Sri Lankan cassava mosaic virus replication associated protein (Rep) triggers transposition of IS 426 in Agrobacterium

Acc

epte

d A

rtic

le

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/1574-6968.12584

This article is protected by copyright. All rights reserved.

Received Date : 10-Jun-2014

Revised Date : 10-Aug-2014

Accepted Date : 15-Aug-2014

Article type : Research Letter

Editor : Holger Deising

Sri Lankan cassava mosaic virus (SLCMV) replication associated protein (Rep) triggers

transposition of IS426 in Agrobacterium

Thulasi Raveendrannair Resmi, Sivarajan Nivedhitha, Chockalingam Karthikeyan,

Karuppannan Veluthambi

Department of Plant Biotechnology, School of Biotechnology, Madurai Kamaraj University,

Madurai, Tamil Nadu, India

Correspondence: Karuppannan Veluthambi, School of Biotechnology, Madurai Kamaraj

University, Madurai-625021, India

Tel: +91-452-2458683

Fax: +91-452-2459105

E mail: [email protected]

[email protected]

[email protected]

[email protected]

Abstract

We report a high rate of IS426 transposition in Agrobacterium tumefaciens in the presence

of the Sri Lankan cassava mosaic virus (SLCMV) replication associated protein gene (Rep).

Acc

epte

d A

rtic

le


Upon conjugal transfer of the binary plasmid pCam-SLCMV-Rep with the SLCMV Rep gene in

the sense orientation under the transcriptional control of the Cauliflower mosaic virus

(CaMV) 35S promoter into the A. tumefaciens vir helper strain EHA105, the binary plasmid

size increased in all 15 transconjugants studied. Southern blot analysis of the

transconjugants with the binary plasmid probe revealed that the 35S promoter and its

proximal sequences in the T-DNA were rearranged. The rearranged sequences harboured

the 1.3-kb IS426 element of A. tumefaciens. Conjugal mobilization of the binary plasmid

pCam-SLCMV-asRep, with the SLCMV Rep gene in antisense orientation, did not cause DNA

rearrangement in EHA105. A mutated SLCMV Rep, in which a frame shift mutation caused

retention of only 27 of the 351 amino acids, did not cause IS426 transposition in A.

tumefaciens. These findings show that the multifunctional begomoviral Rep protein of

SLCMV triggers transposition of IS426 in Agrobacterium.

Key words: Insertion sequences; EHA105; Geminivirus Rep; Transposition; T-DNA

rearrangement

Introduction

Insertion elements (Insertion sequences, IS) are small, genetically compact segments of DNA

which are capable of inserting at numerous sites in target DNA molecules by virtue of their

recombinationally active sequences and the enzyme transposase (Mahillon & Chandler,

1998). The mode of insertion is conservative or replicative (Berg, 1983) and very often is

associated with target site duplication (Calos et al., 1978; Bender & Kleckner, 1992). IS

elements are classified into 20 families based on their arrangement of open reading frames,

similarities in transposases, identities of the terminal inverted repeats and target site

duplication (Siguier et al., 2006). Host factors like integration host factor (IHF), DnaA and

dam DNA methylase modulate transposition activity (Mahillon & Chandler, 1998). IS

elements play an important role in the evolution of many bacteria and are conspicuous

features of Rhizobium and Agrobacterium genomes. The contribution of IS elements to the

evolution of octopine and cucumopine Ti plasmids of Agrobacterium is well documented

(Otten et al., 1992).

The genome of the A. tumefaciens strain C58 carries 25 IS elements (Wood et al.,

2001). IS66, ISNCY, IS3 and IS5 are the IS families commonly found in A. tumefaciens

Acc

epte

d A

rtic

le


(Mahillon & Chandler, 1998). IS867 is present in most octopine/cucumopine isolates of

Agrobacterium. The chromosomal and Ti plasmid distribution of IS867 and IS866 indicates

their spread by replicative transposition (Bonnard et al., 1989; Paulus et al., 1989). IS1312

and IS1313, members of the most widely distributed IS3 family, are present in the Ti plasmid

pTiBo542 of the A. tumefaciens strain A281 (Deng et al., 1995). IS426, previously designated

as IS136, was isolated and sequenced from a nopaline type Ti plasmid pTiT37. IS426 is

1313-bp long and has 32/30 bp inverted repeats with six mismatches (Vanderleyden et al.,

1986).

