© 2016. Published by The Company of Biologists Ltd.

Title

Skb5, an SH3 adaptor protein, regulates Pmk1 MAPK signaling by controlling the intracellular

localization of Mkh1 MAPKKK

Authors

Yuki Kanda1, Ryosuke Satoh1, Saki Matsumoto1, Chisato Ikeda1, Natsumi Inutsuka1, Kanako

Hagihara1, Sumio Matzno 2, Sho Tsujimoto1, Ayako Kita1, Reiko Sugiura1

Affiliation

1. Laboratory of Molecular Pharmacogenomics, School of Pharmaceutical Sciences, Kinki

University

2. Division of Pharmaceutical Education, Faculty of Pharmacy

Corresponding author’s email address

sugiurar@phar.kindai.ac.jp

Key words

Schizosaccharomyces pombe, PKC, MAPKK kinase, Skb5, SH3 adaptor protein

JCS Advance Online Article. Posted on 22 July 2016

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Summary statement

Spatial regulation of MAPKKK remains poorly characterized in fission yeast. Skb5, an SH3

adaptor was shown to attenuate Pmk1 MAPK signaling by regulating subcellular distribution

of Mkh1 MAPKKK.

Abstract

The MAPK cascade is a highly conserved signaling module composed of

MAPK/MAPKK/MAPKKK. MAPKKK Mkh1 is an initiating kinase in Pmk1 MAPK

signaling, which regulates cell integrity in fission yeast. Our genetic screen for regulators of

Pmk1 signaling identified Skb5 (Shk1 kinase binding protein 5), an SH3 domain-containing

adaptor protein. Here, we showed that Skb5 serves as an inhibitor of Pmk1 MAPK signaling

activation by downregulating Mkh1 localization to cell tips via its interaction with the SH3

domain. Consistently, the Mkh13PA mutant protein, with impaired Skb5 binding, remained in

the cell tips, even when Skb5 was overproduced. Intriguingly, Skb5 needs Mkh1 to localize

to the growing ends as Mkh1 deletion and disruption of Mkh1 binding impairs Skb5

localization. Deletion of Pck2, an upstream activator of Mkh1, impaired the cell tip localization

of Mkh1 and Skb5 as well as Mkh1/Skb5 interaction. Interestingly, both Pck2 and Mkh1

localized to the cell tips at the G1/S phase, which coincided with Pmk1 MAPK activation.

Altogether, Mkh1 localization to cell tips is important for transmitting upstream signaling to

Pmk1 and Skb5 spatially regulates this process.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Introduction

The MAPK signaling cascade is a highly conserved signaling module, which plays a central

role in various physiological processes, including cell proliferation, gene expression,

differentiation and cell survival (Nishida and Gotoh, 1993; Marshall, 1994; Her-skowitz, 1995;

Munshi and Ramesh, 2013). It is also conserved in lower eukaryotes such as yeasts and plays

a key role in cell wall biosynthesis and stress responses (Levin, 2005; Park and Bi, 2007; Perez

and Cansado, 2010). The abnormal activation of MAPK signaling leads to deregulated

phosphorylation events that play a role in tumorigenesis (Dhillon and Kolch, 2007; Santarpia

et al., 2012). Therefore, understanding the mechanisms of negative regulation of MAPK and

its application for drug discovery which could target the Raf/MEK/ERK pathway is important

for cancer therapeutics.

The MAPK pathway transmits its signal through the sequential phosphorylation of

MAPK kinase kinase to MAPK kinase to MAPK (Zheng and Guan, 1993; Gardner et al., 1994).

Consistently, protein phosphatases such as DUSP and PP2C which dephosphorylate MAPKs

or upstream kinases play key roles in the negative regulation of these activation processes

(Jeffrey et al., 2007; Chang et al., 2015). MAPKKK lies at the apex of the MAPK pathway

kinase module and plays a critical role in transmitting upstream signaling to MAPKK and

MAPK. MAPKKK has been known to be inactivated through dephosphorylation by PP5 (von

Kriegsheim et al., 2006; Shah et al., 2015), and recent studies on RKIP (Kam et al., 2000; Park

et al., 2006) revealed a novel regulatory mechanism of MAPKKK regulation by an adaptor

protein and its influence on MAPK activation. However, relatively little is known on the

subcellular localization of MAPKKK and its relevance to MAPK activation.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

We have been studying the Pmk1 MAPK signaling module, composed of Mkh1

MAPKKK, Pek1 MAPKK and Pmk1 MAPK, a key regulator of cell wall integrity in fission

yeast (Toda et al., 1996; Sugiura et al., 1999; Sengar et al., 2007). Our genetic screen for

negative regulators of Pmk1 MAPK signaling identified phosphatases (Sugiura et al., 1998)

that inactivate MAPK signaling, including the Pmp1 dual-specificity phosphatase, and the

PP2C serine/threonine protein phosphatase (Takada et al., 2007) in addition to the Rnc1 RNA-

binding protein, (Sugiura et al., 2003) and the cell surface protein Ecm33 (Takada et al., 2010).

Our genetic screen also identified components and activating regulators of Pmk1 MAPK,

including small GTPases Rho1, Rho2, Rho4 and Rho5, and Pck2 protein kinase C, by isolating

mutants of the farnesyl transferase Cpp1 and geranylgeranyl transferase Cwg2 (Ma et al., 2006;

Doi et al., 2015). Here, we have established a novel genetic screen for negative regulators of

Pck2-mediated MAPK signaling activation by utilizing the cell growth defect induced by Pck2

overproduction and its recovery by Pmk1 signaling inhibition (Takada et al., 2007). We

identified Skb5 (Shk1 kinase binding protein 5), an SH3 adaptor protein, which has been

isolated as a binding partner for the p21-activated kinase (PAK) homolog Shk1 in fission yeast.

Further, Skb5 has been shown to directly activate Shk1 kinase activity (Yang et al., 1999). We

showed that Skb5 inhibits Pck2-mediated MAPK signaling hyperactivation by interacting with

Mkh1. Notably, Mkh1 was localized to the cell tips at the G1/S phase in addition to the

previously described localization of the medial region (Madrid et al., 2006), and importantly,

the cell tip localization of MAPKKK was regulated by Skb5/Mkh1 interaction. Pck2 deletion

impaired Mkh1/Skb5 localization at cell tips as well as the Mkh1/Skb5 interaction. Possible

roles of Skb5 as a spatial regulator of MAPKKK and the physiological significance of

MAPKKK localization to cell tips in terms of MAPK signaling activation will be discussed.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Results

Skb5 overproduction negatively regulates Pck2/Pmk1 MAPK signaling

To identify novel regulators of PKC/MAPK signaling in fission yeast, we established a genetic

screen. This screen was based on previous findings from our lab (Takada et al., 2007) and

others (Carnero et al., 2000) that the overexpression of Pck2 in Wild-Type (WT) cells resulted

in severe growth defects, whereas the inhibition or deletion of the components of the Pmk1

MAPK pathway can reverse the growth defects. Consistently, the overproduction of the pmp1+

gene that we previously identified as a dual-specificity phosphatase, which dephosphorylates

and inactivates Pmk1 MAPK (Sugiura et al., 1998) clearly suppressed the growth defect

induced by Pck2 overproduction (Fig. 1A), indicating that this screen can reveal novel genes

involved in the negative regulation of PKC/MAPK signaling. We therefore screened for genes

that when overexpressed can suppress the growth defect induced by Pck2 overproduction.

Consequently, two classes of genes have been identified, and sequence analysis revealed that

skb5+ encoding an SH3-domain containing adaptor protein, and pmp1+ were included. As

shown in Fig. 1A, the overexpression of skb5+ and pmp1+ suppressed the growth defect

induced by Pck2 overproduction in the absence of thiamine (Promoter ON), whereas cells

harboring the control vector alone (+pck2+ +vector) failed to grow in the absence of thiamine.

Because Rho2 acts upstream of Pck2/Pmk1 MAPK signaling, and the overexpression

of Rho2 is toxic to WT cells, but not to deletion cells of the components of the Pmk1 MAPK

pathway (Ma et al., 2006), the effects of Skb5 and Pmp1 overexpression on the growth of Rho2

overproducing cells were also examined. As shown in Fig. 1B, overexpression of Rho2 was

toxic to the WT cells (Promoter ON; +rho2+ +vector), but the overexpression of the skb5+ and

pmp1+ significantly reduced the toxicity of Rho2 overproduction, indicating that Skb5, similar

to Pmp1, is involved in the negative regulation of Rho2/Pck2-mediated MAPK signaling

downstream of Pck2.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

To further delineate the step at which Skb5 functions in Pmk1 MAPK signaling, we

examined the effect of skb5+ on the growth defect induced by Pek1DD, which encodes a

constitutively active MAPKK (Sugiura et al., 1999). As shown in Fig. 1C, the toxicity induced

by Pek1DD overproduction was suppressed by the expression of Pmp1, consistent with the

notion that Pmp1 dephosphorylates and inhibits Pmk1 MAPK (+pek1DD +pmp1+). In clear

contrast, the overexpression of the skb5+ gene failed to suppress the toxicity induced by Pek1DD,

indicating that Skb5, unlike Pmp1, could not reverse the hyperactivation induced by Pek1DD

overproduction. Thus, Skb5 is likely to inhibit MAPK signaling downstream of Pck2 and

upstream of Pek1.

