Upload
others
View
21
Download
0
Embed Size (px)
Citation preview
SlyD, A Ni(II) Metallochaperone for [NiFe]-Hydrogenase Biosynthesis in Escherichia coli
by
Harini Kaluarachchi
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Department of Chemistry University of Toronto
© Copyright by Harini Kaluarachchi 2011
ii
SlyD, A Ni(II) Metallochaperone for [NiFe]-hydrogenase
biosynthesis in Escherichia coli
Harini Kaluarachchi
Doctor of Philosophy
Department of Chemistry
University of Toronto
2011
Abstract
SlyD is a protein involved in [NiFe]-hydrogenase enzyme maturation and, together with HypB
and HypA proteins, contributes to the nickel delivery step. To understand the molecular details
of this in vivo function, the nickel-binding activity of SlyD was investigated in vitro. SlyD is a
monomeric protein that can chelate up to 7 nickel ions with an affinity in the sub-nanomolar
range. By truncation and mutagenesis studies we show that the unique C-terminal metal-binding
domain of this protein is required for Ni(II) binding and that the protein coordinates this metal
non-cooperatively. This activity of SlyD supports the proposed in vivo role of SlyD in nickel
homeostasis.
In addition to nickel, SlyD can bind a variety of other types of transition metals. Therefore it
was feasible that the protein contributes to homeostasis of metals other than nickel. To test this
hypothesis, the metal selectivity of the protein was examined. The preference of SlyD for the
metals examined could be ordered as follows, Mn(II), Fe(II) < Co(II) < Ni(II) ~ Zn(II) << Cu(I)
indicating that the affinity of SlyD for the different metals follows the Irving-Williams series of
iii
metal-complex stabilities. Although the protein is unable to overcome the large thermodynamic
preference in vitro for Cu(I) and exclude Zn(II) chelation, in vivo studies suggest a Ni(II)-
specific function for the protein.
To understand the function of SlyD as a metallochaperone, its interaction with HypB was
investigated. This investigation revealed that SlyD plays a role in Ni(II) storage in E. coli and
can function as a Ni(II)-donor to HypB. This study also revealed that SlyD can modulate the
metal-binding as well as the GTPase activities of HypB. Based on the experimental data, a role
for the HypB-SlyD complex in [NiFe]-hydrogenase biosynthesis is presented.
iv
Acknowledgments
First and foremost I would like to express my gratitude to my supervisor Dr. Deborah Zamble,
without your encouragement and guidance this would not have been possible. Your knowledge,
expertise, enthusiasm and patience for teaching influenced me tremendously. I would like to
thank Dr. Martin Stillman and Duncan Sutherland for their help with establishing mass
spectrometry methods. I am also thankful to Dr. Ingrid Pickering and Dr. Graham George for
their invaluable help at the synchrotron and taking the time to teach me the basics of XAS. Dr.
Alex Young, you have been a great mentor and I thank you for teaching me most of the things I
know about mass spectrometry. I would also like to thank the members of my committee Dr.
Robert Morris, Dr. Voula Kanelis, Dr. Rebecca Jockusch and Dr. Mark Nitz for the assistance
they provided at all levels of the research project.
Thank you to present members of the Zamble lab and the past members that I crossed paths with
for their help, advice, camaraderie and entertainment. I enjoyed the years I spent in the lab.
I was fortunate enough to have worked with the following undergraduates that helped me in the
course of this work, Sandra Krecisz, Judith F. Siebel and Sonia Sugumar, you are all exceptional
and thank you for your help.
I wish to thank Kim Chan Chung for being an amazing friend in and out of the lab, these past
five years would not have been that memorable without you.
Thank you to my sister Supipi, for not only helping me with bench work but for her love and
support throughout my life. I would also like to thank Simon for his help and encouragement in
the last few years.
A special thank you to Andrew Beharry for always believing in me. I am truly grateful for your
unwavering support and friendship. Thank you for being there to share all the success and
failures in all aspects of my life.
Lastly, thank you to my parents for loving me, encouraging me and supporting me
unconditionally. You have been my inspiration and I dedicate this Thesis to you.
v
Table of Contents
Abstract………………………………………………………………………………….......… .....ii
Acknowledgements…………………………………………………………………………… ....iv
Table of contents…………………………………………………………………………..….… ….v
List of Tables………………………………………………………………………………….. ...vii
List of Figures…………………………………………………………………………….…… ..viii
Abbreviations.…………………………………………………………………………….…… …..xi
Chapter 1. Introduction…………………………………………….……………………….. ….1
1.1 Biological relevance of Ni(II)…………………………..……………………........ ….1
1.2 The [NiFe]-hydrogenases……………………………………………………......... ….2
1.3 HypB………………………………………………………………………………. ….5
1.4 SlyD………………………………………………………………………….......... .....8
1.5 Purpose of study……………………………………………………………….….. ...11
Chapter 2. The Ni(II)-binding properties of the metallochaperone SlyD……………….. ...17
2.1 Introduction………………………………..…………………………………........ ...17
2.2 Materials and Methods………………………………………………………......... ...19
2.3 Results……………………………………………………………………………. ...26
2.4 Discussion and Conclusions…..…………………………………………….......... ...43
Chapter 3. The in vitro and in vivo metal specificity of the Ni(II) metallochaperone
SlyD………………………………………………………………………………. ...55
3.1 Introduction………………………………..…………………………………........ ...55
3.2 Materials and Methods………………………………………………………......... ...56
vi
3.3 Results……………………………………………………………………………. ...63
3.4 Discussion………………….…..…………………………………………….......... ...92
Chapter 4. Significance of the HypB-SlyD complex in [NiFe]-hydrogenase
biosynthesis……………………………………………………………………… .102
4.1 Introduction………………………………..…………………………………........ .102
4.2 Materials and Methods………………………………………………………......... .104
4.3 Results……………………………………………………………………………. .109
4.4 Discussion……………………..…………………………………………….......... .125
Chapter 5. Summary and Perspective………………………………………………..…….. .135
5.1 Ni(II)-binding properties of SlyD…………………………………………………. .135
5.2 Metal specificity of SlyD……………………………………………………......... .136
5.3 Significance of the HypB-SlyD complex in [NiFe]-hydrogenase biosynthesis....... .138
5.4 Significance…..…………………………..………………………………….......... .138
5.5 Future directions…………...…..…………………………………………….......... .140
vii
List of Tables
Table 2-1 PCR primers used for mutagenesis………….…………………….............................. ...20
Table 2-2 Masses of SlyD protein…………………...………………………………………… ...21
Table 2-3 Best Ni(II) EXAFS curve-fiiting results for SlyD……….…………...…………..….. ...24
Table 2-4 Stoichiometry of Ni(II) binding to SlyD…………………………………………….. ...28
Table 3-1 Summary of metal concentrations used for metal toxicity studies…………………... ...61
Table 3-2 Primers used for qRT-PCR…………………………………………………………... ...63
Table 3-3 Metal stoichiometry of WT SlyD……………………………………………………. ...82
Table 3-4 KD of SlyD-Metal complexes………………………………………………………... …...93
Table 4-1 Total hydrogenase activity…………………………………………………………... .110
Table 4-2 Cytoplasmic 63
Ni(II) levels….………………………………………………………… .11110
Table 4-3 GTP hydrolysis rates of HypB under saturating conditions............................................ 1.123
viii
List of Figures
Figure 1-1 Biosynthtic pathways of [NiFe] hydrogenase…………………….............................. .....3
Figure 1-2 HypB……………………………………...………………………………………… ….6
Figure 1-3 SlyD……………………………………………………...…………...…………..….. ...10
Figure 2-1 SlyD domain architecture and amino acid sequence……………………………..….. ...18
Figure 2-2 Electronic absorption spectra of wild-type SlyD and mutants……………………..... ...27
Figure 2-3 SlyD binds multiple nickel ions……………………………………………………... ...27
Figure 2-4 Ni(II)-induced 2° structural changes in SlyD………………………………………... ...29
Figure 2-5 Quaternary structure of SlyD………………………………………………………… .......30
Figure 2-6 Analysis of Ni(II) binding to SlyD via ESI-MS……………………………………... ...31
Figure 2-7 Stoichiometry of nickel binding to SlyD……………………………………..……….. .......33
Figure 2-8 SlyD metal sites can compete with EGTA……………………………………........... .....34
Figure 2-9 Ni K near-edge spectra……………………………………………………………… .....35
Figure 2-10 k3-weighted Ni(II) EXAFS data and the Fourier transform of the data……………...….. .....37
Figure 2-11 Comparison of WT SlyD and SlyD1-146 CD spectra…………………………………….. .....38
Figure 2-12 Competition for Ni(II) binding by WT and Triple mutant SlyD……………...………… .....41
Figure 2-13 Overlay of WT EXAFS data with SlyD mutants………………………………...……… .....42
Figure 2-14 Model for Ni(II) binding to SlyD…………………………………………………..…… .....45
Figure 3-1 ESI-MS titration of SlyD with Zn(II)…………………………………………………… ….65
Figure 3-2 Re-evaluating Ni(II) binding to SlyD by ESI-MS………………………………………. ….66
ix
Figure 3-3 Zn(II) stoichiometry & affinity of SlyD………………………………………………… ….67
Figure 3-4 Competition of SlyD with EGTA for Zn(II) binding…………………………………… ….68
Figure 3-5 Determining the Zn(II) dissociation constant (KD) of SlyD using PAR……………...…. ….69
Figure 3-6 Comparison of Ni(II)- vs. Zn(II)-induced secondary structure change in SlyD………… ….71
Figure 3-7 Zn(II) dependent oligomeric state of SlyD……………………………………………… ….71
Figure 3-8 Selectivity of SlyD for Ni(II) vs. Zn(II)………………………………………………… ….72
Figure 3-9 Visualizing Cu(I) binding to SlyD………………………………………………………. ….74
Figure 3-10 ESI-MS titration of SlyD with Cu(I) in the presence of 100 M DTT…………………. ….75
Figure 3-11 Stoichiometry of SlyD for Cu(I)………………………………………………………… ….76
Figure 3-12 Determining the Cu(I) KD for SlyD……………………………………………………... ….77
Figure 3-13 Co(II) binding to SlyD…………………………………………………………………... ….79
Figure 3-14 Resulting d-d transition upon Co(II) binding to SlyD……………………..……………. ….80
Figure 3-15 ESI-MS titration of WT SlyD with Co(II) in the presence of 100 M DTT…………… ….81
Figure 3-16 Affinity of Slyd to Co(II) via Fura-2 competition………………………………………. ….83
Figure 3-17 Zn(II) can replace Co(II) bound to SlyD………………………………………………... ….84
Figure 3-18 Selectivity of SlyD for Ni(II) vs. Fe(II)…………………………………………………. ….85
Figure 3-19 Sensitivity of E. coli to transition metals………………………………………………... ….87
Figure 3-20 Expression profiles of zinc, copper and nickel transporter in aerobic growth………….. ….89
Figure 3-21 Expression of Ni(II) transporters in response to Ni(II)…………………………………. ….89
Figure 3-22 Expression of Ni(II) transporters in the presence of excess Zn(II)……………………... ….90
x
Figure 3-23 Expression profiles of zinc and copper transporters in anaerobic growth………………. ….91
Figure 4-1 Architecture of E. coli SlyD and HypB…………………………………………………. ...103
Figure 4-2 Metal transfer detection via ESI-MS……………………………………………………. 113
Figure 4-3 Ni(II) transfer from SlyD to HypB detected via ESI-MS……………………………….. ...114
Figure 4-4 Analysis of holo HypB by ESI-MS……………………………………………………... ...114
Figure 4-5 SlyD modulates the high-affinity metal site of HypB………………………………… ...116
Figure 4-6 Monitoring metal release from HypB to EGTA in the presence of SlyD variants via
ESI-MS………………………………………………………………………………….. ...118
Figure 4-7 Metal release from HypB using different acceptors…………………………………….. ...119
Figure 4-8 GxP binding to HypB via ESI-MS……………………………………………………… ...120
Figure 4-9 SlyD together with GDP enhances the nickel release rate from HypB…………………. ...121
Figure 4-10 Metal release from HypB to EDTA monitored by electronic absorption
spectroscopy…………………………………………………………………………… ...122
Figure 4-11 SlyD removes Zn(II) from the G-domain of HypB……………………………………... ...123
Figure 4-12 SlyD1-146 cannot competitively remove Zn(II) bound to the G-domain of HypB…….. ...125
Figure 4-13 Proposed model for Ni(II) insertion to the hydrogenase precursor under limited and
abundant exogenous nickel availability.………………………………………….….. .131
xi
Abbreviations
Bca Bicinchoninate
Bcs Bathocuproine sulfonate
CD Circular dichroism
DMG Dimethylgyloxime
DTT Dithiothreitol
EDTA Ethylenediaminetetraacetic acid
EGTA Ethyleneglycoltetraacetic acid
ESI-MS Electrospray ionization mass spectrometry
EXAFS Extended x-ray absorption fine structure
FKBP FK-506 binding proteins
FT Fourier transform
G-domain The GTPase domain of HypB corresponding to residues 77-290
GDP Guanosine diphosphate
GMP-PNP Guanosine 5′-[β,γ-imido]triphosphate
GTP Guanosine triphosphate
HEPES 4-(2-hydroxylethyl)-1 piperazineethanesulfonic acid
HPLC High-performance liquid chromatography
HSID Hot source-induced desolvation
ICP-AES Inductively coupled plasma-atomic emission spectroscopy
IF domain Insertion in the flap domain
IPTG Isopropyl-β-D-1-galactopyranoside
xii
LMCT Ligand to metal charge transfer
MBD Metal-binding domain
NEM N-ethyl maleimide
PAR 4-(2-pyridylazo)resorcinol
PCR Polymerase chain reaction
PPIase Peptidyl prolyl isomerase
qRT-PCR Quantitative real-time polymerase chain reaction
TCEP Tris(2-carboxyethyl)phosphine
WT Wildtype
XAS X-ray absorption spectroscopy
1
Chapter 1 Introduction
1
1.1 Biological relevance of Ni(II)
Nickel is not typically considered to be a biologically important element, however it is used by
fungi, algae, archaebacteria, eubacteria and higher plants (1-4). These organisms exploit nickel
reactivity in the active sites of various enzymes that are important for reactions such as carbon
dioxide and carbon monoxide metabolism, hydrogen uptake and production, and hydrolysis of
urea (5, 6). Many microorganisms employ nickel-mediated processes to enable colonization in
environments that are often regarded as inhospitable. For example, the urease enzyme facilitates
Helicobacter pylori colonization in the human acidic gastric mucosa by producing ammonia to
help neutralize the immediate microenvironment of the microbe (7, 8). Another example is
carbon monoxide dehydrogenase, which oxidizes CO to CO2 and enables the host organism to
grow on this simple and toxic compound (9). Although nickel is absolutely required in these
enzyme systems as a central component of their catalytic mechanisms, it can only be found in
trace amounts in the environment (4, 10). Furthermore, when nickel is available to the organism,
the accumulation of unprotected metal ions must be minimized to prevent potential cellular
damage. Therefore efficient uptake systems, nickel-sensors and regulators, as well as specific
and high affinity nickel-trafficking proteins are necessary to safely meet the enzymatic demand
for nickel (5).
The active sites of nickel-containing enzymes often require a cooperative assembly system of
dedicated accessory proteins to biosynthesize non-protein components and to deliver the metal
cofactors (11). Those proteins that are responsible for shuttling the nickel are termed nickel
chaperones and they are thought to transfer the nickel to the enzyme precursors through protein-
protein interactions. Some of these nickel chaperones may also take on additional roles and
participate in the overall nickel homeostasis of the cell by serving as nickel storage proteins.
How these nickel chaperones bind the nickel ions and how they interact with other accessory
1Sections of this chapter were taken from the following review article: Kaluarachchi, H., Chan Chung, K.
C., Zamble D. B., (2010). Microbial nickel proteins, Nat. Prod. Rep., 27, 681-694. HK and KCC are co-
first authors of this review article.
2
proteins to transport and insert the nickel to the target enzymes are questions that are just
beginning to be answered.
1.2 The [NiFe]-hydrogenases
The [NiFe]-hydrogenase enzymes, expressed in a wide range of bacteria and archaea, catalyze
the formation of hydrogen gas from protons and electrons as well as the reverse reaction (12, 13).
This class of hydrogenase can abate excess reducing equivalents in the cell by using protons as
electron acceptors or they can oxidize hydrogen and couple the resulting electrons to various
electron carriers for energy generation. It is therefore not surprising that this enzyme is found in
a variety of organisms that are able to survive and proliferate in hydrogen-rich environments.
One notable example is in the gastrointestinal tract of humans where colonic fermentation results
in the production of hydrogen gas that is subsequently used as an energy source by [NiFe]-
hydrogenase-containing pathogens (14, 15).
[NiFe] hydrogenase is a heterodimeric enzyme composed of a small subunit, containing iron-
sulfur clusters that relay electrons between the active site and redox partners, as well as a large
subunit (LS) with the embedded binuclear nickel- and iron-containing catalytic center (11). The
binuclear metallocenter is one of the most interesting features of the enzyme with the iron atom
coordinated to one CO and two CN ligands and bridged via two cysteine residues to the nickel
ion that has two additional cysteine ligands (Figure 1-1) (16, 17). Various accessory proteins are
required to assemble the ligands and chaperone the metal cofactors of this intricate metallocenter
onto two CXXC motifs of the LS (5, 11, 18). These accessory factors include proteins that are
encoded by the hyp (hydrogenase pleiotropic) genes hypA-hypF (19) or homologs of the Hyp
proteins that are involved in the maturation of specific hydrogenase isoforms, as well as
additional auxiliary proteins (5).
The current model of [NiFe]-hydrogenase biosynthesis (Figure 1-1) proceeds in two steps
consisting of delivery of the iron complex with the coordinated inorganic ligands followed by
nickel insertion. This order of addition is supported by the purification of hydrogenase from
Ralstonia eutropha with an incomplete metallocenter containing iron but lacking the nickel (20,
21). The formation of the unusual CN ligands is catalyzed by two dedicated maturation proteins,
HypE and HypF (22). HypF is responsible for catalyzing activation of carbamoyl phosphate (23)
3
and through an interaction with HypE a carboxamide group from the substrate is transferred to
the C-terminal cysteine of HypE in a reaction driven by ATP hydrolysis (22, 24). Hydrolysis of
carboxamide and a second ATP subsequently produces a thiocyanate adduct on HypE which is
then transferred to a reduced HypC-HypD complex (25, 26). HypD contains a [4Fe-4S] cluster
and it has been postulated that this could be the source of the iron atom of the hydrogenase
metallocenter and/or it could provide reducing equivalents for the attachment of the ligands to
iron (26, 27). In addition, recent evidence from the R. eutropha H16 system suggests that the
iron center may be loaded with its diatomic ligands prior to transfer to the hydrogenase LS (28).
The insertion of the iron is dependent on a conserved N-terminal cysteine residue on HypC
which is critical for association with either HypD or the LS in separate steps of the maturation
pathway (29).
Figure 1-1. Biosynthetic pathways of [NiFe]-hydrogenase. Working model for the assembly of the
[NiFe] center on the large subunit (LS) of the [NiFe]-hydrogenase, based primarily on our understanding
of the E. coli factors. HycE is the LS of hydrogenase 3. HypC and HypA can be replaced by the
homologous HybG and HybF, respectively, and SlyD is not found in all organisms. HycI is the
hydrogenase 3 isoform-specific protease that senses Ni(II) insertion and cleaves the C-terminus of the LS.
Assembly and association with the small subunit are not shown. The structures shown are the LS and
[NiFe] active site of the ready-oxidized form of the [NiFe]-hydrogenase from Desulfovibrio
fructosovorans (pdb 1YRQ). The presence of the bridging ligand and its identity depend on the state of
the enzyme. The colour scheme is as follows nickel, green; iron, orange; sulfur, yellow; oxygen, red;
nitrogen, blue. Structure was generated with MacPymol.
In addition to a role in iron delivery, it has been suggested that HypC or the homolog HybG act
as a chaperone to keep the LS from misfolding and to maintain a conformational state that
4
enables the nickel ion to access the active site (30). An investigation of the interaction between
HypC and HycE (the LS of Escherichia coli hydrogenase 3) revealed a possible mechanism of
conformational rearrangement of HycE during iron and nickel insertion where HypC masks the
first cysteine residue in the first CXXC motif in HycE through an interaction that cannot be
inhibited by reducing agents (31). This step is then followed by coordination of the second
cysteine in the motif to the iron (31).
The second step in the maturation pathway is insertion of the nickel ion to the active site and is
carried out by the dedicated nickel chaperones HypA, HypB and SlyD. HypA is a metal-binding
protein that is implicated in the nickel insertion step of hydrogenase maturation because lesions
in the hypA gene result in strains that lack hydrogenase activity and the phenotype can be
partially rescued by nickel supplementation to the growth media (32, 33). Interestingly, E. coli
expresses HypA as well as a homolog, HybF, each of which has a certain degree of specificity
for hydrogenase 3 or the hydrogenase 1 and 2 isoenzymes, respectively (33, 34). E. coli HypA
and HybF as well as HypA proteins from other organisms share conserved histidine and
glutamate residues at positions 2 and 3 as well as four conserved cysteine residues that are
localized within a pair of CXXC motifs (34-36). These latter motifs are ideal coordination sites
for structural zinc ions and are commonly found in domains that facilitate interactions with other
biomolecules (37). HypA binds stoichiometric amounts of zinc with nanomolar affinity (34, 38)
and two recently-solved HypA structures verified the tetrahedral coordination of the zinc ion to a
tetrathiolate site (36, 38-40). A second metal-binding site in HypA includes the conserved N-
terminal residues (Met1,His2,Glu3) and binds nickel with micromolar affinity in an octahedral
geometry (34, 36, 38, 41). Given the assignment of separate HypA homologs for the
biosynthesis of the different hydrogenase isoforms in E. coli and also considering its structural
zinc domain, it is feasible that HypA acts as a scaffold protein for the metallocenter assembly
process on the hydrogenase LS (34, 42). Along these lines, it has been noted that a variable
region in the zinc domain of HypA homologs could interact with distinct hydrogenase LSs given
the variability in the hydrogenase enzymes themselves (40). It is possible that HypA is the
immediate source of nickel for the hydrogenase enzyme, and that nickel binding or release
modulates how HypA interacts with the appropriate LS. However, it is unlikely that HypA
functions on its own. HypB (discussed below) is another metal-binding protein required for
nickel incorporation during maturation of the [NiFe]-hydrogenase and complex formation
between HypA and HypB has been demonstrated in vitro (38, 41).
5
Ni(II) insertion by the nickel insertion complex and subsequent coordination of the metal ion by
both cysteines induces cleavage of a C-terminal peptide of HycE by the endopeptidase HycI after
HypC dissociates from the large subunit (43). The exact mechanism of this endoproteolytic
cleavage event is still unknown and the reaction is not inhibited by conventional inhibitors of
serine or metalloproteases (44). What is evident however, is a requirement for nickel loading
prior to C-terminal processing (45). Recent structures of E. coli HycI (specific for hydrogenase
3) are supportive of a model whereby recognition of nickel-bound hydrogenase triggers
conformational changes in the endoprotease resulting in cleavage of the hydrogenase C-terminus
(46, 47). The cleavage site of the [NiFe]-hydrogenase LS occurs at the C-terminal end of a
histidine or arginine residue found three amino acids downstream from the last cysteine in the
DPCXXCXXH(R) motif (44). Once cleavage is completed, a conformational rearrangement
brings the C-terminus inwards and closes the bridge between the two metals by allowing
coordination of the final cysteine at the C-terminus (43, 48).
The assembly of the [NiFe] active site in hydrogenase represents a highly complex, yet
incredibly well organized cooperative mechanism. Thus far, and possibly due to the alluring
nature of the irregular cyanide and carbon monoxide ligands, significant efforts have been
invested in delineating the steps of the biosynthesis pathway revolving around the iron complex.
However, information on the players of the nickel insertion step is beginning to emerge.
1.3 HypB
Hydrogenase maturation and activity is compromised in strains with deletions of hypB and as
with ∆hypA strains, partial enzyme reconstitution is achieved when the growth media is
supplemented with extra nickel (19, 32, 49, 50). HypB has an essential GTPase activity that is
required for hydrogenase maturation and nickel insertion in vivo (49, 51, 52). This activity is
intrinsically low, with a kcat of 0.2 min-1
and a KM of 4-7 μM for the E. coli and Bradyrhizobium
japonicum proteins (53, 54). It is likely that the activity is stimulated in the context of the
complete biosynthetic pathway, but the role of GTP hydrolysis is not yet known. Nucleotide
binding to HypB occurs at the C-terminal domain of the protein (G-domain) and a structure of
HypB from Methanocaldococcus jannaschii revealed that the GTP-binding site bridges a protein
homodimer (Figure 1-2A) (55). Within this G-domain, conserved cysteine and histidine residues
6
Figure 1-2. HypB. (A) Structure of HypB from M. jannaschii (pdb 2HF8). Two GTP molecules are
bound at the interface of the protein dimer. Two zinc ions (silver) are also bound at the interface of the
protein dimer to conserved Cys95 and Cys127 from one monomer and Cys95, Cys127 and His96 from
the other, as well as several solvent molecules. The corresponding E. coli numbering is Cys166, His167
and Cys198. This homolog does not have the N-terminal sequence found in the E. coli protein. Zinc ions
are also bound on the surface to His100 and His104 as well as residues from a molecule of the adjacent
crystal contact (not shown). The color scheme is magnesium, lime; zinc, silver; nickel, green; oxygen,
red; sulfur, yellow; phosphorus, orange; carbons of the GTPS, cyan; and nitrogen, blue. The pictures
were generated by using MacPymol. (B) Truncated sequence alignment of selected HypB proteins
performed with T-Coffee (56). The CXXCGC motifs and conserved cysteines and histidine from the G-
domain are highlighted in yellow and purple, respectively.
A
B
B
7
form a metal-binding site (see Figure 1-2B for alignment) that in the E. coli protein can bind zinc
with a KD of 1 µM and nickel with an order of magnitude weaker affinity (57). Mutations of
C166 or H167 in E. coli HypB disrupts metal-binding to this low-affinity metal site in vitro (57)
and hydrogenase activity was abrogated in strains expressing these HypB mutants (58). The
structure of M. jannaschii HypB also has metal bound to the corresponding residues as well as
the cysteine corresponding to C198, with an asymmetric dinuclear zinc site at the homodimer
interface and a single cysteine from one of the monomers bridging the two zinc metals (Figure 1-
2A) (55).
Some HypB homologs have a CXXCGC motif at the N-terminus (Figure 1-2B) which
contributes to a second metal-binding site. In E. coli HypB, the cysteines in this sequence bind
nickel with picomolar affinity (57) and mutations of these cysteines also abrogated hydrogenase
production in vivo (58). A combination of X-ray absorption spectroscopy (XAS) analysis,
mutagenesis, and chemical modification were used to demonstrate that the initial methionine is
removed and nickel is bound in a square planar geometry with coordination to the amino
terminal nitrogen as well as the three cysteines (57, 58). The location of this tight nickel site at
the beginning of the primary sequence of HypB makes it tempting to speculate that it competes
for nickel in the E. coli cytoplasm, ensuring that sufficient nickel is directed towards the
hydrogenase enzymes, and that it acts as a flexible nickel delivery arm, perhaps in complex with
HypA. However, this site is not conserved so it must have a function that meets the specific
requirements of only certain microorganisms. Furthermore, if the nickel in this high-affinity site
is passed on to other proteins, there must be a change in the site that activates release of the
metal.
Now that each of the nickel- and zinc-binding properties of HypB has been characterized
individually, the question arises as to how they relate to each other within the function of HypB.
XAS analysis of E. coli HypB suggested that the two sites subtly influence each other, indicating
that the two metal sites are not independent (58) Furthermore, one of the ligands of the low-
affinity metal site is part of the GTPase switch II motif, which contributes to the protein
conformational response to GTP hydrolysis. It has been suggested that the reorganization of the
low-affinity metal-binding site of E. coli HypB upon nickel-binding to the high-affinity site
could lead to conformational changes of the protein that provide a link between the GTPase
activity and the metal-binding sites (58). These observations suggest a role for the G-domain
8
metal-binding site as a structural component that recognizes nickel binding or release from the
N-terminal domain and subsequently activates GTP hydrolysis. Supporting this hypothesis, a
recent analysis of HypB has shown that metal binding to the G-domain has an inhibitory affect
on the GTPase activity of the protein (59). This link between metal-binding and enzyme activity
is essential because mutating the ligands of the G-domain metal site of HypB abrogates all
hydrogenase production in E. coli (60). Therefore, it is likely that the low-affinity site binds
metal in vivo and contributes directly to nickel insertion. It has also been proposed that the
GTPase activity may be required for associations between the nickel-insertion factors or for
nickel-insertion protein complex dissociation following nickel ion delivery to the hydrogenase
(5, 42).
Some HypB homologs also contain a histidine-rich region near the N-terminus capable of
binding multiple nickel ions (35, 50, 54). This polyhistidine stretch is important in nickel
storage, ensuring nickel sequestration for subsequent hydrogenase maturation during nickel
deprivation (61). In the cases of organisms with a HypB that lacks the histidine-rich stretch such
as E. coli and H. pylori it was believed that sufficient levels of nickel were made available by
efficient nickel-transport systems (13, 62). However, the role of nickel-storage factor in E. coli
has since been assigned to SlyD.
1.4 SlyD
The lack of a histidine-rich region in E. coli HypB prompted a search for possible nickel storage
proteins that could contribute to the hydrogenase biosynthetic pathway in this organism.
Experiments using pull-down assays of genomically-tagged HypB resulted in the identification
of SlyD as a partner protein (63), and this interaction has also recently been observed between
the H. pylori proteins (64). A role for SlyD during hydrogenase maturation was established with
∆slyD strains of E. coli, which exhibit deficient hydrogenase activity and overall less nickel
uptake (63).
SlyD was originally discovered as a protein that is required to render E. coli sensitive to lysis
mediated by the phage ΦΧ174 (65). The protein stabilizes the viral lysis protein E and bacteria
carrying mutations in the slyD gene are resistant to lysis, hence its acronym sensitive to lysis D
(65). SlyD is a multi-domain protein with a well folded N-terminal region corresponding to a
9
FKBP domain (FK-506 binding protein) with PPIase activity (peptidyl-prolyl isomerase) and a
chaperone domain that assists in protein folding by binding to unfolded/aggregated proteins
(Figure 1-3A) (66, 67). PPIases are ubiquitous enzymes that catalyzes one of the slowest steps
during protein folding, the trans-to-cis isomerization of Xaa-Pro bonds. Typically these
isomerases are divided into three families which include the cyclophilins, the paruvalins, and
FKBPs, and most prolyl-isomerases that assist in cellular protein folding falls into this last class
(68). The general organization of secondary structure elements classifies SlyD as a typical
FKBP protein although it has low sequence identity to the human FKBP12 (hFKBP12) (67).
The chaperone-like activity of SlyD resides in the characteristic insertion within the PPIase
domain termed the “flap” region in hFKBP12, thus this extended chaperone domain is called the
insertion-in-flap (IF) in SlyD (67). This chaperone module binds to unfolded or aggregated
polypeptides and overrides the inherently high sequence specificity of the prolyl isomerase site
thereby enabling the SlyD to function as a general protein-folding protein (68, 69). Supporting
the chaperone activity of SlyD, recent analysis of SlyD complexes in vivo indicate that this
protein interacts directly with the large subunit of the hydrogenase-3 isozyme, HycE (70). This
interaction occurs even before the initial metallocentre assembly step, the iron insertion. SlyD-
HycE interaction is mediated via the IF domain of SlyD, thus it is assumed to function as a
chaperone by keeping the precursor enzyme in a partially unfolded state to allow metal insertion.
While the chaperone function of SlyD is useful for enzyme maturation, the isomerase activity is
not required for hydrogenase maturation in E. coli because mutations that eliminate the PPIase
activity in vitro do not reduce hydrogenase production to the level of the ∆slyD strain in vivo
(71).
Unlike the conserved N-terminal domains of SlyD, the C-terminal region is variable in SlyD
homologues (72) (Figure 1-3B). In E. coli SlyD the final 50 residues include 28 potential metal-
binding amino acids (6 Cys, 15 His, 2 Glu, 5 Asp) and is therefore called the metal-binding
domain (MBD). This domain is unstructured according to NMR data (66, 67), and has the ability
to bind several nickel ions (73), so the protein is expected to function as a nickel storage protein.
The importance of this unique MBD is further supported because truncation of the metal-binding
domain abrogates the activity of SlyD in hydrogenase production (74). Interestingly, metal
binding at the C-terminus can regulate the PPIase activity of the protein (73) therefore providing
what seems to be a switch-type mechanism to turn off one of its activities upon metal binding.
10
Figure 1-3. SlyD. (A) The solution structure of SlyD from E. coli (67), colour coded according to the
secondary structure elements. The domains are labeled and only part of the unstructured metal-binding
domain (MB domain) corresponding to residues 146-165 is shown. (B) Sequence alignment of SlyD
proteins performed with T-Coffee (56). The His and Cys residues are in green and red respectively. The
shaded sequence corresponds to the variable metal-binding domains of SlyD homologs.
SlyD and HypB form a heterodimer through the proline-containing linker region of HypB
between the high-affinity N-terminal metal-binding site and the G-domain, and a loop in the IF
domain of SlyD (74). Complex formation between the two proteins is important for the
hydrogenase-related function of SlyD in vivo, because disruption of this interaction through
mutagenesis of hypB results in decreased but not complete loss of hydrogenase activity, to the
same extent as that observed in the ∆slyD strain (74). In addition, complex formation with SlyD
accelerates nickel release from the high-affinity N-terminal metal-binding site of HypB (74), an
10 20 30 40 50 60 70 80
....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....|
E. coli MKVAK----D LVVSLAYQVR TEDG-VLVDE SPVSAPLDYL HGHGSLISGL ETALEGHEVG DKFDVAVGAN DAYGQYDENL 75
V. cholera MKIEK----N TVASLAYQLT IEDG-VVVDQ STVDAPLDYL HGHNNLITGL ERELEGKVAG DKFTVTIAPE DAYGEHNEDL 75
H. pylori MQNHDLESIK QAALIEYEVR EQGSSIVLDS NISKEPLEFI IGTNQIIAGL EKAVLKAQIG EWEEVVIAPE EAYGVYESSY 80
H. influenzae MKVEK----N VVVSISYQVR TQDG-VLVDE APANQPLEYL QGHNNLVIGL EKALEGKEVG DKFEVRVQPE EGYGAYSENM 75
T. thermophilus MKVGQ----D KVVTIRYTLQ VEG-E-VLDQ G----ELSYL HGHRNLIPGL EEALEGREEG EAFQAHVPAE KAYGPHDPEG 70
*: . . .. : * : :. ::*. *.:: * .:: ** * : * : . : .: ..** :. .
90 100 110 120 130 140 150 160
....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....|
E. coli VQRVPKDVFM GVDELQVGMR FLAETD-QGP VPVEITAVED DHVVVDGNHM LAGQNLKFNV EVVAIREATE EELAHGHVHG 154
V. cholera VQRVPADVFQ GVDELEVGMR FLADTD-QGP IPVEITEVDG DEVVVDGNHM LAGQSLTFTV EVVAVRAATE DEIAHGHIHQ 154
H. pylori LQEVPRDQFE GI-ELEKGMS VFGQTEDNQT IQAIIKDFSA THVMVDYNHP LAGKTLAFRF KVLGFREVSE EEILASHHGG 159
H. influenzae VQRVPKDVFQ GVDELEVGMR FLADTD-IGP VPVVITEIDG DEVVVDGNHM LAGQELHFTV EVVAAREATL EEIAHGHVHG 154
T. thermophilus VQVVPLSAFP EDAEVVPGAQ FYAQDMEGNP MPLTVVAVEG EEVTVDFNHP LAGKDLDFQV EVVKVREATP EELLHGHA-- 148
:* ** . * *: * . .: . : : .. .* ** ** ***: * * . :*: * .: :*: .*
170 180 190 200 210
....|....| ....|....| ....|....| ....|....| ....|....| .
E. coli A----HDHHH DHDHD-GC-C GG--HGHDH- GHEHGGEGCC GGKGNGGCGC H 196
V. cholera AGGCGHDHDH DHDHEGGC-C GGEGHGHDHH GHGKKEGGCC G---GGGCGS H 201
H. pylori G--------- ----T-GC-C GG--HGG-H- GGKKG-GG-C G----CSCSH G 185
H. influenzae A----HSHDD DEEGH-GCGC GG--HHHEH- NHEHNHGSC- ------GCGG H 190
T. thermophilus ---------- ---------- ---------- ---------- ---------- H 149
(B)
(A)
PPIase
domain
IF
domain
MB
domain
11
activity of SlyD that requires its metal-binding domain. These observations support an active
role for SlyD in hydrogenase maturation beyond that of a nickel source, where SlyD modulates
the affinity of the nickel site on HypB.
1.5 Purpose of study
It is clear that SlyD plays an important role in [NiFe]-hydrogenase biosynthsis in E. coli and can
also contribute to Ni(II) homeostasis in this bacterium. While in vivo a Ni(II)-associated
function of SlyD has been established, how this protein binds Ni(II) was not well understood.
Therefore, using several spectroscopic techniques, electrospray-ionization mass spectrometry
(ESI-MS) and molecular biology, an in-depth investigation was conducted to understand the in
vitro nickel-binding activity of SlyD as described in Chapter 2. In addition to Ni(II), SlyD was
also known to bind to other transition metals in vitro (75), bringing forth the issue of metal-
selectivity of SlyD. In an effort to understand whether SlyD could selectively bind Ni(II), the
metal-binding ability of SlyD to several transition metals was investigated in vitro and its role in
metal homeostasis in vivo was examined. These studies are presented in Chapter 3. Finally,
SlyD has the ability to bind several nickel ions and is hypothesized to function as a reservoir of
Ni(II) that is used for [NiFe]-hydrogenase assembly. Chapter 4 is dedicated to examining this
hypothesis and understanding how nickel may be mobilized to the active site of the precursor
enzyme. While nickel mobilization to the hydrogenase enzyme is considered to be carried out by
HypA, HypB and SlyD, how the coordinated action of these proteins leads to successful
biogenesis of the enzyme is not well understood. Therefore, the consequences of the interaction
between HypB and SlyD nickel metallochaperones were examined and the importance of this
HypB-SlyD interaction is presented in Chapter 4.
12
References
1. Fontecilla-Camps, J. C. (1998) Biological Nickel, Struct. Bonding 91, 1-30.
2. Gerendás, J., Polacco, J. C., Freyermuth, S. K., and Sattelmacher, B. (1999) Significance
of nickel for plant growth and metabolism, J. Plant Nutr. Soil Sci. 162, 241-256.
3. Mulrooney, S. B., and Hausinger, R. P. (2003) Nickel uptake and utilization by
microorganisms, FEMS Microbiol. Rev. 27, 239-261.
4. Muyssen, B. T. A., Brix, K. V., DeForest, D. K., and Janssen, C. R. (2004) Nickel
essentiality and homeostasis in aquatic organisms, Environ. Rev. 12, 113-131.
5. Li, Y., and Zamble, D. B. (2009) Nickel homeostasis and nickel regulation: an overview,
Chem. Rev. 109, 4617-4643.
6. Ragsdale, S. W. (2009) Nickel-based Enzyme Systems, J. Biol. Chem. 284, 18571-18575.
7. Bauerfeind, P., Garner, R., Dunn, B. E., and Mobley, H. L. (1997) Synthesis and activity
of Helicobacter pylori urease and catalase at low pH, Gut 40, 25-30.
8. Maier, R. J., Benoit, S. L., and Seshadri, S. (2007) Nickel-binding and accessory proteins
facilitating Ni-enzyme maturation in Helicobacter pylori, BioMetals 20, 655-664.
9. Ragsdale, S. W. (2007) Nickel and the carbon cycle, J. Inorg. Biochem. 101, 1657-1666.
10. Nieminen, T. M., Ukonmaanaho, L., Rausch, N., and Shotyk, W. (2007) Biogeochemistry
of nickel and its release into the environment, in Metal Ions in Life Sciences (Sigel, A.,
Sigel, H., and Sigel, R. K. O., Eds.), John Wiley and Sons.
11. Kuchar, J., and Hausinger, R. P. (2004) Biosynthesis of metal sites, Chem. Rev. 104, 509-
525.
12. Vignais, P. M., and Billoud, B. (2007) Occurrence, classification, and biological function
of hydrogenases: an overview, Chem. Rev. 107, 4206-4272.
13. Casalot, L., and Rousset, M. (2001) Maturation of the [NiFe] hydrogenases, Trends
Microbiol. 9, 228-237.
14. Olson, J. W., and Maier, R. J. (2002) Molecular hydrogen as an energy source for
Helicobacter pylori, Science 298, 1788-1790.
15. Maier, R. J. (2005) Use of molecular hydrogen as an energy source substrate by human
pathogenic bacteria, Biochem. Soc. Trans. 33, 83-85.
16. Fontecilla-Camps, J. C., Volbeda, A., Cavazza, C., and Nicolet, Y. (2007)
Structure/function relationships of [NiFe]- and [FeFe]-hydrogenases, Chem. Rev. 107,
4273-4303.
17. Volbeda, A., and Fontecilla-Camps, J. C. (2003) The active site and catalytic mechanism
of NiFe hydrogenases, Dalton Trans. 4030-4038.
18. Böck, A., King, P. W., Blokesch, M., and Posewitz, M. C. (2006) Maturation of
hydrogenases, Adv. Microb. Physiol. 51, 1-71.
19. Jacobi, A., Rossmann, R., and Bock, A. (1992) The hyp operon gene products are
required for the maturation of catalytically active hydrogenase isoenzymes in Escherichia
coli, Arch. Microbiol. 158, 444-451.
20. Winter, G., Buhrke, T., Lenz, O., Jones, A. K., Forgber, M., and Friedrich, B. (2005) A
model system for [NiFe] hydrogenase maturation studies: Purification of an active site-
containing hydrogenase large subunit without small subunit, FEBS Lett. 579, 4292-4296.
21. Löscher, S., Zebger, I., Andersen, L. K., Hildebrandt, P., Meyer-Klaucke, W., and
Haumann, M. (2005) The structure of the Ni-Fe site in the isolated HoxC subunit of the
hydrogen-sensing hydrogenase from Ralstonia eutropha, FEBS Lett. 579, 4287-4291.
13
22. Blokesch, M., Paschos, A., Bauer, A., Reissmann, S., Drapal, N., and Bock, A. (2004)
Analysis of the transcarbamoylation-dehydration reaction catalyzed by the hydrogenase
maturation proteins HypF and HypE, Eur. J. Biochem. 271, 3428-3436.
23. Paschos, A., Bauer, A., Zimmermann, A., Zehelein, E., and Bock, A. (2002) HypF, a
carbamoyl phosphate-converting enzyme involved in [NiFe] hydrogenase maturation, J.
Biol. Chem. 277, 49945-49951.