Geminiviruses are single-stranded DNA viruses which replicate in the nuclei of

infected plant cells through double-stranded DNA replicative forms by deploying rolling

circle replication (Gutierrez, 1999; Hanley-Bowdoin et al., 2013). All geminiviruses encode a

highly conserved replication associated protein (Rep/AC1/AL1/C1/L1) which is essential for

the initiation of viral replication (Elmer et al., 1988). Rep is a multifunctional protein which

recognises the replication origin by binding to a specific iterated sequence in the intergenic

region of the viral genome (Fontes et al., 1992). It cleaves and ligates the geminivirus DNA

within a conserved nonanucleotide sequence in the plus strand and also acts as a DNA

helicase (Laufs et al., 1995; Clerot et al., 2006; Singh et al., 2008). Rep oligomerisation is

required for DNA binding (Orozco et al., 2000). Its interaction with the viral replication

enhancer protein (REn) results in enhanced viral DNA accumulation (Settlage et al., 1996).

Rep controls viral DNA replication by its interaction with the coat protein (Malik et al.,

2005). During the course of infection, Rep interacts with host factors like PCNA, RBR, GRIK

and SCE1 to create a permissive environment for viral replication (Kong et al., 2000; Castillo

et al., 2003; Shen et al., 2006; Sanchez-Duran et al., 2011; Hanley-Bowdoin et al., 2013).

Triparental mating (Ditta et al., 1980) is a routine method used to transfer a binary

plasmid from E. coli into A. tumefaciens. The binary plasmid is expected to remain intact

when it is transferred into A. tumefaciens. Integrity of the T-DNA in the binary plasmid is

important to ensure that the correct T-DNA sequence is transferred into the plant genome.

When we did triparental mating of the binary plasmid pCam-SLCMV-Rep in A. tumefaciens

EHA105, we found that the size of the binary plasmid increased in the A. tumefaciens

Acc

epte

d A

rtic

le


transconjugants. This observation prompted us to study the factor(s) which contributed to

the change in the binary plasmid size.

Here we report a new function for a geminivirus Rep. SLCMV Rep, placed in a binary

plasmid under the transcriptional control of the CaMV 35S promoter and introduced into

the A. tumefaciens vir helper strain EHA105 by conjugation, caused IS426 transposition in all

15 transconjugants analysed. A mutation causing premature translation termination of Rep

abolished IS426 transposition, which highlighted the role of the Rep protein in the activation

of IS426 transposition.

Materials and Methods

Plasmid constructs

The 1056-bp Rep ORF of the Sri Lankan cassava mosaic virus isolate (SLCMV-[Erode]) DNA A

(NCBI Accession No. KF898349) was amplified and cloned in pGEM-T (Promega, Madison,

USA). The SLCMV Rep gene was excised as a BamHI/KpnI fragment and cloned in the

corresponding sites of pRT100 (Töpfer et al., 1987). A 1.7-kb fragment comprising the Rep

gene, placed between the CaMV 35S promoter and polyadenylation signal in pRT100, was

excised as a HindIII fragment and cloned in the HindIII site of pCambia2300 (Cambia,

http//www.cambia.org/) to yield pCam-SLCMV-Rep. To construct the binary plasmid with

antisense Rep, the 1056-bp Rep gene was excised as a BamHI/SacI fragment and cloned in

the corresponding sites of the pJIC35S cassette with CaMV 35S promoter and

polyadenylation signal (Hellens et al, 2000). The expression cassette with the Rep gene in

antisense orientation was taken as an EcoRV fragment and cloned in the SmaI site of

pCambia2300 to yield pCam-SLCMV-asRep.

pCam-SLCMV-∆Rep harbours a mutated SLCMV Rep gene in pCambia2300. Mutation

of the Rep gene was carried out by XhoI digestion and end-filling with the Klenow fragment.

At the 82-nt position from the translation start codon of Rep, a translation frame shift

results in the generation of an ‘ochre’ termination codon at the 133-nt position. The

resultant protein has 44 amino acids in which amino acids 28-44 are altered due to frame

shift. The mutated Rep gene was excised as a 1.06-kb BamHI/KpnI fragment and cloned into

corresponding sites in pRT100. The 1.7-kb expression cassette with the mutated Rep gene

Acc

epte

d A

rtic

le


was taken as a HindIII fragment and cloned in the HindIII site of pCam2300 to yield pCam-

SLCMV-∆Rep.