If Skb5 serves as an inhibitor of Pmk1 MAPK signaling, then Skb5 deletion cells are

expected to exhibit phenotypes similar to those associated with Pmp1 deletion. As shown in

Figure 1D, Skb5 deletion induced hypersensitivity to 0.6 M MgCl2 as did Pmp1 deletion.

However, Skb5 deletion cells did not exhibit sensitivity to FK506, wherein the growth of Pmp1

deletion cells was significantly inhibited (Fig. 1D). We then examined the combined effect

of FK506 and MgCl2 on Skb5 and Pmp1 deletion cells. Our previous findings established

that the vic (viable in the presence of chloride ion) phenotype has been demonstrated as a strong

indicator of MAPK signaling inhibition (Ma et al., 2006; Doi et al., 2015). The results

showed that Skb5 and Pmp1 deletion cells failed to grow in the media containing 0.06 M MgCl2

and FK506, wherein the WT cells grew, indicating that Skb5 deletion induced a vic negative

phenotype (Fig. 1D). This finding is consistent with the notion that Skb5 inhibits Pmk1

MAPK signaling.

In order to confirm that the suppression of Pck2 overproduction by Skb5 was due to

its effect on Pmk1 MAPK activation, the effect of Skb5 overexpression on the phosphorylation

levels of Pmk1 MAPK was examined. For this, anti-phospho Pmk1 antibodies, which

recognize dually phosphorylated Pmk1, were utilized (Sugiura et al., 1998). As shown in Fig.

1E, Pck2 overproduction driven under the nmt1 promoter stimulated Pmk1 phosphorylation

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

without any environmental stimuli, whereas the co-expression of skb5+ significantly reduced

the phosphorylation levels of Pmk1 as compared with the cells harboring the control vector

alone, thus indicating that Skb5 is involved in the negative regulation of Pck2-mediated Pmk1

signaling. A negative control experiment with a pek1 null mutant cells showed that Pmk1

was not phosphorylated at all even when Pck2 was overexpressed (Supplementary Figure S1).

Skb5 down-regulates Pmk1 MAPK signaling independent of Ptc1

To obtain clues for the mechanisms underlying Pmk1 MAPK signaling suppression by Skb5,

we focused on the ability of Skb5 to bind to several components of the MAPK signaling

pathway. It has been reported that Skb5 binds to Mkh1 MAPKKK and Ptc1 MAPK phosphatase

(Stanger et al., 2012), and that both are involved in the regulation of Pmk1 MAPK signaling

(Sugiura et al, 1999, Takada et al., 2007). To investigate if this interaction is specific, the

interaction between Skb5 and several components of the Pmk1 MAPK pathway, including

Pmk1, Pek1 and Mkh1 was examined. Results clearly showed that Skb5 specifically interacted

with Mkh1 (Fig. 2A, GST-Skb5). Co-precipitation experiments with the unfused GST protein

did not detect Pmk1, Pek1 or Mkh1 in the pull-downs (Fig. 2A, GST).

As Ptc1 has also been shown to be involved in negative regulation of Pmk1 MAPK

(Takada et al., 2007), the Skb5 interaction with the dual-specificity MAPK phosphatase Pmp1

was also investigated. In this case, results showed that Skb5 interacted with Ptc1, but not with

Pmp1 (Fig. 2B, GST-Skb5). Co-precipitation experiments with the unfused GST protein did

not detect Pmp1 or Ptc1 (Fig. 2B, GST).

To know if the interactions between Skb5 and Mkh1 or Ptc1 are required for the

suppression of MAPK signaling, the vic phenotype was utilized. The WT cells failed to grow

in the presence of the calcineurin inhibitor FK506 and 0.12 M MgCl2, whereas cells deleted

for the components of the Pmk1 MAPK pathway were viable in the same media (Ma et al.,

2006). Consistently, cells overexpressing pmp1+ and skb5+ grew in the presence of FK506 and

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

0.12 M MgCl2, whereas the cells harboring the control vector alone failed to grow (Fig. 2C,

upper panel). Next, the effect of the overexpression of pmp1+ and skb5+ was examined in cells

deleted for Ptc1. Notably, the overproduction of Skb5 and Pmp1, fully suppressed the vic

phenotype of the Ptc1 deletion cells, indicating that Skb5 exerted its ability to suppress MAPK

signaling even in the absence of Ptc1 (Fig. 2C, lower panel). Furthermore, Skb5 overproduction

inhibited the hyper-phosphorylation of Pmk1 induced by the cell-wall-damaging agent

micafungin, both in the WT and in the Ptc1 deletion cells (Fig. 2D), thus indicating that the

Skb5-Ptc1 interaction is not required for MAPK signaling suppression by Skb5.

Skb5 inhibits Pmk1 MAPK signaling via its binding to Mkh1

We next focused on the Skb5/Mkh1 interaction and its effect on Pmk1 MAPK, because the

above results strongly suggested the possibility that Skb5 exerted its suppression via its

interaction with Mkh1. Skb5 contains an SH3-domain and it has been reported that mutations

in the SH3 domain impair its interaction with binding partners (Stanger et al., 2012). This

prompted us to make a Skb5YF2A mutant wherein both the tyrosine (Y) 89 and phenylalanine

(F) 135 in the SH3 domain of the Skb5 protein, were mutagenized to alanine (A) (Fig. 3A). As

shown in Fig. 3B, the GST-Skb5YF2A mutant protein barely bound to GFP-Mkh1, whereas the

WT GST-Skb5 interacted with Mkh1 (Fig. 3B, left panel). Importantly, Skb5YF2A maintained

the ability to interact with Ptc1-GFP (Fig. 3B, right panel), indicating that the YF2A mutation

in Skb5 specifically abolished the Mkh1/Skb5 interaction. It should be noted that none of the

GST, GST-fused Skb5 or GST- Skb5YF2A protein bound to the GFP control vector (Fig. 3B).

Next, the effect of the Skb5YF2A mutant protein on the suppression of Pmk1 MAPK

signaling was examined. The overexpression of the mutant skb5YF2A cannot rescue the lethality

of over-expressing Pck2 (Fig. 3C). Similarly, the overexpression of skb5YF2A resulted in the

failure to induce the vic phenotype as did the WT skb5+ (Fig. 3D). As expected, the

overexpression of skb5YF2A did not reduce the Pmk1 phosphorylation levels induced by

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

micafungin as did the WT skb5+ (Fig. 3E). Thus, the ability of Skb5 to interact with Mkh1 is

required for Skb5 to inhibit Pmk1 signaling.

Skb5 affects Mkh1 localization at cell tips

To explore how Skb5 overproduction inhibits Pmk1 signaling by interacting with Mkh1, the

endogenous Mkh1 protein tagged with GFP was visualized and the effect of Skb5

overproduction was examined. It has been reported that Mkh1 localizes at the cytoplasm and

at the septum during cell division (Madrid et al., 2006). Here, the endogenous Mkh1 protein

fused to GFP was localized to the cell tips in addition to the previously described localization

(Fig. 4A, +vector, arrows), (Materials and Methods). Notably, the overproduction of the skb5+

markedly reduced the Mkh1 fluorescence at the cell tips (Fig. 4A, +skb5+, arrows, promoter

ON). The quantification of the cells expressing the endogenous Mkh1-GFP localization at the

cell tips showed that less than 10% of the Skb5 overproducing cells exhibited Mkh1

localization to the cell tips as compared with the cells harboring a control vector alone (Fig.

4A, lower panel, promoter ON). Next, the effect of the overproduction of the skb5YF2A mutant

protein on the Mkh1 localization was investigated, and the skb5YF2A overproduction barely

reduced the Mkh1 localization to the cell tips (Fig. 4A, +skb5 YF2A, arrows, promoter ON), thus

indicating that the Mkh1 localization change was induced largely upon Skb5 binding to Mkh1

through the SH3 domain.

Furthermore, the impact of the Skb5/Mkh1 interaction on Mkh1 localization was

examined by investigating the effect of the Mkh1 mutation which would disrupt Skb5 binding.

It has been reported that the PXXP sequence is a preferred binding signature for the SH3

domains (Stanger et al., 2012), and that the mutation in the proline (P) residues in the budding

yeast Bck1 MAPKKK, markedly impaired its binding with the Nbp2 SH3 domain protein

(Stanger et al., 2012). We then searched for the PXXP motif in Mkh1, and three proline residues

544, 546 and 547 were mutagenized into alanines (A) to make the Mkh13PA protein (Fig. 4B).

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

The resultant Mkh13PA protein markedly reduced its affinity for Skb5, whereas it

maintained the ability to interact with Pek1 and Pck2 (Fig. 4C), indicating that the Mkh13PA

mutation specifically impaired the binding between Mkh1 and Skb5. It should be noted that

none of the GST, GST-Skb5 GST-Pek1 or GST-Pck2 protein bound to the GFP control vector

and the unfused GST protein did not pulldown GFP-Mkh1 or GFP- Mkh13PA (Fig. 4C).

In order to evaluate the physiological significance of the Skb5-Mkh1 interaction, the

Mkh13PA mutation was introduced into the chromosomal mkh1 locus. The resultant Mkh13PA-

GFP protein also localized to the cytosol with intense fluorescence at the cell tips (Fig. 4D

+vector). Notably, however, the skb5+ overexpression failed to reduce the Mkh13PA localization

to the cell tips (Fig. 4D, +skb5+), which was clearly distinct from the observations with the

endogenous Mkh1-GFP protein shown in Fig. 4A. The quantification of the cells also

confirmed the above results (Fig. 4D, lower panel). Thus, the interaction between Skb5 and

Mkh1 appears to play a key role in Mkh1 localization to cell tips.