24. Rangarajan, E. S., Asinas, A., Proteau, A., Munger, C., Baardsnes, J., Iannuzzi, P., Matte,
A., and Cygler, M. (2008) Structure of [NiFe] hydrogenase maturation protein HypE
from Escherichia coli and its interaction with HypF, J. Bacteriol. 190, 1447-1458.
25. Reissmann, S., Hochleitner, E., Wang, H., Paschos, A., Lottspeich, F., Glass, R. S., and
Bock, A. (2003) Taming of a poison: biosynthesis of the NiFe-hydrogenase cyanide
ligands, Science 299, 1067-1070.
26. Blokesch, M., Albracht, S. P., Matzanke, B. F., Drapal, N. M., Jacobi, A., and Bock, A.
(2004) The complex between hydrogenase-maturation proteins HypC and HypD is an
intermediate in the supply of cyanide to the active site iron of [NiFe]-hydrogenases, J.
Mol. Biol. 344, 155-167.
27. Blokesch, M., and Bock, A. (2006) Properties of the [NiFe]-hydrogenase maturation
protein HypD, FEBS Lett. 580, 4065-4068.
28. Ludwig, M., Schubert, T., Zebger, I., Wisitruangsakul, N., Saggu, M., Strack, A., Lenz,
O., Hildebrandt, P., and Friedrich, B. (2009) Concerted action of two novel auxiliary
proteins in assembly of the active site in a membrane-bound [NiFe] hydrogenase, J. Biol.
Chem. 284, 2159-2168.
29. Blokesch, M., and Bock, A. (2002) Maturation of [NiFe]-hydrogenases in Escherichia
coli: the HypC cycle, J. Mol. Biol. 324, 287-296.
30. Drapal, N., and Bock, A. (1998) Interaction of the hydrogenase accessory protein HypC
with HycE, the large subunit of Escherichia coli hydrogenase 3 during enzyme
maturation, Biochemistry 37, 2941-2948.
31. Magalon, A., and Bock, A. (2000) Analysis of the HypC-hycE complex, a key
intermediate in the assembly of the metal center of the Escherichia coli hydrogenase 3, J.
Biol. Chem. 275, 21114-21120.
32. Olson, J. W., Mehta, N. S., and Maier, R. J. (2001) Requirement of nickel metabolism
proteins HypA and HypB for full activity of both hydrogenase and urease in Helicobacter
pylori, Mol. Microbiol. 39, 176-182.
33. Hube, M., Blokesch, M., and Bock, A. (2002) Network of hydrogenase maturation in
Escherichia coli: role of accessory proteins HypA and HybF, J. Bacteriol. 184, 3879-
3885.
34. Blokesch, M., Rohrmoser, M., Rode, S., and Bock, A. (2004) HybF, a zinc-containing
protein involved in NiFe hydrogenase maturation, J. Bacteriol. 186, 2603-2611.
35. Fu, C., and Maier, R. J. (1994) Nucleotide sequences of two hydrogenase-related genes
(hypA and hypB) from Bradyrhizobium japonicum, one of which (hypB) encodes an
extremely histidine-rich region and guanine nucleotide-binding domains, Biochim.
Biophys. Acta. 1184, 135-138.
36. Xia, W., Li, H., Sze, K. H., and Sun, H. (2009) Structure of a nickel chaperone, HypA,
from Helicobacter pylori reveals two distinct metal binding sites, J. Am. Chem. Soc. 131,
10031-10040.
37. Gamsjaeger, R., Liew, C. K., Loughlin, F. E., Crossley, M., and Mackay, J. P. (2007)
Sticky fingers: zinc-fingers as protein-recognition motifs, Trends Biochem. Sci. 32, 63-
70.
14
38. Atanassova, A., and Zamble, D. B. (2005) Escherichia coli HypA is a zinc metalloprotein
with a weak affinity for nickel, J. Bacteriol. 187, 4689-4697.
39. Kennedy, D. C., Herbst, R. W., Iwig, J. S., Chivers, P. T., and Maroney, M. J. (2007) A
dynamic Zn site in Helicobacter pylori HypA: a potential mechanism for metal-specific
protein activity, J. Am. Chem. Soc. 129, 16-17.
40. Watanabe, S., Arai, T., Matsumi, R., Atomi, H., Imanaka, T., and Miki, K. (2009) Crystal
Structure of HypA, a Nickel-Binding Metallochaperone for [NiFe] Hydrogenase
Maturation, J. Mol. Biol. 394.
41. Mehta, N., Olson, J. W., and Maier, R. J. (2003) Characterization of Helicobacter pylori
nickel metabolism accessory proteins needed for maturation of both urease and
hydrogenase, J. Bacteriol. 185, 726-734.
42. Leach, M. R., and Zamble, D. B. (2007) Metallocenter assembly of the hydrogenase
enzymes, Curr. Opin. Chem. Biol. 11, 159-165.
43. Magalon, A., and Bock, A. (2000) Dissection of the maturation reactions of the [NiFe]
hydrogenase 3 from Escherichia coli taking place after nickel incorporation, FEBS Lett.
473, 254-258.
44. Rossmann, R., Maier, T., Lottspeich, F., and Bock, A. (1995) Characterisation of a
protease from Escherichia coli involved in hydrogenase maturation, Eur. J. Biochem.
227, 545-550.
45. Rossmann, R., Sauter, M., Lottspeich, F., and Bock, A. (1994) Maturation of the large
subunit (HYCE) of Escherichia coli hydrogenase 3 requires nickel incorporation
followed by C-terminal processing at Arg537, Eur. J. Biochem. 220, 377-384.
46. Yang, F., Hu, W., Xu, H., Li, C., Xia, B., and Jin, C. (2007) Solution structure and
backbone dynamics of an endopeptidase HycI from Escherichia coli: implications for
mechanism of the [NiFe] hydrogenase maturation, J. Biol. Chem. 282, 3856-3863.
47. Kumarevel, T., Tanaka, T., Bessho, Y., Shinkai, A., and Yokoyama, S. (2009) Crystal
structure of hydrogenase maturating endopeptidase HycI from Escherichia coli, Biochem.
Biophys. Res. Comm. 389, 310-314.
48. Theodoratou, E., Huber, R., and Bock, A. (2005) [NiFe]-Hydrogenase maturation
endopeptidase: structure and function, Biochem. Soc. Trans. 33, 108-111.
49. Maier, T., Lottspeich, F., and Bock, A. (1995) GTP hydrolysis by HypB is essential for
nickel insertion into hydrogenases of Escherichia coli, Eur. J. Biochem. 230, 133-138.
50. Rey, L., Imperial, J., Palacios, J. M., and Ruiz-Argueso, T. (1994) Purification of
Rhizobium leguminosarum HypB, a nickel-binding protein required for hydrogenase
synthesis, J. Bacteriol. 176, 6066-6073.
51. Olson, J. W., and Maier, R. J. (2000) Dual roles of Bradyrhizobium japonicum nickelin
protein in nickel storage and GTP-dependent Ni mobilization, J. Bacteriol. 182, 1702-
1705.
52. Mehta, N., Benoit, S., and Maier, R. J. (2003) Roles of conserved nucleotide-binding
domains in accessory proteins, HypB and UreG, in the maturation of nickel-enzymes
required for efficient Helicobacter pylori colonization, Microb. Pathog. 35, 229-234.
53. Maier, T., Jacobi, A., Sauter, M., and Bock, A. (1993) The product of the hypB gene,
which is required for nickel incorporation into hydrogenases, is a novel guanine
nucleotide-binding protein, J. Bacteriol. 175, 630-635.
54. Fu, C., Olson, J. W., and Maier, R. J. (1995) HypB protein of Bradyrhizobium japonicum
is a metal-binding GTPase capable of binding 18 divalent nickel ions per dimer, Proc.
Nat. Acad. Sci. U. S. A. 92, 2333-2337.
15
55. Gasper, R., Scrima, A., and Wittinghofer, A. (2006) Structural insights into HypB, a
GTP-binding protein that regulates metal binding, J. Biol. Chem. 281, 27492-27502.
56. Notredame, C., Higgins, D., and Heringa, J. (2000) T-Coffee: A novel method for
multiple sequence alignments, J. Mol. Biol. 302, 205-217.
57. Leach, M. R., Sandal, S., Sun, H., and Zamble, D. B. (2005) Metal binding activity of the
Escherichia coli hydrogenase maturation factor HypB, Biochemistry 44, 12229-12238.
58. Chan Chung, K. C., Cao, L., Dias, A. V., Pickering, I. J., George, G. N., and Zamble, D.
B. (2008) A high-affinity metal-binding peptide from Escherichia coli HypB, J. Am.
Chem. Soc. 130, 14056-14057.
59. Cai, F., Ngu, T. T., Kaluarachchi, H., and Zamble, D. B. (2011) Relationship between the
GTPase, metal-binding, and dimerization activities of E. coli HypB, J. Biol. Inorg. Chem.
In Press.
60. Dias, A. V., Mulvihill, C. M., Leach, M. R., Pickering, I. J., George, G. N., and Zamble,
D. B. (2008) Structural and biological analysis of the metal sites of Escherichia coli
hydrogenase accessory protein HypB, Biochemistry 47, 11981-11991.
61. Olson, J. W., Fu, C., and Maier, R. J. (1997) The HypB protein from Bradyrhizobium
japonicum can store nickel and is required for the nickel-dependent transcriptional
regulation of hydrogenase, Mol. Microbiol. 24, 119-128.
62. Eitinger, T., and Mandrand-Berthelot, M. A. (2000) Nickel transport systems in
microorganisms, Arch. Microbiol. 173, 1-9.
63. Zhang, J. W., Butland, G., Greenblatt, J. F., Emili, A., and Zamble, D. B. (2005) A role
for SlyD in the Escherichia coli hydrogenase biosynthetic pathway, J. Biol. Chem. 280,
4360-4366.
64. Stingl, K., Schauer, K., Ecobichon, C., Labigne, A., Lenormand, P., Rousselle, J. C.,
Namane, A., and de Reuse, H. (2008) In vivo interactome of Helicobacter pylori urease
revealed by tandem affinity purification, Mol. Cell. Proteomics 7, 2429-2441.
65. Roof, W. D., Horne, S. M., Young, K. D., and Young, R. (1994) SlyD, a host gene
required for X174 lysis, is related to the FK506-binding protein family of peptidyl-
prolyl cis-trans-isomerases, J. Biol. Chem. 269, 2902-2910.
66. Martino, L., He, Y., Hands-Taylor, K. L., Valentine, E. R., Kelly, G., Giancola, C., and
Conte, M. R. (2009) The interaction of the Escherichia coli protein SlyD with nickel ions
illuminates the mechanism of regulation of its peptidyl-prolyl isomerase activity, FEBS J.
276, 4529-4544.
67. Weininger, U., Haupt, C., Schweimer, K., Graubner, W., Kovermann, M., Bruser, T.,
Scholz, C., Schaarschmidt, P., Zoldak, G., Schmid, F. X., and Balbach, J. (2009) NMR
solution structure of SlyD from Escherichia coli: spatial separation of prolyl isomerase
and chaperone function, J. Mol. Biol. 387, 295-305.
68. Jakob, R. P., Zoldak, G., Aumuller, T., and Schmid, F. X. (2009) Chaperone domains
convert prolyl isomerases into generic catalysts of protein folding, Proc. Natl. Acad. Sci.
U. S. A. 106, 20282-20287.
69. Zoldak, G., and Schmid, F. X. Cooperation of the prolyl isomerase and chaperone
activities of the protein folding catalyst SlyD, J. Mol. Biol. 406, 176-194.
70. Chung, K. C. C., and Zamble, D. B. (2011) The Escherichia coli metal-binding
chaperone SlyD interacts with the large subunit of [NiFe]-hydrogenase 3, FEBS Lett. 585,
291-294.
71. Zhang, J. W., Leach, M. R., and Zamble, D. B. (2007) The peptidyl-prolyl isomerase
activity of SlyD is not required for maturation of Escherichia coli hydrogenase, J.
Bacteriol. 189, 7942-7944.
16
72. Erdmann, F., and Fischer, G. (2007) The nickel-regulated peptidyl prolyl cis/trans
isomerase SlyD, in Metal Ions in Life Sciences (Sigel, A., Sigel, H., and Sigel, R. K. O.,
Eds.), pp 501-518, John Wiley and Sons.
73. Hottenrott, S., Schumann, T., Pluckthun, A., Fischer, G., and Rahfeld, J. U. (1997) The
Escherichia coli SlyD is a metal ion-regulated peptidyl-prolyl cis/trans-isomerase, J. Biol.
Chem. 272, 15697-15701.
74. Leach, M. R., Zhang, J. W., and Zamble, D. B. (2007) The role of complex formation
between the Escherichia coli hydrogenase accessory factors HypB and SlyD, J. Biol.
Chem. 282, 16177-16186.
75. Wulfing, C., Lombardero, J., and Pluckthun, A. (1994) An Escherichia coli protein
consisting of a domain homologous to FK506-binding proteins (FKBP) and a new metal
binding motif, J. Biol. Chem.269, 2895-2901.
17
Chapter 2 The Ni(II)-binding properties of the metallochaperone SlyD
2
2.1 Introduction
Nickel plays a significant role in microorganisms, where the partnership between this metal and
proteins is essential for a multitude of diverse biological functions (1-3). Only present at
nanomolar concentrations in the environment (4, 5), many organisms have evolved to utilize this
transition metal ion in a variety of metalloenzymes such as urease, [NiFe]-hydrogenase, a
superoxide dismutase, and acetyl-coenzyme A synthase (1-3). Although essential, the limited
availability and the inherently reactive nature of nickel ions create the necessity for strict control
within the cellular milieu. Hence the biogenesis of many of the intricate nickel-containing
enzyme centres requires sets of proteins that include factors dedicated to the transport and
delivery of the Ni(II) ions to the target proteins (1, 3). These soluble metal-trafficking proteins
are referred to as metallochaperones (6, 7).
The [NiFe]-hydrogenases are crucial for energy metabolism in Escherichia coli where the
enzymes catalyze the oxidation or production of hydrogen gas (8, 9). These bacteria express at
least 3 isozymes of [NiFe]-hydrogenases that all have a nickel- and iron-containing bimetallic
center at the active site (10). Most of the pleiotropic accessory proteins required for the multi-
step biosynthesis of these metallocenters are encoded by the hyp operon (8, 9, 11), and the
responsibilities of these proteins include delivery of both types of metal ions, synthesis of
organic ligands, and protein folding. Although many of the mechanistic details are not yet
known, HypA and HypB are thought to facilitate the Ni(II) insertion step of this pathway (9, 11).
Furthermore, analysis of bacterial multi-protein complexes led to the discovery that HypB forms
a complex with a protein called SlyD, which suggested that SlyD also participates in
2Reproduced with permission from Kaluarachchi, H., Sutherland, D. E. K., Young, A., Pickering, I. J.,
Stillman, M. J., and Zamble, D. B. (2009). The Ni(II)-binding properties of the metallochaperone SlyD, J.
Am. Chem. Soc.,131,18489-18500. Copyright 2009 American Chemical Society. Author contributions:
H.K performed experiments, analyzed data and wrote the paper. D.E.K.S. and A.Y., assisted during ESI-
MS data collection and analysis. I.J.P assisted in XAS data analysis and writing of the XAS sections.
M.J.S. assisted in ESI-MS data analysis and writing of the ESI-MS sections. D.B.Z analyzed data and
wrote the paper. The main text has not been changed. All tables and figures including data presented as
supplementary information have been added to the main text and renumbered.
18
hydrogenase biosynthesis (12). This hypothesis was supported by experiments with ∆slyD
strains of E. coli, which exhibited reduced activity levels of all three [NiFe]-hydrogenases (12).
That this phenotype could be complemented by the addition of excess nickel to the media
indicated that SlyD contributes specifically to the nickel-loading step of the hydrogenase
metallocenter assembly pathway (12).
Originally identified as a protein that sensitizes E. coli to lysis by bacteriophage ΦX174 (13),
SlyD is a member of the FK506-binding protein (FKBP) family of peptidyl-prolyl isomerases
(PPIase) (14, 15). The PPIase domain located at the N-terminus of the protein (Figure 2-1)
catalyzes the intrinsically slow interconversion of peptidyl-prolyl amide bonds, thereby assisting
in protein folding (16-18). In addition to the isomerase function, which is non-essential for
hydrogenase biosynthesis (19), SlyD also possesses general chaperone activity similar to many
other FKBPs (16, 18). This latter property is attributed to an additional domain inserted within a
loop of the PPIase domain termed IF (insertion in the flap) that is observed in a subset of FKBPs
(20, 21). Deletion of several residues in the SlyD IF domain prevents interaction with HypB and
abrogates its function in hydrogenase production in vivo (22).
Figure 2-1. SlyD domain architecture and amino acid sequence. The amino acid sequence is colour
coded according to the domains. The PPIase domain is homologous to the FK506-binding proteins. The
SlyD metal-binding domain is not conserved in all SlyD homologs, although many have sequences of
variable length that are rich in potential metal-binding residues.
The last fifty amino acids of SlyD encompass an unusual domain that is rich in the potential
metal-binding residues histidine, cysteine, aspartate and glutamate. Given the composition of this
domain, it is not surprising that SlyD is capable of coordinating a range of transition metal ions
such as Co(II), Ni(II), and Cu(II), as well as Zn(II) (14, 23). Several HypB homologues are also
capable of binding multiple metal ions due to his-rich sequences, and in these organisms HypB is
thought to contribute to nickel storage in addition to hydrogenase production (24). The lack of
1 196Peptidyl-Prolyl Isomerase Domain Metal-Binding Domain146
IF- Chaperone Domain
76 120MKVAKDLVVS LAYQVRTEDG VLVDESPVSA PLDYLHGHGS LISGLETALE GHEVGDKFDV
AVGANDAYGQ YDENLVQRVP KDVFMGVDEL QVGMRFLAET DQGPVPVEIT AVEDDHVVVD
GNHMLAGQNL KFNVEVVAIR EATEEELAHG HVHGAHDHHH DHDHDGCCGG HGHDHGHEHG
GEGCCGGKGN GGCGCH
19
such a region in E. coli HypB and the ability of SlyD to bind nickel ions led to the proposal that
SlyD is responsible for nickel storage in E. coli and that it serves as a source of nickel for the
production of the hydrogenase enzymes (22, 23). This hypothesis was supported by the
observations that SlyD influences nickel accumulation in this organism and that the C-terminal
domain of SlyD is required for the optimal production of hydrogenase activity (22). SlyD also
influences nickel release from a metal-binding site of HypB, suggesting another, more active task
for SlyD during hydrogenase biosynthesis (22).
The NMR solution structures of both a truncated version of E. coli SlyD (1-165) and the full-
length protein were recently reported (21, 25). The structures reveal that the PPIase and IF
domains of SlyD resemble those of other members of the FKBP family (26), but in both cases
the metal-binding regions were unstructured. To further understand the function of SlyD as a
metallochaperone and its role in nickel homeostasis, a detailed characterization of nickel binding
to SlyD is reported here. Our investigation revealed SlyD to be a monomeric protein containing
multiple metal sites of similar affinities. Nickel binding occurs via a non-cooperative
mechanism and the protein chelates nickel by using a mixture of coordination geometries.
Through the study of a range of mutants we find that the cysteine residues in the C-terminal
domain confer higher affinity as well as increased binding capacity to SlyD. Furthermore,
although this domain is primarily responsible for metal binding to SlyD, the effects of metal
binding are not limited to this domain in the protein.
2.2 Materials and Methods
Materials. Pfu DNA polymerase was purchased from Stratagene. Primers (Table 2-1) were
purchased from Sigma Genosys. All chromatography media were from GE Healthcare.
Kanamycin, tris(2-carboxyethyl)phosphine (TCEP), dithiothreitol (DTT), isopropyl-β-D-1-
galactopyranoside (IPTG) were purchased from BioShop (Toronto, ON). Metal salts were, as a
minimum, 99.9% pure and purchased from Aldrich. The concentrations of the metal stock
solutions were verified by ICP-AES. Several of the metal-binding studies were performed with
atomic absorption standard solutions (AAS grade) where noted. Other reagents were analytical
grade from Sigma. The buffers for all metal assays were treated with Chelex-100 (Bio-Rad) to
20
minimize trace metal contamination. All samples were prepared with Milli-Q water, 18.2 MΩ-
cm resistance (Millipore).
Generation of SlyD mutants. Point mutations of SlyD were generated in the parent SlyD-
pET24b vector (12) by using the QuickChange PCR mutagenesis method and Pfu polymerase
along with forward and reverse primers listed in Table 2-1. The resulting PCR plasmids were
transformed into XL-2 Blue E. coli heat-shock competent cells (Stratagene) and isolated using
Qiagen plasmid mini-prep kit. The pET24b-SlyD mutation constructs were verified by
sequencing in the forward and reverse directions (ACGT, Toronto, ON). Three different mutants
targeting each pair of cysteine residues were created and are as follows: SlyD C167, 168A, SlyD
C184,185A, and SlyD Δ193-196. A fourth mutant containing all of the above-mentioned
mutations resulting in a protein devoid of any cysteines and referred to as the Triple mutant here
onwards, was also prepared.
Table 2-1. PCR primers used for mutagenesis.
Name Sequencea
SlyD C167,168A forward 5‟-CGACCACGACGGTgcCgcCGGCGGTCATGGCC-3‟
SlyD C167,168A reverse 5‟-GGCCATGACCGCCGgcGgcACCGTCGTGGTCG-3‟
SlyD C184,185A forward 5‟-CACGGTGGCGAAGGCgcCGcAGGCGGTAAAGGCAACGG-3‟
SlyD C184,185A reverse 5‟-CCGTTGCCTTTACCGCCtgCgGcGCCTTCGCCACCGTG-3‟
SlyD ∆193-196 forward 5‟-GTAAAGGCAACGGCGGTTaaGGTTGCCACTAATACTCG-3‟
SlyD ∆193-196 reverse 5‟-CGAGTATTAGTGGCAACCttAACCGCCGTTGCCTTTAC-3‟
aThe bases corresponding to the mutated residues are underlined and the mutations are in lower case.
Protein expression and purification. SlyD wild-type (WT) protein and mutants were expressed
according to the method previously described (12), except that the mutants were expressed in a
∆slyD BL21(DE3) strain of E. coli (22). SlyD and SlyD variants were purified by using a nickel-
nitrilotriacetic acid (Ni-NTA, Qiagen) column followed by anion exchange on a MonoQ column
(GE Healthcare). The presence of SlyD in the protein fractions collected at each step was
verified by SDS-PAGE. After purification of the protein via the MonoQ column we noted that
for several fractions containing SlyD (with the exception of the Triple mutant), there was an
unexpected absorption band at 320 nm that varied in intensity. ESI-MS analysis of the protein
fractions that exhibited the 320 nm absorption did not resolve a mass difference (data not
shown), the absorption was not affected by treatment with ethylenediaminetetraacetic acid
21
(EDTA), and bound metal was not detected in metal analysis (27). We also noted that by
collecting only the fractions with A320/A280 < 0.1 (i.e. fractions without the absorption at 320 nm)
we are able to modify all the cysteine residues upon reaction with N-ethyl maleimide (NEM) (see
below for reaction conditions). In contrast, the fractions with the absorption at 320 nm could not
be completely modified by NEM and showed lower nickel binding capacity in nickel titration
experiments compared to the fully reduced protein fractions (data not shown). For these reasons,
the absorption is assigned to an oxidation product of the Cys residues but the identity of this
oxidation product is not yet known. Treatment with several reducing reagents (TCEP, dithionite,
β-meracaptoethanol, DTT) has proven unsuccessful in reducing the Cys residues to the thiolate
form while keeping the protein intact. Thus, only fractions without this absorption were pooled
and further purified via gel-filtration on a Superdex S-75 column equilibrated with 20 mM
HEPES, pH 7.5, 100 mM NaCl, 2 mM TCEP, and used in all the experiments described here.
The purity of the final protein fractions were verified by ESI-MS and the masses obtained are
listed in Table 2-2.
Table 2-2. Masses of SlyD proteins.
Protein Calculated Mass
(Da)
Mass by ESI-MS
(Da)
SlyD WT 20852.8 20852.0
SlyD C167,168A 20788.7 20788.0
SlyD C184,185A 20788.7 20788.0
SlyD ∆193-196 20452.3 20452.0
Triple mutant 20324.1 20324.0
SlyD 1-146 15833.7 15832.0
N-ethyl maleimide (NEM) modification assay. To prepare apo-protein, samples were pre-treated
with 4 mM TCEP and 20 mM EDTA overnight in an anaerobic glove box at 4oC. The protein
was then gel filtered twice through PD-10 columns (GE Healthcare) equilibrated with 20 mM
HEPES, pH 7.5, 100 mM NaCl (buffer A). An aliquot of this gel-filtered sample was reacted
with a freshly prepared NEM solution in the same buffer. The final concentration of NEM in all
reactions was approximately five times the concentration of cysteines in the protein ([NEM] = 5
× # of Cys × [protein]). The reaction samples were incubated overnight at 4 oC and were
desalted prior to analysis by ESI-MS. Only protein samples that could be fully modified at all
cysteines were used in further experiments.
22
Metal-binding experiments. Apo-protein was prepared as described above, and then incubated
with the indicated amount of Ni(II) (AAS grade diluted into buffer A) overnight at 4oC in an
anaerobic glove box. Nickel binding was monitored by using electronic absorption
spectroscopy.
Circular dichroism (CD) spectroscopy. Protein samples were pre-treated with EDTA and TCEP
as described above and buffer exchanged into 10 mM ammonium acetate, pH 7.5, using micro-
centrifugal devices (MWCO of 10,000) (Pall nanosep centrifuge devices) in an anaerobic glove
box. SlyD samples (60 µM) were incubated with known amounts of NiCl2 overnight at 4oC.
Samples were loaded into a 0.1 cm cuvette and capped to minimize exposure to air. The spectra
were collected on a Jasco J-710 spectropolarimeter by scanning in the wavelength range of
205−320 nm at room temperature. The final spectra obtained are averages of 5 scans collected
by using a scan speed of 20 nm/min. The molar ellipticity was calculated by using the equation
[Ө]= ellipticity (mdeg)/[conc. protein (M) x 10 x 0.l (cm)].
Equilibrium dialysis experiments. Microchambers of DIALYZER (Harvard Apparatus Inc.)
were utilized for equilibrium dialysis experiments that were all conducted at 4oC overnight. The
protein chamber contained 250 µL of protein solution (40 µM) in buffer A with 1 mM TCEP and
the ligand chamber was filled with 250 µL of approximately 10-fold excess NiCl2 in the same
buffer. The amount of protein-bound nickel and free nickel were determined by a high-
performance liquid chromatography (HPLC) method described previously (27). For HPLC
analysis, which was conducted in triplicate, > 50 μg of protein was dried by centrifugation under
vacuum, reconstituted with metal-free concentrated HCl (Seastar Chemicals), and hydrolyzed by
incubation overnight at 95 °C. The sample was dried again to remove HCl and reconstituted in
80 μL of MilliQ water. This sample was injected onto an IonPak CS5A column attached to a
metal-free Dionex BioLC HPLC system followed by post-column mixing with 4-(2-
pyridylazo)resorcinol (PAR) and detection at 530 nm. To determine free nickel concentration, an
equivalent volume of sample from the ligand chamber was analyzed as described above.
Analytical gel filtration. Analytical gel filtration experiments were performed on a Superdex 75-
HR column (GE Healthcare) at 4 °C with a flow rate of 0.5 mL/min and an injection volume of
100 µL. A protein concentration of 100 µM containing 2 mM TCEP was used in all gel-
filtration experiments with the column equilibrated with buffer A containing similar amounts of
23
reducing agent. SlyD samples were incubated with the indicated amounts of NiCl2 overnight at 4
°C prior to use and the column buffer for these runs was supplemented with NiCl2 concentrations
similar to that of the protein sample. The apparent molar mass of the protein (Mr) was calculated
from the eluting volume (Ve) using the equation Kav = (Ve-Vo)/(Vt-Vo), where Kav is the partition
coefficient, Vt is the total column volume and Vo is the void volume. The column was calibrated
by injecting 100 µL of the LMW gel-filtration standards kit (GE Healthcare). Calibrations and
the sample runs were conducted in triplicate to ensure reproducibility.
X-ray absorption spectroscopy (XAS) sample preparation. The purified protein solutions were
pre-treated with 2 mM TCEP and 10 mM EDTA overnight and were buffer exchanged into 20
mM HEPES pH 7.5, 100 mM NaCl and 2 mM TCEP to remove the chelator and then
concentrated by using an Amicon Ultra Centrifugal Filter Device (Millipore, MWCO = 3000 Da)
to an approximate volume of 200 μL. All protein samples were placed on ice and 0.8 equivalents
of Ni(II) (AAS grade diluted in buffer A) was added gradually in multiple small aliquots to
suppress protein aggregation. Glycerol was then added to the protein solutions to give final
concentrations of 20% (v/v). The final protein concentrations of the samples were approximately
1 mM and these were subsequently frozen with liquid nitrogen and stored at −80 °C. For XAS
data acquisition the samples were thawed, transferred to 2 mm pathlength (2 × 4 × 20 mm)
Lucite sample cuvettes, re-frozen and were maintained at 10 K using an Oxford Instruments
liquid helium flow cryostat. Analysis of holo-protein samples subjected to several freeze/thaw
cycles by using electronic absorption spectroscopy indicated no changes in the absorption
profiles indicating that this process utilized during XAS sample handling did not lead to the loss
of any metal-protein interactions.
XAS data collection. XAS data were collected with the SPEAR3 storage ring containing 100 to
200 mA at the Stanford Synchrotron Radiation Lightsource (SSRL Beam-line 7-3 for mutant
proteins, beamline 9-3 for wild-type SlyD). Experiments employed a Si(220) double crystal
monochromator with an upstream Rh-coated collimating mirror which also provided harmonic
rejection; beamline 9-3 additionally has a downstream focusing mirror. Incident and transmitted
intensity was measured by using an ion chamber filled with nitrogen gas, and the spectrum of the
sample was measured in fluorescence using a Canberra 30-element detector. For each sample 4-8
scans were accumulated, and the energy was calibrated by reference to the absorption of a nickel
24
metal foil measured simultaneously with each scan, assuming a lowest-energy inflection point of
8331.6 eV for nickel foil.
Table 2-3. Best Ni(II) EXAFS curve-fitting results for SlyD loaded with 0.8 equivalents of metal.a
Fit A-Bs N R (Å) σ2 (Å
2) ΔE (eV) F-factor
1 Ni-S
Ni-N
2
3
2.18(6)
2.11(5)
0.005(6)
0.006(21)
-13(3) 44.4
2 Ni-S
Ni-N
2
4
2.19(3)
2.13(3)
0.004(1)
0.009(15)
-10(5) 44.9
3 Ni-S
Ni-N
1
3
2.20(2)
2.08(2)
0.004(3)
0.004(3)
-9(3) 44.5
4 Ni-S
Ni-N
1
4
2.20(2)
2.10(3)
0.002(3)
0.007(6)
-8(4) 45.4
5 Ni-S
Ni-N
Ni-Imi
1
2
1
2.21(3)
2.08(7)
2.09(8)
0.005(6)
0.003(13)
0.003(36)
-7(3) 44.4
6 Ni-S
Ni-N
Ni-Imi
1
1
2
2.22(7)
2.12(6)
2.08(1)
0.005(8)
0.005(36)
0.002(3)
-3(1) 29.6
7 Ni-S
Ni-N
Ni-Imi
1
3
1
2.20(7)
2.11(6)
2.08(6)
0.003(4)
0.008(21)
0.002(12)
-6(3) 44.8
8b Ni-S
Ni-N
Ni-Imi
1
2
2
2.20(9)
2.16(7)
2.08(1)
0.004(4)
0.005(22)
0.002(2)
-3(1) 28.5
9 Ni-S
Ni-N
Ni-Imi
1
1
3
2.20(4)
2.14(9)
2.09(1)
0.006(6)
0.003(8)
0.003(2)
-2(1) 28.8
10 Ni-S
Ni-N
Ni-Imi
2
1
2
2.21(3)
2.14(11)
2.07(2)
0.011(6)
0.003(9)
0.001(2)
-4(2) 35.2
11 Ni-S
Ni-N
Ni-Imi
1
3
2
2.21(2)
2.14(3)
2.09(1)
0.003(3)
0.018(9)
0.002(1)
-4(1) 30.3
12 Ni-S
Ni-N
Ni-Imi
2
2
2
2.20(6)
2.18(8)
2.09(1)
0.006(3)
0.006(18)
0.002(2)
-4(2) 31.8
aA-Bs denotes absorber and backscatterer interaction; N denotes coordination number; R is given in Å and
represents interatomic distances; σ2 given in Å
2, are the Debye-Waller factors (mean-square deviations in
interatomic distance); the threshold energy shifts, ∆E0 are given in eV. The values in parentheses are three
times the estimated standard deviations of the final digit listed obtained from the diagonal elements of the
covariance matrix. The F-factor or fit-error function is defined as √∑k6(χ(k)calcd –χ (k)exptl)
2/∑k
6χ(k)exptl
2; The
summation is over all data points included in the refinement. bThe 1S2N2His fit is shown in Figure 7.
25
XAS data analysis. XAS data reduction and analysis were performed using the EXAFSPAK suite
programs (http://ssrl.slac.stanford.edu/exafspak.html), employing a Gaussian pre-edge function
and a weighted polynomial spline with normalization correction to extract the EXAFS
oscillations, (k). The EXAFS was quantitatively analyzed by curve-fitting (k) directly as
described (28), using ab initio theoretical phase and amplitude functions calculated using FEFF,
version 8.4 (29). Phase-shifted fourier transforms were calculated by using theoretical phase
functions from the largest EXAFS component. Proximal atoms that could be fit as nitrogen or
oxygen were fit as nitrogen. To fit EXAFS arising from histidine ligands coordinated to Ni(II),
FEFF 8.25 was used to generate theoretical phase and amplitude parameters for full multiple
scattering pathways containing second and third coordination sphere C and N atoms, using a
model abstracted from the EXAFSPAK program mol-opt. All possible scattering pathways were
included during fitting analysis, and no tilt or wag was introduced into the histidine orientation.
The Debye-Waller factor of all of the multiple scattering pathways was varied at a fixed
difference from that of the ligating nitrogen. For clarity, only the first shell Ni-Nimidazole
scattering pathway is listed (Table 2-3).
Sample preparation and instrument conditions for ESI-MS.
(i) Direct Ni(II) titration of SlyD:
Protein samples were pre-treated with 10 mM EDTA and 2 mM TCEP for 24 hrs at 4oC in an
anaerobic glove box. The samples were then gel-filtered via PD-10 columns using 10 mM
ammonium acetate, pH 7.5. To minimize the sodium ion content in the sample the gel-filtered
samples were subjected to further buffer exchanges into the same buffer via nanosep centrifugal
devices MWCO 10000 (PALL Lifesciences). The metal solutions and the protein samples
prepared under anaerobic conditions were septum capped to minimize oxidation of the protein
prior to ESI-MS measurements. Direct Ni(II) titration results were obtained by injecting the
protein sample with a known amount of Ni(II) acetate solution and allowing the sample to
equilibrate for 3-4 min prior to acquiring the mass spectra. The mass spectra were acquired on a
AB/Sciex QStarXL mass spectrometer equipped with an ion spray source in the positive ion
mode. Ions were scanned from m/z 1200-3500 with accumulation of 1 s per spectrum with no
interscan time delay and averaged for 35 cycles under MCA mode. The instrument parameters
are as follows: ion source gas 50.0 psi; curtain Gas 45.0 psi; ion spray voltage 5500.0 V;
26
declustering potential 150.0 V; focusing potential 210 V; collision gas 3.0; MCP (detector)
2200.0 V. The nickel titration of SlyD1-146 was conducted in a similar manner under aerobic
conditions, and the ions were scanned in the m/z range of 650-2400 with an ion spray voltage set
to 5300 V and a declustering potential of 50.0 V. The spectra were deconvoluted using the
Bayesian protein reconstruction program over a mass range of 20000 – 22000 Da and 15000 –
17000 Da for SlyD WT and SlyD1-146 respectively. A step mass of 1 Da, signal/noise ratio of 10
and the minimum intensity detected set to 1 % was used during reconstruction of the data. The
abundance of apo and holo SlyD species were calculated from the signal intensities of the
reconstructed spectra assuming that all different metalloforms are ionized to the same extent.
Only the peaks corresponding to salt free SlyD were used for calculating the metallation states of
SlyD.
(ii) Titration of nickel-bound SlyD with competitors (EGTA and glycine)
Fractions of the apo-protein in 10 mM ammonium acetate, pH 7.5, were incubated with excess
nickel-acetate overnight at 4oC under anaerobic conditions. The protein sample was then gel-
filtered via PD10 column to remove excess metal. The collected holo-protein fractions were then
incubated with known amounts of the competitors, each prepared in chelexed MilliQ water and
adjusted to a pH of 7.5 by using ammonium hydroxide (metal-free grade). Samples were
incubated overnight at 4oC under an anaerobic environment prior to analysis via ESI-MS. The
mass spectra were collected under identical instrument parameters as mentioned above except
the ions were scanned in the m/z range of 1400-3500.
2.3 Results
Characterization of Ni(II) binding to SlyD. The electronic absorption spectrum of SlyD
incubated with Ni(II) revealed an absorption feature at 315 nm accompanied by an increase in
the absorption at 280 nm (Figure 2-2). These bands are similar to the sulfur-to-metal charge
transfer bands observed in the absorption spectra of small molecule nickel-thiolate complexes
(30, 31) as well as other proteins that bind Ni(II) via Cys residues (32-35). Titration of wild-type
SlyD with nickel produced an increase in the absorption at 315 nm that saturated upon the
addition of 4-5 equivalents of metal, with the protein remaining soluble in solution even after the
addition of a large excess of nickel ions (Figure 2-3). It was unclear whether nickel was binding
27
quantitatively to SlyD, so equilibrium dialysis experiments were conducted to obtain the
stoichiometry of nickel binding to the protein. These experiments demonstrated that the protein
coordinates 4.2 ± 0.2 Ni(II) ions/monomer (Table 2-4).
Figure 2-2. Electronic absorption spectra of wild-type SlyD and mutants. Upon incubation of SlyD (25
µM) with 7 molar equivalents of nickel an absorption band is observed at 315 nm due to LMCT from
sulfur to the Ni(II) centre. The spectra of the mutants are different from that of WT suggesting alterations
in the Ni(II) coordination environment as cysteines are replaced with alanines. Apo-WT (black solid
line), holo-WT (blue dashed line), holo-SlyD C167,168A mutant (red dashed line), holo-SlyD C184,185A
mutant (green dashed line), and holo-SlyD Δ193-196 (purple dashed line).
Figure 2-3. SlyD binds multiple nickel ions. Ni(II) titration curve obtained by incubating SlyD (25 µM)
in 20 mM HEPES, pH 7.5, 100 mM NaCl with increasing concentrations of Ni(II). Metal binding to the
protein was noted by the increasing intensity of the LMCT that appears at 315 nm (Figure 2-2). The
normalized change in absorbance is obtained by subtracting the holo-SlyD spectrum from the apo-SlyD
spectrum and dividing the resulting number by the concentration of the protein used for the titration.
0
0.01
0.02
0.03
0.04
0.05
240 280 320 360 400 440 480
No
rma
lize
d A
bso
rba
nce
(
M-1
)
Wavelength (nm)
0
0.003
0.006
0.009
0.012
0.015
0 4 8 12 16 20 24 28 32
No
rma
lize
d Δ
Ab
s 315
(µM
-1)
Equivalents of Ni(II)
28
Table 2-4. Stoichiometry of Ni(II) binding to SlyD.
Average Ni(II)
Stoichiometrya SD
b
Wild-type SlyD 4.2 0.2
SlyD C167,168A 2.6 0.2
SlyD C184,185A 2.8 0.4
SlyD Δ193-196 2.8 0.3
Triple mutant 1.9 0.4 aThe averages reported are from three independent trials of equilibrium dialysis.
bStandard deviation.
To determine whether nickel binding induces changes in the secondary structure of SlyD, CD
spectroscopy was used. Two minima are observed in the spectrum of the apo-protein at 215 nm
and 227 nm (Figure 2-4). The 215 nm absorption band signifies the existence of β-sheet
structure in the protein, which is expected because of the predominance of β-sheets in both the
PPIase and IF domains (21, 25), whereas the 227 nm band indicates a small amount of β-turn
type structure (23, 36). As Ni(II) is titrated into the protein solution the molar ellipticity
gradually decreases, in agreement with the trend that has been previously observed (23). The
changes in the CD signal, which reach a plateau upon addition of four molar equivalents of
Ni(II), are consistent with an increasing number of β-turns as SlyD chelates Ni(II) ions (23, 36).
In addition, a near UV-CD band emerges at 270 nm as SlyD is incubated with nickel, with
saturation reached at 2 equivalents of nickel. At this longer wavelength the likely chromophores
are aromatic residues that are extremely sensitive to even minor structural perturbations due to
events such as ligand binding, domain rearrangements, and protein-protein interactions (37).
Metal-protein complexes can also generate near UV-CD signals as a result of charge transfer
between the metal ion and aromatic residues in the proteins, as observed in several cases (38,
39). Given that the aromatic residues in SlyD (tyrosine and phenylalanines) are exclusively
located in the N-terminal PPIase and IF domains, these CD results suggest that the effects of
nickel binding to SlyD are not limited to the metal-binding (MB) domain.
To investigate the quaternary structure of SlyD and the effects of Ni(II) on its oligomeric state,
analytical gel filtration experiments were conducted (Figure 2-5). Based on the partition
coefficient an apparent molar mass (Mr,app) of 25 kDa was calculated for apo-SlyD. This mass is
slightly higher than the theoretical molecular weight of 21 kDa, a mass that was confirmed by
using ESI-MS (Table 2-2). However, elution profiles corresponding to higher than the expected
29
molecular masses have been observed for other histidine-rich proteins analyzed by size exclusion
chromatography (40, 41). Hence, it can be concluded that SlyD exists as a monomeric protein at
the concentrations (100 µM) used for analytical gel-filtration. Incubation of SlyD with 1 molar
and 10 molar equivalents of Ni(II) prior to gel filtration did not have a pronounced effect on the
oligomeric state of SlyD (Figure 2-5), resulting in only slightly higher Mr,app of 27 kDa and 28
kDa, respectively.
Figure 2-4. Ni(II)-induced 2° structural changes in SlyD. The intensity of the mean residue ellipticity in
the far-UV decreases compared to that in the spectrum of the apo-protein (blue diamonds) as the protein is
incubated with 1 equivalent of Ni(II) (green diamonds), 2 equivalents (purple diamonds), 4 equivalents
(black diamonds), and 8 equivalents (red diamonds), suggesting the formation of β-turn type structure.
-24
-20
-16
-12
-8
-4
0
4
205 225 245 265 285 305
ӨM
RE
x 1
02
(de
g c
m2
dm
ol-1
)
Wavelength (nm)
30
Figure 2-5. Quaternary structure of SlyD. Analytical gel-filtration of 100 uM SlyD without
Ni(II) (purple), with 1 molar equivalent of Ni(II) (green) and 8 equivalents of Ni(II) (blue). The
retention volumes correspond to a monomeric protein and the presence of metal does not affect
the quaternary structure of SlyD. All experiments were performed at 4oC using a 20 mM HEPES,
100 mM NaCl and 1 mM TCEP, pH 7.5, buffer containing the same concentrations of nickel as
the protein sample.