Triparental mating

Triparental mating was done to introduce binary plasmids from E. coli into the A.

tumefaciens vir helper strain EHA105 (Hood et al., 1993). Single colonies of the donor,

recipient and helper E. coli (pRK2013) were mixed on YEP medium devoid of antibiotics and

allowed to grow overnight at 280C. The cells were suspended in 1 ml 0.9 % (w/v) NaCl and

serial dilutions were performed up to 10-6 dilution. From each dilution, 100 µl was plated on

AB minimal medium (Chilton et al., 1974) supplemented with 10 mg/l rifampicin and 100

mg/l kanamycin.

Southern blot analysis

Total DNA was extracted from A. tumefaciens (Chen et al., 1993) and 1 µg DNA was digested

with an appropriate restriction enzyme and electrophoresed in a 0.8% agarose gel in 1X Tris

Borate-EDTA buffer. The DNA was transferred (Southern et al., 1975) to the Zeta-Probe

nylon membrane (Bio-Rad Laboratories, Hercules, USA). Probe DNA (50 ng) was labeled

with [α-32P]dCTP using the MegaprimeTM DNA labeling system (GE Healthcare UK Ltd., Little

Chalfont, UK). Hybridizations were carried out at 650C and high stringency post-

hybridization washes were performed (Balaji et al., 2004).

PCR analysis

Total DNA from the A. tumefaciens transconjugants was used as the template for PCR

analysis. The primers, 5’CAAGGCGATTAAGTTCGGGTAAC3’ and

5’GTGAGAGAACACTTAGGGTATG3’, designated as A and B, respectively (Fig. 1a), were used

to amplify the CaMV 35S promoter and its flanking regions. To amplify the 35S

polyadenylation signal and its proximal sequences, the primers

5’CTATGACCATGATTACGAATTC3’ and 5’GACCTTCATCTCCCTCAGC3’, designated as C and D,

respectively (Fig. 1a), were used.

Results

DNA rearrangements in the binary plasmid pCam-SLCMV-Rep in A. tumefaciens

Acc

epte

d A

rtic

le


The binary plasmid pCam-SLCMV-Rep, which harbours the Rep gene of SLCMV-[Erode] (NCBI

Accession No. KF898349) in sense orientation in the T-DNA (Fig. 1a), was mobilized into the

A. tumefaciens vir helper strain EHA105 by triparental mating. Southern blot analysis of

total DNA of A. tumefaciens transconjugants was done to check the intactness of the

conjugally mobilized binary plasmid. Total DNA extracted from nine transconjugants was

digested with HindIII and the blot was probed with the linearised binary plasmid pCam-

SLCMV-Rep. The binary plasmid extracted from E. coli and digested with HindIII was used as

a positive control. The fragments expected to hybridize are 8.7 kb and 1.7 kb. Surprisingly,

all nine analysed transconjugants (TC1-TC9) displayed 8.7-kb and 3.0-kb fragments,

indicating a rearrangement within the 1.7-kb fragment (Fig. 1b). Conjugal mobilization was

repeated and six more transconjugants (TC11-TC16) were subjected to Southern blot

analysis after digesting A. tumefaciens DNA with HindIII and with another enzyme KpnI. The

linearised binary plasmid was used as the probe. Digestion with HindIII displayed

hybridization to 8.7-kb and 3.0-kb fragments (Fig. 2) as in the first experiment (Fig. 1b).

Upon KpnI digestion, 9.0-kb and 1.4-kb fragments are expected to hybridize if there is no

DNA rearrangement (Fig. 1a). Surprisingly, KpnI digestion revealed two types of DNA

rearrangements. The transconjugants TC11, -12, -14, -15 and -16 exhibited one type of DNA

rearrangement with 9.0-kb and 2.7-kb fragments whereas the transconjugant TC13 showed

a second type of DNA rearrangement with 10.3-kb and 1.4-kb fragments (Fig. 2).