Skb5 localization was also affected by Mkh1 interaction

Next, the subcellular distribution of endogenous Skb5 tagged with GFP was analyzed. The

fluorescence of the Skb5-GFP protein expressed from its endogenous loci was vague, but

diffusedly observed throughout the cytoplasm, and less than 20% of the cells exhibited cell-

end localization (Fig. 5A, endogenous Skb5WT-GFP, arrows). The fluorescence of exogenously

expressed GFP-Skb5 visualized the Skb5 localization around the cell periphery, and

approximately half of the cells exhibited Skb5 cell-end localization (Fig. 5A, GFP-Skb5WT

overproduction, arrows). The physiological significance of the Skb5-Mkh1 interaction was

examined by introducing the YF2A mutation to the chromosomal skb5 gene. The endogenous

Skb5YF2A-GFP protein also localized to the cell periphery (Fig. 5A, endogenous Skb5YF2A-

GFP), although the frequency of cell tip localization was significantly reduced (33.3%) as

compared with the WT endogenous Skb5 (Skb5WT). Quantification revealed that more than

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

40% of the cells exhibited Skb5 cell-end localization when Skb5 was exogenously expressed

as compared with less than 20% with the endogenous Skb5 (Fig. 5A, lower panel). Notably,

however, when the GFP-Skb5YF2A mutant protein was exogenously expressed, it barely

visualized the peripheral and cell-end localization, and the frequency of the cells exhibiting

cell-end localization decreased markedly (Fig. 5A, Skb5YF2A overproduction).

In order to apprehend if Mkh1 plays a role in Skb5 localization, the effect of Mkh1

deletion on the endogenous Skb5 localization was examined. Notably, Mkh1 deletion

significantly reduced the Skb5 localization to the growing ends, and approximately only 20%

of the cells exhibited cell-end localization (Fig. 5B). Thus, Skb5 can localize to cell ends at

least partly via its interaction with Mkh1.

Skb5 deletion increased Mkh1 cell-tip localization and Pmk1 phosphorylation

To investigate if Mkh1/Skb5 interaction is important for downstream Pmk1 MAPK signaling

activation, Skb5 deletion cells, Skb5YF2A mutant strains and Mkh13PA mutant strains were

studied to see if these strains exhibit altered Pmk1 phosphorylation levels. For this purpose,

Skb5YF2A mutant and Mkh13PA mutant strains were first examined for their phenotypes in terms

of the vic phenotypes. As shown in Figure 1D and in Figure 6A, the Skb5 deletion cells failed

to grow in the presence of 0.06 M MgCl2 and FK506, wherein the WT cells grew well,

indicating that the skb5 null cells displayed vic negative phenotypes. Both the Skb5YF2A

mutant and the Mkh13PA mutant cells exhibited the vic negative phenotypes similar to that

observed in the Skb5 deletion cells (Fig. 6A), consistent with the hypothesis that Skb5/Mkh1

interaction is important for Pmk1 MAPK signaling.

Next, Skb5 deletion cells, Skb5YF2A mutant and Mkh13PA mutant cells were

investigated for Pmk1 MAPK phosphorylation before and after the micafungin treatment. In

the Skb5 deletion cells, Pmk1 MAPK phosphorylation levels were significantly higher as

compared with the WT cells after the micafungin treatment (Fig. 6B). It should be noted that

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

the basal Pmk1 activation between the Skb5 deletion and WT type cells was indiscernible (Fig.

6B). In contrast, the Skb5YF2A mutant and Mkh13PA mutant cells exhibited similar Pmk1

phosphorylation levels both before and after micafungin treatment as compared with the WT

cells (Fig. 6C).

In order to see if the difference of Pmk1 phosphorylation levels in the mutant strains

resulted from the difference in the frequencies of the Mkh1 cell tip localization, the endogenous

Mkh1 protein was visualized in the WT and Skb5 deletion cells. The endogenous Mkh13PA

mutant protein was also visualized and the fluorescence of the cell tip-localized Mkh1 in these

cells was quantified. Results showed that Skb5 deletion significantly increased Mkh1 cell-

tip localization as compared with the WT cells (Fig. 6D). This is consistent with its role as a

negative regulator of MAPK signaling via its interaction with Mkh1. In contrast, the Mkh13PA

mutation did not significantly affect Mkh1 cell-tip localization (Fig. 6D). Thus, although the

biochemical studies showed that Mkh13PA mutation impairs Mkh1/Skb5 binding (Fig. 4C), the

Mkh13PA mutant protein may still maintain its biological ability to bind to Skb5, wherein Skb5

deletion totally abolished the Skb5/Mkh1 interaction.

Pck2 influences Mkh1/Skb5 localization to the cell tips and their interaction

What are the upstream factors which would affect the Mkh1/Skb5 localization at the cell tips?

As candidates, we investigated the effect of the deletion of the small G protein Rho2 and Pck2,

both of which act upstream of Mkh1. The effects of the deletion of the Ras1 small G protein,

which acts upstream of the Byr2-Byr1-Spk1 MAPK pathway, was also investigated. Notably,

the localization of the endogenous Mkh1 protein at the cell ends was markedly abrogated in

Pck2 deletion, but not in Ras1 or Rho2 deletion cells (Fig. 7A). Similar effects were obtained

with endogenous Skb5 localization, as deletion of Pck2 specifically abrogated Skb5 cell-end

localization (Fig. 7B). Quantification revealed that only half of the Pck2 deletion cells exhibited

cell-end localization of Mkh1 and only 20% of the cells exhibited cell-end localization of Skb5

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

as compared with that in the WT cells (Fig. 7A, 7B).

This prompted us to further study the effect of Pck2 deletion on the Mkh1/Skb5

interaction. GST pull-down experiments showed that Pck2 deletion significantly impaired the

Mkh1/Skb5 interaction, as the GFP-Mkh1 protein was barely detectable in the GST pull-down

extracted from Pck2 null cells harboring GST-Skb5 (Fig. 7C). Quantification showed that the

interaction between Mkh1 and Skb5 was about 50% in Pck2 deletion cells as compared with

that in the WT cells (Fig. 7C).

Finally, the effect of Skb5 overproduction on the endogenous Pck2 localization was

examined, and the results showed that Pck2 was localized to the cell ends irrespective of Skb5

overproduction (Fig. 7D). These data are consistent with the above findings that Skb5 does not

interact with Pck2 and that Skb5 specifically impaired Mkh1 localization at the cell ends.

Pck2 and Mkh1 localized to the cell tips in the G1/S phase of the cell cycle

In order to reveal the role of Mkh1 at cell tips and the significance of Pck2-Mkh1-Skb5

localization at cell tips, cell cycle synchronization experiments were performed by using the

cell cycle mutant cdc25-22 expressing the endogenous Mkh1-GFP protein from the native

promoter. Cells from this mutant were grown to the log phase at 25°C, shifted to 37°C for 4

hr to synchronize the cells in the G2 phase, and then shifted back to 25°C. As shown in Figure

8A, the frequency of the Mkh1 cell tip localization oscillates as a function of the cell cycle,

reaching a maximum during the G1/S phase.

We also visualized the endogenous Pck2-GFP protein in the cdc25-22 mutant, and the

Pck2 protein expressed from its native promoter was similarly observed to be localized at the

cell tips during the G1/S phase of the cell cycle (Fig. 8B). It should be noted that in addition

to our findings, other researchers have shown changes in Pmk1 phosphorylation during the cell

cycle, reaching a maximum during the G1/S phase (Madrid et al., 2006; Satoh et al., 2009).

Collectively, Pck2/Mkh1 localization at the cell tips closely coincided with Pmk1 activation at

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

the G1/S phase, suggesting that the cell tip localization of the upstream kinases (Pck2/Mkh1)

could stimulate Pmk1 MAPK, which leads to the oscillation of MAPK activation during the

cell cycle.

Discussion

In this study, we utilized a forward genetic screen in fission yeast to identify molecules involved

in Pmk1 MAPK signaling inhibition. Mkh1 MAPKKK acts upstream of Pmk1 and plays a

pivotal role in MAPK activation. However, to date factors that influence Mkh1 localization

remain poorly characterized. Here, we identified Skb5 as a modulator of Pmk1 signaling and

showed that Skb5 affects Mkh1 localization at the cell tips via its interaction through the SH3

domain, thereby attenuating Pmk1 MAPK signaling.

Our genetic and biochemical experiments demonstrated that Skb5 inhibits Pmk1 MAPK

signaling at the level of Mkh1. Importantly, this data clearly showed that Ptc1, a previously

reported binding partner of Skb5 was not required for the Skb5-mediated inhibition of Pmk1

signaling. Moreover, the phosphorylation analysis of Pmk1 with the Skb5YF2A mutant protein,

with impaired binding ability with Mkh1, indicated that Skb5 inhibits Pmk1 MAPK signaling

by specifically interacting with Mkh1.

How can Skb5 overproduction affect intracellular localization of Mkh1 at the cell tips

and inhibit MAPK signaling?

Two lines of evidence suggested that Skb5 affects Mkh1 localization at the cell tips by

interacting with Mkh1 via its SH3 domain, which leads to Pmk1 signaling inhibition. First, the

overproduction of Skb5, but not that of Skb5YF2A specifically reduced Mkh1 localization at the

cell tips. In addition, the overproduction of Skb5, but not that of Skb5YF2A rescued Pck2-

induced cytotoxicity and inhibited Pmk1 MAPK activation. Second, the Mkh13PA mutant

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

protein, which specifically reduced its affinity for Skb5, was insensitive to Skb5

overproduction, and remained at the cell tips. This was further confirmed by the endogenous

Skb5WT and Skb5YF2A mutant alleles, which were integrated into the chromosomal skb5 locus.