Analysis of Ni(II) binding to SlyD by ESI-MS. To characterize the nickel-binding activity of
SlyD in more detail, the protein was analyzed by ESI-MS as it was titrated with increasing
amounts of nickel. This is the first report of utilizing ESI-MS to directly monitor the formation
of nickel-protein complexes. The observed charge states and the corresponding deconvoluted
spectra for a representative Ni(II) titration as well as a summary of the different species present
at each titration point are shown in Figure 2-6. The data reveal the presence of several
metalloforms that differ in nickel stoichiometries at each titration point, indicating that SlyD has
multiple metal-binding sites with similar affinities for Ni(II). Furthermore, as in the case with
the cysteine-rich metallothioneins (42), the progressive detection of all of the possible metallated
species signifies that Ni(II) binding to SlyD occurs via a non-cooperative mechanism.
0
10
20
30
40
50
13 14 15 16 17 18 19
Ab
so
rba
nce
(A
U)
Retention Volume (mL)
31
Figure 2-6. Analysis of Ni(II) binding to SlyD via ESI-MS. (A) Mass spectra recorded as increasing
amounts of Ni(II) (0.0, 0.6 1.1, 2.2, 3.5 and 8 molar equivalents, top to bottom) were added to apo-SlyD
(34 µM). The associated deconvoluted spectra are shown on the right. (B) Graphical representation of
the Ni(II) titration in which several metalloforms are observed at each titration point, indicating a non-
cooperative metal-binding mechanism.
Mass reconstruction of +TOF MS: 0 MCA scans from SlyDJan2109_1.wiff Max. 2.5e4 cps.
2.09e4 2.10e4 2.11e4 2.12e4 2.13e4 2.14e4 2.15e4Mass, amu
0.0
1000.0
2000.0
3000.0
4000.0
5000.0
6000.0
7000.0
8000.0
9000.0
1.0e4
1.1e4
1.2e4
1.3e4
1.4e4
1.5e4
1.6e4
1.7e4
1.8e4
1.9e4
2.0e4
2.1e4
2.2e4
2.3e4
2.4e4
2.5e42.5e4
Intensi
ty, cps
20853.00
Mass reconstruction of +TOF MS: 25 MCA scans from Sample 2 (SlyD_jan3009) of SlyD_jan3009_04.wiff Max. 6677.4 cps.
2.09e4 2.10e4 2.11e4 2.12e4 2.13e4 2.14e4 2.15e4Mass, amu
0
200
400
600
800
1000
1200
1400
1600
1800
2000
2200
2400
2600
2800
3000
3200
3400
3600
3800
4000
4200
4400
4600
4800
5000
5200
5400
5600
5800
6000
6200
6400
6600
Intensi
ty, cps
20910.00
Mass reconstruction of +TOF MS: 0 MCA scans from SlyD_jan3009_07.wiff Max. 3513.1 cps.
2.09e4 2.10e4 2.11e4 2.12e4 2.13e4 2.14e4 2.15e4Mass, amu
0
200
400
600
800
1000
1200
1400
1600
1800
2000
2200
2400
2600
2800
3000
3200
3400
3513
Intensi
ty, cps
20910.00
Mass reconstruction of +TOF MS: 0 MCA scans from SlyD_jan3009_08.wiff Max. 3932.2 cps.
2.09e4 2.10e4 2.11e4 2.12e4 2.13e4 2.14e4 2.15e4Mass, amu
0
200
400
600
800
1000
1200
1400
1600
1800
2000
2200
2400
2600
2800
3000
3200
3400
3600
3800
3932
Intensi
ty, cps
21023.00
Mass reconstruction of +TOF MS: 0 MCA scans from SlyD_jan3009_09.wiff Max. 2983.8 cps.
2.09e4 2.10e4 2.11e4 2.12e4 2.13e4 2.14e4 2.15e4Mass, amu
0
100
200
300
400
500
600
700
800
900
1000
1100
1200
1300
1400
1500
1600
1700
1800
1900
2000
2100
2200
2300
2400
2500
2600
2700
2800
2900
2984
Intensi
ty, cps
21081.00
Mass reconstruction of +TOF MS: 25 MCA scans from Sample 2 (SlyD_jan3009) of SlyD_jan3009_10.wiff Max. 1911.8 cps.
2.09e4 2.10e4 2.11e4 2.12e4 2.13e4 2.14e4 2.15e4Mass, amu
0
100
200
300
400
500
600
700
800
900
1000
1100
1200
1300
1400
1500
1600
1700
1800
1900
Inten
sity, cp
s
21195.00
Mass (Da)20800 21100 21300 21500
0 1 2 3 4 5 6 7 8 9 +TOF MS: 0 MCA scans from SlyDJan2109_1.wiffa=3.56209262161544440e-004, t0=5.36370156367083840e+001
Max. 1027.0 counts.
1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 3000 3100 3200 3300 3400 3500m/z, amu
0
50
100
150
200
250
300
350
400
450
500
550
600
650
700
750
800
850
900
950
1000
1027
Intensit
y, coun
ts
+TOF MS: 25 MCA scans from Sample 2 (SlyD_jan3009) of SlyD_jan3009_04.wiffa=3.56201640895968570e-004, t0=5.33165838415952750e+001
Max. 491.0 counts.
1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 3000 3100 3200 3300 3400 3500m/z, amu
0
20
40
60
80
100
120
140
160
180
200
220
240
260
280
300
320
340
360
380
400
420
440
460
480
491
Intensit
y, coun
ts
+TOF MS: 0 MCA scans from SlyD_jan3009_07.wiffa=3.56201640895968570e-004, t0=5.33165838415952750e+001
Max. 291.0 counts.
1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 3000 3100 3200 3300 3400 3500m/z, amu
0
10
20
30
40
50
60
70
80
90
100
110
120
130
140
150
160
170
180
190
200
210
220
230
240
250
260
270
280
290
Intensit
y, coun
ts
+TOF MS: 0 MCA scans from SlyD_jan3009_08.wiffa=3.56201640895968570e-004, t0=5.33165838415952750e+001
Max. 395.0 counts.
1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 3000 3100 3200 3300 3400 3500m/z, amu
0
20
40
60
80
100
120
140
160
180
200
220
240
260
280
300
320
340
360
380
395
Intensit
y, coun
ts
+TOF MS: 0 MCA scans from SlyD_jan3009_09.wiffa=3.56201640895968570e-004, t0=5.33165838415952750e+001
Max. 330.0 counts.
1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 3000 3100 3200 3300 3400 3500m/z, amu
0
10
20
30
40
50
60
70
80
90
100
110
120
130
140
150
160
170
180
190
200
210
220
230
240
250
260
270
280
290
300
310
320
330
Intensit
y, coun
ts
+TOF MS: 25 MCA scans from Sample 2 (SlyD_jan3009) of SlyD_jan3009_10.wiffa=3.56201640895968570e-004, t0=5.33165838415952750e+001
Max. 250.0 counts.
1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 3000 3100 3200 3300 3400 3500m/z, amu
0
10
20
30
40
50
60
70
80
90
100
110
120
130
140
150
160
170
180
190
200
210
220
230
240
250
Intensit
y, coun
ts
No
rmal
ized
Inte
nsi
ty
1200 1600 1800 2000 2200 2400
m/z (Da)
+16 +14 +12 +10 +9 +8 +7(A)
0.0
0.4
0.6
1.1
2.2
3.5
8.0
0
0.2
0.4
0.6
0.8
1
0
1
2
3
4
5
6
7
8
9
(B)
32
It has been established that the appearance of specific charge states is associated with the
conformational status of a protein (43). For metalloproteins, a change in the maximum and/or
distribution of charge states can be associated with alterations in the size or conformation of the
protein due to chemical changes such as metallation (44, 45). The m/z spectrum of apo-SlyD
provides evidence for the presence of two different conformations of SlyD in solution (Figure 2-
6). The fact that the relative peak intensities are higher for the smaller charge states suggests that
the majority of the protein adopts a more folded conformation. The small population of lower
m/z species observed in the spectrum of the apo-protein decreases in intensity upon Ni(II)
addition, which suggests that this population of SlyD adopts a more closed conformation upon
Ni(II) binding. Thus, the MS data provide evidence for a Ni(II)-induced folding event, which is
consistent with the Ni(II)-dependent structural changes observed via CD spectroscopy.
Upon analysis of the nickel titrations by MS a definitive end point could not be obtained before
the concentration of salt interfered with the quality of the spectral data. Thus, a different
approach was used to measure the stoichiometry of Ni(II) binding to SlyD. The protein was
incubated with a 10-fold excess of metal overnight and then gel-filtered to remove any loosely
bound Ni(II). The mass spectrum indicated the presence of a mixed population corresponding to
a range of two to seven Ni(II) ions coordinated to the protein, with the dominant peaks arising
from the four- and five-coordinated species (Figure 2-7). It is apparent from the MS data that
holo-SlyD is a mixture of several metalloforms that exist concurrently, which likely leads to the
average stoichiometry of 4.2 ± 0.2 obtained via equilibrium dialysis. This hypothesis is
corroborated by the weighted sum of the metal-bound peaks observed in the MS that yields an
average of 4.6 ± 0.1 nickel ions per SlyD.
To estimate the relative affinities of the multiple metal sites observed in the ESI-MS
experiments, holo-SlyD was prepared by incubating apo-protein with excess nickel followed by
gel filtration and then titration with increasing amounts of glycine prior to MS analysis. The
number of metals bound to SlyD remained unaffected even in the presence of 128 molar
equivalents of the competitor and the mass spectrum was almost identical to that of the protein in
the absence of competitor (data not shown). Therefore, it can be deduced that the affinities of the
detected metal sites are tighter than that of a Ni-(glycine)2 complex (Ka=105.74
) (46). A similar
experiment with EGTA, which is a competitor that forms a 1:1 complex with Ni(II) and has a
33
higher affinity for the metal (Ka = 1013.5
) (46), was also conducted. The SlyD metal-binding sites
were able to compete with EGTA (Figure 2-8), although to a lesser extent than with glycine
because an excess of EGTA could pull off almost all of the nickel from SlyD. Furthermore, the
mass spectra recorded for the EGTA competition experiment provide evidence for the formation
of a small population of ternary complex (approximately 1/6 of the intensity of the Ni-SlyD
peaks, data not shown). The presence of the protein-Ni(II)-EGTA complex implies that metal
release from SlyD does not solely rely on diffusion but that the chelator actively strips the metal
from the protein via formation of a transient ternary complex. This observation also suggests
that at least one of the metal sites is likely to be at the surface of the protein where it is accessible
to the chelator.
Figure 2-7. Stoichiometry of nickel binding to SlyD. Prior to analysis by ESI-MS, wild-type SlyD was
incubated with a 10-fold molar excess of nickel overnight at 4 oC under anaerobic conditions (Left). The
deconvoluted spectrum reveals 4-5 Ni(II) ions bound to SlyD as the predominant species present after gel
filtration (right).
Mass (Da)m/z (Da)
Rela
tive
In
ten
sity
(%
)
Rela
tive
In
ten
sity
(%
)
+TOF MS: 0 MCA scans from SlyD10feb09_gel fil DP150.wiffa=3.56218046144502220e-004, t0=5.35462600039142060e+001
Max. 218.0 counts.
1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 3000 3100 3200 3300 3400 3500m/z, amu
0%
5%
10%
15%
20%
25%
30%
35%
40%
45%
50%
55%
60%
65%
70%
75%
80%
85%
90%
95%
100%
Re
l. I
nt.
(%
)
2343.3
2635.6
2650.0
2358.2
2342.2
2633.6
2663.0
2370.1
2114.62265.5
Mass reconstruction of +TOF MS: 0 MCA scans from SlyD10feb09_gel fil DP150.wiff Max. 2451.0 cps.
2.090e4 2.095e4 2.100e4 2.105e4 2.110e4 2.115e4 2.120e4 2.125e4 2.130e4 2.135e4 2.140e4 2.145e4 2.150e4Mass, amu
0%
5%
10%
15%
20%
25%
30%
35%
40%
45%
50%
55%
60%
65%
70%
75%
80%
85%
90%
95%
100%
Re
l. I
nt.
(%
)
21140.0
2
3
45
6
7
21000 21200 21400
+9
+8
+10
1600 2400 3200
34
Figure 2-8. SlyD metal sites can compete with EGTA. Titration of holo-SlyD (44.7 µM) with increasing
amounts of EGTA in 10 mM ammonium acetate, pH 7.5. The samples were allowed to equilibrate for 5
hrs at room temperature under anaerobic conditions. The relative intensities are representative of the
abundance of each species at a given titration point. Several metalloforms are observed at each titration
point implicating very similar affinities of the multiple metal sites present. Note that the x-axis ([EGTA]
values) is not linear.
X-ray absorption near edge spectroscopy. To obtain structural information about the metal
coordination environment in SlyD, WT protein loaded with 0.8 equivalents of Ni(II) was
analyzed by X-ray absorption spectroscopy (XAS). The absorption edge around 8341 eV
correlates well with the K-edge energy of previously analyzed Ni(II) complexes (Figure 2-9),
and the general shape of the curve for the Ni(II) edge reflects a mixture of sites with either a
square pyramidal or octahedral environment as the major component (47-50). The near-edge of
SlyD exhibits two transitions of weak intensity, at 8332 eV and 8335 eV, as well as a shoulder at
ca. 8342 eV. The small pre-edge feature at 8332 eV can be assigned to a 1s → 3d transition, and
the peak area of this particular transition usually provides an indication of the geometry of the
metal site. The 1s → 3d transition is formally dipole-forbidden but weakly quadrupole-allowed
00.02
0.050.1
0.20.4
0.60.8
15
0
0.1
0.2
0.3
0.4
0.5
0.6
01
23
4
5
6
7
Rela
tive Inte
nsi
ty
35
and thus the expected intensity for this transition is minimal for rigorously centrosymmetric
environments (i.e. square planar or Oh). However, for non-centrosymmetic complexes (5-
coordinate and Td) the transition gains in intensity from dipole-allowed character due to
increased p-d mixing (47, 51). The weak intensity in the SlyD spectrum suggests the presence of
centrocymmetric complexes. The six and four-coordinate environments can usually be
distinguished by a well-resolved peak at 8335 eV associated with the 1s → 4pz transition (with
shakedown contributions) of the latter complexes, and the weak peak at 8335 eV in the SlyD
spectrum suggests a predominance of octahedral complexes with a minor amount of square-
planar or distorted square-planar sites. The 1s → 4pz transition is also observed in spectra of five
coordinate square pyramidal complexes in the form of a shoulder-like feature at 8342 eV prior to
the main edge peak (47), as observed for SlyD. Furthermore, the height of the edge maximum is
indicative of an environment with a significant number of O/N ligands (52). Thus the XAS data
clearly suggest the presence of multiple nickel sites with different geometries and coordination
numbers. These data support the model in which nickel can bind to SlyD in several alternative
sites with similar affinity.
Figure 2-9. Ni K near-edge spectra. (A) The overlaid spectra have been normalized to the edge jump.
The samples include WT SlyD loaded with 0.8 equivalents of Ni(II) (solid black line), as well as the
mutants C167,168A (dashed red line), C184,185A (dashed green line), ∆193-196 (dashed purple line),
and Triple mutant (dashed blue line) loaded with the same amount of metal. (B) The overlaid spectra have
been normalized to the edge jump and are as follows: WT SlyD loaded with 0.8 equivalents of Ni(II)
(solid black line), square planar Ni(Mnt)2 complex (green dashed line), tetrahedral Ni(S)4 complex (red
dashed line) and octahedral Ni(en)3 complex (purple dashed line).
Energy (eV)
No
rmalized F
luo
rescen
ce
8330 8340 8350 8360
0.2
0.6
1.0
1.4
8330 8338
0.3
0
8330 8340 8350 8360
No
rmalized F
luo
rescen
ce
0.2
0.6
1.0
1.4
Energy (eV)
(A) (B)
36
Extended X-ray absorption fine structure (EXAFS). Given that the near-edge data as well as
the ESI-MS results indicate that even sub-stoichiometric amounts of nickel bound to SlyD are
distributed in several sites, obtaining an exact model of the nickel coordination environment
from the EXAFS data of Ni(II)-WT SlyD may not be possible. Nevertheless the data were fit in
an effort to provide qualitative information about the composition of the ligand sets. In order to
minimize the number of variables, the mean coordination number of each type of ligand was
systematically varied as integer values in each fit, although it is possible that the average number
of a certain type of ligand around the different nickel sites may not be a whole number.
Moreover, because the electronic absorption spectrum of wild-type SlyD indicates the presence
of at least one nickel-thiolate interaction, all fits included at least one cysteine ligand. Initial
attempts to fit the data with only a single shells of scatterers resulted in poor fits (selected fits are
listed in Table 2-3) and clearly did not model the intensity at 3-4 Å in the Fourier Transform
(FT) of the EXAFS data (Figure 2-10 and data not shown), which is due to atoms outside the
primary coordination sphere of the Ni(II). This set of peaks is suggestive of one or more
imidazole moieties chelating the Ni(II) ion (51, 53), and the distinct shoulder or “camel hump”
feature observed in the EXAFS also supports histidine ligation of metal (Figure 2-10) (54, 55). It
is also possible that some of the signal in the 4 Å region is caused by a Ni(II)-Ni(II) interaction,
which is feasible given that the ESI-MS demonstrates that the nickel can simultaneously fill
several metal sites on the protein, but this possibility was not included in any fits.
The best fit of the wild-type SlyD EXAFS data was achieved with a 5-ligand set including a
single cysteine at 2.20 Å, two imidazoles with Ni-N distances of 2.08 Å, as well as two
additional nitrogen or oxygen ligands at 2.16 Å (Table 2-3 and Figure 2-10). The goodness of
fit, as indicated by the F-factor, did not change significantly upon fitting to three imidazoles, but
visual inspection of the FT suggested that the histidine contribution was too high (data not
shown). Reducing the number of histidines to one resulted in an increase in the F-factor, as did
increasing the number of cysteines to two. Reasonable fits were also achieved with four and six
ligand sets, but in both cases the best fits also included two imidazoles. The Ni-S distance of ≈
2.2 Å that was observed in all of the best fits is in agreement with other 5-coordinate nickel
compounds (48), but it is also reasonable for four-coordinate complexes and has been observed
in several nickel proteins with octahedral ligation (48, 52). Similarly, the Ni-N distances of the
imidazole ligands (2.07-2.08 Å) are consistent with those of other nickel proteins (56, 57). The
37
length of the additional bonds (> 2.1 Å, either nitrogen or oxygen coordination) is unusually
long, and some correlation between parameters increases the uncertainty of this distance in the
fits. However, it is not atypical of nickel(II) complexes with cyclic ligands so it may indicate
some constraints in the SlyD ligands (58-60), or be a reflection of fitting a mixture of
coordination environments.
Figure 2-10. k3-weighted Ni(II) EXAFS data (left) and the Fourier transform of the data (right). Fourier
transforms were phase corrected for the first shell interaction. The raw data for wild-type SlyD loaded
with 0.8 equivalents of Ni(II) is in black and the best fit model (fit 8, 1S2N2His Table 2-3) is in green.
Metal chelation to the PPIase and IF domains. The CD spectra of the nickel titration of WT
SlyD indicated a metal-dependent structural perturbation in the N-terminal domains of the
protein. These domains contain several potential metal-binding residues (Figure 2-1), so it is
possible that the structural changes are independent of the metal-binding domain (25). To test
this possibility, a truncated variant of SlyD lacking the MB domain, SlyD1-146, was analyzed by
CD spectroscopy. The far-UV CD spectrum of SlyD1-146 exhibits significantly more intense
negative molar ellipticity, with a minimum at 208 nm and another transition at 222 nm (Figure 2-
11). These features may indicate a relatively higher degree of secondary structure, mainly alpha
helical, in comparison to the full-length protein. However, they could also be due to a decrease in
structural elements such as β-turns and a partial opening up of the structure (36, 61). Regardless,
it is clear that the metal-binding domain does have a significant effect on the overall structure of
the protein even in the absence of metal. Incubation of SlyD1-146 with increasing amounts of
χ(k
) x k
3
k (Å-1) R+∆ (Å)
Tran
sfor
m M
agni
tude
6
4
2
0
-2
-4
1.4
1.2
1.0
0.6
0.4
0.2
0.8
0 1 2 3 4 52 4 6 8 10 12
38
Ni(II) (up to 5 equivalents, Figure 2-11 and data not shown) did not change the CD spectrum at
any wavelength measured, indicating that the metal-binding C-terminal domain is necessary to
observe the structural changes in the N-terminal domains and suggesting that there is no direct
nickel binding to the isolated N-terminal domain.
Figure 2-11. Comparison of WT SlyD and SlyD1-146 CD spectra. The spectra are an average of 4 scans
collected on SlyD (60 µM in 10 mM ammonium acetate) incubated with and without Ni(II) overnight at
4oC. The SlyD1-146 variant that contains only the PPIase and the IF domains exhibits higher negative
ellipticity and the protein structure is unperturbed by addition of nickel. Apo-WT (black x), WT with 2
equivalents of Ni(II) (green diamonds), Apo-SlyD1-146 (red x), SlyD1-146 with 2 equivalents of Ni(II)
(purple diamonds).
To test directly whether the N-terminal domains of SlyD have an independent metal-binding
capacity, a Ni(II) titration of SlyD1-146 was conducted in a similar manner as for the WT protein
and analyzed by using ESI-MS. As observed for the full-length protein, the MS spectrum of
apo-SlyD1-146 revealed that there are two populations of conformers differing in overall charge
(data not shown). However, unlike the WT protein, the apo-SlyD1-146 spectrum was dominated
by lower m/z species suggesting a more open conformation of the protein (data not shown), in
agreement with the CD spectroscopy and confirming that the MB domain influences the overall
structure of the protein. Furthermore, unlike the full-length protein, the population distribution
did not change upon addition of nickel. Some nickel binding was observed in the MS but a
Ni(II)-bound protein peak was only detected upon addition of at least 2 molar equivalents of
Ni(II), and following incubation of the protein with 4 equivalents of Ni(II) at least ~30% of
-90
-70
-50
-30
-10
10
195 215 235 255 275 295
ӨM
RE
x 10
2(d
eg
cm
2d
mo
l-1)
Wavelength (nm)
39
SlyD1-146 still remained in the apo form (data not shown). These results suggested that the Ni(II)-
protein complexes detected via MS were a result of non-specific interactions between the metal
and the protein. To test this hypothesis, the protein sample was incubated with 8 molar
equivalents of Ni(II) overnight, then analyzed by MS following gel filtration. Only a peak
corresponding to apo-SlyD1-146 was detected in the gel-filtered samples, confirming that the
metal-protein signals observed during the direct Ni(II) titration experiment arise from non-
specific, weak interactions with the N-terminal domains of SlyD.
Characterization of SlyD mutants. To gain more insight into the involvement of the cysteine
residues in metal binding, as suggested by the spectroscopic experiments, site-directed
mutagenesis was employed. The six cysteines in SlyD are distributed throughout the metal-
binding domain in pairs (Figure 2-1), so three mutants were generated in which each pair of Cys
residues was either mutated to alanine (SlyD C167,168A and SlyD C184,185A) or removed
(C193 and C195 are absent in the SlyD ∆193-196 truncation) (Table 2-1). Electronic absorption
spectroscopy revealed that all three mutants bind Ni(II) (Figure 2-2) and titration experiments
produced binding curves similar to that of the WT SlyD (data not shown). However, the
electronic absorption signals of the mutants saturate with less nickel than wild-type SlyD, and the
spectra from the mutants are altered. Less intense, slightly red-shifted LMCT bands are
observed for the C167,168A and C184,185A mutants, whereas an increase in the intensity of the
LMCT band is observed for the Δ193-196 protein (Figure 2-2). This preliminary analysis of the
mutants implies changes in ligand environment and/or coordination geometry of the Ni(II) sites.
The CD spectra of the apo- and holo-mutant proteins were similar to those of wild-type SlyD,
indicating that mutations did not perturb the overall secondary structure of the protein (data not
shown). Equilibrium dialysis experiments demonstrated that the nickel-binding capacity of all
the mutants was reduced (Table 2-4), supporting a model in which all six Cys residues are
involved in metal binding.
To determine if cysteines are necessary for any metal binding to SlyD, a fourth mutant was
generated that lacked all six Cys residues by introducing all three of the sets of mutations
mentioned above into slyD (referred to as the Triple mutant). As expected, no change was
observed in the electronic absorption spectrum of the Triple mutant incubated with increasing
amounts of Ni(II) (data not shown). However, the Triple mutant protein binds 2 Ni(II) per
40
monomer in equilibrium dialysis experiments (Table 2-4). Given that the electronic absorption
spectroscopy was performed with similar protein concentrations as the equilibrium dialysis
experiments, the lack of a change in the absorption spectrum clearly denotes that the Ni(II) ions
bind to donor atoms for which the LMCT is shifted well into the blue region of the spectrum.
That the Triple mutant was chelating Ni(II) as a monomeric species was verified by analytical
gel-filtration experiments (data not shown). MS analysis of the apo-Triple mutant indicated the
presence of two different conformers with similar populations of m/z species as observed for the
wild-type SlyD (data not shown). A Ni(II) titration revealed that the Triple mutant also adapts a
more folded conformation when bound to nickel and that metal-binding occurs via a non-
cooperative manner comparable to that of wild-type SlyD. However, in agreement with the
equilibrium dialysis data the MS indicated reduced nickel-binding capacity for the Triple mutant.
To gain a better understanding of the importance of the thiolate ligands for metal binding, Ni(II)
titrations of WT SlyD were performed in the presence of equimolar Triple mutant, followed by
ESI-MS analysis. Upon addition of 18 M Ni(II) (≈ 36% of the total protein concentration),
peaks corresponding to 1 and 2 Ni(II) ions bound to WT appeared whereas only a single ion
bound was apparent for the Triple mutant (Figure 2-12), and less of WT was apo-protein in this
competitive environment. In addition, the peak for apo-protein disappear at lower Ni(II)
concentrations for the WT protein than the mutant. No clear peaks could be distinguished in the
mass spectrum past the 246 M Ni(II) titration point for the WT SlyD due to interferences
caused by the increased salt concentration. Nevertheless, wild-type SlyD clearly binds more
nickel than the mutant, indicating that thiol moieties impart better metal sequestering ability to
SlyD but that the protein lacking cysteines is still competent at nickel binding.
XAS of SlyD mutants. An overlay of the near-edge X-ray absorption spectra generated from
WT SlyD and the mutant proteins provides clear evidence that the mutations alter the SlyD
Ni(II)-binding sites (Figure 2-9). Although the overall shapes of the edge spectra are similar to
that of WT, all the mutants exhibit an edge peak that is shifted to a higher energy. Furthermore,
an increase in the intensity of the normalized fluorescence relative to the WT is also evident.
These changes correlate well with the trend noted for Ni(II) complexes as their S-donor ligands
are substituted with N,O-donor ligands (47). Very much like WT SlyD, the SlyD C167,168A
and the SlyD Δ193-196 mutants‟ edge spectra exhibit features for a mixture of octahedral (8332
41
eV), square pyramidal geometries (shoulder at 8342 eV) with some minor contributions from 4-
coordinate planar Ni(II) sites (8335 eV). The SlyD C184,185A mutant on the other hand appears
to contain Ni(II) sites only in centrosymmetric geometries: octahedral and square planar.
However, only a small fraction of this mutant forms the square planar nickel sites since the
intensity of the 1s → 4pz transition is very small. The spectrum of the Triple mutant produced
the highest normalized intensity with a Ni(II) coordination environment that is expected to solely
contain oxygen and nitrogen donor ligands. The near-edge spectrum for this mutant contains a
low intensity 1s → 3d transition at 8332 eV as well as a shoulder at 8342 eV corresponding to 1s
→ 4pz transitions, which are suggestive of a mixture of metal sites with six-coordinate and
square pyramidal geometry, and lacks the peak at 8335 eV assigned to square planar complexes.
Therefore, the XAS data suggest the necessity of thiolate ligands to form low coordination
number, square planar Ni(II) centers in SlyD. The FT of the EXAFS of the SlyD mutants loaded
with nickel are similar to that of wild-type protein (Figure 2-13), but the FT magnitude in the 3-4
Å region is larger for the Triple mutant compared to that of WT SlyD, suggesting that upon
deletion of all Cys ligands the protein compensates with a larger number of histidine ligands in
the coordination sphere.
Figure 2-12. Competition for Ni(II) binding by WT and Triple mutant SlyD. An equimolar solution (25
µM each) of WT SlyD (solid bars) and Triple mutant (striped bars) was titrated with nickel in 10 mM
ammonium acetate, pH 7.5. The relative intensities of different metalloforms at each titration point
correlates to the relative abundance and is represented as follows: Apo (blue); 1, 2, 3, 4, 5, 6 and 7 Ni(II)
ions bound: green, red, black, purple, yellow, grey and light blue bars, respectively.
0
0.2
0.4
0.6
0.8
1
Rela
tive I
nte
nsi
ty
Ni(II) µM
0 18 37 78 111 169 246
42
Figure 2-13. Overlay of WT EXAFS data with SlyD mutants. The WT data are represented as black
solid lines in each spectrum. The k3-weighted Ni(II) EXAFS data are shown in the left and the respective
Fourier transform of the data is on the right. From top to bottom: SlyD C167168A, SlyD C184,185A,
SlyD Δ193-196, and Triple mutant
χ(k
) x
k3
Tra
ns
form
Ma
gn
itu
de
k (Ǻ-1) R+∆ (Ǻ)
χ(k
) x k
3
k (Å-1) R+∆ (Å)
Tra
nsfo
rm M
ag
nitu
de
43
2.4 Discussion and Conclusions
SlyD is an accessory protein required for achieving optimal levels of [NiFe]-hydrogenase
activity in Escherichia coli (12, 22). Together with auxiliary proteins HypA and HypB, it is
thought to act as a nickel chaperone that facilitates the Ni(II) insertion step in the maturation
pathway of this enzyme (11, 12, 22), and it may also serve as a nickel storage protein in this
organism (12). Of the three functional domains in SlyD, the PPIase domain, the molecular
chaperone domain, and the C-terminal metal-binding domain, the latter two are essential for the
role of SlyD in the enzyme biosynthetic pathway (19, 22). Although the molecular chaperone
activity of SlyD has been investigated previously (18, 62), a detailed characterization of the
nickel-binding properties has not been reported. Therefore, to obtain a better understanding of
SlyD as a Ni(II)-binding protein and its function as a metallochaperone, nickel coordination to
the protein was examined in detail by using a range of spectroscopic and spectrometric methods.
Consistent with the results from previous studies, we find that SlyD binds multiple metal ions but
with a higher average nickel stoichiometry than previously noted (14, 23). The discrepancy in
the data is likely due to the oxidation of the cysteine residues under atmospheric conditions, a
hypothesis that is supported by the lower nickel-binding stoichiometries observed with the
mutants in which cysteines were replaced with alanines (Table 2-4). Under physiological
conditions SlyD should retain its full binding capacity given that the protein is located in the
reducing cytosolic compartment and functions under anaerobic growth conditions, at least for its
role in hydrogenase biosynthesis (8). All of the experimental evidence support the importance of
the thiolate ligands for nickel binding. Not only do they impart higher nickel-binding capacity to
SlyD, the Cys ligands enable the formation of metal sites with increased affinity for Ni(II).
Although the amount of free nickel in the E. coli cytoplasm has not been measured, it is likely
that it is a very competitive environment with the nickel ion distribution tightly controlled (63-
65), so the cysteine ligands would allow SlyD to sequester the potentially toxic nickel ions away
from any weaker adventitious sites.
Ni(II) ions fill the binding sites on SlyD in a progressive and overlapping fashion without
altering the oligomeric state of the protein, indicating that metal binding is not cooperative.
Although we anticipated preferential nickel binding to at least one higher-affinity site, the
detailed electrospray mass spectrometry experiments show that SlyD exhibits multiple metal
44
sites of similar affinity, and the X-ray absorption data reveal that even sub-stoichiometric
amounts of nickel produce a mixture of nickel coordination environments. Up to seven nickel
ions remain bound to full-length SlyD following gel filtration chromatography and competition
with glycine, indicating that all of the seven sites have at least low micromolar affinity for Ni(II)
(KD < 1.8 μM). The observation of non-specific protein-metal complexes at high metal
concentrations is an inherent issue of the ionization process utilized during positive mode metal-
protein complex detection. However, the fact that the WT SlyD is able to chelate seven nickel
ions even in the presence of glycine or the Triple mutant clearly indicates that all seven nickel
ions are specifically bound by the protein. Furthermore, this is indicative that all seven metal
sites may be utilized by the protein to bind nickel ions competitively in the bacterial cytosol.
Although the MS data do not allow us to distinguish between nickel binding initially to one site
and then redistribution to other sites versus concurrent filling of multiple sites, it does reveal the
extreme plasticity of SlyD for metal binding and its ability to load a substantial amount of nickel
ions. A similar metal coordination pattern has been observed for human metallothionein (MT-1),
which exists in a dynamic mixture of metalloforms that is dependent on metal concentration in
solution (66-68).
That we were unable to achieve complete saturation via equilibrium dialysis at the maximal
stoichiometry of 7 nickel ions bound that was observed in the MS suggests that not all of the
metal sites on SlyD are equally accessible. A possible explanation for this result can be derived
from a model in which the metal-binding capacity of SlyD is governed by the sequence of Ni(II)
binding to the seven metal sites (Figure 2-14). Given that all sites seem to be of similar affinity,
binding to any of the sites would be equally probable initially. However, Ni(II) binding to a
particular site (e.g. sites 6 & 7 instead of sites 1 & 2) may subsequently hinder the binding of
Ni(II) to other sites (i.e. 1-4) due to structural constraints imposed upon metal chelation, whereas
binding to a different sets of site (i.e. sites 1 & 2) allows the protein to chelate the maximum
number of nickel ions. The changes in conformation brought about by metallation along „dead-
end‟ pathways would be observed by very slow binding rates where complete metallation might
not be realised within the hours of a typical experiment (68). Kinetic experiments will be
required to test this hypothesis.
45
Figure 2-14. Model for Ni(II) binding to SlyD. The order of nickel binding to individual sites
determines the maximum stoichiometry of the protein. For example, binding to sites 6 and 7
hinders the formation of sites 1-4 or inhibits access to these sites whereas binding to sites 1 and 2
allows the protein to coordinate the metal to its full capacity, thereby leading to an equilibrium of
several metalloforms.
Competition experiments with EGTA provide additional evidence for the similar affinity of the
metal sites because the selective depletion of individual metalloforms (resulting in populations
with only 4 Ni(II) ions bound to SlyD, for example) is not observed at any concentration of the
competitor. These experiments also support the conclusion that the protein is able to chelate
nickel in a competing cellular environment, which would be essential for its function as a source
of nickel for hydrogenase biosynthesis even under nickel-limiting conditions. The equilibrium
dissociation constant of nickel binding to SlyD has an upper limit of low micromolar, placing it
in a range that is similar to or tighter than that of nickel-binding proteins from other organisms
such as Hpn, Hpn-like or HspA from Helicobacter pylori (40, 41, 69), UreE (55, 70), and
histidine-rich HypB homologs (71, 72). This latter comparison, coupled with the fact that SlyD
forms a complex with E. coli HypB, supports the hypothesis that one of the purposes of SlyD is
to fill the role occupied by histidine-rich versions of HypB in other systems.
The CD spectroscopy, together with charge state distributions detected during the mass
spectrometry experiments, are indicative of a protein capable of metal binding with small but
distinctive changes in protein structure. The CD suggests that the changes induced by nickel
binding are dominated by the formation of β-turn type structures that are localized to the C-
terminal domain of the protein. A similar metal-induced structure formation has been previously
observed for other proteins (67, 73, 74). An analysis of a collection of proteins indicates that β-
1
2 3
4
56
7
Ni(II) Ni(II)
46
turns predominantly consist of hydrophilic amino acid residues and are concentrated at the
protein surface (36). Thus it is likely that the metal-binding domain is located at the surface of
the protein, an optimal position for facile nickel binding, and a position supported by the
unstructured nature of this region in apo-SlyD (21, 25). Furthermore, in such a location the
nickel ions could be tightly bound but not completely buried, allowing for direct transfer of
nickel ions between SlyD and other proteins via ligand exchange reactions that would not entail a
substantial conformational rearrangement in SlyD.
Considering the properties of SlyD, including a chaperone domain that enables protein-protein
complex formation and an accessible metal-binding domain at the surface, it is evident that SlyD
could participate in hydrogenase biosynthesis in one or more capacities (11, 12, 22). The fact
that it can bind many nickel ions suggests that SlyD functions as a store of nickel, which could
be made available specifically to the hydrogenase pathway through complex formation with
other accessory proteins such as HypB. HypB has an N-terminal metal-binding site with sub-
picomolar affinity for nickel (34), so from a thermodynamic perspective it is feasible that it could
abstract nickel from SlyD via a ternary complex such as that observed in the competition
experiments with EGTA. However, HypB is not the final destination of the nickel ion in this
pathway and in vitro experiments demonstrate that the MB domain of SlyD increases the release
of HypB-bound nickel to a third chelator (22), so an alternative possibility is that SlyD helps to
make this nickel available. The route of the nickel ion on its way to the hydrogenase precursor
protein and whether other components of the nickel insertion complex participate in nickel
delivery, are issues that remain to be defined by future experiments.
Unlike the full-length protein, any adventitious nickel ions bound to SlyD1-146 were completely
stripped away by gel filtration chromatography. The conclusion that the isolated PPIase domain
does not chelate Ni(II) is supported by the CD experiments demonstrating that its structure is
unaffected by the presence of Ni(II) in solution. Thus the MB domain is required for tight nickel
binding to SlyD. Although the metals bind to the C-terminus of SlyD, the N-terminal domains
are also perturbed by this activity, as is evident from the appearance of the near-UV CD band
upon nickel titration of the full-length protein. This perturbation could either result from metal
binding to one or more sites that bridge the MB and the N-terminal domains, or from nickel
binding to the MB domain producing an allosteric effect that propagates into the N-terminus.
47
Experiments with the isolated MB domain designed to resolve this issue have been precluded to
date due to excessive degradation. These conformational changes observed upon nickel binding
may cause the nickel-induced inhibition of the PPIase activity that has previously been reported
(23), an effect not observed in the absence of the metal-binding domain. This connection is in
agreement with a recent NMR study that revealed that the addition of nickel perturbs residues
around the catalytic pocket of the PPIase domain (25).
The fact that nickel binding to SlyD functions as a reversible switch that regulates the PPIase
provides a link between the two activities of the protein. However, as with many PPIase
enzymes (17), it is not known whether this activity of SlyD has a cellular function, so the
physiological relevance of this connection is unclear. The PPIase activity would only be blocked
under anaerobic growth conditions because nickel import by E. coli is activated in the absence of
oxygen (75), the environmental conditions that also necessitate hydrogenase activity (8). The
PPIase activity of SlyD is not critical for hydrogenase biosynthesis (19), but it has been proposed
that it may be detrimental (25), and nickel binding could be a mechanism of preventing
undesired isomerizations of prolines in the other hydrogenase accessory proteins or the enzyme
itself. A similar metal-dependent switch mechanism has been observed for another bacterial
heat-shock chaperone protein Hsp33 (76). Hsp33 normally exists in a deactivated form where
Cys residues in the protein are coordinated to a zinc ion. When the bacteria undergo oxidative
stress the zinc ion is displaced and the protein exhibits folding chaperone activity in its apo-form
by forming an oxidized dimer (76, 77). Whether SlyD is modulated by such a metal-dependent
switch, in which it functions as a general protein folding enzyme under aerobic conditions and
switches to the more specific task of a Ni(II) chaperone for hydrogenase biosynthesis under
anaerobic expression, has yet to be determined.
It is not uncommon for a chaperone protein to perform cellular functions in addition to its protein
folding activity and these extra functions are usually integrated into the chaperone in the form of
an extra domain. For instance, the heat shock protein A (HspA) in H. pylori contains a metal-
binding domain at the C-terminus that is beneficial for Ni(II) resistance in this organism (40).
Calreticulin is a chaperone involved in glycoprotein folding that also participates in the
regulation of intracellular Ca(II) homeostasis (78). In the case of the aforementioned Hsp33,
incorporation of an oxygen-sensitive metal-binding domain at the C-terminus allows this protein
48
to function as a chaperone in response to oxidative stress (77). Augmentation of a constitutively-
expressed chaperone such as SlyD (15) with a metal-binding domain would be advantageous
because a readily available sink for Ni(II) would be present when the bacteria switch to
anaerobic metabolism and start importing nickel. In this manner, the cell would be protected
from the toxic properties of this element while ensuring that the nickel is directed to where it is
needed in the hydrogenase biosynthetic pathway.
SlyD homologs have been annotated in a large number of prokaryotic genomes (79), and
although the C-terminal domains are not well-conserved, many of the homologs have significant
extensions rich in metal-binding residues. Thus SlyD may be a key player in prokaryotic nickel
homeostasis. For example, both biochemical and genetic experiments have implicated SlyD in
the biosynthetic pathway for urease in the human pathogen H. pylori (80, 81). In view of the role
of SlyD in nickel homeostasis in E. coli, the non-cooperative, adaptable metal-binding nature of
SlyD is analogous to metallothioneins that are proposed to be involved in the homeostasis of zinc
levels in the human brain (82, 83). Although SlyD has been characterized in the context of a
nickel-binding protein there are several questions that remain to be resolved. With its high
content of potential metal-binding residues can the protein function as a general metal detoxifier
similar to metallothioneins? What is the metal-specificity of SlyD and how does this specificity
correlate with optimal biogenesis of the hydrogenase enzyme? Is it possible for SlyD to function
as a metallochaperone for other enzymes? Answers to these issues are presented in Chapter 3.
49
References
1. Mulrooney, S. B., and Hausinger, R. P. (2003) Nickel uptake and utilization by
microorganisms, FEMS Microbiol. Rev. 27, 239-261.
2. Ragsdale, S. W. (2009) Nickel-based enzyme systems, J. Biol. Chem. 284, 18571-18575.
3. Li, Y., and Zamble, D. B. (2009) Nickel Homeostasis and Nickel Regulation: An
Overview, Chem Rev.
4. Barceloux, D. G. (1999) Nickel, Clin. Toxicol. 37, 239-258.
5. Muyssen, B. T. A., Brix, K. V., DeForest, D. K., and Janssen, C. R. (2004) Nickel
essentiality and homeostasis in aquatic organisms, Environ. Rev. 12, 113-131.
6. O'Halloran, T. V., and Culotta, V. C. (2000) Metallochaperones, an intracellular shuttle
service for metal ions, J. Biol. Chem. 275, 25057-25060.
7. Rosenzweig, A. C. (2002) Metallochaperones: Bind and deliver, Chem.Biol. 9, 673-677.
8. Böck, A., King, P. W., Blokesch, M., and Posewitz, M. C. (2006) Maturation of
hydrogenases, Advances in Microbial Physiology 51 (Suppl.), 1-71.