Transposition of IS426 into the T-DNA of pCam-SLCMV-Rep caused DNA rearrangement

Southern blot data obtained following KpnI digestion (Fig. 2) revealed that two types of DNA

rearrangements had occurred in the six transconjugants that were analysed. In TC13, the

smaller 1.4-kb fragment was not altered suggesting that DNA rearrangements must have

occured to the left of the KpnI site marked with an asterisk (*) in Fig. 1a. In other five

transconjugants TC11, -12, -14, -15 and -16, a 2.7-kb KpnI fragment hybridized in place of

the 1.4-kb KpnI fragment, suggesting that the DNA rearrangement had occurred to the right

of the KpnI site marked (*) in Fig. 1a. To amplify the region that underwent DNA

rearrangement, two sets of primers were designed. One pair of primers (C and D) was

designed to amplify the CaMV polyadenylation signal (polyA) portion and the 3’ end of the

Rep gene (Fig. 1a). PCR of total DNA extracted from the transconjugants TC12 and TC13

Acc

epte

d A

rtic

le


displayed two different types of DNA rearrangements. The binary plasmid pCam-SLCMV-

Rep extracted from E. coli was used as the positive control. The expected 386-bp fragment

was amplified in pCam-SLCMV-Rep, TC12 and TC13, confirming that the CaMV polyA and its

proximal sequences did not undergo DNA rearrangement (data not shown). Another pair of

primers (A and B) was designed from the right border sequence and the 5’ region of the Rep

gene which will amplify a 622-bp fragment of the CaMV 35S promoter and its proximal

sequences (Fig. 1a). The expected 622-bp fragment was amplified in pCam-SLCMV-Rep, but

a 1.9-kb fragment was amplified in both TC12 and TC13 (data not shown). The results

indicated that the CaMV 35S promoter and its proximal sequences underwent DNA

rearrangement.

The sequences of the amplified 1.9-kb DNA fragments from TC12 and TC13 (Fig. 3)

revealed that the A. tumefaciens IS element IS426 of 1.3 kb was inserted in both cases. In

the case of TC12, the IS element insertion was in the Rep gene (Fig. 3a) whereas in TC13, the

insertion was in the CaMV 35S promoter (Fig. 3b). The inserted IS element was 1319 bp

long and exhibited 99% sequence identity with the Agrobacterium IS426 element

(Vanderleyden et al., 1986). Five bp target site duplications of 5’ATCGT3’ and 5’GGAGA3’

were found in the TC12 and TC13 transconjugants, respectively. The characteristic IS426

structural features such as terminal 5’ TG and CA 3’ sequences and 33-bp terminal inverted

repeats were also observed.

Total DNA from the A. tumefaciens strain EHA105 and nine transconjugants (TC1 to

TC8 and TC12) was subjected to Southern blot analysis with the 1.3-kb IS element probe.

HindIII digested DNA from the recipient EHA105 and all nine transconjugants displayed two

strong signals of 2.9 kb and 9.0 kb corresponding to the endogenous IS426 insertions in

EHA105 (Fig. 4). Additionally, a band at the 3.0-kb position, corresponding to the

rearranged binary plasmid (Fig. 1b), was seen in all nine transconjugants. Thus, it is

confirmed that insertion of the 1319-bp IS426 element into the HindIII fragment in the T-

DNA increased the HindIII fragment size from 1.7 kb to 3.0 kb.

The SLCMV Rep gene in antisense orientation did not cause DNA rearrangement in EHA105

The binary plasmid pCam-SLCMV-asRep harbours the antisense Rep gene of SLCMV. If the

Rep nucleotide sequence per se serves as a target for the observed IS426 transposition, Rep

Acc

epte

d A

rtic

le


antisense sequence would also be a target for IS426 transposition. The binary plasmid

pCam-SLCMV-asRep (Fig. 5a) was mobilized into the A. tumefaciens strain EHA105 by

triparental mating. DNA from seven transconjugants (TC1as to TC7as) was subjected to

Southern blot analysis with the linearised pCam-SLCMV-asRep probe. Agrobacterium DNA

was digested with HindIII. Six transconjugants (except TC3as in which the DNA was

degraded) displayed hybridization of the expected 10-kb and 0.4-kb fragments

corresponding to the intact binary plasmid (Fig. 5b). Thus, Rep nucleotide sequence per se

did not cause IS426 transposition.