More importantly, Skb5 deletion induced Mkh1 cell-tip localization and Pmk1 MAPK

phosphorylation levels. It should be noted that although the Skb5YF2A mutant alleles and the

Mkh13PA mutant alleles exhibited a vic negative phenotype, these mutant alleles did not exhibit

increased Pmk1 activation. Thus, although biochemical studies suggested that Mkh13PA and

Skb5YF2A mutations significantly impaired Skb5/Mkh1 binding, these proteins may still

maintain the ability to interact with the binding partners. Alternatively, there might exist as-

yet-unidentified factors, which would determine Mkh1 cell-tip localization.

What is the physiological significance of Mkh1 localization to the cell tips?

Previous studies in mammals reported that the Raf kinase (MAPKKK upstream of ERK) was

translocated from the cytoplasm to the plasma membrane through the binding with the

upstream GTP-bound Ras. This recruitment of Raf to the plasma membrane induces

conformational change of Raf, allowing its phosphorylation in the plasma membrane by several

kinases such as Src, PKC and AKT, resulting in the activation of the Raf kinase and

downstream MAPK signaling (Marais et al., 1995; Barnard et al., 1998; Hibino et al., 2011).

In our study, Pck2, a target of Rho small GTPases and an upstream activator of Mkh1,

which binds and activates Mkh1, also localizes to the cell tips. Moreover, Pck2 and Mkh1

localized to the cell tips at the G1/S phase of the cell cycle, coincident with Pmk1 MAPK

activation. Interestingly, Pck2 deletion impairs Mkh1 localization to the cell tips as well as

Mkh1/Skb5 interaction. These findings support the hypothesis that Mkh1 localization to the

cell tips is important for Mkh1 to efficiently receive and transmit the Pck2-mediated signaling

to the downstream signaling of Pek1 MAPKK and Pmk1 MAPK. In this regard, Pck2 may

stimulate Mkh1 localization to the cell tips thereby facilitating the signal transduction from the

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

upstream Rho small GTPases to Pmk1 MAPK through Mkh1. It is noteworthy that Pck2

deletion also abrogated Skb5 localization to the cell tips. Thus, it would be intriguing to

speculate if Pck2-mediated Mkh1 phosphorylation would enhance Mkh1 localization to the

cell tips as well as the Skb5/Mkh1 interaction. In line with this, the Skb5/Mkh1 interaction

also seems to be important for Skb5 cell-tip localization, based on the findings that Skb5, but

not Skb5YF2A, localized to the growing ends upon overproduction. Consistently, Mkh1 deletion

reduced Skb5 localization to the growing ends, suggesting that Skb5 needs Mkh1 to localize to

the growing ends and thereby affects Mkh1 localization at the cell tips. Thus, it is hypothesized

that Skb5 may recognize the cell-end-localized and presumably active form of Mkh1 via its

SH3 domain, and this interaction may recruit Skb5 to the cell tips.

Given that Skb5 plays a role as a negative regulator of MAPK signaling, Skb5 may

have a higher affinity to the cell-tip-localized and/or active form of Mkh1, thus raising the

possibility that activation of MAPKKK recruits its adaptor molecule thus making a negative

feedback loop system. Our observations that the Skb5YF2A mutation with impaired Mkh1

binding as well as Mkh1 deletion, markedly reduced Skb5 localization to the growing ends,

further support this hypothesis.

The additional question that arises is “What is the in vivo role of Skb5 in inhibiting

Mkh1 after its activation by Pck2?” Alternatively, does Skb5 serve to keep Mkh1 inactive

prior to recruitment to the tips? The evidence in favor of the latter possibility is the

observation that Skb5 deletion induced Mkh1 cell-tip localization. Thus, although Pmk1

phosphorylation levels may not have detected the effect of Skb5 deletion at the basal level, this

data suggests an in vivo role of Skb5 as a spatial regulator of Mkh1. However, as

hypothesized above, the Pck2-mediated MAPK activation signal induced Mkh1 cell-tip

localization and Mkh1/Skb5 interaction at the cell-tips, thus indicating that Skb5 may also play

a role in inhibiting Mkh1 after its activation by Pck2. In line with this view, Skb5 deletion

significantly stimulated Pmk1 phosphorylation after micafungin treatment. Thus, Skb5 may

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

be dually required for spatial regulation before and after the upstream Pck2 activation. Future

studies will be necessary to clarify the molecular mechanisms of Skb5-mediated inhibition of

the Pck2/Mkh1/Pmk1 MAPK signaling.

Based on a previous paper that Skb5 has been identified as an activator of the p21-

activated kinase (PAK) homolog Shk1, which belongs to the Cdc42 cascade and a paper

reporting a possible crosstalk between the Cdc42 pathway and the Pmk1 MAPK pathway, it

would be intriguing to investigate if Skb5 is also involved in the suppression of the Cdc42-

mediated signaling pathways (Merla and Johnson, 2001). This prompted us to examine the

effect of the skb5+ over-expression, and the results showed that Skb5 over-expression modestly

suppressed Cdc42-induced lethality (Supplementary Figure S2). However, based on a

previous report by Madrid et al, the overexpression of Cdc42G12V did not significantly

stimulated Pmk1 MAPK activation, they concluded that Cdc42 GTPase and PAK kinases Pak1

and Pak2 do not regulate the basal and stress-induced activations of Pmk1. Therefore, the

suppression of Cdc42-mediated lethality by Skb5 overexpression may simply reflect the Skb5

function as an activator and a binding partner for Shk1/Pak1, an important kinase downstream

of Cdc42. Future studies will be required to fully reveal Skb5 function as a critical regulator

of several kinases involved in polarity and morphogenesis.

Intriguingly, SLAP (Src-like Adaptor Protein)/SLAP2, Skb5 orthologues in higher

eukaryotes (http://www.pombase.org/spombe/result/SPCC24B10.13) have been reported to act

as negative regulators of T cell receptor (TCR) signaling. SLAP interacts with a set of proteins

relevant to TCR signal transduction, such as ZAP-70 and Vav via its SH2 domain (Tang et al.,

1999; Holland et al., 2001). In addition, accumulating evidence has revealed an emerging role

of SLAP as a key regulator in receptor tyrosine kinase (RTK) signaling. SLAP has been shown

to interact with a subset of RTKs including Eph receptors and PDGFRs. (Wybenga-Groot and

McGlade, 2015) Interestingly, SLAP function in the regulation of TCR/RTK signaling is

closely coupled with its binding to the ubiquitin ligase Cbl through its C-terminal region,

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

allowing for ubiquitination of substrates such as EphA2 and its subsequent degradation

(Wybenga-Groot and McGlade, 2015). This prompted us to investigate the protein amount of

Mkh1 in the absence and presence of Skb5 overproduction, with a presumption that Skb5 may

couple Mkh1 to the ubiquitin-mediated degradation. However, no Mkh1 protein degradation

was observed upon Skb5 overproduction (data not shown), thus indicating that the effect of

Skb5 on cell-tip Mkh1 localization was not ascribable to Mkh1 degradation, but reflects the

dispersal of Mkh1 localization from the cell tips to the cytoplasm. Further investigations

regarding the regulatory mechanism of Mkh1 localization to cell tips and factors involved in

the process are necessary. However, given that Skb5 shows similarity with SLAP/SLAP2 in

the SH3 domain, Skb5 may downregulate factors involved in Pmk1 MAPK signaling

cooperatively with unidentified ubiquitin ligases.

Materials and Methods

Strains, Media, and Genetic and Molecular Biology Methods

Schizosaccharomyces pombe strains used in this study are listed in Table 1. The complete

medium (yeast extract-peptone-dextrose [YPD]), (yeast extract with supplements [YES]) and

the minimal medium (Edinburgh minimal medium [EMM]) have been described previously

(Sabatinos et al., 2010; Toda et al., 1996). Standard genetic and recombinant DNA methods

(Sabatinos et al., 2010) were used except where otherwise noted. PCR-based genomic epitope

tagging was performed using standard methods (Bahler et al., 1998). Proteins were N-

terminally or C-terminally tagged with GFP or GST expressed from the respective endogenous

loci. The GFP- or GST-tagging did not alter the protein’s function of these molecules as

evidenced by the observations that the phenotypes in terms of the lethality in the presence of

the Cl- and FK506 as well as the sensitivity/tolerance to micafungin are indiscernible from

those of the untagged WT cells (data not shown).

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Isolation of the skb5+

The chromosome-borne nmt1-GFP-pck2+ cells [Pck2 overproducing (Pck2 OP)] were

constructed as described in Bahler et al. (Bahler et al., 1998). The thiamine-repressible nmt1-

GFP-pck2+ integrated (Pck2 OP) cells were transformed using an S. pombe genomic DNA

library constructed in the vector pDB248 (Beach et al., 1982). Leu+ transformants were replica-

plated onto EMM plates at 27°C without the addition of thiamine, and plasmid DNA was

recovered from transformants that showed plasmid-dependent growth in the absence of

thiamine. The recovered plasmids suppressed the lethality induced by Pck2 OP. DNA

sequencing showed that the suppressing plasmids contained SPCC24B10.13 (skb5+) and

pmp1+.