9. Forzi, L., and Sawers, R. G. (2007) Maturation of [NiFe]-hydrogenases in Escherichia
coli, Biometals 20, 565-578.
10. Vignais, P. M., and Billoud, B. (2007) Occurrence, classification, and biological function
of hydrogenases: an overview, Chem. Rev. 107, 4206-4272.
11. Leach, M. R., and Zamble, D. B. (2007) Metallocenter assembly of the hydrogenase
enzymes, Curr. Opin. Chem. Biol. 11, 159-165.
12. Zhang, J. W., Butland, G., Greenblatt, J. F., Emili, A., and Zamble, D. B. (2005) A role
for SlyD in the Escherichia coli hydrogenase biosynthetic pathway, J. Biol. Chem. 280,
4360-4366.
13. Roof, W. D., and Young, R. (1993) Phi X174 E complements lambda S and R
dysfunction for host cell lysis, J. Bacteriol. 175, 3909-3912.
14. Wulfing, C., Lombardero, J., and Pluckthun, A. (1994) An Escherichia coli protein
consisting of a domain homologous to FK506-binding proteins (Fkbp) and a new metal-
binding motif, J. Biol. Chem. 269, 2895-2901.
15. Roof, W., Horne, S., Young, K., and Young, R. (1994) slyD, a host gene required for phi
X174 lysis, is related to the FK506- binding protein family of peptidyl-prolyl cis-trans-
isomerases, J. Biol. Chem. 269, 2902-2910.
16. Kang, C. B., Hong, Y., Dhe-Paganon, S., and Yoon, H. S. (2008) FKBP family proteins:
immunophilins with versatile biological functions, Neurosignals 16, 318-325.
17. Gothel, S. F., and Marahiel, M. A. (1999) Peptidyl-prolyl cis-trans isomerases, a
superfamily of ubiquitous folding catalysts, Cell. Mol. Life Sci. 55, 423-436.
18. Scholz, C., Eckert, B., Hagn, F., Schaarschmidt, P., Balbach, J., and Schmid, F. X. (2006)
SlyD proteins from different species exhibit high prolyl isomerase and chaperone
activities, Biochemistry 45, 20-33.
19. Zhang, J. W., Leach, M. R., and Zamble, D. B. (2007) The peptidyl-prolyl isomerase
activity of SlyD is not required for maturation of Escherichia coli hydrogenase, J.
Bacteriol. 189, 7942-7944.
20. Furutani, M., Iida, T., Yamano, S., Kamino, K., and Maruyama, T. (1998) Biochemical
and genetic characterization of an FK506-sensitive peptidyl prolyl cis-trans isomerase
from a thermophilic archaeon, Methanococcus thermolithotrophicus, J. Bacteriol. 180,
388-394.
50
21. Weininger, U., Haupt, C., Schweimer, K., Graubner, W., Kovermann, M., Bruser, T.,
Scholz, C., Schaarschmidt, P., Zoldak, G., Schmid, F. X., and Balbach, J. (2009) NMR
solution structure of SlyD from Escherichia coli: spatial separation of prolyl isomerase
and chaperone function, J. Mol. Biol. 387, 295-305.
22. Leach, M. R., Zhang, J. W., and Zamble, D. B. (2007) The role of complex formation
between the Escherichia coli hydrogenase accessory factors HypB and SlyD, J. Biol.
Chem. 282, 16177-16186.
23. Hottenrott, S., Schumann, T., Pluckthun, A., Fischer, G., and Rahfeld, J. U. (1997) The
Escherichia coli SlyD is a metal ion-regulated peptidyl-prolyl cis/trans-isomerase, J. Biol.
Chem. 272, 15697-15701.
24. Kuchar, J., and Hausinger, R. P. (2004) Biosynthesis of Metal Sites, Chem. Rev. 104,
509-526.
25. Martino, L., He, Y., Hands-Taylor, K. L. D., Valentine, E. R., Kelly, G., Giancoloa, C.,
and Conte, M. R. (2009) The interaction of the Escherichia coli protein SlyD with nickel
ions illuminates the mechanism of regulation of its peptidyl-prolyl isomerase activity,
FEBS J. 276, 4529-4544.
26. Suzuki, R., Nagata, K., Yumoto, F., Kawakami, M., Nemoto, N., Furutani, M., Adachi,
K., Maruyama, T., and Tanokura, M. (2003) Three-dimensional solution structure of an
archaeal FKBP with a dual function of peptidyl prolyl cis-trans isomerase and chaperone-
like activities, J. Mol. Biol. 328, 1149-1160.
27. Atanassova, A., Lam, R., and Zamble, D. B. (2004) A high-performance liquid
chromatography method for determining transition metal content in proteins, Anal.
Biochem. 335, 103-111.
28. George, G. N., Garrett, R. M., Prince, R. C., and Rajagopalan, K. V. (1996) The
molybdenum site of sulfite oxidase: a comparison of wild-type and the cystein 207 to
serine mutant using x-ray absorption spectroscopy, J. Am. Chem. Soc. 118, 8588-8592.
29. Rehr, J. J., Mustre de Leon, J., Zabinsky, S. I., and Albers, R. C. (1991) Theoretical X-
ray absorption fine structure standards, J. Am. Chem. Soc. 113, 5135-5140.
30. Ragunathan, K. G., and Bharadwaj, P. K. (1992) Nickel(Ii) Complexes with Tripodal
Ligands - Synthesis, X-Ray Structural and Spectroscopic Studies, J. Chem. Soc. Dalton
Trans., 2417-2422.
31. Rosenfield, S. G., Berends, H. P., Gelmini, L., Stephan, D. W., and Mascharak, P. K.
(1987) New Octahedral Thiolato Complexes of Divalent Nickel - Syntheses, Structures,
and Properties of (Et4n)[Ni(Sc5h4n)3] and (Ph4p)[Ni(Sc4h3n2)3].Ch3cn, Inorg. Chem.
26, 2792-2797.
32. Chivers, P. T., and Sauer, R. T. (2002) NikR repressor: High-affinity nickel binding to
the C-terminal domain regulates binding to operator DNA, Chem. Biol. 9, 1141-1148.
33. Iwig, J. S., Leitch, S., Herbst, R. W., Maroney, M. J., and Chivers, P. T. (2008) Ni(II) and
Co(II) sensing by Escherichia coli RcnR, J. Am. Chem. Soc. 130, 7592-7606.
34. Leach, M. R., Sandal, S., Sun, H. W., and Zamble, D. B. (2005) Metal binding activity of
the Escherichia coli hydrogenase maturation factor HypB, Biochemistry 44, 12229-
12238.
35. Wang, S. C., Dias, A. V., Bloom, S. L., and Zamble, D. B. (2004) Selectivity of metal
binding and metal-induced stability of Escherichia coli NikR, Biochemistry 43, 10018-
10028.
36. Perczel, A., and Hollosi, M. (1996) Turns, in Circular Dichroism and the Conformational
Analysis of Biomolecules (Fasman, G. D., Ed.), pp 285-380, Plenum Press, New York.
51
37. Woody, R. W., and Dunker, A. K. (1996) Aromatic and Cystine Side-Chain Circular
Dichroism in Proteins, in Circular Dichroism and the Conformational Analysis of
Biomolecules (Fasman, G. D., Ed.), pp 109-158, Plenum Press, New York.
38. Beltramini, M., Bubacco, L., Salvato, B., Casella, L., Gullotti, M., and Garofani, S.
(1992) The aromatic circular dichroism spectrum as a probe for conformational changes
in the active site environment of hemocyanins, Biochim. Biophys. Acta. 1120, 24-32.
39. Vasak, M., Kagi, J. H., Holmquist, B., and Vallee, B. L. (1981) Spectral studies of cobalt
(II)- and Nickel (II)-metallothionein, Biochemistry 20, 6659-6664.
40. Cun, S., Li, H., Ge, R., Lin, M. C., and Sun, H. (2008) A histidine-rich and cysteine-rich
metal-binding domain at the C terminus of heat shock protein A from Helicobacter
pylori: implication for nickel homeostasis and bismuth susceptibility, J. Biol. Chem. 283,
15142-15151.
41. Ge, R., Watt, R. M., Sun, X., Tanner, J. A., He, Q.-Y., Huang, J.-D., and Sun, H. (2006)
Expression and characterization of a histidine-rich protein, Hpn: potential for Ni2+
storage
in Helicobacter pylori, Biochem. J. 393, 285-293.
42. Sutherland, D. E., and Stillman, M. J. (2008) Noncooperative cadmium(II) binding to
human metallothionein 1a, Biochem. Biophys. Res. Comm. 372, 840-844.
43. Kaltashov, I. A., and Abzalimov, R. R. (2008) Do ionic charges in ESI MS provide useful
information on macromolecular structure?, J. Am. Soc. Mass. Spectrom. 19, 1239-1246.
44. Rigby Duncan, K. E., Kirby, C. W., and Stillman, M. J. (2008) Metal exchange in
metallothioneins: a novel structurally significant Cd(5) species in the alpha domain of
human metallothionein 1a, FEBS J. 275, 2227-2239.
45. Pluym, M., Vermeiren, C. L., Mack, J., Heinrichs, D. E., and Stillman, M. J. (2007)
Heme binding properties of Staphylococcus aureus IsdE, Biochemistry 46, 12777-12787.
46. Martell, A. E., and Smith, R. M. (2003) NIST Standard Reference Database 46, version
7.0, National Institute of Standards and Technology, Rockville, MD.
47. Colpas, G. J., Maroney, M. J., Bagyinka, C., Kumar, M., Willis, W. S., Suib, S. L.,
Baidya, N., and Mascharak, P. K. (1991) X-Ray Spectroscopic Studies of Nickel-
Complexes, with Application to the Structure of Nickel Sites in Hydrogenases, Inorg.
Chem. 30, 920-928.
48. Gu, W. W., Jacquamet, L., Patil, D. S., Wang, H. X., Evans, D. J., Smith, M. C., Millar,
M., Koch, S., Eichhorn, D. M., Latimer, M., and Cramer, S. P. (2003) Refinement of the
nickel site structure in Desulfovibrio gigas hydrogenase using range-extended EXAFS
spectroscopy, J. Inorg. Biochem. 93, 41-51.
49. Musgrave, K. B., Laplaza, C. E., Holm, R. H., Hedman, B., and Hodgson, K. O. (2002)
Structural characterization of metallopeptides designed as scaffolds for the stabilization
of nickel(II)-Fe(4)S(4) bridged assemblies by X-ray absorption spectroscopy, J. Am.
Chem. Soc. 124, 3083-3092.
50. Tan, G. O., Ensign, S. A., Ciurli, S., Scott, M. J., Hedman, B., Holm, R. H., Ludden, P.
W., Korszun, Z. R., Stephens, P. J., and Hodgson, K. O. (1992) On the structure of the
nickel/iron/sulfur center of the carbon monoxide dehydrogenase from Rhodospirillum
rubrum: an x-ray absorption spectroscopy study, Proc. Natl. Acad. Sci. U. S. A. 89, 4427-
4431.
51. Davidson, G., Clugston, S. L., Honek, J. F., and Maroney, M. J. (2001) An XAS
investigation of product and inhibitor complexes of Ni-containing GlxI from Escherichia
coli: Mechanistic implications, Biochemistry 40, 4569-4582.
52
52. Haumann, M., Porthun, A., Buhrke, T., Liebisch, P., Meyer-Klaucke, W., Friedrich, B.,
and Dau, H. (2003) Hydrogen-induced structural changes at the nickel site of the
regulatory [NiFe] hydrogenase from Ralstonia eutropha detected by X-ray absorption
spectroscopy, Biochemistry 42, 11004-11015.
53. Ferreira, G. C., Franco, R., Mangravita, A., and George, G. N. (2002) Unraveling the
substrate-metal binding site of ferrochelatase: an X-ray absorption spectroscopic study,
Biochemistry 41, 4809-4818.
54. Diakun, G. P., Fairall, L., and Klug, A. (1986) EXAFS study of the zinc-binding sites in
the protein transcription factor IIIA, Nature 324, 698-699.
55. Stola, M., Musiani, F., Mangani, S., Turano, P., Safarov, N., Zambelli, B., and Ciurli, S.
(2006) The nickel site of Bacillus pasteurii UreE, a urease metallo-chaperone, as revealed
by metal-binding studies and X-ray absorption spectroscopy, Biochemistry 45, 6495-
6509.
56. Al-Mjeni, F., Ju, T., Pochapsky, T. C., and Maroney, M. J. (2002) XAS investigation of
the structure and function of Ni in acireductone dioxygenase, Biochemistry 41, 6761-
6769.
57. Colpas, G. J., Brayman, T. G., McCracken, J., Pressler, M. A., Babcock, G. T., Ming, L.-
J., Colangelo, C. M., Scott, R. A., and Hausinger, R. P. (1998) Spectroscopic
characterization of metal binding by Klebsiella aerogenes UreE urease accessory protein,
J. Biol. Inorg. Chem. 3, 150-160.
58. Chandrasekhar, S., and McAuley, A. (1992) Synthesis of an N2S-cyclodecane
macrocycle and its nickel(II) complexes, J. Chem. Soc. Dalton Trans., 2967-2970.
59. Goodman, D. C., Reibenspies, J. H., Goswami, N., Jurisson, S., and Darensbourg, M. Y.
(1997) A new macrocycle N3S2 ligand and its nickel(II), cobalt(II), rhodium(III)-103,
and rodium(III)-105 complexes, J. Am. Chem. Soc. 119, 4955-4963.
60. Halfen, J. A., and Young, V. G. J. (2003) Efficient preparation of 1,4,8-trimethlcyclam
and its conversion into thioalkyl-pendant pentadentate chelate, Chem. Comm. 2894-2895.
61. Perczel, A., and Fasman, G. D. (1992) Quantitative analysis of cyclic β-turn models,
Protein Sci. 1, 378-395.
62. Knappe, T. A., Eckert, B., Schaarschmidt, P., Scholz, C., and Schmid, F. X. (2007)
Insertion of a chaperone domain converts FKBP12 into a powerful catalyst of protein
folding, J. Mol. Biol. 368, 1458-1468.
63. Bloom, S. B., and Zamble, D. B. (2004) The metal-selective DNA-binding response of
Escherichia coli NikR, Biochemistry 43, 10029-10038.
64. Iwig, J. S., Rowe, J. L., and Chivers, P. T. (2006) Nickel homeostasis in Escherichia coli
- the rcnR-rcnA efflux pathway and its linkage to NikR function, Mol. Microbiol. 62,
252-262.
65. Rowe, J. L., Starnes, G. L., and Chivers, P. T. (2005) Complex transcriptional control
links NikABCDE-dependent nickel transport with hydrogenase expression in Escherichia
coli, J. Bacteriol. 187, 6317-6323.
66. Salgado, M. T., Bacher, K. L., and Stillman, M. J. (2007) Probing structural changes in
the alpha and beta domains of copper- and silver-substituted metallothionein by emission
spectroscopy and electrospray ionization mass spectrometry, J. Biol. Inorg. Chem. 12,
294-312.
67. Rigby Duncan, K. E., and Stillman, M. J. (2006) Metal-dependent protein folding:
metallation of metallothionein, J. Inorg. Biochem. 100, 2101-2107.
53
68. Ngu, T. T., Easton, A., and Stillman, M. J. (2008) Kinetic analysis of arsenic-metalation
of human metallothionein: significance of the two-domain structure, J. Am. Chem. Soc.
130, 17016-17028.
69. Zeng, Y. B., Zhang, D. M., Li, H., and Sun, H. (2008) Binding of Ni(2+) to a histidine-
and glutamine-rich protein, Hpn-like, J. Biol. Inorg. Chem. 13, 1121-1131.
70. Lee, M. H., Pankratz, H. S., Wang, S., Scott, R. A., Finnegan, M. G., Johnson, M. K.,
Ippolito, J. A., Christianson, D. W., and Hausinger, R. P. (1993) Purification and
characterization of Klebsiella aerogenes UreE protein: a nickel-binding protein that
functions in urease metallocenter assembly, Protein Sci 2, 1042-1052.
71. Fu, C., Olson, J. W., and Maier, R. J. (1995) HypB protein of Bradyrhizobium japonicum
is a metal-binding GTPase capable of binding 18 divalent nickel ions per dimer, Proc.
Natl. Acad. Sci. U.S.A. 92, 2333-2337.
72. Rey, L., Imperial, J., Palacios, J. M., and Ruiz-Argueso, T. (1994) Purification of
Rhizobium leguminosarum HypB, a nickel-binding protein required for hydrogenase
synthesis, J. Bacteriol. 176, 6066-6073.
73. Yang, S., Thackray, A. M., Fitzmaurice, T. J., and Bujdoso, R. (2008) Copper-induced
structural changes in the ovine prion protein are influenced by a polymorphism at codon
112, Biochim. Biophys. Acta. Prot. Proteom. 1784, 683-692.
74. Munoz, A., Dughish, M., Specher, T., Shaw, C. F., and Petering, D. H. (1999) Formation
and reactions of copper metallothionein in vitro and in cells, J. Inorg. Biochem. 74, 302-
302.
75. Wu, L.-F., Mandrand-Berthelot, M.-A., Waugh, R., Edmonds, C. J., Holt, S. E., and
Boxer, D. H. (1989) Nickel deficiency gives rise to the defective hydrogenase phenotype
of hydC and fnr mutants in Escherichia coli, Mol. Microbiol. 3, 1709-1718.
76. Jakob, U., Muse, W., Eser, M., and Bardwell, J. C. A. (1999) Chaperone activity with a
redox switch, Cell 96, 341-352.
77. Won, H. S., Low, L. Y., De Guzman, R., Martinez-Yamout, M., Jakob, U., and Dyson, H.
J. (2004) The zinc-dependent redox switch domain of the chaperone Hsp33 has a novel
fold, J. Mol. Biol. 341, 893-899.
78. Martin, V., Groenendyk, J., Steiner, S. S., Guo, L., Dabrowska, M., Parker, J. M. R.,
Muller-Esterl, W., Opas, M., and Michalak, M. (2006) Identification by mutational
analysis of amino acid residues essential in the chaperone function of calreticulin, J. Biol.
Chem. 281, 2338-2346.
79. Erdmann, F., and Fischer, G. (2007) The nickel-regulated peptidyl prolyl cis/trans
isomerase SlyD, in Metal Ions in Life Sciences (Sigel, A., Sigel, H., and Sigel, R. K. O.,
Eds.), pp 501-518, John Wiley and Sons.
80. Benanti, E. L., and Chivers, P. T. (2009) An intact urease assembly pathway is required
to compete with NikR for nickel ions in Helicobacter pylori, J. Bacteriol. 191, 2405-
2408.
81. Stingl, K., Schauer, K., Ecobichon, C., Labigne, A., Lenormand, P., Rousselle, J.-C.,
Namane, A., and De Reuse, H. (2008) In vivo interactome of Helicobacter pylori urease
revealed by tandem affinity purification, Mol. Cell. Proteom. 7, 2429-2441.
82. Palumaa, P., Eriste, E., Njunkova, O., Pokras, L., Jornvall, H., and Sillard, R. (2002)
Brain-specific metallothionein-3 has higher metal-binding capacity than ubiquitous
metallothioneins and binds metals noncooperatively, Biochemistry 41, 6158-6163.
54
83. Palumaa, P., Tammiste, I., Kruusel, K., Kangur, L., Jornvall, H., and Sillard, R. (2005)
Metal binding of metallothionein-3 versus metallothionein-2: lower affinity and higher
plasticity, Biochim. Biophys. Acta. Prot. Proteom.1747, 205-211.
55
Chapter 3 The in vitro metal selectivity and in vivo metal specificity of the
nickel metallochaperone SlyD
3.1 Introduction
Metal selectivity in biology is a complex and essential process that is achieved through the action
of a number of protein factors. These proteins involved in metal homeostasis ensure that metal-
dependent proteins are paired with the correct metal-ion to produce a biologically active protein.
Proteins involved in metal homeostasis include membrane importers/exporters, metal storage
proteins that are responsible for safe sequestration, metallochaperones dedicated to targeted
delivery of metal ions, as well as metal-sensing transcription factors which together control the
availability of a specific metal in the cytoplasm of the cell. The fidelity of the proteins involved
in metal homeostasis is at the top of a hierarchy of metal selectivity, as their specificity is now
proposed to ultimately influence the metal occupancy of all other proteins that require a metal
ion cofactor for function (1, 2). Therefore, knowledge of proteins involved in metal homeostasis
and their ability to recognize and chelate a cognate metal partner is a pre requisite to
understanding how metal specificity is achieved in the context of an entire cell.
The Escherichia coli protein SlyD is an example of a protein that is involved in Ni(II)
homeostasis. SlyD contributes to nickel accumulation in this organism and is also necessary for
energy metabolism because it participates in the nickel insertion step during [NiFe]-hydrogenase
metallocenter assembly (3, 4). NMR solution structures of E. coli SlyD revealed that the N-
terminal region consists of two well-defined domains, the FKBP (FK-506 binding protein)
domain and an IF (insert in the flap) domain that recognizes and binds to unfolded protein (5, 6).
The FKBP domain shares homology with other members of the FKBP family of peptidyl-prolyl
isomerases (PPIases) and catalyzes the otherwise slow isomerization of proline peptide bonds
during protein folding in vivo (7, 8). In E. coli SlyD the final 50 residues at the C-terminus
correspond to the metal-binding domain (MBD) and includes 28 potential metal-binding amino
acids (6 Cys, 15 His, 2 Glu, 5 Asp). This C-terminal domain is unstructured according to NMR
data and is variable between SlyD homologues (9). A vital role for the metal-binding domain
was established when truncations of this region resulted in compromised hydrogenase production
56
in E. coli (3). In support of the nickel-related in vivo function of SlyD, a recent analysis of the
protein revealed that it can bind up to 7 nickel ions with an affinity in the nanomolar range (10).
This in vitro investigation also revealed that SlyD coordinates nickel through a non-cooperative
mechanism and exists in a mixture of metalloforms at a given metal concentration. The ability of
the protein to sequester a substantial amount of Ni(II) in the unique MBD has been proposed to
contribute to Ni(II) storage in E. coli (11).
Although SlyD has been characterized in detail in the context of its nickel-binding capabilities,
this protein can bind several other types of transition metals such as Zn(II), Cu(II) and Co(II) in
vitro (12). However, this activity is not well characterized. Therefore, to establish whether SlyD
is specific for Ni(II), and if so, to gain an understanding of how this specificity is achieved, we
explored the metal binding activity of SlyD to several biologically relevant first row transition
metals, Mn(II), Fe(II), Co(II), Cu(I), and Zn(II) (13). Our results indicate that while SlyD is
unable to bind Mn(II) or Fe(II) with appreciable affinity it can bind to Co(II), Cu(I) and Zn(II).
We also find that Ni(II) can selectively bind to SlyD over Co(II) but that selectivity for nickel is
not observed in the presence of Cu(I) or Zn(II). Although SlyD did not exhibit selectivity
towards nickel in vitro, in vivo experiments reveal that SlyD can selectively influence the
balance of nickel ions in E. coli under anaerobic conditions.
3.2 Materials & Methods
Materials. The following metal salts, ZnSO4, [Cu(CH3CN)4]PF6, Ni(Acetate)2, CoSO4, FeSO4
and MnCl2 were purchased from Aldrich as a minimum 99.9% pure. Except for copper, all metal
solutions were prepared by dissolving the salts as purchased in Milli-Q water that was stirred in
an anaerobic glovebox (O2 < 1 ppm) for at least 24 hrs to minimize oxygen content.
Concentrations of metal stock solutions were verified by ICP-AES. The Cu(I) salts were re-
crystallized as described previously to remove any trace amounts of Cu(II) and the resulting
powder was dissolved in an Ar(g) saturated 30% (v/v) acetonitrile/water solution (14). The
concentrations of the copper solutions were established by using bathocuproine sulfonate (Bcs)
as described previously (15). Buffers for all metal assays were prepared with Milli-Q water that
was treated with Chelex-100 (Bio-Rad) and they were stirred in an anaerobic glovebox (O2 < 1
ppm) for at least 24 hrs prior to use. All titrations and assays were conducted at least in triplicate
57
to ensure reproducibility. The metal chelators ethyleneglycoltetraacetic acid (EGTA),
bicinchoninate (Bca), Bcs, glycine were purchased from Sigma-Aldrich as a minimum 99% pure
and the pH of the stock solutions were adjusted to match that of the protein buffer.
Protein expression, purification and preparation. SlyD wild-type (WT) and the triple mutant
proteins (triple mutant is devoid of any Cys residues and has the following mutation/deletions:
Cys 167,168,184,185 Ala and Δ193-196) were expressed and purified as mentioned previously
(10). Preparation of apo protein and determining the reduction state of the protein via N-Ethyl
maleimide modifications were carried out as described previously (10).
Metal binding via electronic absorption spectroscopy. Protein samples were buffer exchanged
into 20 mM HEPES pH 7.5, 100 mM NaCl and 90 L aliquots of apo SlyD were incubated with
the appropriate metal concentrations as noted at 4 oC under anaerobic conditions. Samples were
analyzed under aerobic conditions except for Fe(II) and Cu(I) titrations, which were measured in
an anaerobic cuvette to minimize exposure to air. Due to significant background signals from
Fe(II) and Cu(I) in HEPES buffer, direct metal-binding experiments for these two metals were
conducted in 10 mM ammonium acetate, pH 7.5 buffer. Experiments involving Cu(I) and
Bcs/Bca were conducted in 20 mM HEPES buffer pH 7.5, 100 mM NaCl and spectroscopic
analysis was conducted under aerobic conditions.
Equilibrium dialysis. SlyD samples of 40 M were dialyzed against an equal volume of
appropriate metal solutions containing 320 M metal at 4 oC overnight in an anaerobic glovebox
using Microchambers of DIALYZER (Harvard apparatus). At the end of the equilibration period
samples from the protein chamber (metal bound to protein + free metal) and the metal ion
chamber (free metal) were measured in triplicate via a previously described HPLC method (16).
Metal binding via ESI-MS. Protein samples were buffer exchanged using 500 L aliquots of 10
mM ammonium acetate, pH 7.5 in six dilution steps using 10K nanosep centrifugal devices
(PALL Science). Direct metal titration results for zinc were obtained by equilibrating the protein
samples (10 M each) with a known amount of ZnSO4 solutions. Titration of SlyD with Cu(I),
and Co(II) was obtained by incubating the protein samples (10 M) with [Cu(MeCN)4]+ and
CoSO4 respectively in the presence of 100 M DTT. Samples were allowed to equilibrate
overnight at 4 oC in an anaerobic glovebox, followed by transfer to septum capped vials for MS
analysis.
58
ESI-MS instrumental parameters and data acquisition/processing. The mass spectra were
acquired on a AB/Sciex QStarXL mass spectrometer equipped with an ion spray source in the
positive ion mode and a Hot Source-Induced Desolvation (HSID) interface (Ionics Mass
spectrometry Group Inc.). Ions were scanned from m/z 1300-3000 with accumulation of 1 s per
spectrum with no interscan time delay and averaged for a 2-4 min period. The instrument
parameters are as follows: ion source temperature 200 oC, ion source gas 50.0 psi; curtain Gas
50.0 psi; ion spray voltage 5000.0 V; declustering potential 60.0 V; focusing potential 60 V;
collision gas 3.0; MCP (detector) 2200.0 V. The spectra were deconvoluted using the Bayesian
protein reconstruction program over a mass range of 20000 – 22000 Da and a step mass of 1 Da,
signal/noise ratio of 20 and the minimum intensity detected set to 1 % were used during
reconstruction of the data. Addition of DTT to protein samples decreases the intensity of the
signal detected and at metal concentrations at or above 2 equivalents of metal (i.e. 20 M or
higher) the signal is further suppressed due to high salt conditions. Therefore, samples
containing DTT were acquired with similar instrument conditions listed above except the Q1
transmission was enhanced at m/z of 2500 Da. The amount of apo and holo SlyD species were
calculated from the signal intensities of the reconstructed spectra assuming that all different
metalloforms are ionized to the same extent. Only the peaks corresponding to salt free SlyD
were used for calculating the metallation states of SlyD.
Stoichiometry of metal binding via ESI-MS. To obtain the total number of metal-binding sites, a
100 L aliquot of 100 M SlyD in 10 mM ammonium acetate, pH 7.5 was incubated with the
indicated amount of the appropriate metal and was left to equilibrate overnight at 4 oC in an
anaerobic glovebox. The samples were then gel-filtered via PD-10 columns (GE Healthcare)
using 10 mM ammonium acetate, pH 7.5 to remove unbound or loosely-bound metal ions and
eluting fractions were analyzed via ESI-MS.
Competition experiments via ESI-MS. Fractions of the apo-protein in 10 mM ammonium acetate,
pH 7.5, were incubated with 10 equivalents of metal overnight at 4 oC under anaerobic
conditions. The protein samples were then gel-filtered via PD-10 column to remove excess
metal. The collected holo-protein fractions were incubated with known amounts of the
competitors, each prepared in chelexed MilliQ water and adjusted to a pH of 7.5 by using
ammonium hydroxide (metal-free grade). Samples were incubated overnight at 4 oC under an
anaerobic environment prior to analysis via ESI-MS. The metal affinity constants, protonation
59
constants of the chelators, metal bound chelators and aqueous metal ions at 25 oC were obtained
from the NIST (National Institute of Science and Technology) database version 8.0 (17). The
apparent constants at pH 7.5 were then calculated by using the method described by Fahrni et. al.
(18).
PAR competition experiments. A competition reaction was set up as noted in equation (A) by
adding increasing amounts of apo SlyD to separate aliquots of 400 M PAR containing 8 M
Zn(II) in 20 mM HEPES pH 7.5, 100 mM NaCl.
Zn(PAR)2 + SlyD ⇄ Zn-SlyD + 2PAR Kex1 (A)
Samples were equilibrated overnight at 4 oC and subsequently analyzed by electronic absorption
spectroscopy at 500 nm. Titrations of 400 M PAR with Zn(II) under identical conditions were
used to calculate the amount of [Zn-Par2] formed in the competition reactions described in (A).
As the pH of the solution greatly affects the formation constant of Zn-PAR2 complex as well as
the molar absorption coefficient () of this complex, the metal-binding affinity of PAR under
these particular buffer conditions were calibrated using EGTA as described in detail by
Zimmerman et al. (15). Briefly, increasing amounts of EGTA were titrated into 400 M PAR
containing 8 M Zn(II) to achieve a competition as noted in (B).
Zn(PAR)2 + EGTA ⇄ Zn-EGTA + 2PAR Kex2 (B)
An average KD of SlyD for zinc was then obtained from equation (C) (derived from combining
reactions A and B) where the known formation constant for Zn-EGTA corrected for pH (Ka =
109.39
) was used (18).
KD (Zn-SlyD) = KD (Zn-EGTA) x (Kex2/Kex1) (C)
Circular dichroism (CD) spectroscopy. Protein samples were pre-treated with EDTA and TCEP
as described above and buffer exchanged into 10 mM ammonium acetate pH 7.5 using micro-
centrifugal devices (MWCO of 10,000) (Pall nanosep centrifuge devices) in an anaerobic
glovebox. SlyD samples (60 µM) were incubated with known amounts of metal overnight at
4oC. Samples were loaded into a 0.1 cm cuvette and capped to minimize exposure to air. The
spectra were collected on a Jasco J-710 spectropolarimeter by scanning in the wavelength range
60
of 205−320 nm at room temperature. The final spectra obtained are averages of 5 scans collected
by using a scan speed of 20 nm/min.
Analytical gel filtration chromatography. Analytical gel filtration experiments were performed
on an analytical Superdex 75-HR column (GE Healthcare) at 4 °C with a flow rate of 0.5 ml/min
and using an injection loop of 100 µL. Protein sample of 75 µM were prepared and injected into
the column that was equilibrated with 20 mM HEPES, pH 7.5, 100 mM NaCl, 1 mM TCEP.
Samples were incubated with the indicated amount of metal at 4 °C overnight in an anaerobic
glovebox prior to use. Triple mutant samples were prepared under aerobic conditions. The
column was calibrated by injecting 100 µL of the LMW gel filtration standards kit (GE
Healthcare).
Cu(I)-binding stoichiometries and affinities using Bca and Bcs. All experiments were set up and
equilibrated in an anaerobic glovebox using buffers that were degassed with Argon for several
hours. Apo protein samples were titrated into a solution of [Cu(L)2]3-
(L = Bcs or Bca) of
defined molar ration L:Cu(I) ≥ 2.5, where the chelator concentration was kept high enough to
ensure negligible contribution from the 1:1 Cu:L complex. In these mixtures, the ligand and
copper concentrations were held constant while varying the concentration of the protein.
Transfer of Cu(I) from the chelator to protein or vice versa can be detected by the change in
absorbance at 483 nm for Bcs and 562 nm for Bca (15). By systematically varying the
concentration of the chelators and the protein, conditions that favoured either competitive or non-
competitive conditions were achieved. From the resulting spectra the KD and the stoichiometry
of SlyD for Cu(I) were determined.
Co(II) affinity using Fura2. A stock solution of 35 M Fura-2 (Invitrogen) containing 8-12 M
Co(II) was obtained by incubating the metal with the chelator for 30 min at room temperature.
The free dye concentration was determined by using absorption spectroscopy and the reported
extinction coefficient of 28000 M-1
cm-1
at 363 nm (19). To achieve competitive conditions as
noted in reaction (D), increasing amounts of apo SlyD were added to separate aliquots of this
cobalt-Fura2 solution and allowed to equilibrate overnight at 4 oC in an anaerobic glovebox.
[Co(II)-Fura2] + SlyD ⇄ Co-SlyD + Fura2 Kex3 (D)
KD (Co-SlyD) = (Kex3)-1
KD (Co-Fura2) (E)
61
The resulting solutions were analyzed using electronic absorption spectroscopy at 368 nm, which
indicates the amount of chelator bound to cobalt ion. An extinction coefficient of -24000 M-1
cm-1
at 368 nm was measured by titration of Fura2 with the CoSO4 alone under identical
conditions and used for calculating the concentration of Co(II)-Fura-2 present at each titration
point. An average KD of Co-SlyD was then calculated using data from several replicates via
equation (E).
Metal toxicity studies
(A) In LB media. Wild type and ΔslyD strains from the BW25113 KEIO gene deletion
collection were used in this assay (20). The growth rates of wild type and ΔslyD strains, under
different metal concentrations were assessed by measuring the OD600 over 24 h. The following
metal salts were utilized to supplement the growth media; NiCl2, CoSO4, ZnSO4 and CuSO4. All
cultures were maintained at 37 oC in an aerobic environment. The concentrations tested and the
observed effects are summarized in Table 3-1.
Table 3-1. Summary of metal concentrations used for metal toxicity studies.
Growth
Condition Metal tested [Metal(II))] M
LB media
Aerobic
Co(II) 100, 200, 500, 1000, 10000*
Ni(II) 100, 200, 500, 1000, 10000*
Cu(II) 100, 200, 500, 1000*
Zn(II) 100, 200, 500, 1000, 10000*
Minimal Media
Aerobic
Co(II) 10, 100*
Ni(II) 10, 30*, 100*
Cu(II) 10, 100, 250*†
Zn(II) 10, 150, 300, 400, 700*†
*No growth was detected for the wildtype and ΔslyD strains indicating lethal metal concentrations.
† A slight precipitate was detected upon addition of the metal to minimal media.
(B) In minimal media. All solutions used in this assay were treated with chelex-100 (Biorad)
overnight to remove any trace metals. Metal stocks were prepared from chelex-treated Milli-Q
water. The M9 media (1x) (Sigma) was supplemented with 0.2% glucose, 1 mM MgSO4 and
100 M CaCl2 and sterile filtered. Two bacterial strains were used in these toxicity studies: the
above mentioned BW25113 and the MC4100. The growth rate was monitored in M9 media by
measuring the OD600 over 24 h. All cultures were maintained at 37 oC under aerobic conditions.
The concentrations of metals tested and the observed effects are summarized in Table 3-1.
62
Growth conditions for quantitative real-time PCR (qRT-PCR).
(A) Aerobic. All experiments were conducted using the bacterial strain MC4100 and the ΔslyD
strain in the same background (21). Cultures were grown at 37 oC, shaking at 250 rpm
aerobically until the cultures reached exponential growth phase (approx. 16 hrs) followed by
treatment with a known amount of metal for 30 minutes.
(B) Anaerobic. For anaerobic growth experiments MC4100 wildtype, ΔslyD strains were used.
The M9 salts (1x) were chelex treated overnight to remove any trace metal and then the
following nutrients were added back to the media: 30 mM sodium formate, 0.5% glucose (v/v), 1
mM MgCl2, 100 nM CaCl2, 100 nM (NH4)2MoO4, 100 nM NaSeO3. Cultures were grown in a
capped bottle without any headspace for 17 hrs at 37 oC allowing the cultures to reach a mid-log
phase (OD600 =0.5 – 0.6). These anaerobically-grown cultures were then divided into sterile
falcon tubes containing no metal or with 10 M NiCl2 in an anaerobic glovebox. The small
cultures were then capped and allowed to grow for an additional 30 min at 37 oC. For analysis of
Zn(II) and Cu(II) under anaerobic conditions an identical procedure was followed, except the
chelex-treated M9 media was supplemented with only 0.2 % glucose (v/v), 1 mM MgCl2, 100
nM CaCl2.
RNA isolation and qRT-PCR. Total RNA was isolated by using the RNeasy Mini Kit (Qiagen)
according to the manufacturers’ protocol for the mechanical disruption and purification of
bacterial RNA. The QuantiTect Reverse Transcription Kit (Qiagen) was used for synthesis of
cDNA from ~0.5-1 g of RNA and to eliminate contaminating genomic DNA. qPCR reactions
were performed on a LightCycler 480 Real-time PCR block (Roche) using SYBR green
(Finnzymes) and primers specific for each transporter as listed in Table 3-2. holB mRNA
encoding for a DNA gyrase was used as an internal control as the expression level of this protein
was shown to be unaffected in the presence of metal (22).
63
Table 3-2. Primers used for qRT-PCR.
Primer Name Sequences (5’ 3’)
znuA forward ACATGCATCTTTGGCTTTCC
znuA reverse TGCCTCAAAATCCTTCAGGT
zntA forward AGAAAGCCCCTCAATTTGCT
zntA reverse CCGGAGACGTTTTCAGAGAG
copA forward CAAGCCAGAAATCGGTCAGC
copA reverse CAAAGAAATACCAGATTGCCGC
cusF forward ATGAAACCATGAGCGAAGCACA
cusF reverse CGGATCGTGATGGATGGTGAT
nikA forward CAGTGCTCGATAACCGTCAA
nikA reverse GCGCTTTTCAGGGTAATTTG
rcnA forward GAACCAGGGCACTCAAAAAC
rcnA reverse TGCGGTATGCGAAATAGTTG
holB forward GCTTAGGTGGTGCGAAAGTC
holB reverse GTTTCTGCTGGTGGCTCTTC
3.3 Results
The metal-binding domain (MBD) of SlyD is unusual because more than 50% of the residues in
this C-terminal region can potentially coordinate to a metal ion and contains a mixture of
thiolates, imidazoles and carboxylates. This distinctive amino acid composition raises the
question as to whether this protein can selectively bind Ni(II), the only metal ion thus far proven
to be associated with a SlyD function in vivo (21). To address this issue we characterized the in
vitro metal-binding activity of SlyD to several transition metal ions that are known to be
accumulated by E. coli (23).
Zn(II) binding to SlyD.
Zinc is one of the most abundant transition metals avidly acquired by E. coli and the intracellular
concentrations of this metal ion can reach up to ~0.1 mM (23). Given the abundance of zinc in
the cytoplasm and the ligand composition of MBD of SlyD, it is feasible that Zn(II) binds to
SlyD in vivo. We first examined Zn(II) binding to SlyD in vitro using mass spectrometry. Apo
protein samples were titrated with increasing amounts of ZnSO4 followed by ESI-MS analysis.
The observed charge states and the corresponding deconvoluted spectra for a representative
Zn(II) titration are shown in Figure 3-1. The data reveal the presence of several metalloforms of
the protein that differ in the amount of zinc bound at each titration point, indicating that SlyD
64
contains multiple metal-binding sites with similar affinities for zinc. The existence of these
stable, partially-metallated intermediates indicate a non-cooperative metallation mechanism
similar to that observed when SlyD chelates Ni(II) ions (10, 24). Changes in the charge state
distribution observed during ESI-MS analysis can be used to infer conformational changes of a
protein upon ligand binding (25). As previously noted (10), the m/z spectrum of apo-SlyD shows
the presence of two different populations of SlyD in solution (Figure 3-1), with an abundance of
protein carrying a higher charge (i.e. +16 signal is more intense than the signal for +9 species)
indicating that apo SlyD predominantly exists in a more unfolded state under these experimental
conditions. Upon titration with Zn(II) the relative peak intensities for the lower m/z species
decreases with increasing metal ion concentrations suggesting a metal-induced conformational
change in which the addition of Zn(II) shifts the equilibrium of SlyD to the more folded
conformer. A similar but more dramatic nickel-induced folding was noticed for SlyD in our
previous investigation, which was conducted on the same instrument under identical
experimental conditions but prior to installation of the HSID interface. The HSID is an
atmospheric pressure interface that is used for efficient dissolvation of sample, which is
accomplished via energy transfer from the hot gas as the ions travel through multiple flow
regions. The resulting ions are orthogonally introduced to the mass spectrometer and the
interface is expected to lead to greater sensitivity and stability of the signal while operating
similar to a conventional ion source (http://www.ionicsmsv.eu/ionicsmsveu.swf). To allow
comparison of data acquired under the same instrumental settings, nickel coordination to SlyD
was re-evaluated on the mass spectrometer now equipped with the interface. Slight changes in
the m/z spectra were noted; the apo SlyD spectrum is now predominantly populated by lower m/z
species (Figure 3-2) whereas without the interface the apo protein exhibited a higher abundance
of lower charge states (10). This difference in populations could be due to partial unfolding of
the protein in this HSID due to the higher temperatures used. However, as previously reported
the addition of nickel caused a shift in the charge state envelopes indicating metal-induced
folding. (Figure 3-2 and (10)). The resulting reconstructed data acquired on the mass
spectrometer with the HSID interface are comparable to the data obtained for SlyD previously,
revealing that the protein coordinates a variable number of nickel ions at a given metal
concentration, indicative of a non-cooperative metal-binding mechanism.