Rep, encoding the complete protein, is required for IS426 transposition

A mutated version of SLCMV Rep gene was made to evaluate whether the complete Rep

protein coding sequence is required to activate transposition of IS426. A premature

translation termination was introduced into the Rep ORF by destroying an XhoI site by end

filling at the 82-bp position from the translation start codon. The mutation was verified by

sequencing. The resultant Rep gene with an ‘ochre’ termination codon at the 133-nt

position, will encode a 44-amino acid protein in which amino acids 28-44 are altered due to

a frame shift mutation produced by the XhoI site destruction. In effect, the mutated protein

has only 27 correct amino acids of the 351-amino acid Rep protein. The mutated Rep gene,

placed between the CaMV 35S promoter and 35S polyA signal in pCambia2300 (pCam-

SLCMV-∆Rep) was mobilized into the A. tumefaciens strain EHA105 by triparental mating.

DNA from seven transconjugants (TC1∆ to TC7∆) and the transconjugant TC12 was

subjected to Southern blot analysis. A. tumefaciens DNA was digested with HindIII and the

blot was probed with the linearised pCam-SLCMV-∆Rep. The transconjugants (TC1∆ to

TC7∆) displayed hybridization of 8.7-kb and 1.7-kb fragments expected of the intact pCam-

SLCMV-∆Rep suggesting that DNA rearrangement due to transposition did not take place

(Fig. 6). DNA rearrangement is seen in TC12 in which pCam-SLCMV-Rep in sense orientation

was mobilized.

Mutation of the Rep gene, which resulted in encoding only 27 of the 351-amino acids

of the Rep protein, abolished the DNA rearrangement caused by IS426 transposition.

Therefore, the SLCMV Rep gene encoding the complete Rep protein is required to trigger

IS426 transposition in A. tumefaciens.

Acc

epte

d A

rtic

le


Discussion

DNA rearrangements due to IS element insertion occurred in all 15 A. tumefaciens EHA105

transconjugants obtained by conjugal mobilization of the binary plasmid pCam-SLCMV-Rep,

which harboured the Rep gene of SLCMV in the sense orientation. The insertions occurred

either in the 5’ part of the Rep gene or in the CaMV 35S promoter region. The IS element

that caused the DNA rearrangement in both regions was identified as IS426. As reported

before (Vanderleyden et al., 1986), the element is 1319-bp long, has 33-bp terminal

inverted repeats, causes 5-bp target site duplication and the termini have 5’ TG and CA 3’

sequences (Fig. 3). Introduction of pCam-SLCMV-Rep into EHA105 by electroporation also

resulted in DNA rearrangement in all eight transformants (data not shown). Therefore,

conjugation per se is not responsible for DNA rearrangements.

Instances of IS element transpositions have been reported in many eukaryotic and

prokaryotic systems. Transposition of the 1.3-kb IS3411 element into the ureG gene of E.

coli 1021 inactivated the gene. All analysed insertions which caused target site duplication

were found at CTG sites (Collins & Gutman, 1992). IS1 and IS27 elements were found

inserted at different sites of the ‘gene IV’ region of CaMV genome when the viral genome

was cloned in pBR322 in E. coli (Hohn et al., 1982). Agrobacterium-derived insertion

sequences and transposable elements were detected in transgenic plants. Tn5393 and

Tn5563 were found in transgenic Arabidopsis (Zhao et al., 2009) and rice (Kim & An, 2012)

transformed with the A. tumefaciens vir helper strain LBA4404. In both cases, transposons

were inserted into the T-DNA of binary vectors in Agrobacterium before they were

transferred into the plant genome. Long (18-kb) Agrobacterium chromosomal DNA

segments were found integrated in Arabidopsis (Ülker et al., 2008). In these, fragments

bearing IS426 were found at a high frequency. T-DNA insertion into Agrobacterium

chromosomal DNA could be facilitated by the chromosomal nicks and breaks created by IS

transpositions. Ülker et al. (2008) interpreted that a second T-DNA inserted proximal to the

first T-DNA in Agrobacterium in a proper orientation might have provided the left border

sites, which effected the whole DNA complex comprising two T-DNAs and an IS element for

transfer into the plant genome.