Protein Expression, Site-directed mutagenesis

For protein expression in yeast, thiamine-repressible nmt1 promoter was used (K Maundrell et

al., 1990). Expression was repressed by the addition of 4.0 mg/ml thiamine to EMM and was

induced by washing and incubating the cells in EMM lacking thiamine. The GST- or the GFP-

fused gene was sub-cloned into the pREP1 vectors. Skb5YF2A and Mkh13PA were generated

using the Quick Change mutagenesis kit (Stratagene, La Jolla, CA, USA). The primers used

are summarized in Table 2.

Protein Detection

Anti-GFP (Ma et al., 2006), anti-GST (Ma et al., 2006), and anti-Phospho-Pmk1 (Sugiura et

al., 1999) were used as the primary antibodies (1:20,000 dilutions). anti-rabbit (Cell signaling)

was used as the secondary antibody (1:4,000 dilution). Membranes were developed with

Chemi-Lumi One Super (Nscalai tesque). Protein levels were quantified using ImageJ software

(http://rsb.info.nih.gov/ij/).

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Growth Conditions and Stress Treatment

Unless otherwise stated, cells were cultivated at 27°C in EMM (Sabatinos et al, 2010). Prior to

stress treatment, the cells were grown to mid-log phase (OD660 nm= 0.5). To the culture

medium, 200 mg/mL Micafungin stock solution was added at the indicated concentrations.

After stress treatment, the culture medium was chilled in ice water for one minute. The cells

were harvested by brief centrifugation at 4°C.

Microscopy and Miscellaneous Methods

Light microscopy methods (e.g. fluorescence microscopy) were carried out as described

previously (Kita et al., 2004; Satoh et al., 2012). Photographs were taken using AxioImager

M1 (Carl Zeiss, Germany) equipped with an LSM700 (Carl Zeiss, Germany) and ZEN 2012

software (Carl Zeiss, Germany). Images were processed with ZEN 2012 software (Carl Zeiss,

Germany). Cell extract preparation and immunoblot analysis were performed as previously

described (Sio et al., 2005).

Image Quantification

The quantification of cell tip localization was done for at least 2 individual datasets, which

summed up to 100 counted cells.

Statistical Analysis

All results are expressed as means and s.d. of several independent experiments. Data were

analyzed using a one-way ANOVA, followed by a post hoc test using Dunnett's multiple

comparison (Fig. 4A; upper row of graphs, Fig. 6D; upper row of graphs), a one-way ANOVA,

followed by a post hoc test using Tukey-Kramer’s multiple comparison (Fig. 5A; upper row of

graphs), or by Student's t-test (Fig. 5B; upper row of graphs). P values less than 5% were

regarded as significant. Asterisks indicate significant differences, and n.s. indicates not

significant.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Acknowledgments

We thank Dr. T. Toda, K. Nakano and the Yeast Resource Center (YGRC/NBRP;

http://yeast.lab.nig.ac.jp/nig) for providing strains and plasmids; Professor William Figoni for

critical reading of the manuscript. We are grateful to the members of the Laboratory of

Molecular Pharmacogenomics for their support.

Competing interests

No competing interests declared.

Author contributions

R.S. designed this project. Y.K., R.S., S.M., C.I., N.I., S.T. and A.K. carried out experiments.

Y.K., S.M., S.T., A.K., K.H., and R.S. analyzed the data. Y.K. and R.S. wrote the manuscript.

All authors reviewed the manuscript.

Funding

This work was supported by research grants from the Ministry of Education, Culture, Sports,

Science and Technology of Japan (to R.S.). This work was also supported by the MEXT-

Supported Program for the Strategic Research Foundation at Private Universities 2014-2018

（S1411037）.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

References

Ba¨hler, J., Wu, J., Longtine, M. S., Shah, N. G., McKenzie, III, A., Steever, A. B., Wach,

A., Philippsen, P. and Pringle, J. R. (1998). Heterologous modules for efficient and versatile

PCR-based gene targeting in Schizosaccharomyces pombe. Yeast. 14, 943–951.

Barnard, D., Diaz, B., Clawson, D. and Marshall, M. (1998). Oncogenes, growth factors and

phorbol esters regulate Raf-1 through common mechanisms. Oncogene. 17, 1539-1547.

Beach, D., Piper, M. and Nurse, P. (1982). Construction of a Schizosaccharomyces pombe

gene bank in a yeast bacterial shuttle vector and its use to isolate genes by complementation.

Mol. Gen. Genet. 187, 326–329.

Carnero, E., Ribas, J. C., García, B., Durán, A. and Sánchez, Y. (2000).

Schizosaccharomyces pombe ehs1p is involved in maintaining cell wall integrity and in calcium

uptake. Molecular and General Genetics. 264, 173-183.

Chang, P., Jun-yi, T., Yun-fei, X., Peng, X., Hong-da, L., Hao-an, W., Wen-bo, W., Fan-

guo, M., Xiao, Y. and Jin-peng, S. (2015). The catalytic role of the M2 metal ion in PP2Cα.

Sci. Rep. 5, 8560.

Dhillon, A. S., Hagan, S., Rath, O. and Kolch, W. (2007). MAP kinase signalling pathways

in cancer. Oncogene. 26, 3279–3290.

Doi, A., Kita, A., Kanda, Y., Uno, T., Asami, K., Satoh, R., Nakano, K. and Sugiura, R.

(2015). Geranylgeranyltransferase Cwg2-Rho4/Rho5 module is implicated in the Pmk1 MAPK

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Kinase-mediated cell wall integrity pathway in fission yeast. Genes Cells. 20, 310-23

Gardner, A. M., Vaillancourt, R. R., Lange-Carter, C. A. and Johnson, G. L. (1994). MEK-

1 phosphorylation by MEK kinase, Raf, and mitogen-activated protein kinase: analysis of

phosphopeptides and regulation of activity. Mol. Biol. Cell. 5, 193-201.

Herskowitz, I. (1995). MAP kinase pathways in yeast: for mating and more. Cell. 80, 187–

197.

Hibino, K., Shibata, T., Yanagida, T. and Sako, Y. (2011). Activation kinetics of RAF protein

in the ternary complex of RAF, RAS-GTP, and kinase on the plasma membrane of living cells:

single-molecule imaging analysis. J. Biol. Chem. 286, 36460-8.

Holland, S. J., Liao, X. C., Mendenhall, M. K., Zhou, X., Pardo, J., Chu, P., Spencer, C.,

Fu, A., Sheng, N. and Yu, P., et al. (2001). Functional cloning of Src-like adapter protein-2

(SLAP-2), a novel inhibitor of antigen receptor signaling. J. Exp. Med. 194, 1263–76.

Jeffrey, K. L., Camps, M., Rommel, C. and Mackay, C. R. (2007). Targeting dual-specificity

phosphatases: manipulating MAP kinase signalling and immune responses. Nat. Rev. Drug

Discov. 6, 391–403.

Kam, Y., Petra, J., Brian, M., David, W. R., Harald, M., John, M. S. and Walter K. (2000).

Mechanism of Suppression of the Raf/MEK/Extracellular Signal-Regulated Kinase Pathway

by the Raf Kinase Inhibitor Protein. Mol. Cell Biol. 20, 3079–3085.

Kita, A., Sugiura, R., Shoji, H., He, Y., Deng, L., Lu, Y., Sio, S.O., Takegawa, K., Sakaue,

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

M., Shuntoh, H. and Kuno, T. (2004) Loss of Apm1, the μ1 subunit of the clathrin-associated

adaptor-protein-1 complex, causes distinct phenotypes and synthetic lethality with calcineurin

deletion in fission yeast. Mol. Biol. Cell. 15, 2920–2931.

Levin, D. E. (2005). Cell wall integrity signaling in Saccharomyces cerevisiae. Microbiol. Mol.

Biol. Rev. 69, 262–291.

Ma, Y., Kuno, T., Kita, A., Asayama, Y. and Sugiura, R. (2006). Rho2 is a target of the

farnesyltransferase Cpp1 and acts upstream of Pmk1 mitogen-activated protein kinase

signaling in fission yeast. Mol. Biol. Cell. 17, 5028–5037.

Ma, Y., Kuno, T., Kita, A., Nabata, T., Uno, S. and Sugiura, R. (2006). Genetic evidence

for phospholipid-mediated regulation of the Rab GDP-dissociation inhibitor in fission yeast.

Genetics. 106, 064-709.

Madrid, M., Soto, T., Khong, H. K., Franco, A., Vicente, J., Pérez, P., Gacto, M. and

Cansado, J. (2006). Stress-induced Response, Localization, and Regulation of the Pmk1 Cell

Integrity Pathway in Schizosaccharomyces pombe. J. Biol. Chem. 281, 2033–2043.

Marais, R., Light, Y., Paterson, H. F. and Marshall, C. J. (1995). Ras recruits Raf-1 to the

plasma membrane for activation by tyrosine phosphorylation. EMBO J. 14, 3136–3145.

Marshall, C. J. (1994). MAP kinase kinase kinase, MAP kinase kinase and MAP kinase. Curr.

Opin. Genet. Dev. 4, 82–89.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Maundrell, K. (1990). nmt1 of fission yeast. A highly transcribed gene completely repressed

by thiamine. J. Biol. Chem. 265, 10857–10864.

Merla, A. and Johnson, D. I. (2001). The Schizosaccharomyces pombe Cdc42p GTPase

signals through Pak2p and the Mkh1p-Pek1p-Spm1p MAP kinase pathway. Curr. Genet. 39,

205-209.