65
Figure 3-1. ESI-MS titration of SlyD with Zn(II). The addition of increasing amounts of Zn(II) to
SlyD (10 M) leads to concurrent filling of multiple metal sites indicating a non-cooperative metal-
binding mechanism. From top to bottom the equivalents of zinc added relative to protein concentration
are as follows: 0, 0.5, 1.5, 2, 4 and 6.3. The m/z spectra are shown on the left with their respective
reconstructed spectra in the right panels. The numbers heading the dotted-lines indicate the amount of
Zn(II) bound to SlyD (right panels) and the charge state of the protein (left panels).
m/z
Rel
ativ
e in
tens
ity
+16 +14 +12 +10 +9 +8
Mass (Da)
20800 21000 21400
0 1 2 3 4 5 6 7
1600 2000 2400 2800 21200
66
Figure 3-2. Re-evaluating Ni(II) binding to SlyD by ESI-MS. The m/z spectra (left panels) and the
reconstructed spectra (right panels) for a Ni(II) titration analyzed on the mass spectrometer equipped with
the HSID interface. Addition of increasing concentrations of nickel acetate to the apo protein (10 M)
results in simultaneous metal loading to multiple metal sites, which is indicative of a non-cooperative
Ni(II)-binding mechanism. The molar equivalents of nickel added relative to protein concentration from
top to bottom is as follows: 0, 0.6, 2.1, 3.5, 4.2, 6 The numbers leading the dotted-line represent the
amount of nickel bound to the protein (right panels) and the charge state of SlyD (left panels).
m/z
Re
lative
in
ten
sity
+16 +14 +12 +10 +9 +8
Mass (Da)
20800 21000 21400
0 1 2 3 4 5 6 7
1600 2000 2400 2800 21200
67
A definitive endpoint to the Zn(II) titration cannot be achieved because the concentration of salt
interferes with the quality of the MS data. Therefore, the total number of tight binding sites on
SlyD was established by analyzing a protein sample that was treated with an 8-fold excess of
Zn(II) overnight followed by gel-filtration to remove excess or loosely-bound Zn(II). The mass
spectrum indicates the presence of a mixed population of metallated species with a total of five
metal-binding sites with dominant peaks arising from the four and five Zn(II)-coordinated
species (Figure 3-3).
Figure 3-3. Zn(II) stoichiometry & affinity of SlyD. Mass spectra of a SlyD sample (100 M)
incubated with 800 M zinc followed by gel filtration to remove any weak or non-specifically bound
metal indicates a maximum capacity of 5 Zn(II) sites (Top panels). Treatment with 1 mM glycine does
not lead to any significant change in the amount of metal bound to the protein (bottom panels) indicating
that the KD (Zn-SlyD) is tighter than that of glycine for zinc ions.
To estimate the relative affinities of these multiple metal sites, this sample was incubated with an
excess of glycine. Analysis of the holo SlyD samples containing the competitor resulted in a
spectrum that was almost identical to the spectrum without any chelator added. Thus, the MS
data signify that SlyD is capable of binding up to 5 Zn(II) ions with an affinity greater than a Zn-
+TOF MS: 35 MCA scans from Sample 2 (ZnSlyD-Gelfil_27Mar2009) of ZnSlyD-Gelfil_27Mar2009.wiffa=3.56210051967030970e-004, t0=5.32468411187073800e+001
Max. 458.0 counts.
1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 3000 3100 3200 3300 3400 3500m/z, amu
0
20
40
60
80
100
120
140
160
180
200
220
240
260
280
300
320
340
360
380
400
420
440
458
Inte
ns
ity
, c
ou
nts
Mass reconstruction of +TOF MS: 35 MCA scans from Sample 2 (ZnSlyD-Gelfil_27Mar2009) of ZnSlyD-Gelfil_27Mar2009.wiff Max. 5991.3 cps.
2.090e4 2.095e4 2.100e4 2.105e4 2.110e4 2.115e4 2.120e4 2.125e4 2.130e4 2.135e4 2.140e4 2.145e4 2.150e4Mass, amu
0
200
400
600
800
1000
1200
1400
1600
1800
2000
2200
2400
2600
2800
3000
3200
3400
3600
3800
4000
4200
4400
4600
4800
5000
5200
5400
5600
5800
5991
Inte
ns
ity
, c
ps
21106.0000
+TOF MS: 35 MCA scans from Sample 3 (ZnSlyDGelFil_100uMGly_30March2009) of ZnSlyDGelFil_100uMGly_30March2009.wiffa=3.56210051967030970e-004, t0=5.32468411187073800e+001
Max. 209.0 counts.
1200 1300 1400 1500 1600 1700 1800 1900 2000 2100 2200 2300 2400 2500 2600 2700 2800 2900 3000 3100 3200 3300 3400 3500m/z, amu
0
10
20
30
40
50
60
70
80
90
100
110
120
130
140
150
160
170
180
190
200
209
Inte
ns
ity
, c
ou
nts
Mass reconstruction of +TOF MS: 35 MCA scans from Sample 3 (ZnSlyDGelFil_100uMGly_30March2009) of ZnSlyDGelFil_100uMGly_... Max. 1818.1 cps.
2.090e4 2.095e4 2.100e4 2.105e4 2.110e4 2.115e4 2.120e4 2.125e4 2.130e4 2.135e4 2.140e4 2.145e4 2.150e4Mass, amu
0
100
200
300
400
500
600
700
800
900
1000
1100
1200
1300
1400
1500
1600
1700
1800
Inte
ns
ity
, c
ps
21106.0000
Zn(II)
3
Zn(II)
4 Zn(II)
5
Zn(II)
3
Zn(II)
4Zn(II)
5
Rel
ativ
e in
tens
ity
1200 1600 2000 2400 2800 3200
m/z (Da) Mass (Da)
20800 21100 21300 21500
68
(glycine)2 complex (Ka of 104.96
) (17). On the other hand, the addition of the stronger Zn(II)
chelator EGTA (apparent KD at pH 7.5 of 4.25 x 10-10
M), to zinc-loaded SlyD results in a
progressive decrease in the amount of metal bound to SlyD and no distinct metalloform (i.e..
only 3 Zn(II) bound or only 2 Zn(II) bound) can be isolated at any given chelator concentrations,
providing evidence for multiple metal sites of similar affinity (Figure 3-4). Furthermore, this
competition indicated that SlyD can compete with EGTA for zinc coordination because the
protein is still bound to Zn(II) upon equilibration with ~80-fold excess of competitor.
Figure 3-4. Competition of SlyD with EGTA for Zn(II) binding. Titration of holo-SlyD (19.5 µM,
obtained via gel filtration of apo SlyD incubated with 8-fold excess metal) with increasing amounts of
EGTA in 10 mM ammonium acetate, pH 7.5. The samples were allowed to equilibrate for 5 hrs at room
temperature under anaerobic conditions. The relative intensities are representative of the abundance of
each species at a given titration point. Several metalloforms are observed at each titration point
implicating very similar affinities of the multiple metal sites present. Note that the x-axis ([EGTA]
values) is not linear.
To estimate the affinity of SlyD for zinc ions quantitatively, a competition assay was performed
using the colorimetric indicator PAR. This chelator forms a 2:1 PAR to Zn(II) complex in
solutions that results in an increased absorbance at 500 nm (26). Titration of increasing amount
00.195
0.5850.975
1.56
0
0.2
0.4
0.6
0
1
2
3
4
5
Rela
tive I
nte
nsity
69
of apo SlyD to a 400 M PAR solution containing 8 M Zn(II) results in a gradual decrease in
the signal at 500 nm (as opposed to a linear decrease) indicative of an effective competition
between the protein and the ligand as described in reaction (A) (Figure 3-5). An identical
titration with EGTA instead of protein was also conducted to calibrate the affinity of the Zn-
PAR2 under the buffer conditions used, since the formation constant of this complex is affected
by the pH (15). The resulting data from these two titrations were fitted to a model assuming a
single binding event to obtain an apparent KD of 1.0 ± 0.4 x 10-10
M for demonstrating that SlyD
binds zinc more tightly than EGTA at pH 7.5 (Figure 3-5).
Figure 3-5. Determining the Zn(II) dissociation constant (KD) of SlyD using PAR. Change in the
amount of Zn(II)-Par2 complex upon addition of increasing amounts of apo SlyD (filled diamonds) or
EGTA (unfilled squares). Change in the Zn(II)-PAR2 complex is proportional to the absorption at 500
nm. Titrations were conducted in 20 mM HEPES pH 7.5, 100 mM NaCl with a [PAR]Total = 400 M and
[Zn(II)]Total = 8 M. SlyD is more effective than EGTA at pH 7.5 at competing with PAR for zinc,
indicating KD(Zn-SlyD) < KD (Zn-EGTA) of 10-9.3
M.
For comparison, the affinity of Ni(II)-SlyD complexes were also evaluated. Exploratory
experiments indicated that the protein could out compete Fura-2 (KD 2.4 x 10-8
M, (27)) for
Ni(II) coordination (data not shown) establishing a quantitative upper-limit to nickel-SlyD
0
0.2
0.4
0.6
0.8
1
0 0.4 0.8 1.2 1.6 2
Fra
ction o
f Z
n(I
I)-P
AR
2C
om
ple
x
SlyD or (EGTA):Zn(II)
70
complexes. Combining these results with the fact that Ni(II) can bind to SlyD concurrently with
Zn(II) (see below), a KD(Ni(II)-SlyD) of 10-10
M can be roughly estimated.
To determine whether zinc binding could induce structural changes in the protein as suggested
by ESI-MS, a Zn(II) titration was analyzed by using CD spectroscopy. Two minima are
observed for the apo protein at 215 nm and 227 nm (Figure 3-6). Typically proteins with β-sheet
type structures give rise to the band at 215 nm, as would be expected for SlyD because both the
PPIase and IF domains are predominantly composed of β-sheets (6), whereas the 227 nm band
suggests the presence of β-turn type structure (28, 29). As SlyD is titrated with increasing
amounts of Zn(II) a gradual decrease in the molar ellipticity is observed in the far-UV region that
reaches a plateau upon addition of 4 mol equiv of Zn(II). Although this trend is similar to that
observed when SlyD chelates nickel, the overall degree of change in the molar ellipticity is
significantly lower for Zn(II). Therefore, the CD spectra suggests that the zinc-induced
secondary structure for SlyD is likely different from that of Ni(II). Additional evidence for the
adaptation of a different conformation by SlyD when binding zinc is the lack of a signal at 270
nm. The chromophores at these longer wavelengths are usually aromatic residues (tyrosine and
phenylalanines in the case of SlyD) that are exclusively located in the PPIase and the IF-domains
of SlyD. These residues can generate a signal in response to even a very minor change in their
environment that may occur as a result of ligand binding (30). This lack of a charge transfer
band at 270 nm region implies that Zn(II) binding gives rise to a tertiary conformation that is
distinct from that of nickel(II)-bound SlyD. However, considering that this 270 nm signal could
also arise from charge transfer between metal and an aromatic residue (31), the lack of such a
transfer processes with a closed shell d10
metal such as zinc could also be a likely explanation for
this difference.
SlyD is a monomeric protein that can bind Ni(II) without any quaternary structure changes (10).
In order to investigate whether SlyD bound Zn(II) is also a monomer, analytical gel-filtration
chromatography was utilized. The addition of up to 4 mol equiv of Zn(II) did not change the
oligomeric state of SlyD (Figure 3-7). However, addition of 6 mol equiv of Zn(II) and higher
resulted in a very broad elution profile with no distinct peaks except for the monomer indicating
that SlyD is susceptible to form oligomers at these higher Zn(II) concentrations. Therefore,
unlike with nickel, higher zinc concentrations can influence the quaternary structure of the
protein such that SlyD is in an equilibrium of monomer and oligomers.
71
Figure 3-6. Comparison of Ni(II)- vs. Zn(II)-induced secondary structure changes in SlyD. A
decrease in the mean residue ellipticity is detected in the far-UV region as compared to the apo protein
(60 M) spectrum (filled circles) when the protein is incubated with metal. The spectra for the metal
loaded SlyD are as follows: 2 equiv. Zn(II) (filled diamonds), 2 equiv. Ni(II) (unfilled diamonds), 4 equiv
Zn(II) (filled triangles), 4 equiv Ni(II) (unfilled triangles) and 8 equiv Zn(II) (black crosses).
Figure 3-7. Zn(II) dependent oligomeric state of SlyD. Analytical gel-filtration chromatography of 75
M apo SlyD (black line), SlyD with 2 molar equiv. of Zn(II) (green line), 4 molar equiv. of Zn(II) (red
line), and 6 mol equiv of Zn(II) (blue line). The elution volume of ~18 mL corresponds to monomeric
SlyD species and addition of excess zinc (6 mol equiv. and higher) results in a broad elution profile
suggestive of zinc-induced oligomer formation.
-24
-19
-14
-9
-4
1
6
205 225 245 265 285 305
ӨM
RE
x 1
04
(de
g c
m2
dm
ol-1)
Wavelength (nm)
0
2
4
6
8
10
12
14
11 13 15 17 19 21
Abso
rba
nce
(A
U)
Elution Volume (mL)
← Monomer
Oligomer →
72
To assess the selectivity of SlyD for Zn(II) or Ni(II), a competition titration was conducted in
which apo SlyD was incubated with equivalent amounts of Ni(II) and Zn(II) overnight. Binding
of zinc to the protein could be monitored indirectly because replacement of nickel by zinc results
in a decrease in the ligand to metal charge transfer (LMCT) band at 315 nm produced by the
nickel-SlyD complex (10). A less intense signal is observed when apo SlyD is titrated with an
equimolar solution of nickel and zinc in comparison to titration of apo SlyD with Ni(II) alone
(Figure 3-8A). Thus the data provide evidence for metal-binding sites on SlyD that
preferentially sequester Zn(II) in the presence of Ni(II). In order to assess whether the order of
metal addition affects the metallation state of SlyD, two competition titrations were carried out.
Figure 3-8. Selectivity of SlyD for Ni(II) vs. Zn(II). (A) Addition of equimolar solution of Ni(II) and
Zn(II) to SlyD (filled diamonds) results in lower intensity LMCT at 315 nm, when compared to a titration
with equivalent amounts of Ni(II) alone (unfilled diamonds). The x-axis indicates the total amounts of
Ni(II) added relative to apo SlyD (15 M). (B) Change in A315 as Ni(II) is added to a SlyD sample (15
M) pre-incubated with 8 mol equiv of Zn(II) (filled diamonds) or addition of Zn(II) into a SlyD sample
(15 M) pre-incubated with 8 mol equiv. of Ni(II) (unfilled diamonds). The absorbance was normalized
by dividing the absorbance at 315 nm by the concentration of the protein used.
Firstly, SlyD was pre-incubated with 8 fold excess Ni(II) for 24 h followed by a Zn(II) titration
and replacement of Ni(II) was detected as a decrease in the intensity of the LMCT band at 315
nm. Secondly, SlyD was pre-treated with 8 mol excess of Zn(II) for 24 h followed by a Ni(II)
titration and replacement of the Zn(II) by nickel could be detected as an increase in the intensity
of LMCT band at 315 nm. A representative data set for each of the competition titrations that
were allowed to equilibrate for 24 h after the addition of the second metal ion is shown in Figure
3-8B. Increasing the incubation period after addition of the second metal to 48 h or 72 h
0
0.003
0.006
0.009
0.012
0.015
0 4 8 12 16 20
Nor
mal
ized
ΔA
bs31
5(
M-1
)
[Metal(II)]/[SlyD]
0
0.003
0.006
0.009
0.012
0.015
0 1 2 3 4 5 6 7 8
Nor
mal
ized
Abs
315
(M
-1)
[Ni(II)]/[SlyD]
(A) (B)
73
generated similar results indicating that 24 h is sufficient to reach a thermodynamic equilibrium
(data not shown). The results are a clear indication of the fact that nickel is able to replace a
fraction of the Zn(II) bound to SlyD and vice versa. Furthermore, the two titration curves do not
intersect at any of the metal concentrations tested, highlighting that the metallation state of SlyD
is dependent on the order of metal addition when considering Ni(II) and Zn(II).
Cu(I) binding to SlyD.
Compared to zinc the intracellular copper quota is lower in E. coli, reaching only about 10 M
(23). As SlyD is a cytoplasmic protein we only characterized Cu(I) (not Cu(II)) binding to the
protein because this is likely the prevalent form of copper present in the reducing cytosolic
environment (32). Cu(I) addition to SlyD is accompanied by a charge transfer band centred
around 254 nm that increases in intensity as a function of the metal content added, reaching
saturation around 4-5 equivalents of metal added (Figure 3-9). There is precedence for binding
of electron rich Cu(I) to the softer thiolate ligands and the 254 nm signal is ascribed to a S
Cu(I) charge transfer band (33, 34). To verify that the 254 nm LMCT is due to the formation of
the Cu(I)-thiolate bond, a similar titration was conducted using the SlyD mutant devoid of all
Cys residues (denoted as the triple mutant here onwards). Addition of Cu(I) to the mutant SlyD
failed to generate a change in the absorption spectrum, providing support to the fact that the
LMCT bands are due to Cu(I) binding to SlyD via thiolate residues (data not shown).
To gain an understanding of the Cu(I)-binding mechanism of SlyD, copper titrations were
analyzed via ESI-MS. Although all possible precautions were taken to ensure anaerobic
conditions, the addition of Cu(I) resulted in the appearance of protein-dimers that increased in
intensity with the addition of increasing amount of Cu(I) (data not shown). The dimer formation
was accompanied by a decrease in the protein mass by 6 Da suggesting oxidation of the protein
because the oxidized form of SlyD also exhibits this decrease in mass from 20852 Da to 20846
Da (data not shown). Therefore, copper titrations of SlyD were re-evaluated in the presence of
100 M DTT. Inclusion of the reducing agent did indeed prevent the formation of protein-
dimers and the accompanying loss of mass indicating that in the presence of Cu(I) the protein is
extremely susceptible to oxidation (Figure 3-10). Addition of DTT to the protein buffer
significantly reduced the ion signal detected resulting in spectra with poor resolution (data not
shown). Therefore, to improve the quality of the spectra, Cu(I) titrations containing DTT in the
74
buffer were acquired with the ion signal enhanced at a m/z of 2500 Da. Representative spectra
for a copper titration acquired under these conditions are shown in Figure 3-10, and demonstrate
that the addition of Cu(I) results in the appearance of several Cu(I)-bound SlyD species. At
metal concentrations below 4 molar equivalents of Cu(I), the predominant species observed
correspond to apo SlyD, SlyD with a single copper ion bound and SlyD with 4 Cu(I) bound.
Assuming that all metal-SlyD species are ionized to the same extent, the metallation pattern
implies that binding of a single Cu(I) ion facilitates the binding of the 2nd
, 3rd
and the 4th
Cu(I)
ion to the protein. Therefore, unlike Ni(II) or Zn(II) coordination, SlyD appears to bind Cu(I)
through a cooperative mechanism. The binding process is not fully cooperative as minor peaks
corresponding to intermediate states can still be observed (i.e. 2 Cu(I) or 3 Cu(I)-bound SlyD).
The addition of 6 molar equivalents of Cu(I) results in the appearance of metalloforms with more
than 4 Cu(I) ions bound indicating additional metal-binding sites on SlyD. However a definite
saturation point could not be obtained through this direct titration method as these concentrations
of salt interfere with the quality of the MS data. It should be noted that significant changes in the
population of charge states are not detected when Cu(I) is added. This is due to the above
mentioned enhancement of the signal at m/z 2500 Da because Ni(II) titrations analyzed under
these instrument settings did not lead to the expected shift in the m/z spectra that is indicative of
metal-induced folding (Figure 3-2 and data not shown).
Figure 3-9. Visualizing Cu(I) binding to SlyD. An anaerobic titration of apo SlyD (25 M) with
increasing Cu(I) results in the appearance of charge a transfer band ~ 254 nm, indicative of Cu(I) binding
to thiolate ligands (inset). A plot of the change in Abs254 (normalized relative to the protein
concentration) versus equivalents of copper indicates saturation around ~3.5-4 equivalents of Cu(I) added.
0
0.004
0.008
0.012
0.016
0.0 2.0 4.0 6.0 8.0
Norm
aliz
ed
Δ
Ab
s2
54
(
M-1
)
[Cu(I)]/[SlyD]
0
0.2
0.4
0.6
0.8
1
1.2
1.4
220 260 300 340 380 420
Ab
so
rba
nce
Wavelength (nm)
75
Figure 3-10. ESI-MS titration of SlyD with Cu(I) in the presence of 100 M DTT. The addition of
increasing amounts of Cu(I) to SlyD (10 M) leads to appearance of several Cu(I)-SlyD species. From
top to bottom the equivalents of Cu(I) added relative to protein concentrations are as follows: 0, 0.3, 0.8,
2.3, 3.9, 6 The m/z spectra are shown on the left with their respective reconstructed spectra on the right.
The numbers heading the dotted lines indicate the amount of Cu(I) bound to SlyD (right panels) and the
charge state of the protein (left panels). The most intense peaks correspond to apo, 1 Cu(I) and 4 Cu(I)-
bound SlyD species (at Cu(I) equivalents < 4) suggestive of a cooperative metal-binding mechanism.
Given that ESI-MS could not be used to determined the Cu(I) stoichiometry, coupled with the
fact that Cu(I) binding to SlyD was analyzed in the presence of DTT, which has a considerable
affinity for Cu(I) (35), the stoichiometry of the metal complex was re-evaluated by using the
small molecule chelator Bca. This copper probe forms an air stable [Cu(Bca)2]3-
complex with a
formation constant of β2 = 1017.2
that gives rise to a readily detectable charge transfer band in the
visible region with a maximum at 562 nm ( = 7900 M-1
cm-1
) (15). Titration of apo wild-type
protein into a solution of 40 M Cu(I) and 100 M Bca resulted in a linear decrease in the signal
m/z
Rel
ativ
e in
tens
ity+16 +14 +12 +10 +9 +8
Mass (Da)20800 21200 21600
0 1 2 3 4 5 6
1600 2000 2400 2800
76
at 562 nm indicating that the conditions used resulted in non-competitive conditions (Figure 3-11
inset). Increasing the Bca concentrations to 300 M while keeping the copper concentration at
40 M resulted in the same linear decrease in absorbance at 562 nm, indicating that the protein
binds Cu(I) with a much higher affinity than Bca. A linear fit of the data indicate that 10 M
SlyD is sufficient to remove the 40 M Cu(I) bound to Bca, thereby confirming that Bca
concentrations ≤ 300 M cannot compete with SlyD and that the protein binds 4 equivalents of
Cu(I) (Figure 3-11).
Figure 3-11. Stoichiometry of SlyD for Cu(I). Titration of apo SlyD into a solution of 100 M Bca
containing 40 M Cu(I) results in linear decrease in absorbance at 562 nm. A linear fit of the data reveals
that at 0.25 [SlyD]/[Cu(I)] all the Cu(I) is removed from Bca by the protein, indicating a stoichiometry of
4 Cu(I)/SlyD monomer.
To determine the KCu(I) of SlyD, competitive conditions were achieved by using the Bcs chelator.
Similar to the Bca, Bcs also coordinates Cu(I) to form an air-stable [Cu(Bcs)2]3-
, albeit with a
higher formation constant (β2 = 1019.8
), which can be detected by a charge transfer band with a
maximum at 483 nm ( = 13000 M-1
cm-1
) (15). Addition of increasing amount of apo SlyD to a
mixture containing 40 M Cu(I) and 100 M Bcs revealed that SlyD competes for copper at this
concentration of the chelator whereas increasing the Bcs concentration to 500 M while keeping
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0 0.05 0.1 0.15 0.2 0.25 0.3
Absorb
ance 562 n
m
[SlyD]: [Cu(I)]
0
0.1
0.2
0.3
0.4
0 0.2 0.4 0.6
Absorb
ance 562 n
m
[SlyD]/[Cu(I)]
77
the copper concentration constant suggested that SlyD is unable to compete effectively at this
high chelator concentration (Figure 3-12). Thus titration of protein into a solution with constant
concentrations of Bcs and copper at 200 M and 40 M respectively was used to determine the
affinity of Cu(I) for SlyD (Figure 3-12). The data were fitted assuming a single binding scheme
to obtain an apparent KD of (1.5 ± 0.3) x 10-17
M for Cu(I) binding to SlyD.
Figure 3-12. Determining the Cu(I) KD for SlyD. Change in the absorbance at 483 nm upon the
addition of apo SlyD to solutions with a constant Cu(I) concentration of 40 M and [Bcs]total = 100 M
(squares), 300 M (circles), 500 M (triangles). The non-linear decrease in the absorption with increasing
protein concentration is indicative of competitive conditions for Cu(I) binding.
To evaluate the metal selectivity of SlyD with respect to Cu(I), a second series of experiments
were conducted using the weaker copper probe, Bca. To establish whether the reaction described
in equation (F) can occur, 10 M SlyD was first incubated with 50 M Cu(I) for 1 h, followed
by addition of 200 M Bca. Then to this resulting mixture 80 M of Ni(II) or Zn(II) was added
that was allowed to equilibrate for 24 h .
Cu4ISlyD + M
II + 2 Bca
2- ⇄ M
IISlyD + 4Cu
I(Bca)2
3- (F)
As expected, the addition of Bca to the SlyD sample containing 5 molar excess of Cu(I) leads to
an increase in the absorption at 562 nm (data not shown). The absorbance corresponds to a
concentration of 10 M CuI(Bca)2
3-, because SlyD can only bind 40 M of the added Cu(I) in
0
0.1
0.2
0.3
0.4
0.5
0.6
0 0.4 0.8 1.2 1.6 2
Ab
so
rba
nce
48
3 n
m
[SlyD]/[Cu(I)]
78
the presence of this chelator (discussed above and see figure 3-11). The ability of either Ni(II) or
Zn(II) to replace the bound Cu(I) was then measured indirectly in these competition experiments,
because the displaced Cu(I) will form a complex with the Bca leading to an increased absorption
at 562 nm. Excess Ni(II) or Zn (II) did not change the signal at 562 nm, demonstrating that the
forward reaction in (F) did not occur under these experimental conditions (data not shown).
Control experiments were conducted with Bca and Ni(II) or Zn(II) alone to ensure that addition
of these metals did not alter the spectrum of Bca. To determine if the reverse reaction could be
achieved, a 10 M protein sample was pre-incubated with 8 equivalents of Ni(II) or Zn(II) for 24
h, followed by addition of 5 equivalents of Cu(I) and 200 M Bca and equilibration for an
additional 24 h. The resulting absorbance of these samples at 562 nm corresponded to only 10
M CuI(Bca)2
3- suggesting that the rest of the 40 M Cu(I) was bound by SlyD (data not
shown). Therefore, these results support tight binding of 4 Cu(I) ions even in the presence of
Ni(II) or Zn(II). This preferential binding of Cu(I) corroborates the thermodynamic parameters
measured for the different metals thus far, where KD (Cu(I)-SlyD) < KD (Ni(II)-SlyD), KD (Zn-SlyD).
Co(II) binding to SlyD.
Although cobalt is not widely used by E. coli this transition metal ion can still be found in low
abundance in the cytosol of this bacteria (13). In addition, Co(II) was of particular interest to us
because two other proteins involved in nickel homeostasis, RcnR and RcnA are known to also
bind and respond to cobalt in vivo (36). To observe whether SlyD could coordinate Co(II), a
direct cobalt titration of apo SlyD was analyzed via electronic absorption spectroscopy. The
resulting spectra indicate that addition of Co(II) leads to an increase in the absorption at 280 nm
accompanied by a broad shoulder in the 300-390 nm region that saturates upon addition of 3-4
equivalents of the metal (Figure 3-13). The absorption spectrum of the Co(II)-saturated SlyD
sample reveals the presence of an LMCT band at 293 nm (c = 7800 M-1
cm-1
) and a broader
charge transfer band centred around 360 nm (c = 3418 M-1
cm-1
) (the linear increase in
absorption as a result of increasing Co(II) concentrations was used to determine the molar
absorptivity of the metal-protein complex). These near UV-Vis bands have been noted for
several proteins that chelate Co(II) in vitro, and are attributed to ligand-to-metal charge transfer
from thiolates in Cys residues to the metal centre (36, 37). This assignment of bands is
supported by the lack of such a CT band when Co(II) is added to the triple mutant (data not
79
shown). The intensity of these near UV bands can be used to estimate the number of S-Co(II)
interactions with an expected 900-1200 M-1
cm-1
per S-Co(II). Based on the extinction
coefficient of 7800 M-1
cm-1
calculated for SlyD it is likely all six Cys residue contribute to
cobalt coordination.
Figure 3-13. Co(II) binding to SlyD. Difference spectrum generated by subtracting apo SlyD (25 M)
from a protein sample incubated with 7 equivalents of Co(II). Inset: Plot of molar absorptivity at 320 nm
vs. equivalents of Co(II) indicates saturation around 3-4 equivalents of Co(II) added.
The visible regions of Co(II) complexes typically have bands due to d-d transitions that are
diagnostic of the coordination environment of the metal within the protein (38). As the molar
absorption coefficient for these bands are expected to be ten-fold lower than the LMCTs (38), a
300 M protein sample was titrated with Co(II) under anaerobic conditions. Titration with
increasing amounts of cobalt resulted in an absorption band centred at 650 nm that exhibit
maximum absorbance upon addition of 2.5 equivalents of metal (Figure 3-14). Extinction
coefficients for Co(II) d-d transitions are useful in determining the geometry of the metal site
such that four coordinate tetrahedral sites exhibit d-d bands with > 300 M-1
cm-1
, five-
coordinate ion has 50 M-1
cm-1
< < 300 M-1
cm-1
and an octahedral site exhibit transition bands
with < 50 M-1
cm-1
(39). An extinction coefficient of 235 M-1
cm-1
was obtained for SlyD
(based on the linear region of the titration curve, with up to 2 equivalents of Co(II) added)
suggestive of formation of predominantly five coordinate Co(II) centres in SlyD. Further cobalt
0
0.1
0.2
0.3
0.4
0.5
240 340 440 540 640 740
Ab
so
rba
nce
Wavelength (nm)
0
0.002
0.004
0.006
0.008
0 2 4 6 8 10
Norm
aliz
ed
Δ
Abs
32
0(
M-1
)
Equivalents of Co(II)
80
addition is accompanied by blue shifting of these spectra with subsequent decrease in the A650
signal that plateaus around 4-5 equivalents of Co(II), indicating changes in the average
coordination sphere at higher cobalt concentrations (Figure 3-14).
Figure 3-14. Resulting d-d transitions upon Co(II) binding to SlyD. (A) The addition of Co(II) to a
300 M SlyD sample leads to the appearance of d-d transition bands centred around 650 nm. (B) A plot
of the change in absorbance at 650 nm versus the total concentration of cobalt indicates that maximum
absorbance is achieved upon addition of ~3 equivalents of Co(II). Co(II) concentrations beyond 3
equivalents leads to blue shifting and significant changes in the absorption profile (dashed lines in (A))
that plateaus around 4-5 equivalents of cobalt ions added (B).
To evaluate Co(II) binding in more depth, the binding of this metal to the protein was further
analyzed by ESI-MS. Similar to copper titrations mentioned above, the addition of cobalt ions
led to a concomitant decrease in mass of the protein by 6 Da and the appearance of dimer species
(data not shown), indicating the oxidation of the protein. Therefore, titrations were carried out in
the presence of 100 M DTT. Mass spectrometry data revealed that similar to zinc and nickel
ions, Co(II) binding by the protein also occurred through a non-cooperative metal-binding
mechanism as mixtures of metallated species were detected at all Co(II) concentrations tested
(Figure 3-15). At a given amount of Co(II), less Co(II)-SlyD species were observed for samples
containing DTT than samples without DTT indicating that the reducing agent was competing
with SlyD for cobalt ion binding (data not shown). Therefore, the stoichiometry of the protein
for Co(II) was established through equilibrium dialysis which indicated an average of 4 Co(II)
per monomer, a capacity analogous to that of nickel ions for SlyD (Table 3-3).
0
0.0002
0.0004
0.0006
0.0008
0.0 2.0 4.0 6.0 8.0 10.0N
orm
aliz
ed A
bs
650
(M
-1)
[Co(II)]/SlyD
(B)
0
0.05
0.1
0.15
0.2
0.25
0.3
400 500 600 700 800 900
Absorb
ance
Wavelength (nm)
(A)
81
Figure 3-15. ESI-MS titration of WT SlyD with Co(II) in the presence of 100 M DTT. Addition of
increasing amounts of Co(II) to SlyD (10 M) leads to concurrent filling of multiple metal sites indicating
a non-cooperative metal-binding mechanism. From top to bottom the equivalents of Co(II) added relative
to protein concentration are as follows: 0, 1, 2.5, 3.5, 4.4, 7 The m/z spectra are shown on the left with
their respective reconstructed spectra on the right panel. The numbers heading the dotted-line indicate the
amount of Co(II) bound to SlyD (right panels) and the charge states of the protein (left panels). The
amount of Co(II)-SlyD appears to be less than the total Co(II) added to the solution when DTT is included
in the protein buffer, suggesting the reducing agent competes with SlyD for cobalt coordination.
Mass (Da)
20800 21200 21600
Rel
ativ
e in
tens
ity
+16 +14 +12 +10 +9 +8 0 1 2 3 4 5 6
1600 2000 2400 2800
m/z
82
Table 3-3. Metal stoichiometry of WT SlyD†.
Metal Ni (II) Mn (II) Co(II)
Mn(II) 0.2 ± 0.1
Co(II) 3.9 ± 0.1
Ni(II) 4.2 ± 0.3
Ni(II) & Mn(II) 4.0 ± 0.2 n/d*
Ni(II) & Co(II) 4.4 ± 0.1 n/d*
†Stoichiometries were determined by using equilibrium dialysis in which 40 M apo SlyD samples were dialyzed
against an equal volume of 320 M metal each, over night at 4 oC in an anaerobic glovebox. *n/d, a protein-metal
complex for the particular metal was not detected.
To establish the affinity of SlyD for Co(II), competition experiments with the fluorescence
indicator Fura-2 were performed. Although Fura-2 was originally designed as a molecular
sensor for Ca(II), this chelator has been previously used for determining the affinity of several
proteins for various transition metals including Co(II) (19, 37). The chelator forms a 1:1
complex with Co(II) that can be visualized by the decrease in absorbance at 368 nm.
Competitive conditions required for determining the dissociation constant of SlyD for cobalt ions
were achieved by titrating apo protein into a constant concentration of [Co(II)-Fura2], leading to
an increase in the signal at 368 nm (indicative of a decreasing [Co(II)-Fura2]- in solution) (Figure
3-16). To determine the affinity, data with a fractional saturation between 0.8-0.2 (with respect
to the Fura-2) from several replicates were compiled to obtain an average KD (SlyD-Co(II)) of 4 ± 1 x
10-9
M. It should be noted that we used the KD of 8.64 x 10-9
M reported for the [Co(II)-Fura2]
complex at pH 7.0 (40), as the affinity of this chelator to metal is constant near neutral pH (41).
As both Co(II)- and Ni(II)-bound SlyD give rise to spectra with transitions in the near UV-
Visible region, metal selectivity of the protein was established by using equilibrium dialysis.
Analysis of samples equilibrated with a solution containing 8-fold excesses of Co(II) and Ni(II)
revealed that the protein was exclusively bound to nickel with an average stoichiometry of 4.4
(Table 3-3). As SlyD binds nickel with an average nickel stoichiometry of ~4 when equilibrated
with Ni(II) alone (Table 3-3 and (10)) these data indicate that SlyD selectively coordinates nickel
to its’ full capacity in the presence of Co(II). Specificity of the protein for Co(II) versus Zn(II)
was established by taking advantage of the absence of LMCT bands when Zn(II) chelates to
SlyD. Incubation of SlyD with 7 mol equivalents of Zn(II) for 24 h followed by addition of
increasing amounts of Co(II) that was allowed to equilibrate further up to 72 h failed to generate
83
any CT bands (data not shown). Thus, these results indicate that SlyD binds Zn(II) preferentially
over cobalt as expected given the measured affinity of SlyD for the individual metals. Similarly,
as Zn(II) was titrated into a sample of SlyD pre-incubated with 8-fold excess of Co(II) the
LMCT band at 320 nm decreased in intensity, and disappeared completely at 6 equivalents of
Zn(II) added indicating effective replacement of Co(II) with Zn(II) at metal sites composed of
Cys ligands (Figure 3-17).
Figure 3-16. Affinity of SlyD to Co(II) via Fura-2 competition. Titration of apo SlyD into a solution
of Co(II) (10 M) and Fura-2 (35 M) leads to a decrease in the amount of [Co(II)-Fura2]2-
in solution
that is detected by the absorbance at 368 nm. From competition titrations such as that shown an apparent
KD (Co(II)-SlyD) of 4 ± 1 x 10-9
M was obtained.
0
0.2
0.4
0.6
0.8
1
0 4 8 12 16 20 24
Fra
ction o
f [C
o(I
I)-F
ura
2]
com
ple
x
[SlyD]Total (M)
84
Figure 3-17. Zn(II) can replace Co(II) bound to SlyD. Addition of increasing amounts of Zn(II) to a
SlyD sample (25 M) saturated with Co(II) (200 M) leads to a decrease in the signal at 320 nm,
indicating that Zn(II) can effectively replace all the Co(II) from metal sites composed of thiolate ligands.
Fe(II) binding to SlyD.
Given the high abundance of the E. coli iron quota, ~ 0.1 mM found in the cytosol (13), and the
propensity of this metal to coordinate to Cys residues, Fe(II) binding to SlyD was also
investigated. Electronic absorption spectroscopic analysis of SlyD protein samples mixed with
increasing amounts of Fe(II) did not reveal any changes in the spectrum (data not shown). As
Fe(II) binding to thiolate ligands is expected to generate LMCT bands in the visible region of an
absorption spectrum (42), the lack of such CT bands were indicative of the fact that SlyD did not
bind Fe(II). To establish that Ni(II) could effectively bind to SlyD even in the presence of
Fe(II), a protein sample pre-incubated with 10 molar excess of Fe(II) was used for a Ni(II)
titration. Ni(II) binding to SlyD was unaffected as the binding curve was comparable to that
obtained from incubation of SlyD with Ni(II) alone (Figure 3-18).
0
0.002
0.004
0.006
0.008
0 2 4 6 8 10 12
Norm
aliz
ed
Δ
Abs
320
(M
-1)
Equivalents of Zn(II)
85
Figure 3-18. Selectivity of SlyD for Ni(II) vs. Fe(II). The change in absorbance at 315 nm upon
titration of apo SlyD (25 M) with Ni(II) (crosses) is shown. A similar titration curve is obtained when
adding Ni(II) to a SlyD sample (25 M) pre-incubated with 250 M Fe(II) (diamonds), indicating that
Ni(II) coordination to the protein is unperturbed in the presence of excess Fe(II).
Mn(II) binding to SlyD.
Considering the large number of carboxylate moieties and His residues present in SlyD, Mn(II) is
another metal ion that could be coordinated by this protein. The addition of Mn(II) to SlyD did
not produce any change in the absorption profile of the protein (data not shown), however
equilibrium dialysis indicated that a very small fraction of the protein was bound to the metal, i.e.
0.2 equivalents of metal bound (Table 3-3). Therefore to determine whether manganese could
affect the Ni(II)-binding activity of SlyD, a Ni(II) titration was carried out using a SlyD sample
that was first incubated with 8 molar excess Mn(II). Overlay of the results from this titration
with a control experiment conducted with nickel alone yielded similar binding curves indicating
that Ni(II) can effectively compete with Mn(II) (data not shown). The selectivity of the protein
for Mn(II) vs. Ni(II) was evaluated by a separate method, in which the protein was allowed to
0
0.05
0.1
0.15
0.2
0.25
0.3
0 2 4 6 8 10
ΔA
bso
rban
ce a
t3
15
nm
Equivalents of Ni(II)
86
equilibrate with a metal solution containing 8 molar excesses of Ni(II) as well as Mn(II).
Analysis of the metal content of this sample revealed SlyD exclusively bound to nickel, further
corroborating the selective binding of nickel over manganese ions (Table 3-3).
In vivo metal selectivity of SlyD.
(A) Susceptibility of E. coli to external metal concentrations.
Given that SlyD can coordinate several different types of metal ions in vitro with considerable
affinity, it is feasible that SlyD plays a role in maintaining optimal metal levels in E. coli by
functioning as a general metal buffer/detoxifier. To test this hypothesis, the growth rates of wild
type and ΔslyD strains were examined by measuring optical density at different metal
concentrations in both LB and minimal media. During these investigations we noted that when
using minimal media, metal concentrations > 0.7 mM could not be investigated due to significant
amounts of precipitation. Furthermore, the maximum external metal concentrations that could be
used without severely inhibiting the growth of either bacterial strain were much lower in minimal
media compared to LB media, signifying that the components in the rich media influence the
available metal concentrations (Table 3-1). Nevertheless, no significant differences in the
growth rates were observed for the ΔslyD strain compared to wild type at any of the metal
concentrations tested in either LB or minimal media under aerobic conditions (Figure 3-19 and
data not shown) suggesting that SlyD is not essential to confer metal resistance against cobalt,
nickel, copper or zinc in E. coli under aerobic growth conditions.
87
Figure 3-19. Sensitivity of E. coli to transition metals. Representative data set for the effect on the
growth rate of a wildtype and a ΔslyD strain upon addition of various metal concentrations detected via
OD600. These experiments were conducted in minimal media supplemented with the following amounts
of metal: (A) 10 M Ni(II), (B) 30M Ni(II), (C) 50 M Cu(II), (D) 250 M Cu(II), (E) 150 M Zn(II),
(F) 500 M Zn(II). The black lines correspond to the wildtype and the coloured lines indicate the growth
detected for the ΔslyD strain. The solid lines and the dashed lines represent growth detected in untreated
and treated cultures, respectively.
0
0.3
0.6
0.9
1.2
0 2 4 6 8 10
OD
600
Time (h)
0
0.3
0.6
0.9
1.2
0 2 4 6 8 10
OD
600
Time (h)
(A) (B)
0
0.4
0.8
1.2
1.6
0 2 4 6 8 10
OD
600
Time (h)
0
0.4
0.8
1.2
1.6
0 2 4 6 8 10
OD
600
Time (h)
(C) (D)
0
0.5
1
1.5
2
2.5
0 2 4 6 8 10
OD
600
Time (h)
0
0.5
1
1.5
2
2.5
0 2 4 6 8 10
OD
600
Time (h)
(E) (F)
88
(B) Transcriptional response of metal transporters.
To further assess the potential role of SlyD in metal homeostasis, we examined the transcription
of several metal transporters in E. coli using quantitative PCR (qRT-PCR). The basis for
monitoring mRNA levels of transporters stems from the fact that the expression of these proteins
are tightly regulated by metal sensing transcription factors that gauge the concentration of a
particular metal with extreme selectivity (43). A comparison of the mRNA levels of the
transporters between wild type strain and ∆slyD strains should enable us to determine the impact
of SlyD on a given metal homeostasis pathway.