Acc

epte

d A

rtic

le


The insertion of IS136 (Vanderleyden et al., 1986) into the cry1Ac-SBTI (soybean

trypsin inhibitor) fusion gene resulted in the inactivation of the gene when it was

transformed into cotton calli by Agrobacterium-mediated transformation (Rawat et al.,

2009). The fusion protein was not expressed in the transgenic plant due to the interruption

of SBTI gene by the insertion of IS136. The A. tumefaciens strain GV3101 used for

transformation is a derivative of the C58 strain which has IS136 (Rawat et al., 2009). IS136,

later renamed as IS426, was first reported by Vanderleyden et al. (1986). IS136 described

by Vanderleyden et al. (1986) and Rawat et al. (2009) and the IS426 described in this study

are the same. The Agrobacterium strain EHA105 used in our study is a derivative of the C58

strain which contains IS426 (Wood et al., 2001). IS426 cloned in this study hybridized to two

DNA fragments in the A. tumefaciens strain EHA105 (Fig. 4). In several triparantal mating

experiments routinely done in our lab in the A. tumefaciens strain EHA105 with different

binary plasmids, we did not observe DNA rearrangements in binary plasmids. Therefore, it

is interesting to note that introduction of the binary plasmid pCam-SLCMV-Rep caused DNA

rearrangements, consequent to IS426 transposition, in all 15 transconjugants analysed.

Interestingly, both IS426 insertions we report here are mapped to the T-DNA. Rep-

activated IS426 insertion could have also occurred in the backbone of the binary plasmid, in

the pTiBo542∆, and in the chromosomal sites. We observed that the triparental mating

efficiency of pCam-SLCMV-∆Rep (without the SLCMV Rep gene) was 214,000

transconjugants/ml bacterial suspension. The triparental mating efficiency of pCam-SLCMV-

Rep (with the SLCMV Rep gene) reduced to 800 transconjugants/ml bacterial suspension

(data not shown). This drastic reduction in triparental mating efficiency may be attributed

to mutations caused by the insertion of IS426 into the binary vector backbone, pTiBo542∆

or the chromosomes of A. tumefaciens.

Our analysis of antisense Rep binary plasmid mobilization into EHA105 threw light on

the fact that DNA rearrangements occur only when the Rep sense construct is mobilized into

EHA105. It ruled out the likely involvement of target sequences in Rep in bringing about the

transposition of IS426. The binary plasmid harbouring the mutated Rep gene (pCam-

SLCMV-∆Rep, with a deletion of 324 of 351 amino acids) did not show any DNA

rearrangement upon conjugal mobilization of the binary plasmid into EHA105. It is evident

Acc

epte

d A

rtic

le


from these results that the Rep sequence encoding the complete, functional Rep protein is

required to trigger IS426 transposition in EHA105. The expression of CaMV 35S promoter-

driven genes in A. tumefaciens was reported before (Hiei et al., 1994). Therefore, it is very

likely that SLCMV Rep protein is made in A. tumefaciens harbouring pCam-SLCMV-Rep.

Geminivirus Rep is a multifunctional DNA binding protein which binds to iterated

sequences upstream of the origin of replication and nicks in the invariant nonanucleotide

sequence to initiate rolling circle replication. The replication initiator protein, DnaA of E.

coli, which is reported to promote Tn5 transposition (Yin & Reznikoff, 1987), shares

functional similarity with the geminivirus Rep. Similar to Rep, the DnaA protein binds to a

repeated sequence in E. coli origin of replication referred as DnaA box to initiate replication

(Messer, 2002). The repeated sequence in E. coli origin of replication shares sequence

homology to the sequence at the outer end of Tn5. By binding to the outer end of Tn5, the

DnaA protein provides structural assistance during transposition by bringing the two ends of

transposon together (Yin & Reznikoff, 1987). Similar to the DnaA protein, SLCMV Rep may

act along with the transposase to trigger the transposition of IS426.

We show for the first time that the SLCMV Rep protein triggers IS426 transposition in

Agrobacterium. This study highlights the importance of performing detailed Southern blot

analysis or multiplex PCR and sequencing to study the intactness of binary plasmids after

their mobilization into vir helper Agrobacterium strains. DNA rearrangements within the T-

DNA in Agrobacterium will lead to the development of unusual transgenic plants with

unintended IS element insertions in the transgenes.