Munshi, A. and Ramesh, R. (2013). Mitogen-activated protein kinases and their role in

radiation response. Genes Cancer. 4, 401–408.

Nishida, E. and Gotoh, Y. (1993). The MAP kinase cascade is essential for diverse signal

transduction pathways. Trends Bio-chem. Sci. 18, 128–131.

Park, H. O. and Bi, E. (2007). Central roles of small GTPases in the development of cell

polarity in yeast and beyond. Microbiol. Mol. Biol. Rev. 71, 48–96.

Park, S., Rath, O., Beach, S., Xiang, X., Kelly, S. M., Luo, Z., Kolch, W. and Yeung, K. C.

(2006). Regulation of RKIP binding to the N-region of the Raf-1 kinase. FEBS Letters. 580,

6405–6412.

Perez, P. and J. Cansado. (2010). Cell integrity signaling and response to stress in fission

yeast. Curr. Protein Pept. Sci. 11, 680–692.

Sabatinos, S. A. and Forsburg, S. L. (2010). Molecular genetics of Schizosaccharomyces

pombe. Methods Enzymol. 470, 759–795.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Santarpia, L., Lippman, S. L. and El-Naggar, A. K. (2012). Targeting the MAPK- RAS-

RAF signaling pathway in cancer therapy. Expert Opin Ther Targets. 16, 103–119.

Satoh, R., Tanaka, A., Kita, A., Morita, T., Matsumura, Y., Umeda, N., Takada, M.,

Hayashi, S., Tani, T., Shinmyozu, K. and Sugiura, R. (2012). Role of the RNA-binding

protein Nrd1 in stress granule formation and its implication in the stress response in fission

yeast. PLoS One. 7, e29683.

Sengar, A. S., Markley, N. A., Marini, N. J. and Young, D. (1997). Mkh1, a MEK kinase

required for cell wall integrity and proper response to osmotic and temperature stress in

Schizosaccharomyces pombe. Mol. Cell Biol. 17, 3508–3519.

Shah, B. H. and Catt, K. J. (2006). Protein phosphatase 5 as a negative key regulator of Raf-

1 activation. Trends Endocrinol Metab. 17, 382–384.

Sio, S. O., Suehiro, T., Sugiura, R., Takeuchi, M., Mukai, H. and Kuno, T. (2005). The role

of the regulatory subunit of fission yeast calcineurin for in vivo activity and its relevance to

FK506 sensitivity. J. Biol. Chem. 280, 12231–12238.

Stanger, K., Gorelik, M. and Davidson, A. R. (2012). Yeast Adaptor Protein, Nbp2p, Is

Conserved Regulator of Fungal Ptc1p Phosphatases and Is Involved in Multiple Signaling

Pathways. J. Biol. Chem. 287, 22133–22141.

Sugiura, R., Toda, T., Shuntoh, H., Yanagida, M. and Kuno, T. (1998). pmp1+ ,a suppressor

of calcineurin deficiency, encodes a novel MAP kinase phosphatase in fission yeast. EMBO J.

17, 140–148.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Sugiura, R., Toda, T., Dhut, S., Shuntoh, H. and Kuno, T. (1999). The MAPK kinase Pek1

acts as a phosphorylation-dependent molecular switch. Nature. 399, 479–483.

Sugiura, R., Kita, A., Shimizu,Y., Shuntoh, H., Sio, S. O. and Kuno, T. (2003). Feedback

regulation of MAPK signalling by an RNA-binding protein. Nature. 424, 961-965.

Takada, H., et al. (2007). Atf1 is a target of the mitogen-activated protein kinase Pmk1 and

regulates cell integrity in fission yeast. Mol. Biol. Cell. 18, 4794–4802.

Takada, H., Nishida, A., Domae, M., Kita, A., Yamano, Y., Uchida, A., Ishiwata, S., Fang,

Y., Zhou, X. and Masuko, T., et al. (2010). The Cell surface protein gene ecm33+ is a target

of the two transcription factors Atf1 and Mbx1 and negatively regulates Pmk1 MAPK cell

integrity signaling in fission yeast. Mol. Biol. Cell. 21, 674-85.

Tang, J. S. Sawasdikosol, J. H. Chang and S. J. Burakoff. (1999). SLAP, a dimeric adapter

protein, plays a functional role in T cell receptor signaling. Proc. Natl. Acad. Sci. USA. 96,

9775–9780.

Toda, T., Dhut, S., Superti, F. G., Gotoh, Y., Nishida, E., Sugiura, R. and Kuno, T. (1996).

The fission yeast pmk1+ gene encodes a novel mitogen-activated protein kinase homolog which

regulates cell integrity and functions coordinately with the protein kinase C pathway. Mol. Cell

Biol. 16, 6752–6764.

von Kriegsheim, A., Pitt, A., Grindlay, G. J., Kolch, W. and Dhillon, A. S. (2006).

Regulation of the Raf-MEK-ERK pathway by protein phosphatase 5. Nat. Cell Biol. 8, 1011–

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

1016.

Wybenga-Groot L. E. and McGlade, C. J. (2015). RTK SLAP DOWN: The emerging role

of Src-like adaptor protein as a key player in receptor tyrosine kinase signaling. Cellular

Signalling. 27, 267–274.

Yang, P., Pimental, R., Lai, H. and Marcus, S. (1999). Direct activation of the fission yeast

PAK Shk1 by the novel SH3 domain protein, Skb5. J. Biol. Chem. 274, 36052–36057.

Zheng, C. F. and Guan, K. L. (1993). Properties of MEKs, the kinases that phosphorylate and

activate the extracellular signal-regulated kinases. J. Biol. Chem. 268, 23933–23939.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Figures

Fig. 1. Skb5 overproduction negatively regulates the Pck2/Pmk1 MAPK signaling

pathway. (A) Skb5 was identified as a regulator of the cytotoxicity induced by Pck2

overproduction. Wild-type (WT) cells transformed with the control vectors alone, pREP2-GST-

Pck2 and the control vector, pREP2-GST-Pck2 and the skb5+gene, or pREP2-GST-Pck2 and

pmp1+ gene, were grown in EMM in the presence (Promoter OFF) or absence (Promoter ON)

of thiamine at 27°C for 5 days. (B) Skb5 suppressed the cytotoxicity induced by Rho2

overproduction. WT cells transformed with the control vectors alone and Rho2 overproduction

cells harboring either the control vector, the skb5+gene, or the pmp1

+ gene, were grown in

EMM in the presence (Promoter OFF) or absence (Promoter ON) of thiamine at 27°C for 3

days. (C) Skb5 failed to suppress the cytotoxicity induced by Pek1DD

overproduction. WT cells

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

transformed with the control vectors alone, pREP2-GST-Pek1DD and the control vector,

pREP2-GST-Pek1DD and the skb5+gene, or pREP2-GST-Pek1DD and pmp1

+ gene, were grown

in EMM in the presence (Promoter OFF) or absence (Promoter ON) of thiamine at 27°C for 6

days. (D) Skb5 deletion induced a vic negative phenotype. WT, Skb5 deletion, and Pmp1

deletion cells were grown in YPD or YPD in the presence of 0.06 M MgCl2+FK506, FK506,

0.06 M MgCl2, or 0.6 M MgCl2 at 27°C for 4 days. (E) Skb5 overproduction can suppress

Pmk1 MAPK phosphorylation induced by Pck2 overproduction. The chromosome-borne nmt1-

GFP-Pck2 cells expressing endogenous Pmk1-GST transformed with either the control vector

or the skb5+, were grown in EMM in the presence (promoter ON -) or absence (promoter ON

+) of thiamine at 27°C. Cell lysates and proteins bound to glutathione beads were analyzed by

immunoblotting using either anti-GFP antibodies (GFP-Pck2), anti-GST antibodies (Pmk1-

GST), and anti-phospho-Pmk1 antibodies (phosphorylated Pmk1). Upper panel: The data

shown are representative of three independent experiments. Lower panel: Quantification of

Pmk1 phosphorylation calculated by measuring intensities of the phosphorylated Pmk1 (as

detected by anti-phospho-Pmk1 antibodies) versus total Pmk1 as loading control (as detected

by anti-GST antibodies) using Image J software.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Fig. 2. Skb5 suppressed Pmk1 MAPK signaling independent of the interaction with Ptc1.

(A) Skb5 binds to Mkh1. GST pull-downs carried out with GST or GST-Skb5; Cells

transformed with plasmids harboring GFP alone (vector), GFP-Pmk1, Pek1-GFP, or GFP-

Mkh1, were collected and the lysates were incubated with purified GST or GST-Skb5.

Proteins bound to glutathione beads were analyzed by SDS-PAGE and immunoblotted using

anti-GFP or anti-GST antibodies. (B) Skb5 binds to Ptc1. Cells transformed with plasmids

harboring GFP alone (vector), GFP-Pmp1, or Ptc1-GFP, were collected and the lysates were

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

incubated with purified GST or GST-Skb5. Proteins bound to glutathione beads were analyzed

by SDS-PAGE and immunoblotted using anti-GFP or anti-GST antibodies. (C) Skb5

overproduction exhibits vic (viable in the presence of immunosuppressant and chloride ion)

phenotype in the absence of Ptc1. Upper panel: Skb5 overexpression exhibits vic phenotype in

the WT cells. WT cells transformed with the control vector, the skb5+ gene or the pmp1+ gene

were grown in EMM and EMM containing 0.12 M MgCl2 plus FK506 at 27°C for 4 days.