Thus far, nickel is the only metal ion connected to the in vivo function of SlyD (21). To test
whether deletion of SlyD could lead to perturbation of the nickel ion balance in E. coli, the
expression levels of the ABC type nickel importer NikABCDE and the nickel exporter RcnA
were evaluated by monitoring the mRNA levels of nikA and rcnA, respectively. While the
expression of rcnA was induced when cells were treated with 10 M Ni(II) as expected, we
observed no difference between transcript levels in ∆slyD compared to wild type cells in
aerobically-grown bacteria (Figure 3-20). We next examined the transcript levels of nikA and
rcnA in anaerobically grown E. coli with or without 10 M Ni(II). Similar to the observations
made under aerobic conditions, while a substantial induction in rcnA expression was observed
upon metal addition, the change in mRNA levels in the wild type and ΔslyD strains were
comparable, indicating that SlyD does not affect the nickel exporting pathway (Figure 3-21). In
contrast, a ~3 fold difference in the nikA mRNA level was detected in the ΔslyD strain when
compared to wild type without nickel supplementations of the media (Figure 3-21). As
anticipated, upon addition of 10 M Ni(II) a ~10 fold and a ~8 fold reduction in the expression
level of nikA was observed for the wild type and ΔslyD strains respectively (Figure 3-21). When
considering the mRNA levels of the nickel-treated cells the wild type contains ~2 fold more nikA
transcript than the deletion strain. Therefore, these diminished nikA transcript levels in the ΔslyD
strain indicate an impact on the nickel uptake pathway upon deletion of this gene. To test
whether SlyD contributes to nickel homeostasis specifically even in the presence of other metals,
nikA and rcnA transcript levels were monitored in anaerobically-grown bacteria treated for 30
min with 10 M Ni(II) as well as 400 M Zn(II), a concentration high enough to elicit a response
in zinc homeostasis (see below). The transcript levels for the two transporters in these growths
followed a similar trend to that observed when bacteria were treated with nickel alone, thereby
89
indicating that SlyD is able to specifically contribute to the maintenance of nickel ions even in
the presence of excess zinc in vivo (Figure 3-22).
Figure 3-20. Expression profiles of zinc, copper and nickel transporters in aerobic growth. Relative
mRNA levels detected upon addition of 10 M Zn(Ni) (Panel A), 400 M Zn (II) (Panel B-C) and 150 M
Cu(II) (Panel D-E). The bars denoted –Zn(II)/Cu(II) and Ni(II) correspond to bacteria cultured in minimal
media without added metal. The mRNA detected for each transcript in the wildtype and ΔslyD strain under
identical growth conditions are shown in solid and clear bars, respectively. The reported relative mRNA levels
were normalized with respect to holB which encodes a DNA gyrase. A p-value > 0.05 was calculated for the
transcript levels of the wildtype and ΔslyD strain under each growth condition, indicating no significant
difference between the two strains.
Figure 3-21. Expression of Ni(II) transporters in response to Ni(II). Change in mRNA levels from
anaerobically-cultured bacteria upon treatment with 10 M Ni(II). The bars denoted -Ni(II) indicated the
transcripts detected for bacteria grown without extra Ni(II) added to the media. The amount of mRNA
observed in wildtype and ΔslyD strains are shown in black and clear bars respectively. The observed
transcripts levels are relative to that of the DNA gyrase, holB. The p-value of < 0.05 indicates the values are
significantly different and p-values > 0.05 are considered not to be significantly different.
0
0.5
1
1.5
2
2.5
3
-Zn(II) +Zn(II)
0
4
8
12
16
20
-Cu(II) +Cu(II)
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
-Zn(II) +Zn(II)
0
0.5
1
1.5
2
2.5
-Ni(II) +Ni(II)
rcnA znuA zntA copA
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
-Cu(II) +Cu(II)
cusF
Re
lati
ve
mR
NA
le
ve
ls
(A) (B) (C) (D) (E)
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
-Ni(II) +Ni(II)
p < 0.05
p < 0.05
0
5
10
15
20
25
30
35
-Ni(II) +Ni(II)
Rela
tive
mR
NA
leve
ls
nikA rcnA
p > 0.05
p > 0.05
90
Figure 3-22. Expression the Ni(II) transporters in the presence of excess Zn(II). Relative change in
mRNA levels of nikA and rcnA detected upon addition of 10 M Ni(II) and 400 M Zn(II). Bacteria
were grown in media optimized for hydrogenase expression under anaerobic conditions. The bars
denoted –Ni(II) correspond to bacteria cultured in media without added metal. The mRNA detected for
each transcript in the wildtype and ΔslyD strain under identical growth conditions are shown in solid and
clear bars respectively. The reported relative mRNA levels were normalized with respect to holB which
encodes a DNA gyrase. The p-values < 0.05 indicate the data sets are significantly different whereas p-
values > 0.05 are considered to be not significantly different.
To determine whether SlyD can influence zinc homeostasis transcription of two zinc-responsive
genes were monitored upon addition of 400 M ZnSO4. The two transcripts monitored
correspond to znuA, which encodes a subunit of the major inducible high-affinity Zn(II) uptake
ABC transporter system, and zntA, which encodes a Zn(II) exporter from the P1-type ATPase
family (44). The concentration of zinc was chosen based on the toxicity experiments, which
revealed that addition of 400 M zinc results in slower growth (as opposed a lethal concentration
leading to no growth). Furthermore, several previous investigations assessing the genome-wide
transcriptional response of E. coli to zinc have demonstrated that [Zn(II)] >100 M is sufficient
to observe a change in the transcript levels of the above-mentioned transporters, albeit under
different media compositions (45, 46). While the addition of zinc led to an increase in zntA
transcription and a decrease in znuA transcription as expected we observed no significant
difference between wild type and ∆slyD strains for these transcripts (Figure 3-20). Similarly, no
difference was detected between wild type and ΔslyD in the absence of oxygen (Figure 3-23).
0
1.5
3
4.5
6
7.5
9
-Ni(II) +Ni(II)
0
0.2
0.4
0.6
0.8
1
1.2
1.4
-Ni(II) +Ni(II)
Re
lative
mR
NA
le
ve
ls
nikA rcnA
p > 0.05
p < 0.05
p > 0.05
p < 0.05
91
Figure 3-23. Expression profiles of zinc and copper transporter in anaerobic growth. Relative
mRNA levels detected upon addition of 400 M Zn(II) (Panels A-B) and 150 M Cu(II) (Panel C-D).
The bars denoted –Zn(II)/Cu(II) correspond to bacteria cultured in minimal media without added metal.
The mRNA detected for each transcript in the wildtype and ΔslyD strain under identical growth
conditions are shown in solid and clear bars respectively. The reported relative mRNA levels were
normalized with respect to holB which encodes a DNA gyrase. A p-value > 0.05 was calculated for
wildtype and ΔslyD strain under each growth conditions indicating no significant difference between the
two strains.
We next tested the involvement of SlyD in copper homeostasis, by examining copA and cusF
transcripts under high Cu(II) levels by addition of 150 M Cu(II) to the media in the presence of
molecular oxygen. Similar to zinc, this particular copper concentration was also selected based
on our toxicity studies that indicated 150 M is sufficient to reduce the growth rate of the
bacteria. In addition, previous investigations on copper toxicity in E. coli by Outten et al.
revealed that CuSO4 above 100 M is sufficient to cause extreme stress levels (47). At these
high copper concentrations the primary copper exporter CopA as well as the CusCFBA system
that exports copper across both membranes to the extracellular space are necessary to render
copper tolerance to the bacteria (47). While the expression of both exporters increase in the
presence of copper, copA transcripts are induced to a higher level compared to cusF in the
presence of oxygen (Figure 3-20). In contrast, in anaerobically grown bacteria a more dramatic
increase in mRNA levels was detected for cusF relative to copA (Figure 3-23), confirming the
differential expression of the two exporters in response to molecular oxygen observed previously
(47). Although the expected responses were detected upon treatment with copper, the fold
0.0
0.3
0.6
0.9
1.2
1.5
-Zn(II) +Zn(II)
0
20
40
60
80
-Cu(II) +Cu(II)
0.0
1.5
3.0
4.5
6.0
7.5
9.0
-Zn(II) +Zn(II)
znuA zntA copA cusFR
ela
tive
mR
NA
le
ve
ls
0
0.3
0.6
0.9
1.2
1.5
1.8
-Cu(II) +Cu(II)
(A) (B) (C) (D)
92
increase in mRNA levels were similar in both the wildtype and ΔslyD strains indicating that
deletion of SlyD did not lead to perturbation of the copper homeostasis in E. coli (Figure 3-20
and 3-23).
Discussion
An understanding of how proteins detect and coordinate the correct metal ion is an important
issue when considering proteins involved in metal homeostasis. In this investigation, metal-
binding activity and metal-selectivity of SlyD, a protein involved in maintaining the balance of
nickel ions in E. coli, was examined (48). Among the metals tested, SlyD was capable of
binding Zn(II), Cu(I), and Co(II) in vitro whereas binding of Mn(II) or Fe(II) to the protein was
not detected. Given the diverse array of potential metal-binding residues present in the MBD of
SlyD, it is not surprising that the protein can coordinate many of the first row transition metals in
addition to Ni(II), which was described previously (10). In addition to the non-discriminating
primary structure, the lack of specificity is likely also due to the highly malleable conformation
of the MBD of the protein, supported by the fact that the structure of this region cannot be
resolved from NMR measurements even upon addition of 1 equivalent of Ni(II) (5).
Zn(II) ions bind to SlyD in a progressive and overlapping fashion similar to that observed for
Ni(II), indicating that zinc binding is similarly non-cooperative. Competition titrations indicate
that SlyD has five zinc-binding sites and can chelate this metal with an apparent KD of 10-10
M.
The CD spectroscopy, together with charge state distribution detected by mass spectrometry is
indicative of small but distinctive changes in the protein structure. Although Ni(II) also leads to
structural changes in SlyD, the overall shape of the CD spectrum for Zn(II)-bound SlyD is
different. In addition to a lower metal-binding capacity when compared to Ni(II), the amount of
secondary structure formed appears to be less when binding zinc ions. Therefore it is possible
that the two metal ions are sequestered utilizing distinct metal sites in SlyD that result in
different protein folds. This interpretation is supported by the competition titrations in which the
addition of Ni(II) together with Zn(II) only resulted in a decrease in the intensity of nickel
LMCT band, as opposed to complete elimination of the band, at least at the metal concentrations
tested. The ability of zinc to partially replace nickel and vice versa is additional evidence for
some “Ni-specific” as well as “Zn-specific” sites. Interestingly, when considering nickel and
zinc ions, the order in which the metal is added to the protein appears to govern the final
93
metallation state of the protein. Therefore, it appears that binding of the first metal may lock the
protein in to a specific conformation such that only a few sites are then accessible for metal
exchange reactions, further strengthening the distinct folds adapted by SlyD for Ni(II) vs Zn(II).
Changes in protein structure, also termed allostery, is one of the mechanisms widely used by
proteins to overcome the thermodynamically dictated metal specificity (2, 43). In this event, the
binding of the “correct metal” is exploited to drive the changes in the
secondary/tertiary/quaternary structure of the protein and or dynamics (i.e. protein-protein
interactions) that ultimately results in a biological function. In the case of SlyD, the difference
in the fold of the protein upon Ni(II) vs. Zn(II) binding may allow the protein to discriminate
between the two metal ions and produce the desired biological function of SlyD in vivo only
when the correct metal is bound.
Table 3-4. KD of SlyD-Metal complexes.§
Metal KMe (M)
Co(II) 4 ± 1 x 10-9 a
Ni(II) 10-10 b
Cu(I) 1.5 ± 0.3 x 10-17 c
Zn(II) 1.0 ± 0.1 x 10-10 d
§Data were treated assuming binding of a single metal ion to obtain a macroscopic KD.
aDetermined via competition
with Fura-2. bEstimated from competition with PAR, Fura-2 and Zn-SlyD.
cDetermined by competition with Bcs.
dCalculated from competition experiments with PAR.
In addition to zinc, SlyD can bind up to 4 Cu(I) ions with an apparent affinity of ~10-17
M, the
tightest detected for all the metals tested. Unlike Ni(II) and Zn(II), which are able to bind to the
protein concurrently, Cu(I) can reach its full capacity of 4 metal ions per SlyD monomer even
when the protein is pre-loaded with Ni(II) or Zn(II). These results are not surprising considering
that the average KD measured for Cu(I) is seven orders of magnitude tighter than that observed
for zinc and nickel ions. Thus, the specificity of SlyD towards Cu(I) appears to be dictated by the
relative thermodynamic parameters (i.e. KMe) measured. In addition to the extremely high
affinity, copper is further distinguished by the fact that binding of this metal to SlyD appears to
be partially cooperative, which may be another factor that enables the protein to bind Cu(I)
selectively over nickel or zinc. SlyD can also bind to cobalt ions with an average stoichiometry
of ~4 and from competition experiments an apparent KD of ~ 10-9
M was detected. However,
when considering the selectivity of the protein with respect to Co(II) the trend is opposite to that
94
observed for Cu(I). For instance, addition of Zn(II) to a cobalt-saturated sample yields SlyD that
is solely chelated by Zn(II) and similarly when protein is presented with equimolar solutions of
nickel and cobalt only Ni(II)-bound SlyD can be isolated. Therefore, in agreement with the
measured KMe, the selectivity data clarify that in the presence of either nickel or zinc the much
weaker Co(II)-SlyD complexes are not formed. Based on these in vitro metal-binding studies
conducted on SlyD, the preference for metal ions can be ordered as follows, Mn(II), Fe(II) <
Co(II) < Ni(II), Zn(II) << Cu(I). This series resembles the natural order of stabilities for
biologically essential divalent metals, commonly termed the Irving-Williams series (49) which
predicts that copper, zinc and nickel will form the tightest complexes, followed by cobalt, ferrous
iron and manganese and finally calcium and magnesium forming the weakest complexes. From
these results it is evident that the strength of the metal binding is dictated by the properties of the
metals rather than the protein and that SlyD is sufficiently flexible to be able to accommodate the
coordination preference of each of these metal ions.
It is well known that due to their flexible nature, many proteins can accommodate a variety of
different metals in their metal-binding site(s). Several examples for this trend can be found by
just considering some Ni(II) homeostatic proteins. For example UreE, a chaperone dedicated to
shuttling Ni(II) for urease biosynthesis can bind Co(II), Cu(II) as well as Zn(II). Not only do
these metals bind to the protein they can effectively compete with binding of Ni(II) ions (50).
Through extensive spectroscopic investigations it was shown that although UreE can bind
several transition metals, the geometry and the coordination sphere utilized by the protein to
coordinate each metal is distinct (50). Therefore, only Ni(II) binding is expected to elicit the
correct fold of UreE, which subsequently enables the protein to interact with the partner proteins
involved in urease biosynthesis. NikR from E. coli can chelate several other divalent metal ions
in vitro (i.e.. Co(II), Cu(II), Zn(II), Cd(II)) in addition to Ni(II). Similarly to SlyD, the affinity of
NikR for the first row metals tested also followed the Irving-Williams series (37). Spectroscopic
studies revealed that like UreE, NikR utilizes a unique geometry and coordination sphere for
each metal (51), chemical and thermal denaturation data along with in vitro DNA-binding assays
provided evidence for a Ni(II)-selective enhancement in the stability and activity of the protein
(37, 52). Therefore, binding of Ni(II) alone is considered to provide a favourable protein
conformation that allows NikR to achieve its biological function, as has been verified in vivo
(37, 51). Additional examples are found when considering the proteins involved in maintaining
95
nickel homeostasis in Helicobacter pylori, such as the putative Ni(II) storage protein, Hpn. For
this small histidine-rich protein, even though an in vitro preference of Cu(II) > Ni(II) > Zn(II)
was observed a preferential effect of nickel was detected during in vivo metal toxicity studies
(53).
Although conclusive in vitro evidence for a Ni(II)-specific conformation of the protein such as
that described for NikR and UreE is currently lacking for SlyD, the specificity of the protein can
be inferred from in vivo studies. The Ni(II) homeostasis pathway in E. coli is complex, and
there is evidence that there are two distinct pools of nickel that are maintained by two different
transcription factors, RcnR and NikR (54). One of the nickel pools is connected to the exporter,
RcnA, which is de-repressed by the transcription factor RcnR in response to elevated Ni(II) and
this response is observed both aerobically and anaerobically (54). While a specific Ni(II) uptake
system is not known to be expressed under aerobic conditions, nickel can still gain access to the
cytoplasm through non-specific metal importers such CorA that are unaffected by the presence of
oxygen (55). However, a specific nickel uptake system, the Nik transporter, is expressed under
anoxic conditions when the demand for nickel is higher due to the expression of the [NiFe]
hydrogenase enzymes (56). As a result a second nickel pool is established to provide nickel for
enzyme maturation and is connected to the activity NikR (55, 56). The role of SlyD in nickel
homeostasis was analyzed via monitoring the transcript levels of the nickel importer nikA and the
exporter rcnA. The results obtained for these two importers provide several insights into nickel
homeostasis in E. coli. Firstly, deletion of slyD reduced the nickel capacity of the cytoplasm
such that nikA transcription was down regulated in the absence of the protein. Secondly, deletion
of slyD did not impact the exporter expression, indicating that the protein does contribute to the
nickel exporting pathway. Furthermore the in vivo data suggest that SlyD contributes only to the
nickel pool maintained by the Nik importer. The nickel brought into the cytoplasm through the
Nik importer is considered to be preferentially routed to [NiFe]-hydrogenase maturation through
the action of metallochaperones. Therefore, these findings corroborate the nickel-related
function of SlyD in enzyme maturation, and strengthen the assignment of this protein as a nickel
metallochaperone.
Results from the toxicity studies clearly indicate that although the protein is capable of
coordinating several types of transition metals, SlyD does not function as a general metal
detoxifier like some other nickel storage factors such as hpn or hpn-like proteins (53, 57). In
96
addition, deletion of SlyD did not lead to a significant change in the transcription profiles of the
copper or zinc transporter suggesting that although the protein could not preferentially coordinate
nickel in vitro, its activity is specific for Ni(II) in vivo. Therefore SlyD is yet another protein
that can be included in the growing repertoire of proteins for which thermodynamically dictated
affinities in vitro cannot be extrapolated to in vivo function.
The mis-matched metal selectivity of SlyD in vitro versus in vivo raises the question as to how
SlyD is able to overcome the thermodynamically-dictated metal specificity within the cell under
normal growth conditions. It is now clear that the effective intracellular concentrations of metal
ions are tightly controlled within a cell. In E. coli, copper homeostasis is regulated by the copper
sensor CueR that has an affinity for copper in the zeptomolar range (10-21
M) (58). This
estimated affinity of the regulator implies that all cellular copper is tightly bound and buffered
within the cytosol. A similar scenario is observed for zinc as well, where the Zn(II) sensors Zur
and ZntR in E.coli, bind this metal with Kd of 10-15
M (23). This tight regulation of the
cytoplasmic metal concentrations suggests virtually no free metal ions of Cu(I) or Zn(II), thus
SlyD may not be able to gain access to these metal ions unless the protein can interact with a
metal importer directly. As Cu(I) and Zn(II) are the only metals that can disrupt the Ni(II)
binding capacity of SlyD the limited availability of these metals will likely leave the protein free
to bind Ni(II) and function in nickel homeostasis in E. coli. This concept is supported by the fact
that when excess Zn(II) was added along with Ni(II), the nikA mRNA levels were similar to that
observed for Ni(II) alone. Thus, the data imply even under toxic metal conditions when zinc
homeostasis is disrupted, SlyD is capable of retaining its Ni(II)-specific function in vivo. The
fact that the deletion of slyD did not change the transcript levels of the copper and zinc
transporters under toxic metal levels is additional evidence that supports the Ni(II)-specific role
of SlyD in E. coli.
Similar to copper and zinc, nickel concentrations are thought to be tightly buffered to less than
one free nickel ion within the E. coli by the previously mentioned RcnR and NikR (54). Then
how is SlyD able to bind nickel in vivo and contribute to the nickel homeostasis? NikR has two
nickel-binding sites, with affinities of 10-12
and 10-7
M (55). Nickel binding to both sites allows
the regulator to bind to DNA with a tighter affinity than when only a single site is occupied by
nickel, indicating two levels of gene regulation at different metal concentrations. If one were to
follow the above argument presented for Cu(I) and Zn(II) ion regulation, then SlyD that chelates
97
nickel with ~10-10
M affinity would not be able to compete with NikR for the high affinity metal
sites. However, it is possible that the protein is able to sequester enough metal for storage and/or
transfer before the low affinity site of NikR is filled and transcription of the nickel importer is
completely turned off. On the other hand, there may be no such competition for nickel if SlyD
can directly interact with the Nik transporter. Nickel transported via the Nik system is directed
to the biosynthesis of the [NiFe]-hydrogenase as deletion of the importer abrogates the enzyme
activity (56). In addition it has been shown that there is no competition between NikR and nickel
transported for metallocentre assembly suggesting that metallochaperones sequester nickel for
hydrogenase maturation at the transporter (54, 56). Given that SlyD is known to form a protein-
protein complex with the nickel chaperone HypB (21, 59), SlyD may also gain access to nickel
via ligand exchange reactions at the transporter. An interaction of SlyD or the SlyD-HypB
complex with the Nik transporter would circumvent the thermodynamically dictated metal
affinities of the proteins, and ensure the population of the metallochaperones with nickel alone
through kinetic means by relying on protein-protein interactions. Further experiments involving
cross-linking and co-localization are necessary to determine whether such complexes are indeed
formed in vivo.
In addition to thermodynamic gradients several strategies are utilized by cells to overcome the
challenges in populating each metallo-protein with the correct metal. For instance, specificity is
achieved through first and second coordination spheres of the protein, metal-induced allostery as
well as limiting the amounts of free metal available for those that are high in the stability series
(i.e. copper and zinc). Utilizing metallochaperones for metal delivery and compartmentalization
are yet more ways to overcome thermodynamically dictated preference for metals by proteins.
This study exemplifies the need for these additional mechanisms and highlights the crucial role
of cellular strategies in maintaining the relative abundance of a particular metal that enable a
protein to selectively bind its cognate metal within the cell.
98
References:
1. Robinson, N. J. (2007) A more discerning zinc exporter, Nat. Chem. Biol. 3, 692-693.
2. Waldron, K. J., and Robinson, N. J. (2009) How do bacterial cells ensure that metalloproteins get
the correct metal?, Nat. Rev. Microbiol. 7, 25-35.
3. Leach, M. R., and Zamble, D. B. (2007) Metallocenter assembly of the hydrogenase enzymes,
Curr. Opin. Chem. Biol. 11, 159-165.
4. Zhang, J. W., Leach, M. R., and Zamble, D. B. (2007) The peptidyl-prolyl isomerase activity of
SlyD is not required for maturation of Escherichia coli hydrogenase, J. Bacteriol. 189, 7942-
7944.
5. Martino, L., He, Y., Hands-Taylor, K. L., Valentine, E. R., Kelly, G., Giancola, C., and Conte, M.
R. (2009) The interaction of the Escherichia coli protein SlyD with nickel ions illuminates the
mechanism of regulation of its peptidyl-prolyl isomerase activity, FEBS J. 276, 4529-4544.
6. Weininger, U., Haupt, C., Schweimer, K., Graubner, W., Kovermann, M., Bruser, T., Scholz, C.,
Schaarschmidt, P., Zoldak, G., Schmid, F. X., and Balbach, J. (2009) NMR solution structure of
SlyD from Escherichia coli: spatial separation of prolyl isomerase and chaperone function, J.
Mol. Biol. 387, 295-305.
7. Knappe, T. A., Eckert, B., Schaarschmidt, P., Scholz, C., and Schmid, F. X. (2007) Insertion of a
chaperone domain converts FKBP12 into a powerful catalyst of protein folding, J. Mol. Biol. 368,
1458-1468.
8. Scholz, C., Eckert, B., Hagn, F., Schaarschmidt, P., Balbach, J., and Schmid, F. X. (2006) SlyD
proteins from different species exhibit high prolyl isomerase and chaperone activities,
Biochemistry 45, 20-33.
9. Erdmann, F., and Fischer, G. (2007) The nickel-regulated peptidyl prolyl cis/trans isomerase
SlyD, in Metal Ions in Life Sciences (Sigel, A., Sigel, H., and Sigel, R. K. O., Eds.), pp 501-518,
John Wiley and Sons.
10. Kaluarachchi, H., Sutherland, D. E., Young, A., Pickering, I. J., Stillman, M. J., and Zamble, D.
B. (2009) The Ni(II)-Binding Properties of the Metallochaperone SlyD, J. Am. Chem. Soc. 131,
18489-18500.
11. Li, Y., and Zamble, D. B. (2009) Nickel homeostasis and nickel regulation: an overview, Chem.
Rev. 109, 4617-4643.
12. Wulfing, C., Lombardero, J., and Pluckthun, A. (1994) An Escherichia coli protein consisting of
a domain homologous to FK506-binding proteins (FKBP) and a new metal binding motif, J. Biol.
Chem. 269, 2895-2901.
13. Finney, L. A., and O'Halloran, T. V. (2003) Transition metal speciation in the cell: Insights from
the chemistry of metal ion receptors, Science 300, 931-936.
14. Salgado, M. T., Bacher, K. L., and Stillman, M. J. (2007) J. Biol. Inorg. Chem. 12, 294.
15. Zimmermann, M., Clarke, O., Gulbis, J. M., Keizer, D. W., Jarvis, R. S., Cobbett, C. S., Hinds,
M. G., Xiao, Z. G., and Wedd, A. G. (2009) Metal Binding Affinities of Arabidopsis Zinc and
Copper Transporters: Selectivities Match the Relative, but Not the Absolute, Affinities of their
Amino-Terminal Domains, Biochemistry 48, 11640-11654.
16. Atanassova, A., Lam, R., and Zamble, D. B. (2004) Anal. Biochem. 335, 103.
17. Martell, A. E., and Smith, R. M. (2003) NIST Standard Reference Database 46, version 8.0
National Institute of Standards and Technology, Rockville, M.D.
99
18. Fahrni, C. J., and O'Halloran, T. V. (1999) Aqueous coordination chemistry of quinoline-based
fluorescence probes for the biological chemistry of zinc, J. Am. Chem. Soc. 121, 11448-11458.
19. Golynskiy, M. V., Gunderson, W. A., Hendrich, M. P., and Cohen, S. M. (2006) Metal binding
studies and EPR spectroscopy of the manganese transport regulator MntR, Biochemistry 45,
15359-15372.
20. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita,
M., Wanner, B. L., and Mori, H. (2006) Construction of Escherichia coli K-12 in-frame, single-
gene knockout mutants: the Keio collection, Mol. Syst. Biol. 2, 2006 0008.
21. Zhang, J. W., Butland, G., Greenblatt, J. F., Emili, A., and Zamble, D. B. (2005) A role for SlyD
in the Escherichia coli hydrogenase biosynthetic pathway, J. Biol. Chem. 280, 4360-4366.
22. Graham, A. I., Hunt, S., Stokes, S. L., Bramall, N., Bunch, J., Cox, A. G., McLeod, C. W., and
Poole, R. K. (2009) Severe Zinc Depletion of Escherichia coli: ROLES FOR HIGH AFFINITY
ZINC BINDING BY ZinT, ZINC TRANSPORT AND ZINC-INDEPENDENT PROTEINS, J.
Biol. Chem. 284, 18377-18389.
23. Outten, C. E., and O'Halloran, T. V. (2001) Femtomolar sensitivity of metalloregulatory proteins
controlling zinc homeostasis, Science 292, 2488-2492.
24. Ngu, T. T., and Stillman, M. J. (2009) Metal-binding mechanisms in metallothioneins, Dalton
Trans. 5425-5433.
25. Kaltashov, I. A., and Abzalimov, R. R. (2008) J. Am. Soc. Mass Spectrom. 19, 1239.
26. Tanaka, M., Funahash.S, and Shirai, K. (1968) Kinetics of Ligand Substitution Reaction of
Zinc(2)-4-(2-Pyridylazo)Resorcinol Complex with (Ethylene Glycol)Bis(2-Aminoethyl Ether)-
N,N,N',N'-Tetraacetic Acid, Inorg. Chem. 7, 573-&.
27. McNulty, T. J., and Taylor, C. W. (1999) Extracellular heavy-metal ions stimulate Ca2+
mobilization in hepatocytes, Biochem. J. 339, 555-561.
28. Hottenrott, S., Schumann, T., Pluckthun, A., Fischer, G., and Rahfeld, J. U. (1997) J. Biol. Chem.
272, 15697.
29. Perczel, A., Hollosi, M., and Fasman, G. D. (1996) Circular Dichroism and the Conformational
Analysis of Biomolecules (Fasman, G. D. Ed.), pp 285-380, Plenum Press, New York.
30. Woody, R. W., Dunker, A. K., and Fasman, G. D. (1996) Circular Dichroism and the
Conformational Analysis of Biomolecules (Fasman, G. D. Ed.), pp 285-380, Plenum Press, New
York.
31. Beltramini, M., Bubacco, L., Salvato, B., Casella, L., Gullotti, M., and Garofani, S. (1992) The
aromatic circular dichroism spectrum as a probe for conformational changes in the active site
environment of hemocyanins, Biochim. Biophys. Acta. 1120, 24-32.
32. Rensing, C., and Grass, G. (2003) Escherichia coli mechanisms of copper homeostasis in a
changing environment, FEMS Microbiol. Rev. 27, 197-213.
33. Cobine, P. A., George, G. N., Jones, C. E., Wickramasinghe, W. A., Solioz, M., and Dameron, C.
T. (2002) Copper transfer from the Cu(I) chaperone, CopZ, to the repressor, Zn(II)CopY: Metal
coordination environments and protein interactions, Biochemistry 41, 5822-5829.
34. Badarau, A., Firbank, S. J., McCarthy, A. A., Banfield, M. J., and Dennison, C. Visualizing the
Metal-Binding Versatility of Copper Trafficking Sites, Biochemistry 49, 7798-7810.
35. Xiao, Z., Brose, J., Schimo, S., Ackland, S. M., La Fontaine, S., and Wedd, A. G. Unification of
the Copper(I) Binding Affinities of the Metallo-chaperones Atx1, Atox1, and Related Proteins:
DETECTION PROBES AND AFFINITY STANDARDS, J. Biol. Chem. 286, 11047-11055.
100
36. Iwig, J. S., Leitch, S., Herbst, R. W., Maroney, M. J., and Chivers, P. T. (2008) Ni(II) and Co(II)
sensing by Escherichia coli RcnR, J. Am. Chem. Soc. 130, 7592-7606.
37. Wang, S. C., Dias, A. V., Bloom, S. L., and Zamble, D. B. (2004) Selectivity of metal binding
and metal-induced stability of Escherichia coli NikR, Biochemistry 43, 10018-10028.
38. Maret, W., and Vallee, B. L. (1993) Cobalt as Probe and Label of Proteins, Metallobiochem. 226,
52-71.
39. Adrait, A., Jacquamet, L., Le Pape, L., de Peredo, A. G., Aberdam, D., Hazemann, J. L., Latour,
J. M., and Michaud-Soret, I. (1999) Spectroscopic and saturation magnetization properties of the
manganese- and cobalt-substituted Fur (ferric uptake regulation) protein from Escherichia coli,
Biochemistry 38, 6248-6260.
40. Kwan, C. Y., and Putney, J. W. (1990) Uptake and Intracellular Sequestration of Divalent-
Cations in Resting and Methacholine-Stimulated Mouse Lacrimal Acinar-Cells - Dissociation by
Sr-2+ and Ba-2+ of Agonist-Stimulated Divalent-Cation Entry from the Refilling of the Agonist-
Sensitive Intracellular Pool, J. Biol. Chem. 265, 678-684.
41. Grynkiewicz, G., Poenie, M., and Tsien, R. Y. (1985) A new generation of Ca2+ indicators with
greatly improved fluorescence properties, J. Biol. Chem. 260, 3440-3450.
42. Morleo, A., Bonomi, F., Iametti, S., Huang, V. W., and Kurtz, D. M., Jr. Iron-nucleated folding of
a metalloprotein in high urea: resolution of metal binding and protein folding events,
Biochemistry 49, 6627-6634.
43. Giedroc, D. P., and Arunkumar, A. I. (2007) Metal sensor proteins: nature's metalloregulated
allosteric switches, Dalton Trans. 3107-3120.
44. Waldron, K. J., Rutherford, J. C., Ford, D., and Robinson, N. J. (2009) Metalloproteins and metal
sensing, Nature 460, 823-830.
45. Lee, L. J., Barrett, J. A., and Poole, R. K. (2005) Genome-wide transcriptional response of
chemostat-cultured Escherichia coli to zinc, J. Bacteriol. 187, 1124-1134.
46. Yamamoto, K., and Ishihama, A. (2005) Transcriptional response of Escherichia coli to external
zinc, J. Bacteriol. 187, 6333-6340.
47. Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) The independent cue
and cus systems confer copper tolerance during aerobic and anaerobic growth in Escherichia coli,
J. Biol. Chem. 276, 30670-30677.
48. Kaluarachchi, H., Chung, K. C. C., and Zamble, D. B. (2010) Microbial nickel proteins, Nat.
Prod. Rep. 27, 681-694.
49. Irving, H., and Williams, R. J. P. (1948) Order of Stability of Metal Complexes, Nature 162, 746-
747.
50. Colpas, G. J., Brayman, T. G., McCracken, J., Pressler, M. A., Babcock, G. T., Ming, L. J.,
Colangelo, C. M., Scott, R. A., and Hausinger, R. P. (1998) Spectroscopic characterization of
metal binding by Klebsiella aerogenes UreE urease accessory protein, J. Biol. Inorg. Chem. 3,
150-160.
51. Leitch, S., Bradley, M. J., Rowe, J. L., Chivers, P. T., and Maroney, M. J. (2007) Nickel-specific
response in the transcriptional regulator, Escherichia coli NikR, J. Am. Chem. Soc. 129, 5085-
5095.
52. Bloom, S. L., and Zamble, D. B. (2004) Metal-selective DNA-binding response of Escherichia
coli NikR, Biochemistry 43, 10029-10038.
101
53. Ge, R., Zhang, Y., Sun, X., Watt, R. M., He, Q. Y., Huang, J. D., Wilcox, D. E., and Sun, H.
(2006) Thermodynamic and kinetic aspects of metal binding to the histidine-rich protein, Hpn, J.
Am. Chem. Soc. 128, 11330-11331.
54. Iwig, J. S., Rowe, J. L., and Chivers, P. T. (2006) Nickel homeostasis in Escherichia coli - the
rcnR-rcnA efflux pathway and its linkage to NikR function, Mol. Microbiol. 62, 252-262.
55. Li, Y., and Zamble, D. B. (2009) Nickel homeostasis and nickel regulation: an overview, Chem.
Rev. 109, 4617-4643.
56. Rowe, J. L., Starnes, G. L., and Chivers, P. T. (2005) Complex transcriptional control links
NikABCDE-dependent nickel transport with hydrogenase expression in Escherichia coli, J.
Bacteriol. 187, 6317-6323.
57. Zeng, Y. B., Yang, N., and Sun, H. Metal-binding properties of an hpn-like histidine-rich protein,
Chemistry 17, 5852-5860.
58. Changela, A., Chen, K., Xue, Y., Holschen, J., Outten, C. E., O'Halloran, T. V., and Mondragon,
A. (2003) Molecular basis of metal-ion selectivity and zeptomolar sensitivity by CueR, Science
301, 1383-1387.
59. Leach, M. R., Zhang, J. W., and Zamble, D. B. (2007) The role of complex formation between
the Escherichia coli hydrogenase accessory factors HypB and SlyD, J. Biol. Chem. 282, 16177-
16186.
102
Chapter 4 Significance of the HypB-SlyD complex in [NiFe]-hydrogenase
biosynthesis3
4.1 Introduction
Accounting for nearly one-third of all proteins in nature, metalloproteins catalyze some of the
most complex and important processes that are essential for all cellular life (1). Incorporation of
the inorganic cofactor into these metalloproteins is a challenging process due to the prevalence of
buried metallocenters and the complexity of many of these metal-containing active sites. This
process is further complicated by the fact that assembly of these proteins needs to be achieved in
the context of exceedingly low concentrations of free metal ions within a cell. Several
mechanisms have been adapted by nature to meet these demands, one of which is utilization of
proteins dedicated to handling a specific metal ion during the biosynthesis process (2). These
proteins, termed metallochaperones, not only ensure the delivery of the correct metal ion to a
specific target even in an environment of low metal availability but also protect other biological
components of the cell from the detrimental effects of metal ions (3). Furthermore, these helper
proteins are one of the key factors that enable a cell to overcome the inherent thermodynamic
metal affinities of individual factors, via transfer of a specific metal through transient protein-
protein interactions (1).
The hydrogenase enzymes found in many bacteria and archaea catalyze the oxidation of
hydrogen gas and/or the reverse reaction (4). Central to microbial energy metabolism as well as
fuel cell applications, this chemically challenging reaction occurs at an intricate organometallic
metal centre consisting of unique diatomic ligands such as carbon monoxide and cyanide (5). In
the case of the [NiFe]-hydrogenases, the gas processing occurs at the dinuclear metal site that is
buried within the large subunit of a heterodimeric protein. Much of the current knowledge about
the assembly of this sophisticated metal cluster is based on investigations conducted on the
Escherichia coli hydrogenase 3 iso-enzyme and presumably occurs in two steps. The initial iron
incorporation is performed by HypCDEF proteins that are responsible for synthesis of the
diatomic ligands and delivery of the decorated iron centre to the large subunit (4). The
3The in vivo experiments presented in this chapter were designed and performed by J. W. Zhang.
103
subsequent nickel insertion step is carried out by the three metallochaperone proteins HypA,
HypB and SlyD (4, 6).
Figure 4-1. Architecture of E. coli SlyD and HypB. (A) SlyD consists of an N-terminal FKBP-type
PPIase domain, an IF (insertion in the flap) chaperone domain and a C-terminal metal-binding domain
that is rich in potential metal-binding residues (7) A loop in the chaperone domain (residue 107-111) is
essential for the SlyD-HypB complex formation (8). (B) The first seven residues of HypB (CXXCGC)
encompass the high-affinity Ni(II) binding-motif (KDNi(II)
1.2 x 10-13
M) while the residues C166, H167
and C198 located in the GTPase domain contribute to the low-affinity metal-binding site that can bind
either Ni(II) or Zn(II) with micromolar affinity (9, 10). HypB interacts with SlyD via the the linker
region (8).
HypA consists of a N-terminal metal-binding site that can coordinate Ni(II) with micromolar
affinity (6). The protein also contains a structural zinc site at the C-terminus typical of protein
domains mediating protein-protein interactions (6). As such, HypA is anticipated to serve as a
scaffold for the nickel insertion complex during enzyme maturation (11). HypB has an essential
GTPase activity that is required for hydrogenase maturation and nickel insertion in vivo (12-14).
E. coli HypB has two metal-binding sites, one at the N-terminus of the protein that binds nickel
with picomolar affinity and a second metal-binding site in the GTPase domain (G-domain) that
can bind nickel or zinc with low-micromolar affinity (10) (Figure 4-1). Mutation of the residues
contributing to either of the metal sites results in a hydrogenase-deficient phenotype, indicating
the importance of both metal sites in HypB for hydrogenase biogenesis (9). In addition to these
two metal-binding sites, some HypB homologues such as that from B. japonicum contain poly-
histidine stretches that are capable of binding nickel with high capacity but low affinity (15).
This polyhistidine stretch is absent in E. coli HypB and consequently the nickel storage role is
thought to be carried out by SlyD. SlyD is a multi-domain protein harbouring both protein
folding (16, 17) and metal-binding activities (18, 19) (Figure 4-1). In support of the suggested
1 196
Peptidyl-Prolyl Isomerase
Domain
Metal-Binding
Domain146
IF- Chaperone Domain
76 120
(A)
C2XXC5GC7
GTPase Domain
2 8 77 290
Linker
Region
High-Affinity
Ni(II) site
C166H167C198
Low-Affinity
Metal-Binding
site
(B)V107EITA111
104
nickel storage function, in vitro characterization of SlyD revealed that the protein has
considerable capacity for nickel (7 potential nickel-binding sites) and binds the metal with an
affinity in the nanomolar range (19). The unique C-terminal metal-binding domain (MBD) of
SlyD features a large concentration of potential metal-binding residues and is essential for this
nickel chelation in vitro (19). Corroborating the importance of the metal-binding activity of
SlyD, the MBD is essential for optimal hydrogenase biogenesis as well as nickel accumulation in
E. coli (8).
SlyD was initially recognized as an accessory factor of the hydrogenase maturation pathway
when the protein was found in a complex with HypB, in multiprotein pull-down assays designed
to discover additional components of the [NiFe]-hydrogenase maturation pathway (20).
Subsequent in vitro work has established that these two proteins form a heterodimer through the
proline-containing linker region of HypB located between the high-affinity N-terminal metal-
binding site and the G-domain, and a loop in the IF domain of SlyD (8) (Figure 4-1). This
protein-protein interaction is important for the hydrogenase-related function of SlyD in vivo, as
disruption of this interaction through mutagenesis results in decreased hydrogenase activity, to a
similar extent as that observed in the ∆slyD strain (8). However, the consequences of this
interaction and how it enhances hydrogenase biogenesis are not clearly understood yet. The aim
of this study was to gain a better understanding of how the SlyD and HypB interaction modulates
the metal-binding and GTPase activities of HypB. The results presented provide evidence for
the nickel storage function of SlyD and show that these stored nickel ions can be used as a source
to metallate HypB, even under competitive conditions. This investigation also revealed that the
HypB-SlyD interaction results in faster metal release from the N-terminal high-affinity Ni(II) site
of HypB, as has been observed before (8), and this effect is enhanced by the nature of the
nucleotide bound to HypB, suggesting a gated metal release process. Furthermore, we find that
the GTPase activity of HypB is enhanced in the presence of SlyD, which can rescue the
enzymatic activity that is inhibited by binding of metal to the G-domain. The implications of the
altered metal-binding and hydrolysis functions that emerge as a result of protein complex
formation on [NiFe]-hydrogenase metallocentre assembly are discussed.
105
4. 2 Materials and Methods
Materials. All metal salts and the chelators, EDTA, EGTA, glycine, were purchased from
Sigma-Aldrich as 99.9% pure salts unless otherwise stated. The working solutions of the
chelators were adjusted to pH 7.5 prior to use and the concentrations of the metal stock solutions
were established by ICP-AES. GDP, GTP and the GTP analog, guanosine 5′-[β,γ-
imido]triphosphate (GMP-PNP) were purchased from Sigma and used as supplied unless
otherwise noted. Buffers for all assays were treated with Chelex-100 (Bio-Rad) whereas buffers
for MS-ESI experiments were treated with Chelex-100 that was converted to the NH4+ form from
the Na+ form according to the manufacturer’s protocol. Tryptone, yeast extracts and glycerol
were purchased from BioShop Canada Inc. All other chemicals were purchased from Sigma-
Aldrich unless otherwise noted.
Growth conditions. The MC4100 strain and the ΔslyD strain in the same background were
grown anaerobically for 5 hrs in sealed flasks of buffered tryptone-yeast extract-potassium
phosphate (TYEP) media supplemented with 0.8% glycerol, 15 mM sodium formate, 1 M
sodium molybdate and 1 M sodium selenite, following inoculation with 1% (v/v) of an
aerobically grown overnight culture. Radioactive 63
Ni(II) (Perkin Elmer) was included in the
growth media at a final concentration of 0.25 M. Following the 5 h growth, cells were washed
thoroughly with chilled 50 mM potassium phosphate pH 7.0 to remove any excess nickel. The
cells were then grown anaerobically for an additional 16 h at 37 oC in buffered TYEP media or
media that was supplemented with dimethylglyoxime (DMG). At the start of each new growth
step, chloroamphenicol (34 g/mL) was added to the ΔslyD bacterial cultures.