Lower panel: Skb5 overexpression exhibits vic phenotype in ptc1 deletion cells. Cells as

indicated were grown EMM and EMM containing 0.12 M MgCl2 plus FK506 at 27°C for 4

days. (D) Skb5 overproduction inhibits Pmk1 MAPK phosphorylation both in the WT and ptc1

KO cells (Δptc1). Left panel: WT cells expressing endogenous Pmk1-GST transformed with

the control vector or the skb5+ gene, were grown in EMM at 27°C and incubated with 2 µg/ml

micafungin for 1 hr, and the phosphorylation of Pmk1 was analyzed as described in Fig. 1D.

Right panel: Ptc1 deletion cells expressing endogenous Pmk1-GST transformed with the

control vector or the skb5+ gene, were grown in EMM at 27°C and the phosphorylation of

Pmk1 was analyzed as described in Fig. 1E.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Fig. 3. Skb5/Mkh1 interaction is important for the Skb5-mediated inhibition of Pmk1

MAPK signaling. (A) Amino acid sequence of Skb5 and its mutant version of Skb5YF2A. The

underlined tyrosine (Y) 89 and phenylalanine (F) 135 of Skb5wt were mutated to alanine (A) to

make Skb5YF2A. (B) Skb5YF2A specifically lost its binding affinity to Mkh1. Cells transformed

with plasmids harboring GFP, GFP-Mkh1, or Ptc1-GFP were collected and the lysates were

incubated with purified GST alone, GST-Skb5 or GST-Skb5YF2A. Cell lysates (Lysate) and

proteins bound to glutathione beads (Pull-down) were analyzed by SDS-PAGE and

immunoblotted using anti-GFP or anti-GST antibodies. (C) Skb5YF2A overexpression did not

suppress the cytotoxicity induced by Pck2 overproduction. WT cells transformed with

pREP2-GST-Pck2 and the control vector, pREP2-GST-Pck2 and the skb5+gene, or pREP2-

GST-Pck2 and skb5YF2A gene, were grown in EMM in the presence (Promoter OFF) or absence

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

(Promoter ON) of thiamine at 27°C for 5 days. (D) Skb5YF2A overexpression did not exhibits

vic phenotype. Cells overexpressing the skb5YF2A failed to grow in the presence of EMM plus

0.12 M MgCl2 and FK506 at 27°C. WT cells transformed with the control vector, skb5+ gene

and skb5YF2A gene were grown in EMM +0.12 M MgCl2 +FK506 at 27°C for 4 days. (E)

Skb5YF2A overproduction failed to inhibit Pmk1 MAPK signaling. The phosphorylation levels

of Pmk1 were not inhibited upon Skb5YF2A overproduction. WT cells expressing endogenous

GST-tagged Pmk1, transformed with the control vector, skb5+ gene or the skb5YF2A gene, were

grown in EMM at 27°C and incubated with 2 µg/ml micafungin for 1 hr. Proteins bound to

glutathione sepharose (Pull-down) were analyzed as described in Fig. 1D. Lower panel: Graph

shows phosphorylation levels of Pmk1 analyzed as described in Fig. 1D.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Fig. 4. Skb5 overproduction affects Mkh1 localization to the growing ends. (A) Mkh1

localization to the growing ends is reduced by Skb5 overproduction, but not by Skb5YF2A.

Upper panel: WT cell expressing endogenous Mkh1-GFP transformed with the control vector

(+vector), the skb5+gene or the skb5

YF2A gene, were grown in EMM plus thiamine for 16 hr.

The fluorescence of Mkh1-GFP was observed as described. Scale bar, 10 μm. n=3. Middle

panel: The number in each lane indicates the number of the cells with Mkh1 localization to the

cell ends/100 cells. The asterisks indicate significant differences (Dunnett's test, **P<0.01;

n=3, (mean±s.d.). (see Materials and Methods) n=3.

Lower panel: The number indicates the ratio of the number of the cells with Mkh1 localization

to the growing ends versus that of the cells harboring the control vector. (B) Amino acid

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

sequence of Mkh1 and its mutant version of Mkh13PA. The underlined three prolines 544, 546

and 547 of Mkh1wt were mutated to alanine (A) to make Mkh13PA. (C) Mkh13PA

specifically

lost its binding affinity to Skb5. Cells were transformed with plasmids harboring GFP alone,

GFP-Mkh1, GFP-Mkh13PA

were collected and the lysates were incubated with purified GST,

GST-Skb5, GST-Pek1 or GST-Pck2. Cell lysates (Lysate) and proteins bound to glutathione

beads (Pull-down) were analyzed by immunoblotting using anti-GFP and anti-GST antibodies.

(D) Mkh13PA localization to growing ends does not change upon Skb5 overproduction. Upper

panel: WT cells expressing endogenous Mkh13PA transformed with the control vector, or the

skb5+gene, were grown in EMM +thiamine for 16 hr. Scale bar, 10 μm. n=3 (see Materials and

Methods), (mean±s.d.). Middle panel and Lower panel: The ratio and the percentages of the

cells were analyzed as described in Fig. 4A.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Fig. 5. Skb5 localization to the growing ends needs Skb5/Mkh1 interaction. (A) Skb5, but

not Skb5YF2A

, accumulated in the growing ends upon its overproduction. Upper panel: WT cell

expressing endogenous Skb5-GFP, or Skb5YF2A

-GFP transformed with the control vector, and

the WT cells transformed with the GFP-Skb5 or GFP-Skb5YF2A

, were grown in EMM

+thiamine for 16 hr. Scale bar, 10 μm. n=3 (see Materials and Methods), (mean±s.d.). Middle

panel: The number in the picture indicates the Skb5/Skb5YF2A

cell-tip localization/100 cells in

each sample. The asterisks indicate significant differences (Tukey’s test, **P<0.01, *P<0.05;

n=3, (mean±s.d.). (see Materials and Methods). Lower panel: The graph shows the ratio of the

cells with Skb5/Skb5YF2A

cell-tip-localization versus that of the cells expressing the

endogenous Skb5. (B) Skb5 localization to growing ends is decreased in mkh1 KO cell. Upper

panel: WT cells or mkh1 KO cells expressing endogenous Skb5 transformed with the control

vector, were grown in EMM for 16 hr. Scale bar, 10 μm. n=3 (see Materials and Methods),

(mean±s.d.). Middle panel and Lower panel: The ratio and the percentages of the cells were

analyzed as described in Fig. 4A. The asterisks indicate significant differences (Student's t-test,

**P<0.01; n=3, (mean±s.d.). (see Materials and Methods).

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Fig. 6. Skb5 deletion increased Mkh1 cell-tip localization and Pmk1 phosphorylation.

(A) Skb5 deletion, Skb5YF2A mutation and Mkh13PA mutation induced a vic negative phenotype.

Upper panel: WT, skb5YF2A mutant, and Skb5 deletion cells were grown in YPD or YPD in the

presence of 0.06 M MgCl2+FK506 at 27°C for 4 days. Lower panel: WT, mkh13PA mutant, and

Skb5 deletion cells were grown in YPD or YPD in the presence of 0.06 M MgCl2+FK506 at

27°C for 4 days. (B) Skb5 deletion induced Pmk1 hyperphosphorylation. The WT and Skb5

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

deletion cells expressing endogenous Pmk1-GST, were grown in EMM at 27°C and incubated

with 2 µg/ml micafungin for 0, 20, 40, 60 min, and the phosphorylation of Pmk1 was analyzed

and quantified as described in Fig. 1E. The data shown are representative of three independent

experiments. (C) The skb5YF2A mutation and the mkh13PA mutant did not increase Pmk1

hyperphosphorylation. Left panel: WT and skb5YF2A mutant cells expressing endogenous

Pmk1-GST, were grown in EMM at 27°C and incubated with 2 µg/ml micafungin for 0, 20, 40,

60 min, and the phosphorylation of Pmk1 was analyzed and quantified as described in Fig. 1E.

Right panel: The WT and mkh13PA cells expressing endogenous Pmk1-GST, were grown in

EMM at 27°C and incubated with 2 µg/ml micafungin for 0, 20, 40, 60 min, and the

phosphorylation of Pmk1 was analyzed and quantified as described in Fig. 1E. (D) Skb5

deletion increased Mkh1 cell-tip localization. Upper panel: WT and Skb5 deletion cells

expressing endogenous Mkh1 tagged with GFP or cells expressing the Mkh13PA mutant protein

tagged with GFP under the native promoter were analyzed as described in Figure 4A. Middle

panel and Lower panel: The ratio and the percentages of the cells were analyzed as described

in Fig. 4A. The asterisks indicate significant differences (Dunnett's test, **P<0.01; n=3,

(mean±s.d.). (see Materials and Methods).

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Fig. 7. Pck2 is required for efficient Skb5/Mkh1 localization at the cell tips. (A) Mkh1

localization to the growing ends was decreased in the absence of Pck2. Upper panel: WT, ras1

KO, rho2 KO or pck2 KO cells expressing endogenous Mkh1 tagged with GFP, were grown in

EMM for 16 hr. Scale bar, 10 μm. n=3 (see Materials and Methods), (mean±s.d.). Middle panel

and Lower panel: The number in the graph indicates the cell-tip-localization of GFP-Mkh1 per

100 cells as described in Fig. 4A. The ratio and the percentages of the cells with Mkh1

localization to the cell ends, were analyzed as described in Fig. 4A. (B) Skb5 localization to

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

the growing ends was decreased in the absence of Pck2. Upper panel: WT, ras1 KO, rho2 KO

or pck2 KO cells expressing endogenous Skb5 tagged with GFP were grown in EMM for 16

hr. Scale bar, 10 μm. n=3 (see Materials and Methods), (mean±s.d.). Middle panel and Lower

panel: The ratio and the percentages of the cells with Skb5 localization to the cell ends, were

analyzed as described in Fig. 4A. (C) Pck2 influences the binding between Skb5 and Mkh1.