Cellular nickel accumulation. After the final growth step, cells were harvested and extensively
washed with 50 mM potassium phosphate pH 7.0. Cell extracts were prepared by sonication in
the same buffer followed by centrifugation at 18,000 rpm for 20 min. Radioactivity was
measured by scintillation counting in 3 mL of UltimaGold scintillation fluid with a Tri-Carb
2100TR (Packard Instruments) liquid scintillation analyzer.
Hydrogenase activity assay. For analysis of hydrogenase activity in the cell cultures, cell
extracts were prepared according to the method described by Zhang et al. (20). The hydrogenase
activity of all three isozymes in E. coli was measured by hydrogen-dependent reduction of
benzyl viologen according to the procedure of Ballantine and Boxer (21).
106
Protein expression and purification. SlyD wildtype protein and SlyD variants were over
expressed and purified according to the methods previously described (19, 20). Only fully
reduced SlyD was used for the subsequent experiments as determined via an N-ethyl maleimide
modification assay (19). HypB was expressed and purified according to the method used by
Leach et. al, and supplementation of the growth media with 1 mM NiSO4 is expected to yield
purified HypB with close to stoichiometric amount of Ni(II) bound (10). The amount of metal
bound to HypB was determined by treating HypB with excess p-hydroxymecuribenzoic in the
presence of 4-(2-pyridylazo)resorcinol (PAR) followed by detection at 500 nm. The resulting
Ni(II)-PAR signal was compared to a standard curve prepared under the same conditions to
determine the fraction of metal bound and the protein was routinely found to contain > 0.95
equivalents of Ni(II). To assess the free thiol content of purified HypB, tris(2-
carboxyethyl)phosphine (TCEP) was removed by PD10 gel-filtration columns (GE Healthcare)
and the protein was mixed with 5,5’-dithio-bis(2-nitrobenzoic acid) (DTNB) in the presence of 6
M guanidinium hydrochloride and compared against β-mercaptoethanol as a standard. The
HypB mutant C2,5,7A was expressed and purified in a similar manner to the wildtype protein
except the growth media was not supplemented with additional nickel Ni(II) (10). Analysis of the
metal content of the purified HypB mutant according to the method described above indicated
the presence of only apo protein.
Sample preparation for electrospray-ionization mass spectrometry (ESI-MS). All sample
preparations were conducted in an anaerobic chamber. Apo HypB samples were prepared by
incubating the protein with 10 mM EDTA and 5 mM TCEP for 3 days at 4 oC. The sample was
then buffer exchanged via PD-10 columns equilibrated with 10 mM ammonium acetate, pH 7.5
(MS buffer) and the fractions containing the protein were collected and concentrated to a volume
of ~100 L. This sample was further buffer exchanged four times with 500 L aliquots of MS
buffer via a 10K MWCO nanosep centrifugal device (PALL lifesciences) to remove salt. Holo
HypB and apo SlyD samples were prepared by incubating the proteins with 1 mM TCEP
overnight at 4 oC and buffer exchanging into 10 mM ammonium acetate, pH 7.5 in a similar
manner to the apo HypB samples. Ni(II)-bound SlyD samples were prepared by addition of
appropriate amount of nickel with subsequent equilibration of the sample overnight at 4 oC. To
ensure reproducibility all experiments mentioned below were conducted at least in triplicate.
107
Metal transfer using ESI-MS. HypB and SlyD protein concentrations of 100 M each were used
for these reactions unless otherwise noted. After mixing all of the components necessary for the
reaction, samples were left at room temperature in an anaerobic glovebox. To monitor the
metallation state of the protein mixture at a given time point, an aliquot of the mixture was
removed and diluted 10-fold using MS buffer into septum-capped vials to reduce exposure to air
and analyzed via ESI-MS immediately. When metal chelators were included in the reaction
mixture, a 10 molar excess of the competitor relative to the HypB protein concentration was
added to the mixture.
Equilibrium dialysis. Using microchambers of DIALYZER (Harvard Apparatus, Inc.), a 100 M
sample of apo HypB (250 L) was dialyzed against a 100 M SlyD sample loaded with 1
equivalent of Ni(II) (250 L). The chambers were separated by a 1 MWCO membrane, and the
samples were allowed to equilibrate at room temperature in an anaerobic glove box. For ESI-MS
analysis at a given time point, solutions from each of the chambers were diluted 10-fold into
septum-capped vials using MS buffer.
Metal-release assays using ESI-MS.
a) Metal release from HypB in the presence of SlyD variants. Holo HypB and apo SlyD at 100
M each were used for these reactions unless otherwise noted. An EGTA concentration of 1
mM also used. After equilibrating the samples for the indicated amount of time at room
temperature in an anaerobic glovebox, they were diluted 10-fold into septum-capped vials for
analysis via ESI-MS. Control experiments with HypB and chelator alone were carried out under
identical experimental conditions.
b) Metal release from HypB using different chelators. To initiate the reactions, proteins were
mixed at a 1:2 ratio with 50 M holo HypB and 100 M apo SlyD, into buffer containing 250
M of the chelator under investigation. At the indicated times, aliquots of these samples that
were allowed to equilibrate at room temperature in an anaerobic glove box were diluted 10-fold
into septum-capped vials and analyzed by ESI-MS immediately.
c) Metal release from HypB in the presence of nucleotide. GDP (purchased as the Na+ form
from Sigma-Aldrich) was buffer exchanged using a C18 Vydac analytical column (GRACE)
using MS Buffer, prior to use in ESI-MS experiments. GMP-PNP was used as purchased
108
(obtained as Li+ form from Sigma-Aldrich). Prior to conducting the assays, holo HypB samples
were incubated with the respective nucleotide (5 molar excess relative to HypB) at room
temperature in an anaerobic glove box for 30 min. Reactions were initiated by mixing holo
HypB bound to nucleotide (100 M) and apo SlyD (100 M) with buffer containing 1 mM
EDTA. An aliquot of the sample was transferred to a septum-capped vial at various time points
and diluted 10-fold prior to analysis by ESI-MS immediately.
ESI-MS instrumental parameters, data acquisition and processing. The mass spectra were
acquired on a AB/Sciex QStarXL mass spectrometer equipped with an ion spray source in the
positive ion mode and a Hot Source-Induced Desolvation (HSID) interface (Ionics Mass
Spectrometry Group Inc.). Ions were scanned from m/z 1300-3000 with accumulation of 1 s per
spectrum with no interscan time delay and averaged over a 2-4 min period. The instrument
parameters were as follows: ion source temperature 200 oC, ion source gas 50.0 psi; curtain gas
50.0 psi; ion spray voltage 5000.0 V; declustering potential 60.0 V; focusing potential 60 V;
collision gas 3.0; MCP (detector) 2200.0 V. The resulting spectra were deconvoluted without
further manipulation using the Bayesian protein reconstruction program over an appropriate mass
range using a step mass of 1 Da, signal/noise ratio of 20 and the minimum intensity detected set
to 1%.
Metal-release assays using electronic absorption spectroscopy: Holo HypB samples (100 M)
in 10 mM ammonium acetate, pH 7.5, and 1 mM MgCl2 were incubated with 500 M nucleotide
for 30 min at room temperature prior to the start of the reaction. SlyD (100 M) was rapidly
mixed with holo HypB at 1:1 ratio into buffer containing 1 mM EDTA and loaded into an
anaerobic cuvette in the anaerobic glovebox. All samples were allowed to equilibrate for ~1 min
prior to collection of data. Spectra were recorded every 15 min for 2 h and the amount of Ni(II)
bound to HypB was determined by the intensity of the signal at 320 nm. The fraction of holo
HypB was calculated using the following ratio (A320/Amax) where Amax is the absorption detected
at 320 nm at the first time point. Apo HypB does not have a detectable signal at 320 nm.
GTPase kinetic assays and HPLC analysis. To measure the GTPase activity, protein samples
were buffer exchanged into 20 mM Tris, pH 7.5, 100 mM NaCl, 5 mM MgCl2 and 1 mM TCEP.
The following reaction conditions were used for al1 GTP hydrolysis measurements that were
conducted under aerobic conditions: A final concentration of 1 M HypB, 50 M SlyD and 450
109
M GTP. When SlyD was included in the reaction mixture, the two proteins were allowed to
equilibrate at room temperature for 30 mins. Assays were initiated by rapid mixing of the
protein solutions with GTP followed by incubation of the samples at 37 oC under aerobic
conditions. After 10 min, the reactions were quenched by adding 1 M perchloric acid and after
10 min, neutralized with 4 M sodium acetate, pH 4.0. Precipitated protein and salt was removed
by centrifuging at 18000 rpm for 5 min and 25 L of the resulting supernatant was diluted into
Milli-Q water to a total volume of 100 L for analysis. Samples were injected on a Dionex
BioLC equipped with an A50 autosampler with an injection volume set to 50 L. GDP and GTP
were resolved on a C18 Vydac analytical column (GRACE) with an isocratic mobile phase
consisting of 100 mM sodium phosphate buffer, pH 6.6, 10 mM tetrabutylammonium bromide,
4% acetonitrile. Nucleotides were detected via the absorbance at 254 nm and under these
conditions, GDP eluted at ~7.8 min and GTP eluted at ~9.5 min. Integration of the peak area
using PeakNet Client v 6.4 (Dionex Inc.) relative to control samples (with no enzyme present)
treated in an identical faction allowed for quantification of moles GDP produced L-1
min-1
,
from which kcat was then determined. For analysis of GTPase activity as a result of metal
coordination to the site at the G-domain, 10 M purified HypB was incubated with either 10
molar excess of Ni(II) or 1.5 molar excess of Zn(II) respectively at room temperature for 1 h.
The GTPase activities of these samples were measured in an identical manner as described above
by subsequent dilutions of these samples to 1 M.
4.3 Results
SlyD functions as a nickel storage protein in E. coli. The ability of SlyD to coordinate
multiple nickel ions, coupled with the fact that deletion of this gene results in reduced nickel
content in E. coli when grown under anaerobic conditions, has led to the designation of SlyD as a
nickel reservoir (19, 20). These stored nickel ions on SlyD are expected to be utilized for
[NiFe]-hydrogenase metallocentre assembly when bacteria are faced with nickel-limiting
conditions. If this hypothesis is true, then a ΔslyD strain should be deficient in hydrogenase
activity compared to the wildtype strain, especially when bacteria are faced with Ni(II)
starvation. Cell cultures were first exposed to Ni(II) under anaerobic conditions to allow E. coli
to accumulate nickel and potentially store Ni(II) in SlyD. Then, hydrogenase activity was
assessed following washing of the cells and further growth for 16 h anaerobically in media with
110
or without dimethyl glyoxime (DMG). Supplementation with DMG is expected to mimic nickel-
limiting conditions because this chelator binds nickel with high affinity (22, 23). Deletion of
slyD results in 80% reduction in hydrogenase activity whereas the relative activity decreases
even further to 11% of the wildtype when grown in nickel-limited media (Table 4-1). Addition
of DMG decreases the hydrogenase activity in each strain by 54% and 74% for the wildtype and
ΔslyD strains, respectively (Table 4-1). This decrease in activity for the deletion strain under
limiting nickel conditions is evidence that SlyD contributes to hydrogenase maturation by
functioning as a nickel reservoir.
Table 4-1. Total hydrogenase activity.
- DMG + DMG
% of enzyme activity in +
DMG relative to - DMG
Wildtype 1.00 0.46 ± 0.09 46%
∆slyD 0.20 ± 0.03 0.05 ± 0.02 26%
% enzyme activity in ΔslyD
relative to WT 20% 11%
Hydrogenase activity in cultures that were first grown with 0.25 M
63Ni, followed by washing and further
anaerobic growth for 16 h. Total hydrogenase activity was measured using the benzyl-viologen assay. The data are
normalized to the amount of hydrogenase activity detected (measured as units/mg) in the wildtype strain grown
without addition of DMG. The errors reported are standard deviation from at least three independent replicates.
Table 4-2. Cytoplasmic 63
Ni(II) levels.
- DMG + DMG
% of Ni(II) in + DMG
relative to - DMG
Wildtype 1.00 0.70 ± 0.08 70%
∆slyD 0.45 ± 0.15 0.05 ± 0.02 12%
% Ni(II) in ΔslyD
relative to WT 45% 8%
Amount of radioactive nickel remaining in bacteria that were cultured for 5 hrs in media containing 0.25 M
63Ni
anaerobically, followed by washing and further anaerobic growth for 16 h. The data are normalized to the amount
of 63
Ni detected (measured as cpm/mg) in the wildtype strain grown without addition of DMG. The errors reported
are from at least three independent replicates.
To determine whether the decrease in hydrogenase activity is in fact due to less nickel retention
by the ΔslyD strain, the nickel content was also analyzed for the two bacterial strains grown
under different media compositions. As expected (20), bacterial strains with lesions in the slyD
gene only accumulate 45% of Ni(II) levels observed in the wildtype strain when grown in media
without DMG. A more dramatic decrease in the nickel content is observed when the bacteria are
111
grown in media supplemented with DMG, with only 8% nickel accumulation in the ΔslyD strain
relative to the wildtype strain grown under identical conditions (Table 4-2). Similarly, when
considering the impact of limiting available nickel by treatment with DMG the effects are more
pronounced for the ΔslyD strain as the cytoplasmic nickel content dropped by 88% whereas only
a 30% decrease is observed in the wildtype strain (Table 4-2). Therefore, the data indicate that
under nickel-limiting conditions, deletion of slyD, results in a 5.8-fold decrease of the nickel
quota within the cell, further supporting the hypothesis that SlyD functions as a nickel storage
protein.
Metallation of apo-HypB using SlyD as a Ni(II) source. Metal stored under abundant Ni(II)
conditions is typically utilized for enzyme biosynthesis when bacteria are faced with metal
limiting conditions (11). Therefore, it is possible that Ni(II) stored in SlyD is mobilized for
assembly of the [NiFe]-hydrogenase metallocentre. The most likely partner for metallation by
SlyD is HypB, because a HypB-SlyD protein complex is observed in vivo (20). To test this
hypothesis, metal transfer experiments were conducted in vitro. These transfer reactions were
initiated by mixing 100 M SlyD containing 1 equivalent of Ni(II) with 100 M apo HypB
under anaerobic conditions. HypB and SlyD are expected to form a heterodimer with a KD of
~10 M (8), therefore protein concentrations of 100 M each were chosen to ensure > 70%
complex formation. It is estimated that there are approximately 25000 molecules of HypB and
10000 molecules of SlyD expressed per cell of bacteria, which roughly translates to 52 M
HypB and 17 M SlyD assuming a cell volume of 10-15
L (7, 24). Therefore, the concentrations
utilized in these in vitro assays are within the range of physiological concentrations of the two
proteins.
ESI-MS was used for analysis of the metal transfer reactions because it detects all the proteins
present in solution simultaneously and it reveals the metallation state of each of the proteins.
Representative spectra for a metal transfer assay are shown in Figure 4-2. The peak intensities
from the reconstructed spectra were used to calculate the fractions of holo HypB assuming that
both apo and holo HypB species in the reaction mixture are ionized similarly in the ESI source
and that the signal detected for each species in the gas phase is proportional to their respective
concentration in the solution phase. Ni(II)-bound HypB is not detected after a 15 min incubation
period (data not shown), but a gradual increase in the amount of the Ni(II)-bound HypB species
112
with a concomitant decrease in the amount of holo SlyD species is observed when the protein
mixture is allowed to equilibrate for longer (Figure 4-2 and Figure 4-3A). Although HypB has
two metal-binding sites only a single Ni(II) per HypB monomer is detected in these spectra
signifying metal loading into a single metal site. Considering the affinities of the Ni(II) sites of
HypB (~pM and ~M) (10) and those of SlyD (~nM) (19) it is likely that the high-affinity metal
site at the N-terminus of HypB is being loaded via this metal transfer process, rather than the
weaker site in the G-domain. To verify this explanation, metal transfer from holo SlyD to the
HypB mutant C2,5,7A was assessed. This HypB mutant contains an intact G-domain metal site
but mutating the three cysteines to alanines disrupts the high-affinity nickel-binding activity (10).
Ni(II) transfer between holo SlyD and the HypB mutant was not observed (data not shown),
indicating that SlyD only transfers metal to the N-terminal high-affinity site. Nevertheless, these
data denote that SlyD can function as a Ni(II) donor to HypB, albeit with slow metal exchange
rates. To ensure that incomplete metallation of HypB observed after 4 h is not due to
compromised integrity of HypB, a control experiment was conducted with an apo HypB sample
that was incubated with 1 molar equivalent of metal and analyzed under identical conditions at
various time points. The mass spectra indicate that fully metallated HypB is obtained in less than
30 min incubation and remains fully metal bound over the course of 4 h, suggesting that partial
metallation is a SlyD-dependent effect and not due to compromised integrity of the HypB protein
(data not shown).
In addition to the expected apo HypB peak at 31432 Da, an additional peak is observed at 31460
Da in the reconstructed spectrum for apo HypB (Figure 4-1). Only the apo-protein is susceptible
to this modification (+28 Da) since addition of 1 equivalent of Ni(II) to the protein yields a
single peak corresponding to the Ni-bound HypB (Figure 4-3), suggesting that these peaks result
from modification of apo protein during the ionization process. Exposure to reactive oxygen
species during the ionization process can cause oxidative modifications of amino acid side chains
that result in an increase in the protein mass (25, 26). Typically, lowering the voltage on the ion
source is expected to reduce the oxidation of the protein (25), however lowering of the voltage
did not reduce the oxidation of HypB (data not shown). A further decrease in the applied voltage
was precluded by the significant decrease in the signal due to insufficient ionization energy. The
N-terminal region containing the metal-binding site is a likely candidate for this modification
because binding of Ni(II) is able to protect the protein from oxidation.
113
Figure 4-2. Metal transfer detection via ESI-MS. Representative reconstructed mass spectra
corresponding to SlyD (left panels) and HypB (right panels). Mass spectra corresponding to SlyD bound
to 1 equivalent of Ni(II) and apo HypB before mixing (top panels). Metallation state of the proteins after
equilibrating for 4 h (middle panels) and the same reaction conducted in the presence of a 10 molar excess
EGTA (bottom panels). Numbers heading the dotted lines represent the number of Ni(II) ions bound to
the protein. The (*) in HypB spectra corresponds to fully reduced apo HypB whereas (**) indicates apo
HypB with the +28 Da modification.
In order to assess whether metallation of HypB is due to direct metal transfer achieved through
heterodimer formation and not through dissociation of the Ni(II) from SlyD followed by
subsequent binding by HypB, SlyD bound to 1 equivalent of metal was dialyzed against an apo
HypB sample. Metallation of apo HypB is still observed, indicating that a fraction of the Ni(II)-
HypB formed is due to this diffusion-mediated process (Figure 4-3A). However, the metallation
rate is considerably reduced compared to that achieved when the two proteins are incubated
together. These results suggest that although diffusion-dependent metal transfer does occur,
Ni(II) transfer is significantly enhanced due to protein-protein complex formation.
Mass (Da)
20700 20900 21100 21300
Mass (Da)
31300 31400 31500 31600
Rel
ativ
e In
tens
ity
0 1 2 3
**
**
**
*
1
*
*
Before
Mixing
After
4 h
After 4h
with EGTA
SlyD HypB
114
Figure 4-3. Ni(II) transfer from SlyD to HypB detected via ESI-MS. (A) Equilibrating SlyD (100
M) bound to 1 equiv. of Ni(II) with apo HypB (100 M) leads to a gradual increase in the amount of
Ni(II)-bound HypB with time (diamonds). Equilibrating the two proteins separated by a membrane
results in significantly slower metal transfer rates (circles). (B) Fraction of Ni(II)-bound HypB obtained
with time upon equilibrating 1 equiv. of Ni(II)-bound SlyD (100 M) with apo HypB (100 M) in the
presence of 1 mM EGTA (squares). A lower yield of Ni(II)-bound HypB is obtained when 100 M Ni(II)
is added to a solution of apo HypB (100 M) and 1 mM EGTA (triangles), suggesting protein-mediated
metal transfer. Error bars represent standard deviation of at least 3 independent trials.
Figure 4-4. Analysis of holo HypB by ESI-MS. Representative spectra of HypB bound to 1 equivalent
of Ni(II) (denoted as holo HypB) after leaving the protein at room temperature for 25 h. The m/z spectra
and the reconstructed spectra are shown in the left and right panels, respectively. The dotted-lines denote
the apo-HypB species corresponding to masses of 31432 Da and 31460 Da.
0
0.1
0.2
0.3
0.4
0.5
0 1 2 3 4
Fra
ctio
n o
f N
i(II)-
bo
un
d H
yp
B
Time (h)
0
0.1
0.2
0.3
0.4
0.5
0 1 2 3 4
Fra
ctio
n o
f N
i(II)-
bo
un
d H
yp
B
Time (h)
(A) (B)
Mass (Da)
31300 31400 31500 31600
Holo HypB
Rel
ativ
e In
tens
ity
m/z
1600 2000 2400 2800
115
To validate whether SlyD can still function as a source of nickel for HypB in a competitive
environment, metal transfer from SlyD to HypB was monitored in the presence of two metal
chelators, EGTA and glycine. EGTA forms a 1:1 complex with Ni(II) with an apparent KD ~10-
11 M at pH 7.5 whereas two glycine molecules are required to form a complex with Ni(II) and
binds this metal with an affinity in the low micromolar range (27). Transfer of nickel from SlyD
to the HypB high-affinity metal site is still observed and remains unchanged in the presence of
10 molar excess (i.e. 1 mM) of the weak competitor glycine (data not shown). In the case of the
stronger competitor EGTA, the fraction of Ni(II)-bound HypB is diminished compared to that
observed without the competitor (Figure 4-2 and 4-3B). However, addition of 1 equivalent of
nickel without SlyD to apo HypB solution containing 1 mM EGTA results in further diminished
fraction of Ni(II)-HypB obtained (Figure 4-3B). Therefore, these data are consistent with the
model that SlyD is not only able to provide Ni(II) to HypB, but it is able to do so in a strongly
competitive environment.
SlyD modulates the HypB high-affinity Ni(II)-binding site. The reason why fully-saturated
HypB could not be obtained in the metal-transfer assays even after long equilibration periods that
were sufficient to remove all the nickel bound to SlyD was puzzling. Earlier investigations by
Leach et al. demonstrated that SlyD can modulate the N-terminal nickel site of HypB, likely
through the formation of a protein-protein complex (8). In order to determine if partial
metallation is a result of this modulation of the HypB Ni(II) site by SlyD, a protein mixture
containing equimolar apo SlyD and holo HypB was analyzed by ESI-MS. Upon addition of apo
SlyD to holo HypB samples, a loss of Ni(II) ions from the high-affinity site of HypB is observed
with increasing incubation time and at 25 h only half of HypB remains bound to nickel (Figure 4-
4). At any of the time points analyzed no metal was bound to SlyD, suggesting that metal loss
was not due to chelation by SlyD. To ensure that metal loss was due to the presence of SlyD,
control experiments were conducted in which a sample of HypB alone was analyzed under
identical experimental conditions. No metal loss was detected from HypB even after allowing the
sample to remain at room temperature for a 25 h period under anaerobic conditions (Figure 4-4).
Therefore, the data indicate that an interaction with SlyD leads to a dramatic change in the high-
affinity Ni(II) site of HypB such that the nickel-HypB protein complex does not survive the
ionization process during the MS analysis.
116
Figure 4-5. SlyD modulates the high-affinity metal site of HypB. Representative reconstructed mass
spectra corresponding to apo SlyD (left panel) and holo HypB (right panel) before mixing (top panels)
and after allowing the two proteins to equilibrate for 25 h (bottom panels). Numbers heading the dotted
lines represent the number of Ni(II) ions bound to the protein. Partial loss of metal occurs from HypB as
indicated by the appearance of apo-peaks (* and **), but this fraction of lost metal is not coordinated by
apo SlyD as the mass of the protein remains unchanged. The (*) in HypB spectra corresponds to fully
reduced apo HypB whereas (**) is apo HypB containing the +28 Da modification.
Features of SlyD important for increased metal-release rates. In order to establish which
attributes of SlyD are necessary to enhance the metal release rates from HypB, several SlyD
mutants were analyzed. The metal release experiments were conducted in the presence of 1 mM
EGTA (chelator added as an acceptor of Ni(II)) with 100 M each of HypB and SlyD, followed
by ESI-MS analysis. As mentioned above, when compared to HypB alone, inclusion of SlyD in
the reaction leads to acceleration of Ni(II) release from HypB. Addition of SlyD1-146, a truncated
version of SlyD lacking the metal-binding domain, does not modulate the Ni(II) site of HypB as
the metal release rate was similar to that of HypB alone (Figure 4-6). To verify that protein-
protein complex formation is necessary for this accelerated metal release, a SlyD mutant that is
unable to form a heterodimer with HypB was used. This SlyD mutant, referred to as the ΔIF
SlyD, was described previously and has a deletion in the IF-chaperone domain corresponding to
Mass (Da)
20700 20900 21100 21300
Mass (Da)
31300 31400 31500 31600
Rel
ativ
e In
tens
ity0 1 2 3 4
**
*
1
Before
Mixing
After
25 h
SlyD HypB
117
residues 107-111, which abrogates complex formation (8). Even after allowing the proteins to
equilibrate for 6.25 hours, 92% of HypB retained bound Ni(II) indicating that the SlyD-HypB
complex formation is essential for modulation of the HypB Ni(II) site (Figure 4-6). When a
variant of SlyD corresponding to the metal-binding domain of SlyD was utilized (i.e. SlyD146-196
referred to as the SlyD-MBD) a metal-release profile comparable to that of ΔIF SlyD was
observed (Figure 4-6). Cross-linking experiments involving the SlyD-MBD and WT HypB
failed to produce a cross-linked product suggesting that the IF-domain is essential for the
complex formation (data not shown). Taken together the results obtained for the three mutants
indicate that the IF domain that is essential for complex formation, as well as the metal-binding
domain are both necessary to accelerate release of the Ni(II) from the N-terminal metal-site of
HypB. To determine whether Cys residues in SlyD are necessary for modulation of the metal-
binding activity of HypB by SlyD, a variant devoid of Cys residues designated as the triple
mutant (triple mutant contains the following mutations and deletion: C167,168,184,185A and
Δ193-196) was utilized. Although the triple mutant has reduced affinity as well as reduced
capacity for Ni(II) binding (19), the metal release profile was not affected when compared to the
WT SlyD protein (Figure 4-6). Thus, the results indicate that the Cys residues on SlyD are not
required for affecting the high-affinity Ni(II) site of HypB.
Thiol-based acceptor enhances the metal release from HypB. If nickel flows from the SlyD-
HypB complex to the hydrogenase enzyme precursor, it is likely to be uni-directional in vivo.
This assumption is based on the fact that once the Ni(II) is coordinated by the Cys residues of the
precursor [NiFe]-Hydrogenase large subunit, this subunit is expected to undergo proteolytic
cleavage at the C-terminus with subsequent folding to yield a mature enzyme, thereby trapping
the metal ion at the active site. To mimic this thermodynamic nickel sink, metal release from
HypB by SlyD was re-evaluated in the presence of EDTA, a chelator with high affinity for Ni(II)
(apparent KD of 10-15
M at pH 7.5) (27). As expected, inclusion of EDTA leads to faster metal
release. Only 64% of HypB remains bound to Ni(II) after a 30 min reaction compared to 72%
with EGTA (Figure 4-7). Similar to the above mentioned metal-release assays, nickel-bound
SlyD species are not detected indicating that the nickel is not transferred to SlyD but sequestered
by the chelator once released from the HypB metal site. To observe whether addition of an
acceptor containing thiol moieties could affect the metal release rate, a seven residue peptide
(termed B7) was used. The basis for addition of chelator containing thiol groups is that it would
118
be a closer mimic to the [NiFe]-hydrogenase precursor as the coordination sphere of the enzyme
consists of Cys residues (11). This B7-peptide corresponds to the minimal sequence of the high-
affinity nickel-binding site of HypB. Similar to the full-length protein, the peptide has high
affinity for nickel ions, and coordinates this metal with a KD of ~10-13
M. (Douglas, C., Zamble,
D. B., manuscript in preparation). Although the peptide binds Ni(II) with lower affinity than
EDTA, the metal release from HypB is greatest in the presence of this peptide as only 28% of
HypB remains bound to Ni(II) after a 30 minute incubation, suggesting that the thiol residues
favour this metal release process (Figure 4-7). For all chelators used, control experiments with
50 M HypB and 250 M chelator alone were conducted to ensure the enhanced metal-release
rates observed were in fact due to the presence of SlyD (Figure 4-7).
Figure 4-6. Monitoring metal release from HypB to EGTA in the presence of SlyD variants via
ESI-MS. Addition of 1 mM EGTA to holo HypB (100 M) results in Ni(II) loss from the high-affinity
site (empty diamonds). Addition of 100 M wildtype (filled squares) or the triple mutant SlyD (filled
diamonds) leads to an increase in the rate of metal release to EGTA. Addition of MBD-SlyD (empty
circles), ΔIF SlyD (empty squares) or SlyD1-146 (empty triangles) at a concentration of 100 M each does
not affect the rate of Ni(II) release from HypB to EGTA. Error bars represents the standard deviation of
at least 3 independent trials.
0.4
0.5
0.6
0.7
0.8
0.9
1
0 1 2 3 4 5 6 7
Fra
ctio
n o
f N
i(II)-
bo
un
d H
yp
B
Time (h)
119
Figure 4-7. Metal release from HypB using different acceptors. Fraction of holo HypB remaining
after incubating HypB (50 M) with 250 M chelator (filled bars) for 30 mins compared to fraction of
holo HypB remaining after including apo SlyD (100 M, empty bars) in the reaction mixture. The trend
in metal release rate does not correlate with the KD of the chelators for Ni(II) (EDTA < B7-peptide <
EGTA).
Effect of SlyD on GxP bound form of HypB. In addition to the metal-binding activity, the
GTPase function of HypB is also essential for the biogenesis of the [NiFe] hydrogenase enzyme
(9, 28). HypB can bind GDP with micro-molar affinity in vitro (26, 27). GTP hydrolysis is
routinely used as a molecular switch to alter the conformation of proteins (29), thus it is possible
that binding of nucleotide could affect the high-affinity Ni(II) site of HypB. In order to
investigate this possibility, Ni(II) release from the N-terminal metal site of HypB to EDTA was
carried out in the presence of GDP or GMP-PNP, a non-hydrolysable analogue of GTP. The
addition of 500 M GDP to 100 M HypB leads to ~90 % of the protein bound to GDP as
detected by ESI-MS (Figure 4-8). However, in agreement with previous data, GMP-PNP
appears to have lower affinity for HypB when compared to GDP and only results in ~60% GTP
bound form (Figure 4-8) (28). No change in metal release profiles could be detected when HypB
alone was incubated with either form of the nucleotide indicating that the affinity of the Ni(II)
site is not affected when GMP-PNP or GDP is bound by HypB (Figure 4-9). In contrast, upon
addition of apo SlyD to the protein mixture, an accelerated loss of Ni(II) was detected for the
0
0.2
0.4
0.6
0.8
1
B7 peptide EGTA EDTA
Frac
tion
of N
i(II)
boun
d H
ypB
120
GDP-bound form of HypB, whereas no change in metal release profile was observed for GMP-
PNP-bound HypB when compared to that of HypB without any nucleotide (Figure 4-9).
Figure 4-8. GxP binding to HypB via ESI MS. A representative reconstructed mass spectrum for
HypB bound to 1 equivalent of Ni(II) at the high-affinity site, denoted as holo HypB (top panel).
Incubation of 100 M holo HypB with 500 M GDP (middle panel) or the GTP analog, GMP-PNP
(bottom panel) followed by 10-fold dilution prior to MS analysis results in the formation of holo HypB-
nucleotide complexes. The relative abundance of 90% for GDP-HypB and 60% for GMP-PNP-HypB
was calculated based on the peak intensities of each species.
Mass (Da)
31400 31600 31800 32000
Rel
ativ
e In
tens
ity
Holo HypB
holo HypB + GDP
holo HypB
holo HypB
holo HypB + GMP-PNP
121
Figure 4-9. SlyD together with GDP enhances the nickel release rate from HypB. Amount of holo
HypB (100 M) remaining upon equilibration of the protein in 1 mM EDTA for 15 mins. (filled bars).
Including SlyD (100 M) in the HypB, EDTA reaction mixture results in a larger apo HypB fraction
under identical equilibration conditions (unfilled bars). An additional acceleration in the metal release
rate is observed when GDP is added to the HypB/SlyD/EDTA mixture, whereas no change in metal
release rate observed when a GTP analog (GMP-PNP) is added to the mixture. These metal release
assays were analyzed by using ESI-MS.
As we could not detect fully GMP-PNP loaded HypB through mass spectrometry, the observed
nucleotide-dependent metal release activity of HypB was further examined by using electronic
absorption spectroscopy. This analysis method allowed for the inclusion of 1 mM MgCl2 in the
protein buffer (MS is not tolerant to such high salt concentrations), which would facilitate
binding of the nucleotide to the protein. Ni(II) binding to the Cys residues at the N-terminal
metal site of HypB results in a ligand to metal charge transfer (LMCT) band at 320 nm (320
7300 M-1
cm-1
) (10). Therefore, the loss of metal from HypB can be monitored by the decrease
in the intensity of this LMCT band. Taking advantage of the knowledge that SlyD addition to
HypB does not lead to Ni(II) transfer to SlyD (discussed above), the decrease in LMCT should
then correlate with Ni(II) loss from HypB as EDTA chelates Ni(II). In these metal release assays
the change at 320 nm was monitored over a 2 h time period upon mixing holo HypB and apo
SlyD (100 M each) in the presence of 1 mM EDTA. To evaluate the effect of the nucleotide,
holo HypB was incubated with 500 M nucleotide for 30 min at room temperature prior to
addition of SlyD and EDTA. The resulting metal release data are presented in Figure 4-10. In
agreement with the ESI-MS data, an increase in SlyD-dependent metal release is observed that is
further accelerated when HypB is bound to GDP. By fitting the metal release profiles to a 1st
0
0.2
0.4
0.6
0.8
1
No Nucleotide + GTP analog + GDP
Fra
ctio
n o
f N
i(II)
bo
und
Hyp
B
122
order decay event a t1/2 ~ 24 h and 73 min was obtained for HypB and for the HypB-SlyD
mixture, respectively. The half-life for the GMP-PNP loaded HypB in the presence of SlyD
remains unaffected (t1/2 ~ 75 min) whereas the half-life of the GDP bound form decreases to t1/2 ~
33 min. Therefore, the data provide clear evidence that SlyD-dependent modulation of the Ni(II)
site of HypB is further enhanced when HypB is bound to GDP.
Figure 4-10. Metal release from HypB to EDTA monitored by electronic absorption spectroscopy.
Change in the fraction of 100 M Ni(II)-bound HypB in the presence of 1 mM EDTA (empty symbols)
monitored by decreasing absorption of the LMCT band at 320 nm. Metal release from HypB (empty
squares) is not affected upon addition of GDP (empty circles) or GTP analog (unfilled diamonds) to
HypB. Including 100 M SlyD in the reaction mixture (filled symbols) results in an increase in the rate
of metal release. Metal release from HypB bound to GTP analog is not effected (filled diamonds)
whereas SlyD further accelerates the metal release process when HypB is bound to GDP (filled circles).
GTPase activity of HypB. Similar to most other small guanine nucleotide-binding proteins, the
intrinsic GTP hydrolysis rate of E. coli HypB is very slow (kcat = 0.17 min-1
) (28, 30). However
for some of these proteins, an interaction with a partner protein increases its enzymatic activity
(31, 32). To test whether SlyD has this effect on HypB, GTP hydrolysis rates under saturation
conditions were monitored with or without SlyD. HypB with Ni(II) bound at the N-terminal
metal site catalyzes the hydrolysis of GTP with a kcat of 0.27 ± 0.06 min-1
, a rate that is slightly
higher but comparable to that has been observed before (28, 30). A moderate three-fold increase
in the catalytic rate is observed when HypB is pre-incubated with SlyD (Table 4-3) and control
0
0.2
0.4
0.6
0.8
1
0 15 30 45 60 75 90 105 120
Fra
ction o
f N
i(II)-
bou
nd H
ypB
Time (min)
123
experiments with SlyD alone were conducted to ensure that the increase in GTP hydrolysis is
from HypB only.
Table 4-3. GTP hydrolysis rates of HypB under saturating conditions.
Metal
bound at the
G-domain
HypBWT
kcat (min-1
)
HypBWT +
SlyDWT
kcat (min-1
)
HypBWT +
SlyD1-146
kcat (min-1
)
HypBC2,5,7A
kcat (min-1
)
-- 0.27 ± 0.06 0.82 ± 0.04 0.36 ± 0.08 0.25 ± 0.09
Ni(II) 0.13 ± 0.03 0.87 ± 0.01 0.12 ± 0.03 0.12 ± 0.02
Zn(II) 0.07 ± 0.04 0.91 ± 0.09 0.06± 0.04 0.04 ± 0.01 Assays were performed using 1 M HypB protein and 450 M GTP and when required SlyD was included in the
reaction at a final concentration of 50 M. HypB samples with SlyD and or ligand were incubated for 1 hr at room
temperature prior to assay. The kcat are averages and standard deviations from more than three independent
experiments. To load the G-domain metal site, protein was incubated with 10 molar excess Ni(II) or 1.5 molar
excess Zn(II).
E. coli HypB contains a second metal-binding site within the G-domain of the protein that can
bind Zn(II) or Ni(II) with a KD of 1 M and 12 M, respectively (10). To assess whether SlyD
could still affect GTPase activity when HypB is metallated at both metal sites, HypB with either
Ni(II) or Zn(II) bound to the low-affinity site was incubated with SlyD, and the hydrolysis rates
of these protein mixtures were measured. HypB activity was reduced when the G-domain metal
site was metallated with either Zn(II) or Ni(II) as has been shown previously (30). Inclusion of
SlyD in the reaction mixture results in complete recovery of enzymatic activity with hydrolysis
rates comparable to SlyD/HypB mixture in which HypB is only bound to Ni(II) at the N-terminal
metal site (Table 4-3). Given that SlyD can bind multiple Ni(II) and or Zn(II) ions with an
affinity in the nanomolar range ((19) and Kaluarachchi, H., Zamble D. B., unpublished data), the
observed recovery could be a result of metal loss from the G-domain metal due to chelation by
SlyD. To test this possibility, GTP hydrolysis of HypB with metal bound at the G-domain was
measured in the presence of SlyD1-146. This SlyD variant lacking the MB domain is unable to
bind either Ni(II) or Zn(II) (19) and Kaluarachchi, H., Zamble, D. B., unpublished data). Unlike
the WT protein, addition of the SlyD1-146 mutant did not lead to the moderate increase in GTPase
activity, suggesting that the MBD of SlyD is necessary for this activity. In addition, the mutant
failed to rescue the inhibition of enzymatic activity when the G-domain metal site was occupied
with either nickel or zinc (Table 4-3). To verify that SlyD did indeed demetallate the low-
affinity metal site of HypB, a holo HypB sample (10 M) was incubated with 0.8 equivalents of
Zn(II) for 30 min, followed by incubation of this sample with apo SlyD (10 M) which was
124
analyzed via ESI-MS. The resulting mass spectra shows that this metal transfer process is ~95%
complete within 15 min (Figure 4-11) signifying that the experimental conditions used are
sufficient to remove all the metal from the G-domain.
Figure 4-11. SlyD removes Zn(II) from the G-domain of HypB. Representative reconstructed mass
spectra corresponding to holo HypB containing 0.8 equivalents of Zn(II) (top right panel) and apo SlyD
(top left panel) prior to mixing. Reconstructed spectra of the proteins after equilibrating the solution for
15 min at room temperature (bottom panels). Quantitation of the Zn(II) peak by area indicate that >90%
of the Zn(II) has been removed from the HypB and is subsequently coordinated by SlyD.
Analysis of this process using SlyD1-146 does not reveal any metal loss from HypB even after
allowing the proteins to incubate for 2 h (Figure 4-12), indicating that the MBD of SlyD is
necessary for this process. Given that the affinity for Ni(II) to this G-domain site is 10-fold
lower than that for Zn(II), this chelation by SlyD will also remove Ni(II) thus leading to the
observed recovery of the GTPase activity (Table 3). Therefore, the MS data supports a model in
which SlyD removes the metal bound at the G-domain of HypB thus leading to recovery of the
GTPase activity of HypB.
Mass (Da)
20700 20900 21100 21300
Mass (Da)
31300 31400 31500 31600
Rel
ativ
e In
tens
ity
0 1 2 3 +Ni(II) +Ni(II) & Zn(II)
125
Figure 4-12. SlyD1-146 cannot competitively remove Zn(II) bound to the G-domain of HypB.
Representative reconstructed mass spectra corresponding to holo HypB containing 0.8 equivalents of
Zn(II) (top right panel) and apo SlyD1-146 (top left panel) prior to mixing. Reconstructed spectra of the
proteins after equilibrating the solution for 2 h at room temperature (bottom panels). No change in the
mass spectra are detected indicating Zn(II) remains bound to HypB.
To assess whether high-affinity nickel site modulates the enzymatic activity of HypB, the
GTPase activity of the C2,5,7A HypB mutant was analyzed. While this mutant protein contains
an intact G-domain metal site, it cannot bind Ni(II) at the N-terminus because the three Cys
residues coordinating the Ni(II) have been mutated to Ala residues (10). The kcat measured for
the apo protein and for protein with either Zn(II) or Ni(II) bound at the G-domain was analogous
to that of the wildtype HypB indicating that the N-terminal nickel-site does not alter the GTPase
activity of the protein (Table 4-3).
Mass (Da)
20700 20900 21100 21300
Mass (Da)
31300 31400 31500 31600
Rel
ativ
e In
tens
ity
Apo +Zn(II) +Ni(II) +Ni(II) & Zn(II)
126
4.4 Discussion
The lack of a poly-histidine tail in E. coli HypB compared to its homologs prompted a search for
proteins that could functionally replace this nickel storage activity. This search led to the
discovery of SlyD as a protein that contributes to the maturation of the [NiFe]-hydrogenase
enzymes in this bacteria (20). The C-terminal region of SlyD corresponds to an unusual metal-
binding region that is rich in both the number and diversity of available metal-binding residues,
which are proposed to confer nickel storage capability to SlyD. These stored metal ions are then
anticipated to serve as a source of nickel when bacteria are faced with metal scarce
environments. Although analysis of SlyD in vitro and in vivo thus far supports this model (8, 19,
20), the experiments described herein provide direct evidence to validate this hypothesis. When
comparing bacteria cultured with or without the nickel chelator, DMG, the cytoplasmic nickel
content of the ΔslyD strain is significantly depleted in comparison to that of the wildtype strain
indicating that SlyD is a major determinant of nickel storage in E. coli. Similarly, when
considering the amount of active hydrogenase produced, the inhibitory effect of the chelator is
more pronounced in the ΔslyD strain, indicating bacteria without SlyD are highly-dependent on
exogenous nickel for [NiFe]-hydrogenase assembly. Therefore these results provide
physiological evidence that SlyD acts as a nickel reservoir in E. coli and this storage capacity is
useful for enzyme biosynthesis when nickel is scarce.