Upper panel: WT or Pck2 deletion cells expressing GFP-Mkh1 transformed with plasmids

harboring the control GST vector or GST-Skb5 were grown in EMM +thiamine at 27°C. Cells

were collected and the lysates were incubated with purified GST alone or GST-Skb5. Cell

lysates (Lysate) and proteins bound to glutathione beads (Pull-down) were analyzed by

immunoblotting using anti-GFP and anti-GST antibodies. Lower panel: Quantification of the

Mkh1/Skb5 binding in WT and Pck2 deletion cells. The intensities of the bands in the pull-

downs were analyzed using Image J software. (D) Skb5 does not affect Pck2 localization in the

growing ends. Upper panel: WT cells expressing endogenous Pck2 tagged with GFP

transformed with the control vector or the skb5+ gene, were grown in EMM +thiamine for 16

hr. Scale bar, 10 μm. n=3 (see Materials and Methods), (mean±s.d.). Middle panel and Lower

panel: Quantification of the cell-tip localization of Pck2-GFP was analyzed as described in Fig.

4A.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Fig. 8. Pck2 and Mkh1 localized to the cell tips in a cell-cycle dependent manner. (A) Cells

from the cdc25-22 mutants expressing endogenous Mkh1-GFP from the native promoter, were

grown to the log phase at 25°C, shifted to 37°C for 4 hr to synchronize the cells in the G2 phase,

and then shifted back to 25°C. Aliquots were obtained at different time points, and the cell-

tip Mkh1 localization (■) was analyzed as described in Figure 1(A). The septation index (□)

is also shown, which indicates good cell cycle synchrony in the culture. (B) Cells from the

cdc25-22 mutants expressing endogenous Pck2-GFP from the native promoter, were grown to

the log phase at 25°C and analyzed as described in Figure 8A. Aliquots were obtained at

different time points, and the cell-tip Pck2 localization (■) was analyzed as described in Figure

1A. The septation index (□) is also shown, which indicates good cell cycle synchrony in the

culture.

J. Cell Sci. 129: doi:10.1242/jcs.188854: Supplementary information

Figure S1. Pck2 overproduction did not induce Pmk1 MAPK activation in Pek1

deletion cells.

WT or Pek1 deletion cells expressing the chromosome-borne nmt1-GFP-Pck2 and Pmk1-

GST were grown in EMM in the presence (promoter OFF) or absence (promoter ON) of

thiamine at 27°C. Pmk1 phosphorylation and quantification was analyzed as described

in Figure 1E.

Jour

nal o

f Cel

l Sci

ence

• S

uppl

emen

tary

info

rmat

ion

J. Cell Sci. 129: doi:10.1242/jcs.188854: Supplementary information

Figure S2. Cdc42 over-expression-mediated lethality was suppressed by Pmk1

deletion and skb5 overexpression.

WT cells transformed with the control vectors alone, pREP81-cdc42G12V and the control

+vector, pREP81-cdc42G12V and the skb5 gene, or Pmk1 deletion cells harboring pREP81-

cdc42G12V, were grown in EMM in the presence (Promoter OFF) or absence (Promoter

ON) of thiamine at 27°C for 8 days.

Jour

nal o

f Cel

l Sci

ence

• S

uppl

emen

tary

info

rmat

ion

J. Cell Sci. 129: doi:10.1242/jcs.188854: Supplementary information

Table S1. Schizosaccharomyces pombe strain used in this study

Strain Genotype Reference

HM123 h- leu1-32 Our stock

KP452 h- leu1-32 ura4-D18 mkh1::ura4+ Our stock

KP456 h- leu1-32 ura4-D18 Our stock

KP898 h- leu1-32 ura4-D18 ptc1::ura4+ Our stock

KP2163 h- leu1-32 pck2::KanMX6 Our stock

KP2497 h- leu1-32 ura4-D18 nmt1-rho2+-GFP-ura4+ Our stock

SP630 h- leu1-32 ura4-D18 skb5::ura4+ Our stock

SP1657 h- leu1-32 ura4-D18 pck2+-GFP-ura4+ Our stock

SP2231 h- leu1-32 pmk1+-GST-KanMX6 Our stock

SP2390 h- leu1-32 ura4-D18 nmt1-pck2+-GFP-ura4+ pmk1+-GST-KanMX6 Our stock

SP2490 h- leu1-32 ura4-D18 skb5::ura4+ pmk1+-GST-KanMX6 Our stock

SP2556 h- leu1-32 mkh1+-GFP-KanMX6 This study

SP2605 h- leu1-32 skb5+-GFP-KanMX6 This study

SP2607 h- leu1-32 ura4-D18 ptc1::ura4+ pmk1+-GST-KanMX6 This study

SP2716 h? leu1-32 ura4-D18 cdc25-22 pck2+-GFP-ura4+ This study

SP2718 h- leu1-32 skb5YF2A-GFP-KanMX6 This study

SP2719 h- leu1-32 mkh13PA-GFP-KanMX6 This study

SP2724 h- leu1-32 ura4-D18 skb5::ura4+ mkh1+-GFP-KanMX6 This study

SP2725 h- leu1-32 ura4-D18 pck2::ura4+ skb5+-GFP-KanMX6 This study

SP2726 h? leu1-32 ura4-D18 cdc25-22 mkh1+-GFP- KanMX6 This study

SP2727 h- leu1-32 ura4-D18 rho2::ura4+ skb5+-GFP-KanMX6 This study

SP2729 h- leu1-32 skb5+-GFP-KanMX6 pmk1+-GST-KanMX6 This study

SP2740 h- leu1-32 skb5YF2A-GFP-KanMX6 pmk1+-GST-KanMX6 This study

SP2741 h- leu1-32 ura4-D18 ras1::ura4+ mkh1+-GFP-KanMX6 This study

SP2742 h- leu1-32 ura4-D18 ras1::ura4+ skb5+-GFP-KanMX6 This study

SP2743 h- leu1-32 ura4-D18 mkh1::ura4+ skb5+-GFP-KanMX6 This study

SP2744 h- leu1-32 ura4-D18 rho2::ura4+ mkh1+-GFP-KanMX6 This study

SP2745 h+ his2 leu1-32 mkh13PA-GFP-KanMX6 pmk1+-GST-KanMX6 This study

SP2746 h- leu1-32 ura4-D18 pck2::ura4+ mkh1+-GFP-KanMX6 This study

SP2749 h- leu1-32 mkh1+-GFP-KanMX6 pmk1+-GST-KanMX6 This study

Jour

nal o

f Cel

l Sci

ence

• S

uppl

emen

tary

info

rmat

ion

J. Cell Sci. 129: doi:10.1242/jcs.188854: Supplementary information

Table S2. Schizosaccharomyces pombe primers used in this study

Gene Primer

Mkh1 3PA sense 5’-CCTGCACCTGCAGCCACAGAGACATCTAGTTTACG-3’

Mkh1 3PA antisense 5’-GGCTGCAGGTGCAGGATCTCTATGTGCCACAAAAT-3’

Skb5 Y89A sense 5’-AGCTGATTTCGAGCCCCTCCATGATAATGAACTCG-3’

Skb5 Y89A antisense 5’-GCTAGCGCAACGGCGTCAGCAAGGACGTTGAAAGA-3’

Skb5 F135A sense 5’-TTGTTCCTGAGACTGCAGTTAAATTAGAGGTATAA-3’

Skb5 F135A antisense 5’-TGCAGTCTCAGGAACAAGCCCGCTTCTTCCTGAGG-3’

Mkh1 endogenous sense

5’-ATCACCCGTTTATGAAATGTGACGAAGAATTCAACTTTAAGGACACGAATCTTTACGACA

TGCTTTGTAAAAGAAAGAGCCGGATCCCCGGGTTAATTAA-3’

Mkh1 endogenous antisense

5’-

AATAAATAGCTATAAGAAGAAATTGAGAATGCATGCCCCTGCGAGGAAACGCTAAGTAA

TAAATAATAATTGCGACCAATGAATTCGAGCTCGTTTAAAC-3’

Skb5 endogenous sense

5’-

GCGATGGTTGGTTGATTGCATACGATGATGCCTCAGGAAGAAGCGGGCTTGTTCCTGAGA

CGTTTGTTAAATTAGAGGTACGGATCCCCGGGTTAATTAA-3’

Skb5 endogenous antisense

5’-TGGAACATAAAATAAGGAATAACATTTTAAAATCAATTTGACAAAAAGAAAAAGTAAAA

AGGGTTCAATTCAACGCTCTTGAATTCGAGCTCGTTTAAAC-3’

Mkh1 3PA endogenous sense 5’-ATGGCTGCCGATATCGGATC-3’

Skb5 YF2A endogenous sense 5’-ATGGCGGAAGAGACTGAAGAG-3’

Jour

nal o

f Cel

l Sci

ence

• S

uppl

emen

tary

info

rmat

ion