Given that SlyD was originally found to contribute to hydrogenase biosynthesis through its
interaction with HypB (20) and that HypB has two metal-binding sites required for hydrogenase
biosynthesis (9, 10), it was feasible that HypB could function as an acceptor of nickel from SlyD.
The results from the metal transfer assays reveal that SlyD can metallate the high-affinity nickel
site of HypB even under competitive conditions albeit with slow metal transfer rates. These data
imply that stored Ni(II) ions may be mobilized from SlyD to precursor hydrogenase enzyme, via
HypB. This observed transfer within a SlyD-HypB complex suggests that the critical nickel can
be supplied to HypB without relying on diffusion, thus avoiding competition with the abundant
metal-chelating molecules present in the cytoplasm. The slow metallation of HypB suggests that
HypB and SlyD alone are not sufficient to achieve ideal metal transfer conditions. Additional
factors that could contribute to an acceleration of this process may include interactions with other
protein partners such as HypA. It is also possible that docking of the Ni(II)-insertion protein
complex onto the large subunit of the precursor enzyme may enhance this process. Nevertheless,
127
these results together with the in vivo data provide evidence that E. coli can use SlyD to supply
Ni(II) for enzyme maturation under nickel limiting conditions.
Although SlyD may act as a nickel source, delivery of nickel by HypB is considered to be the
privileged pathway because hydrogenase maturation is completely abolished in the absence of
HypB (8, 33, 34) whereas deletion of SlyD only results in decreased hydrogenase activity in vivo
(8). Furthermore, by adding excess Ni(II) to the media, hydrogenase activity in the ΔslyD strain
can be fully restored whereas only partial recovery is detected for ΔhypB (8, 33, 34). The ideal
location of the nickel site (N-terminally located Ni(II) site that is readily accessible for metal
exchange) coupled to the fact that HypB can bind nickel with high affinity (1.2 x 10-13
M, (10))
would enable this protein to compete for nickel and act as a Ni-chaperone that funnels sufficient
metal ions for the hydrogenase enzyme biogenesis. However, if metal transfer from HypB to the
precursor enzyme was to rely on diffusion, the extremely high affinity of HypB would translate
to a very slow metal release rate from HypB (~19 h, assuming a kon only limited by diffusion),
which is likely irrelevant considering the short life cycle (i.e. minutes) of E. coli. Therefore, it is
not surprising that an additional protein factor such as SlyD is necessary to make this nickel
available for hydrogenase biosynthesis on a physiologically relevant time-frame. The results
presented here and by Leach et al. (8) reveal that the interaction of SlyD with HypB leads to a
dramatic increase in the rate of nickel release from the N-terminal metal site. A survey of SlyD
variants indicates that while the Cys residues on SlyD are not necessary for the modulation of
metal-binding activity of HypB, a successful heterodimer formation as well as the metal-binding
domain of SlyD are an absolute must for activation of metal release as has been reported
previously (8). Investigation of different chelators also revealed that the metal release process
can be enhanced by addition of acceptors with thiol moieties. This implies that Ni(II) release
from HypB can be further catalyzed upon docking of HypB onto the precursor enzyme, which
would place the Ni(II) ion in close proximity to the enzyme active site consisting of Cys
residues. Use of thiol exchange reactions is a common feature among the copper
metallochaperones such as Atox1 and Ccs2 (35), whether these types of reactions are also used
by HypB for metal transfer is an issue that remains to be verified in the future.
The requirement for an NTPase during the assembly of enzyme metallocentres appears to be an
emerging theme (6). This concept is exemplified by HypB, which contains a C-terminal GTPase
domain (i.e. G-domain) that is conserved among the HypB homologues (6). GTP binding and
128
hydrolysis are mandatory for assembly of the enzyme active-site because mutations that
abrogates GTPase activity in vitro abolishes enzyme activity in vivo (28). Although it is known
that this enzymatic function of HypB is essential, research to date has not clearly established as
to how energy derived from the hydrolysis step is utilized during the assembly of the [NiFe]-
centre of the enzyme. However, answers to this key issue can be obtained from the results
presented in this report.
First, the SlyD-mediated decrease in affinity of the N-terminal nickel site is enhanced when
HypB is bound to GDP, but GDP alone does not modulate the high-affinity site, suggesting that a
more favourable interaction is achieved between SlyD and GDP-bound HypB. Currently the
only other known GDP-specific effect on E. coli HypB is that the presence of nucleotide
enhances dimerization of HypB (30). However, it is unlikely that the observed change is a result
of this altered oligomeric state of HypB as we would expect to observe a similar enhancement
for GTP as well, since dimerization is not dependent on the identity of the nucleotide (30). A
similar enhancement in an interaction upon nucleotide binding has been observed between the
GTPase chaperone MeaB and the B12-dependent isomerase, methylmalonyl-CoA mutase
(MCM). The affinity of the protein complex of the cobalt-dependent MCM and MeaB was
found to increase by ~15 fold when MeaB is bound to a GTP when compared to the GDP-bound
form of MeaB (32). Evidence for nucleotide-dependent protein-protein interactions is also
observed during assembly of the urease active site, where mutations that decrease nucleotide
binding to the GTPase UreG prevents docking of the accessory protein complex UreGDF onto
the precursor urease enzyme (36). The results presented here also suggest that while the N-
terminal nickel-site does not contribute to enzymatic activity of the protein, GTP hydrolysis can
affect the metal-transfer from the N-terminal site of HypB. However, this link is only achieved
when SlyD is present because nucleotide-dependent increase in metal release is not observed for
HypB alone. This gating mechanism by SlyD is likely a useful mechanism in vivo, which would
ensure that HypB does not release the Ni(II) routed for the [NiFe]-hydrogenase enzyme
prematurely. Furthermore, these observations supports a model where GTP hydrolysis precedes
the Ni(II) insertion step to the precursor enzyme as GDP enhances the metal-release from HypB-
SlyD complex.
Second, in addition to modulating the high-affinity metal-binding site on HypB, SlyD is able to
moderately enhance the GTPase activity of HypB. Although the effect is minor this is the first
129
protein factor discovered so far that can positively contribute to the enzymatic activity of HypB.
This enhancement of the low intrinsic hydrolysis rate upon binding to a partner protein gives us
insight into how protein-protein interactions can accelerate biological processes and is not
uncommon among NTPases. For example, HydF (the GTPase involved in metal insertion into
the[FeFe]-hydrogenase) enzymatic activity increases by 50% in the presence of the other
accessory protein HydE or HydG (31). The aforementioned MeaB provides another example, as
its GTP hydrolysis rate increases ~100 fold in the presence of the MCM enzyme (32). It is
noteworthy that while many of these partner proteins significantly affect the hydrolysis rates, the
effect of SlyD is very minor. This indicates that SlyD alone is not sufficient to fulfill the role of
the GTP-activating protein (GAP) and additional factors such as HypA or even the precursor
enzyme may be required to enhance the GTPase activity of HypB.
Third, the G-domain metal site of HypB is demetallated in the presence of SlyD. As reported
here and by Cai, et al. (30), metal binding to this G-domain site is linked to the GTPase activity
and binding of either Zn(II) or Ni(II) inhibits GTPase turnover (30). The G-domain metal site
and/or the link it provides to GTP hydrolysis is essential for hydrogenase maturation because
mutating any of the residues that coordinate the metal ion abolishes in vivo hydrogenase activity
(9). This metal-induced inhibition is circumvented by the presence of SlyD because SlyD
competitively binds these metal ions with a much higher affinity than HypB. This metal removal
by SlyD leading to recovery of the GTPase activity of HypB is further supported by the fact that
SlyD1-146, which cannot bind metal with an appreciable affinity (19), is unable to reverse this
metal-dependent inhibition. By combining the in vitro data presented here and our current
knowledge of HypB, the in vivo significance of this G-domain metal site can now be inferred. It
is likely that this metal site functions as a regulatory switch for the GTPase function of HypB,
such that metal loading to the G-domain site will prevent the protein from needlessly
hydrolyzing GTP until a successful Ni(II)-insertion complex is formed with the other partner
proteins. Successful protein-protein complex formation and subsequent metal extraction by
SlyD then allows HypB to begin GTP hydrolysis, which results in successful metal transfer to
the precursor enzyme.
In summary, the results presented here provide evidence that the role of SlyD in hydrogenase
maturation goes beyond that of a reservoir of nickel ions needed during hydrogenase
biosynthesis under nickel-limiting conditions. Although SlyD is not absolutely essential for the
130
Ni(II) insertion process, as are HypA or HypB, the results support a model as to how E. coli
utilize this protein to optimize the biogenesis of the [NiFe]-hydrogenase (Figure 4-12).
Additionally we report a link between GTP hydrolysis and the Ni(II)-transfer step from HypB
that is only established in the presence of SlyD. These discoveries give us insight as to how the
protein-protein interactions as well as the GTPase function of HypB can be exploited to ensure
the timely delivery of the metal ion. Furthermore, these protein-protein mediated effects
highlight the importance of the coordinated actions of multiple protein factors to overcome the
thermodynamic and kinetic barriers of inserting the nickel into the partially assembled
hydrogenase. It is likely that this process is more complicated than presented here, as the effect
of HypA was not assessed in these experiments, although this protein is known to be necessary
for enzyme maturation (19). Nevertheless, the results presented here serves as a starting point to
elucidate the exact mechanism of nickel insertion and the interplay of the metal-binding and
enzymatic activities of the proteins in the nickel insertion complex HypA-HypB-SlyD.
131
Scheme 4-12. Proposed model for Ni(II) insertion to the hydrogenase precursor under limited (a)
and abundant (b) exogenous nickel availability. The initial two steps involve metal transfer within the
HypB-SlyD complex. Under nickel-limiting conditions, Ni(II) stored on SlyD is transferred to apo HypB
(1a → 2a). Under abundant nickel conditions HypB is metallated at the high-affinity site as well as the
G-domain site and SlyD competitively removes Ni(II) from the G-domain, readying HypB for GTP
hydrolysis (1b → 2b). The HypB/SlyD complex associates with HypA, which anchors this Ni(II)-
insertion complex to the large subunit of the precursor enzyme (denoted as H2ase). The third step involves
GTP hydrolysis by HypB and the catalytic rate is now enhanced (denoted by change in colour of HypB)
due to the formation of the multi-protein complex including SlyD and the absence of metal coordinated at
the G-domain site. Upon GTP hydrolysis, the GDP-bound HypB in association with SlyD and/or HypA
enables facile transfer of the Ni(II) from the N-terminal site of HypB. Following dissociation of the
nickel insertion complex, the final step involves recognition of the Ni(II)-bound hydrogenase enzyme by
the HycI protease, which leads to C-terminal cleavage and subsequent folding into a mature enzyme.
HypA
HypB
GDP
SlyD
Ni2+ Ni2+
Ni2+ Ni2+ +
SlyD
Ni2+ Ni2+
Ni2+ Ni2+
HypB
GTP
HypA
(1a)
H2ase
HypA
SlyD
Ni2+
Ni2+ Ni2+
HypB
GTP
Ni2+
Fe2+
HypB
GTP
SlyD
Ni2+ Ni2+
+
SlyD
Ni2+ Ni2+
HypB
GTP
Ni2+
Ni2+
HypB
GTP
Ni2+
Ni2+
HypA
GTP
GDP + Pi
H2ase
Fe2+
HypA
SlyD
Ni2+
Ni2+ Ni2+HypB
Ni2+
GDP
(4)
Ni2+
(2a)
(3)
SlyD
Ni2+
Ni2+ Ni2+
Ni2+
H2ase
Ni2+
HycI
(5)
Ni(II) limited conditions Abundant Ni(II)
(1b)
(2b)
132
References
1. Waldron, K. J., and Robinson, N. J. (2009) How do bacterial cells ensure that
metalloproteins get the correct metal?, Nat. Rev. Microbiol. 7, 25-35.
2. Kuchar, J., and Hausinger, R. P. (2004) Biosynthesis of metal sites, Chem. Rev. 104, 509-
525.
3. Waldron, K. J., Rutherford, J. C., Ford, D., and Robinson, N. J. (2009) Metalloproteins
and metal sensing, Nature 460, 823-830.
4. Forzi, L., and Sawers, R. G. (2007) Maturation of [NiFe]-hydrogenases in Escherichia
coli, Biometals 20, 565-578.
5. Ragsdale, S. W. (2009) Nickel-based Enzyme Systems, J. Biol. Chem. 284, 18571-18575.
6. Kaluarachchi, H., Chan Chung, K. C., and Zamble, D. B. (2010) Microbial nickel
proteins, Nat. Prod. Rep. 27, 681-694.
7. Roof, W. D., Fang, H. Q., Young, K. D., Sun, J., and Young, R. (1997) Mutational
analysis of slyD, an Escherichia coli gene encoding a protein of the FKBP immunophilin
family, Mol. Microbiol. 25, 1031-1046.
8. Leach, M. R., Zhang, J. W., and Zamble, D. B. (2007) The role of complex formation
between the Escherichia coli hydrogenase accessory factors HypB and SlyD, J. Biol.
Chem. 282, 16177-16186.
9. Dias, A. V., Mulvihill, C. M., Leach, M. R., Pickering, I. J., George, G. N., and Zamble,
D. B. (2008) Structural and biological analysis of the metal sites of Escherichia coli
hydrogenase accessory protein HypB, Biochemistry 47, 11981-11991.
10. Leach, M. R., Sandal, S., Sun, H., and Zamble, D. B. (2005) Metal binding activity of the
Escherichia coli hydrogenase maturation factor HypB, Biochemistry 44, 12229-12238.
11. Li, Y., and Zamble, D. B. (2009) Nickel homeostasis and nickel regulation: an overview,
Chem. Rev. 109, 4617-4643.
12. Olson, J. W., and Maier, R. J. (2000) Dual roles of Bradyrhizobium japonicum nickelin
protein in nickel storage and GTP-dependent Ni mobilization, J. Bacteriol. 182, 1702-
1705.
13. Maier, T., Lottspeich, F., and Bock, A. (1995) GTP hydrolysis by HypB is essential for
nickel insertion into hydrogenases of Escherichia coli, Eur. J. Biochem. 230, 133-138.
14. Mehta, N., Benoit, S., and Maier, R. J. (2003) Roles of conserved nucleotide-binding
domains in accessory proteins, HypB and UreG, in the maturation of nickel-enzymes
required for efficient Helicobacter pylori colonization, Microb. Pathogen. 35, 229-234.
15. Olson, J. W., Fu, C., and Maier, R. J. (1997) The HypB protein from Bradyrhizobium
japonicum can store nickel and is required for the nickel-dependent transcriptional
regulation of hydrogenase, Mol. Microbiol. 24, 119-128.
16. Scholz, C., Eckert, B., Hagn, F., Schaarschmidt, P., Balbach, J., and Schmid, F. X. (2006)
SlyD proteins from different species exhibit high prolyl isomerase and chaperone
activities, Biochemistry 45, 20-33.
17. Hottenrott, S., Schumann, T., Pluckthun, A., Fischer, G., and Rahfeld, J. U. (1997) The
Escherichia coli SlyD is a metal ion-regulated peptidyl-prolyl cis/trans-isomerase, J. Biol.
Chem. 272, 15697-15701.
18. Hottenrott, S., Schumann, T., Pluckthun, A., Fischer, G., and Rahfeld, J. U. (1997) The
Escherichia coli SlyD is a metal ion-regulated peptidyl-prolyl cis/trans-isomerase, J. Biol.
Chem. 272, 15697-15701.
133
19. Kaluarachchi, H., Sutherland, D. E., Young, A., Pickering, I. J., Stillman, M. J., and
Zamble, D. B. (2009) The Ni(II)-binding properties of the metallochaperone SlyD, J. Am.
Chem. Soc. 131, 18489-18500.
20. Zhang, J. W., Butland, G., Greenblatt, J. F., Emili, A., and Zamble, D. B. (2005) A role
for SlyD in the Escherichia coli hydrogenase biosynthetic pathway, J. Biol. Chem. 280,
4360-4366.
21. Ballantine, S. P., and Boxer, D. H. (1985) Nickel-Containing Hydrogenase Isoenzymes
from Anaerobically Grown Escherichia-Coli K-12, J. Bacteriol. 163, 454-459.
22. Benanti, E. L., and Chivers, P. T. (2009) An intact urease assembly pathway is required
to compete with NikR for nickel ions in Helicobacter pylori, J. Bacteriol. 191, 2405-
2408.
23. Seshadri, S., Benoit, S. L., and Maier, R. J. (2007) Roles of His-rich hpn and hpn-like
proteins in Helicobacter pylori nickel physiology, J. Bacteriol. 189, 4120-4126.
24. Maier, T., Jacobi, A., Sauter, M., and Bock, A. (1993) The product of the hypB gene,
which is required for nickel incorporation into hydrogenases, is a novel guanine
nucleotide-binding protein, J. Bacteriol. 175, 630-635.
25. Boys, B. L., Kuprowski, M. C., Noel, J. J., and Konermann, L. (2009) Protein oxidative
modifications during electrospray ionization: solution phase electrochemistry or corona
discharge-induced radical attack?, Anal. Chem. 81, 4027-4034.
26. Takamoto, K., and Chance, M. R. (2006) Radiolytic protein footprinting with mass
spectrometry to probe the structure of macromolecular complexes, Annu. Rev. Biophys.
Biomol. Struct. 35, 251-276.
27. Martell, A. E., and Smith, R. M. (2003) NIST Standard Reference Database 46, version
8.0, National Institue of Standards and Technology, Rockville, MD.
28. Maier, T., Lottspeich, F., and Bock, A. (1995) GTP hydrolysis by HypB is essential for
nickel insertion into hydrogenases of Escherichia coli, FEBS J. 230, 133-138.
29. Caldon, C. E., Yoong, P., and March, P. E. (2001) Evolution of a molecular switch:
universal bacterial GTPases regulate ribosome function, Mol. Microbiol. 41, 289-297.
30. Cai, F., Ngu, T. T., Kaluarachchi, H., and Zamble, D. B. Relationship between the
GTPase, metal-binding, and dimerization activities of E. coli HypB, J. Biol. Inorg. Chem.
In Press.
31. Broderick, J. B., Shepard, E. M., McGlynn, S. E., Bueling, A. L., Grady-Smith, C. S.,
George, S. J., Winslow, M. A., Cramer, S. P., and Peters, J. W. (2010) Synthesis of the
2Fe subcluster of the [FeFe]-hydrogenase H cluster on the HydF scaffold, Proc. Nat.
Acad. Sci. U.S.A. 107, 10448-10453.
32. Padovani, D., Labunska, T., and Banerjee, R. (2006) Energetics of interaction between
the G-protein chaperone, MeaB, and B-12-dependent methylmalonyl-CoA mutase, J.
Biol. Chem. 281, 17838-17844.
33. Maier, T., Jacobi, A., Sauter, M., and Bock, A. (1993) The Product of the Hypb Gene,
Which Is Required for Nickel Incorporation into Hydrogenases, Is a Novel Guanine
Nucleotide-Binding Protein, J. Bacteriol. 175, 630-635.
34. Olson, J. W., Mehta, N. S., and Maier, R. J. (2001) Requirement of nickel metabolism
proteins HypA and HypB for full activity of both hydrogenase and urease in Helicobacter
pylori, Mol. Microbiol. 40, 270-270.
35. Robinson, N. J., and Winge, D. R. Copper metallochaperones, Annu. Rev. Biochem. 79,
537-562.
36. Moncrief, M. B., and Hausinger, R. P. (1997) Characterization of UreG, identification of
a UreD-UreF-UreG complex, and evidence suggesting that a nucleotide-binding site in
134
UreG is required for in vivo metallocenter assembly of Klebsiella aerogenes urease, J.
Bacteriol. 179, 4081-4086.
135
Chapter 5 Summary and Perspective
Enzymes that use nickel are considered to be relics from an era pre-dating the generation of
dioxygen by photosynthesis into the atmosphere, a time when nickel was more plentiful (1).
Nevertheless nickel still serves as an essential catalytic cofactor in many enzymes found in
eubacteria, archaebacteria, algaea, fungi and plants today (2). Currently there are eight known
nickel enzymes that catalyze a plethora of reactions resulting in the use and/or production of
gases such as carbon monoxide, methane, hydrogen and oxygen (3). In addition to the enzymes
that employ nickel, organisms with a requirement for nickel also express a variety of proteins
that contribute to the transport, distribution, regulation as well as assembly of the nickel active
sites. These proteins ensure that proper balance of metal is maintained, as excess nickel, like
many other transition metals can be detrimental to an organism. Although these proteins
involved in nickel homeostasis are essential to the survival of an organism, not much is known
about the mechanisms of action of these individual components, how they interrelate within the
pathways, or how metal selectivity is achieved. This dissertation focuses on understanding the
molecular details of one such component in E. coli nickel homeostasis, SlyD and provides some
insight into the rules and requirements that govern intracellular transition metal homeostasis at a
molecular level.
5.1 Ni(II)-binding properties of SlyD
The biosynthesis of the intricate metallocentre in [NiFe]-hydrogenase requires the coordinated
action of several accessory proteins that in E. coli are encoded by hypA-F (2). SlyD was recently
identified as an additional accessory protein involved in this maturation pathway, specifically
contributing to the nickel delivery step to the enzyme (4). SlyD posses a very unique C-terminal
sequence that is rich in both the number and types of metal-binding ligands. A vital role for this
metal-binding domain was shown as deletion of this domain compromises the activity of SlyD in
hydrogenase maturation as well as nickel accumulation in E. coli (5). To understand the
molecular details of this in vivo function, the nickel-binding activity of SlyD was investigated by
using a combination of various spectroscopic methods and mass spectrometry. The study
demonstrated that SlyD binds multiple nickel ions with a capacity for coordinating up to seven
136
nickel ions. The analysis of non-covalent metal-protein complexes via ESI-MS revealed that
SlyD coordinates nickel in a non-cooperative manner with affinity in the nanomolar range. In
addition, the ESI-MS revealed that the protein exists in a mixture of metalloforms that is
dependent on the availability of nickel ions in solution. Structural analysis via CD spectroscopy
suggested that this metallochaperone undergoes small but distinct changes in the structure upon
metal binding and that these nickel-binding sites are predominantly assembled through β-turn
formation. Although the C-terminal metal-binding domain is primarily responsible for metal
chelation, metal binding also perturbs the structure of the N-terminal domains. An investigation
of the nickel sites by X-ray absorption spectroscopy (XAS) showed that SlyD binds nickel ions
by using several different geometries and coordination numbers that range from 4-6 coordinate.
Also, the XAS data suggest that Cys and His residues as well as carboxylate moieties are utilized
by the protein to coordinate the nickel ions. Finally, the characterization of SlyD mutants
demonstrated that the cysteine residues in the C-terminal domain confer tighter affinity as well as
increased binding capacity to SlyD but are not essential for Ni(II) binding. However, in
agreement with the vital role of the metal-binding domain for hydrogenase activity in vivo,
deletion of this region completely abolishes the ability of the protein to coordinate nickel ions.
Therefore, this investigation provided a detailed analysis delineating the molecular basis of
nickel binding by SlyD in vitro and provides support for the proposed nickel-storage role of SlyD
in nickel homeostasis (3).
5.2 Metal specificity of SlyD
Although SlyD can bind nickel and is an important factor in nickel homeostasis in E. coli,
previous investigations demonstrated that this protein can also coordinate several other types of
first row transition metals (6). This observation raised the question of whether SlyD could
preferentially coordinate nickel in the presence of other transition metal ions. In addition,
because SlyD can bind these other metals, it was feasible that the protein contributes to metal
homeostasis pathways other than nickel. In order to answer these questions, the in vitro metal-
binding activity of SlyD to several biologically relevant transition metals: Mn(II), Fe(II), Co(II),
Cu(I) and Zn(II) was examined. Using a combination of mass spectrometry and spectroscopic
methods, it was established that while binding to manganese or ferrous ions was not detected the
protein could coordinate multiple Co(II), Zn(II) as well as Cu(I) signifying the promiscuous
137
nature of this protein. SlyD binds Co(II) with an average stoichiometry of 4 and exhibits
nanomolar affinity for this ion (average KD of 4±1 x 10-9
M) whereas it can coordinate up to 5
zinc ions with an average KD of 1.0±0.4 x 10-10
M. Cu(I) complexes of SlyD have the greatest
stability as the protein binds 4 cuprous ions with an average KD of 1.5 ± 0.3 x 10-17
M. Analysis
of the metal-binding mechanism via ESI-MS revealed that similar to nickel, zinc and cobalt bind
to the protein utilizing a non-cooperative mechanism while Cu(I) binding to the protein followed
a partially cooperative metallation pathway. Through competition titrations the ability of SlyD
to preferentially coordinate nickel in the presence of a second metal ion was investigated. These
metal selectivity studies revealed that the protein has the following preference for metal Mn(II),
Fe(II) < Co(II) < Ni(II), Zn(II) << Cu(I), which correlates with the individually measured
thermodynamic affinities of the protein for each metal. This order of preference also matches the
universal order of preferences for divalent metal ions, termed the Irving-Williams series (1).
Therefore, the in vitro data indicate that SlyD is a flexible protein that can accommodate a
variety of divalent metal ions, and this flexible nature leads to imperfect selection for nickel.
To determine whether the in vitro metal-binding activity of these other transition metals
translates into participation of SlyD in other metal homeostasis pathways, several in vivo assays
were conducted. Initial assays tested whether SlyD is necessary to confer metal resistance to
bacteria and the results revealed that the presence of the protein was not necessary for growth of
the bacteria at high metal concentration of cobalt, nickel, copper or zinc. Thus, these
investigations suggested that SlyD does not play the role of a metal detoxifier as originally
anticipated. The second set of in vivo investigations evaluated the transcriptional level of several
metal transporters in E. coli via qRT-PCR. These transporter expression levels are tightly
regulated by metal-sensing transcription factors that gauge the concentration of a particular metal
with extreme selectivity (7). By comparing the transcription profile of the wildtype strain to a
ΔslyD strain, the impact of the slyD deletion in a given metal homeostasis pathway was
determined. The transcripts of the zinc importer znuA and the exporter zntA were monitored to
determine the effects on zinc homeostasis whereas the two major copper exporters, copA and
cusF were used to gauge the impact on copper homeostasis. Under all the conditions tested, the
mRNA levels detected for these four transporters in the ΔslyD strain did not significantly differ
from that of the wildtype strain, indicating that SlyD is not an essential component in
maintaining the balance of either copper or zinc in E. coli. The role of SlyD in nickel
138
homeostasis was analyzed via monitoring the transcript levels of the nickel importer nikA and the
exporter rcnA. The results obtained for these two importers provide several insights into nickel
homeostasis in E. coli. Firstly, deletion of slyD reduced the nickel capacity of the cytoplasm
such that nikA transcription was down regulated in the absence of the protein. Secondly, deletion
of slyD did not impact the exporter expression, indicating that the protein does not contribute to
the nickel exporting pathway. This evidence supports a model in which E. coli maintains two
distinct nickel pools within the cytoplasm, one maintained by the Nik importer and the second
linked to the RcnA exporter (8), and SlyD contributes only to the nickel pool maintained by the
Nik importer. The nickel brought into the cytoplasm through the Nik importer is considered to
be preferentially routed to [NiFe]-hydrogenase maturation through the action of
metallochaperones. Therefore, these findings corroborate the nickel-related function of SlyD in
enzyme maturation, and strengthen the assignment of this protein as a nickel metallochaperone.
Furthermore, this investigation also showed that although SlyD is unable to overcome the large
thermodynamic preference in vitro for Cu(I) and exclude Zn(II) chelation even in the presence of
nickel, it is able to retain it’s Ni(II)-specific activity in vivo. Thus, this investigation serves to
highlight the crucial role of cellular trafficking pathways for maintaining the relative abundance
of a particular metal that enables a protein to selectively bind its cognate metal within the cell.
5.3 Significance of the HypB-SlyD complex in [NiFe]-hydrogenase biosynthesis
Nickel chaperones play a central role in microbial nickel homeostasis by shuttling nickel within
the cytoplasm and protecting the cell against toxicity during this transit. The nickel chaperone
role during the [NiFe]-hydrogenase biosynthesis is fulfilled by the proteins HypA, HypB and
SlyD (9).
The hypothesized nickel storage role of SlyD is based on the fact that the MBD can coordinate a
significant number of nickel ions (10). These stored metal ions are then anticipated to serve as a
source of nickel when bacteria are faced with metal scarce environments. Chapter 4 provides
experimental evidence to validate this hypothesis where the impact of deletion of slyD on the
overall nickel content and the hydrogenase activity under nickel limiting conditions was
investigated. Nickel limiting growth conditions were achieved through addition of the metal
chelator dimethylglyoxime, which significantly reduces the cytoplasmic nickel content in ΔslyD
in comparison to that of the wildtype. When hydrogenase activity was assessed, the inhibitory
139
effect of the chelator appeared more pronounced in the ΔslyD strain, indicating bacteria without
SlyD are highly-dependent on exogenous nickel for [NiFe]-hydrogenase assembly. Thus the
results presented provide physiological evidence for the hypothesis that SlyD acts as a nickel
reservoir in E. coli and this storage capacity is useful for enzyme biosynthesis when nickel is
scarce.
In addition to serving as a nickel storage protein, SlyD is known to associate with HypB in vivo
and this heterodimer formation is necessary for optimal hydrogenase activity (5). However, the
significance of this interaction and how it enhances the biogenesis of hydrogenase are not clearly
understood. Our hypothesis was that SlyD contributes to hydrogenase maturation by mobilizing
the stored nickel to the precursor enzyme via HypB. This hypothesis was validated through
metal-transfer experiments which indicated that SlyD can indeed act as a nickel donor to HypB,
even in a competitive environment. This transfer of nickel ions within a SlyD-HypB protein
complex suggests that in vivo, the critical nickel is supplied to HypB without relying on
diffusion and thus avoiding competition with the abundant metal chelating molecules present in
the cytoplasm.
In addition to acting as a nickel source, HypB-SlyD interaction can also stimulate Ni(II)-release
from the N-terminal high affinity Ni(II) site of HypB. A survey of SlyD variants indicates that
successful heterodimer formation as well as the metal-binding domain of SlyD are required for
this modulation of the metal-binding activity of HypB. The significance of this result can be
considered in the context of the role of HypB in vivo. This protein is considered to be the
primary nickel carrier for assembly of the [NiFe]-hydrogenase metallocentre because deletion of
the hypB gene abolishes hydrogenase function in vivo. In addition, the protein has ideal
properties of a metallochaperone, an N-terminally located nickel site with high-affinity for
competitive nickel-binding and subsequent easy metal transfer that could funnel sufficient metal
ions to hydrogenase biogenesis. However, if nickel-transfer were to rely on diffusion, enzyme
maturation would be an extremely slow process. Therefore, it is not surprising that an additional
factor like SlyD is necessary to decrease the affinity of the Ni(II) site of HypB to ensure that the
metal-transfer process can occur in a physiologically relevant time frame. Chapter 4 also reports
several other consequences of the HypB-SlyD interaction. Firstly, addition of chelators with
thiol moieties leads to an increase in metal-release rates from HypB. This suggests that the
nickel transfer from HypB to the precursor enzyme is favoured because the first coordination
140
sphere of the hydrogenase is exclusively composed of thiolates. Secondly, the metal-release
process can be further accelerated when HypB is bound to GDP and the effect of GDP is only
observed in the presence of SlyD. Therefore, these results indicate that GDP-bound
conformation of HypB is necessary to achieve faster metal-transfer, which implies that GTP
hydrolysis likely precedes the nickel insertion step during biosynthesis. Furthermore, SlyD is
necessary to achieve the acceleration of nickel release from GDP-bound HypB suggesting that
protein complex formation provides a link between the transfer of the metal from HypB and the
GTPase activity of the protein.
In addition to modulating the N-terminal Ni(II) site, the affect of SlyD with respect to the
GTPase activity of HypB was also investigated. Interaction with SlyD leads to a ~3 fold increase
in the GTPase activity of HypB, but the effect is more pronounced when HypB contains a metal
at the G-domain metal site. Metal binding to the G-domain can regulate the GTPase activity of
the protein as nickel or zinc binding to this site has an inhibitory effect (11). This inhibitory
effect is circumvented in the presence of SlyD as the protein competitively removes the metal ion
from the G-domain of HypB. Based on the data gathered, we can only speculate about the role
of this G-domain metal site in vivo. It is likely that metal binding to the G-domain is used as a
regulatory component to ensure that GTPase activity is not turned on prematurely, but upon
complex formation, SlyD extracts the metal from the G-domain allowing HypB to enter the
hydrolysis cycle. By combining all the data obtained in this study, a role for SlyD and the SlyD-
HypB interaction in the hydrogenase metallocentre assembly can be derived and is presented in
chapter 4. Although our investigation only involved two of the known partner proteins in the
nickel-insertion step, the insights gained from this study will serve as a framework for building
the molecular and mechanistic details of the nickel insertion step during the hydrogenase
assembly. Furthermore, these protein-protein mediated effects that we discovered, highlight the
importance of the coordinated actions of multiple protein factors in overcoming the
thermodynamic and kinetic barriers to insertion of the nickel ion into the partially assembled
hydrogenase.
5.4 Significance
The utilization of H2(g) for energy is considered to be a crucial feature of very early life on Earth
evident by the presence of hydrogenases in bacteria, archaea, and some eukaryotes (12).
141
Convergent evolution has led to three distinct classes of hydrogenases annotated based on the
combination of metal(s) at the active sites, the [NiFe]-hydrogenase, [FeFe]-hydrogenases and
[Fe]-hydrogenases. These enzymes are able to catalyze the interconversion of molecular H2 and
protons. Consequently they are used to vent excess reducing potential in some anaerobic
microorganisms, while others species use the enzyme to generate a proton motive force that is
necessary for biological functions (13). While hydrogenases have garnered much interest from a
bioinorganic perspective due to the presence of metal-centres decorated with uncommon ligands
such as carbon monoxide and cyanide, interest in hydrogen metabolism and hydrogenases has
grown exponentially over the past decade as these enzymes may have a use in a variety of
biotechnological applications (14).
One of the foremost applications is generation of H2, which is considered to be a sustainable,
cleaner source of energy than fossil fuels. Biological hydrogen production through
microorganism such as algaea and cyanobacteria are at the forefront of this energy production
methods, because H2 production can be coupled to natural sun-light via photosynthesis (15, 16).
Hydrogen evolution can also be achieved through dark fermentation method using bacteria such
as Clostridium sp. that couples the break down of carbohydrate-rich substrates to hydrogen
production. As carbohydrate-rich substrates are naturally found in waste such as food waste or
sewage, this application simultaneously addresses two crucial issues, a supply of energy and
environmental protection (15). Other applications of hydrogenase include the use of enzyme for
bioremediation of toxic heavy metals. Pd(II), Pt(IV) and Ru(III) found in industrial waste can be
converted to the more insoluble metallic forms through reduction using hydrogenases (17).
Hydrogenases are also becoming important from a medical stand point, as these enzymes are
now considered a virulence factor of pathogenic enteric bacteria such as E. coli, Salmonella and
Helicobacter species. These bacteria use the hydrogen produced by the colonic flora within the
animal host as a source of energy, thus proliferating in the anoxic environments within the host
(18). Also, E. coli uses hydrogenases as one of the means to resist the harshly acidic conditions
of the stomach (19). Helicobacter pylori, a lead cause of gastritis and peptic ulcers, requires
[NiFe]-hydrogenases as well as a second nickel-containing enzyme, urease, to successfully
colonize the mucosal surfaces of the human stomach (20). As a human nutritional requirement
for nickel has not been found yet (2), these nickel-dependent enzymes as well as nickel-binding
142
proteins provide an orthogonal pathway that can be targeted by antibiotics without any negative
effects on the host (20, 21).
It is evident that nickel ions as well as nickel-containing enzymes play important roles in all life.
Nature has not only perfected the chemistries performed by these enzymes through the course of
billions of years but has also engineered elaborate systems to ensure the efficient biogenesis of
these enzymes. An in-depth understanding of how this biosynthesis is naturally achieved and
how each protein is optimized to perform their tasks is a pre-requisite for effectively
manipulating hydrogenases or the nickel homeostasis pathway for applications in the future.
This understanding can only come from an investigation of the proteins as well as the interplay
between these proteins involved in these processes.
5.5 Future directions
The research presented in this thesis gives us insight to the molecular details about how the
recently-discovered nickel chaperone protein SlyD binds metal and contributes to nickel
homeostasis in E. coli. The investigations reported here, combined with the pre-existing
knowledge of HypA and HypB, now completes our knowledge about the molecular structure and
metal-binding properties of all three individual accessory protein required for [NiFe]-
hydrogenase biosynthesis. The next step would be to investigate the mechanistic details of metal
transfer and how these shuttling proteins influence or are influenced by each other to attain
successful biogenesis of the hydrogenase enzyme. The HypB-SlyD interaction study
demonstrates the need for having such an integrated system to get an adequate understanding of
exactly how the nickel insertion process is achieved through the concerted action of the
accessory proteins. In addition to SlyD, HypB is known to interact with HypA and a HypA-
HypB-SlyD complex can also be isolated in vivo (9, 22). The consequences of this multi-protein
complex on the metal-binding properties of the proteins and the enzymatic activity of HypB are
essential to understanding why such a protein complex is necessary and how the three proteins
deliver the nickel ion to the metallocentre assembly in vivo. Using this bottom-up approach,
eventually all of the components necessary for assembly of an active [NiFe]-hydrogenase system
in a cell-free system maybe possible, as has been achieved for the nickel-dependent enzyme
urease and the [FeFe]-hydrogenases (23, 24). Although we know that nickel is mobilized via this
protein complex, it is not clearly established where this protein complex specifically acquires
143
nickel. It has been suggested that these proteins gain access to nickel via direct interaction with
the nickel specific importer NikABCDE transporter and thus provide a dedicated source of nickel
for enzyme maturation (25). Which proteins are responsible for this interaction and how the
metal transfer occurs between the transporter and the metallochaperones are questions that
remain to be answered through future investigations.
144
References
1. Waldron, K. J., Rutherford, J. C., Ford, D., and Robinson, N. J. (2009) Metalloproteins
and metal sensing, Nature 460, 823-830.
2. Li, Y., and Zamble, D. B. (2009) Nickel homeostasis and nickel regulation: an overview,
Chem. Rev. 109, 4617-4643.
3. Ragsdale, S. W. (2009) Nickel-based Enzyme Systems, J. Biol. Chem. 284, 18571-18575.
4. Zhang, J. W., Butland, G., Greenblatt, J. F., Emili, A., and Zamble, D. B. (2005) A role
for SlyD in the Escherichia coli hydrogenase biosynthetic pathway, J. Biol. Chem. 280,
4360-4366.
5. Leach, M. R., Zhang, J. W., and Zamble, D. B. (2007) The role of complex formation
between the Escherichia coli hydrogenase accessory factors HypB and SlyD, J. Biol.
Chem. 282, 16177-16186.
6. Wulfing, C., Lombardero, J., and Pluckthun, A. (1994) An Escherichia coli protein
consisting of a domain homologous to FK506-binding proteins (FKBP) and a new metal
binding motif, J. Biol. Chem. 269, 2895-2901.
7. Giedroc, D. P., and Arunkumar, A. I. (2007) Metal sensor proteins: nature's
metalloregulated allosteric switches, Dalton Trans. 3107-3120.
8. Rowe, J. L., Starnes, G. L., and Chivers, P. T. (2005) Complex transcriptional control
links NikABCDE-dependent nickel transport with hydrogenase expression in Escherichia
coli, J. Bacteriol. 187, 6317-6323.
9. Kaluarachchi, H., Chan Chung, K. C., and Zamble, D. B. (2010) Microbial nickel
proteins, Nat. Prod. Rep. 27, 681-694.
10. Kaluarachchi, H., Sutherland, D. E. K., Young, A., Pickering, I. J., Stillman, M. J., and
Zamble, D. B. (2009) The Ni(II)-binding properties of the metallochaperone SlyD, J. Am.
Chem. Soc. 131, 18489-18500.
11. Cai, F., Ngu, T. T., Kaluarachchi, H., and Zamble, D. B. (2011) Relationship between the
GTPase, metal-binding, and dimerization activities of E. coli HypB, J. Biol. Inorg. Chem.
In Press.
12. Vincent, K. A., Parkin, A., and Armstrong, F. A. (2007) Investigating and exploiting the
electrocatalytic properties of hydrogenases, Chem. Rev. 107, 4366-4413.
13. Mulrooney, S. B., and Hausinger, R. P. (2003) Nickel uptake and utilization by
microorganisms, FEMS Microbiol. Rev. 27, 239-261.
14. McGlynn, S. E., Mulder, D. W., Shepard, E. M., Broderick, J. B., and Peters, J. W.
(2009) Hydrogenase cluster biosynthesis: organometallic chemistry nature's way, Dalton
Trans. 4274-4285.
15. Kim, D. H., and Kim, M. S. (2011) Hydrogenases for biological hydrogen production,
Bioresour. Technol. In press.
16. Mertens, R., and Liese, A. (2004) Biotechnological applications of hydrogenases, Curr.
Opin. Biotechnol. 15, 343-348.
17. Vignais, P. M., and Billoud, B. (2007) Occurrence, classification, and biological function
of hydrogenases: an overview, Chem. Rev. 107, 4206-4272.
18. Maier, R. J., Olczak, A., Maier, S., Soni, S., and Gunn, J. (2004) Respiratory hydrogen
use by Salmonella enterica serovar Typhimurium is essential for virulence, Infect.
Immun. 72, 6294-6299.
19. Noguchi, K., Riggins, D. P., Eldahan, K. C., Kitko, R. D., and Slonczewski, J. L.
Hydrogenase-3 contributes to anaerobic acid resistance of Escherichia coli, Plos One 5,
e10132.
145
20. Maier, R. J. (2003) Availability and use of molecular hydrogen as an energy substrate for
Helicobacter species, Microbes and Infection 5, 1159-1163.
21. Maier, R. J. (2005) Use of molecular hydrogen as an energy substrate by human
pathogenic bacteria, Biochem. Soc. Trans. 33, 83-85.
22. Chung, K. C. C., and Zamble, D. B. (2011) The Escherichia coli metal-binding
chaperone SlyD interacts with the large subunit of [NiFe]-hydrogenase 3, FEBS Lett. 585,
291-294.
23. Carter, E. L., Flugga, N., Boer, J. L., Mulrooney, S. B., and Hausinger, R. P. (2009)
Interplay of metal ions and urease, Metallomics 1, 207-221.
24. Kuchenreuther, J. M., George, S. J., Grady-Smith, C. S., Cramer, S. P., and Swartz, J. R.
(2011) Cell-free H-cluster Synthesis and [FeFe] Hydrogenase Activation: All Five CO
and CN- Ligands Derive from Tyrosine, Plos One 6, e20346.
25. Rowe, J. L., Starnes, G. L., and Chivers, P. T. (2005) Complex transcriptional control
links NikABCDE-dependent nickel transport with hydrogenase expression in Escherichia
coli, J. Bacteriol. 187, 6317-6323.