Acknowledgement

Grants from Indo-Swiss Collaboration in Biotechnology (DBT/SDC) and Ms Rasi seeds Pvt.

Ltd. supported this work. Miss Angel Priya is thanked for technical support.

References

Balaji V, Vanitharani R, Karthikeyan AS, Anbalagan S & Veluthambi K (2004) Infectivity analysis of two variable DNA B components of Mungbean yellow mosaic virus-Vigna in Vigna mungo and Vigna radiata. J Biosci 29: 297-308.

Acc

epte

d A

rtic

le


Bender J & Kleckner N (1992) Tn10 insertion specificity is strongly dependent upon sequences immediately adjacent to the target-site consensus sequence. Proc Natl Acad Sci USA 89: 7996-8000.

Berg DE (1983) Structural requirement for IS50-mediated gene transposition. Proc Natl Acad Sci USA 80: 792-796. Bonnard G, Vincent F & Otten L (1989) Sequence and distribution of IS866, a novel T region-associated insertion sequence from Agrobacterium tumefaciens. Plasmid 22: 70-81.

Calos MP, Johnsrud L & Miller JH (1978) DNA sequence at the integration sites of the insertion element IS1. Cell 13: 411-418.

Castillo AG, Collinet D, Deret S, Kashoggi A & Bejarano ER (2003) Dual interaction of plant PCNA with geminivirus replication accessory protein (Ren) and viral replication protein (Rep). Virology 312: 381-394.

Chen W & Kuo T (1993) A simple and rapid method for the preparation of gram-negative bacterial genomic DNA. Nucleic Acids Res 21: 2260.

Chilton M, Currier TC, Farrand SK, Bendich AJ, Gordon MP & Nester EW (1974) Agrobacterium tumefaciens DNA and PS8 bacteriophage DNA not detected in crown gall tumours. Proc Natl Acad Sci USA 71: 3672-3676.

Clerot D & Bernardi F (2006) DNA helicase activity is associated with the replication initiator protein Rep of tomato yellow leaf curl geminivirus. J Virol 80: 11322-11330.

Collins CM & Gutman DM (1992) Insertional inactivation of an Escherichia coli urease gene by IS3411. J Bacteriol 174: 883-888.

Deng W, Gordon MP & Nester EW (1995) Sequence and distribution of IS1312: Evidence for horizontal DNA transfer from Rhizobium meliloti to Agrobacterium tumefaciens. J Bacteriol 177: 2554-2559.

Ditta G, Stanfield S, Corbin D & Helinski D R (1980) Broad host-range DNA cloning system for gram-negative bacteria: Construction of a gene bank of Rhizobium meliloti. Proc Natl Acad Sci USA 77: 7347-7351.

Elmer JS, Brand L, Sunter G, Gardiner WE, Bisaro DM & Rogers SG (1988) Genetic analysis of tomato golden mosaic virus. II. The product of the AL1 coding sequence is required for replication. Nucleic Acids Res 16: 7043-7060.

Fontes EPB, Luckow VA & Hanley-Bowdoin L (1992) A geminivirus replication protein is a sequence specific DNA binding protein. Plant Cell 4: 597-608.

Acc

epte

d A

rtic

le


Gutierrez C (1999) Geminivirus DNA replication. Cell Mol Life Sci 56: 313-329.

Hanley-Bowdoin L, Bejarano ER, Robertson D & Mansoor S (2013) Geminiviruses: masters at redirecting and reprogramming plant processes. Nat Rev Microbiol 11: 777-788.

Hellens RP, Edwards EA, Leyland NR, Bean, S & Mullineaux PM (2000) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol 42 819-832.

Hiei Y, Ohta S, Komari T & Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6: 271-282.

Hohn T, Richards K & Lebeurier G (1982) Cauliflower mosaic virus on its way to becoming a useful plant vector. Curr Top Microbiol 96: 193-236.

Hood EE, Gelvin SB, Melchers LS & Hoekema A (1993) New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res 2: 208-218.

Kim S & An G, (2012) Bacterial transposons are co-transferred with T-DNA to rice chromosomes during Agrobacterium-mediated transformation. Mol Cells 33: 583-589.

Kong L, Orozco BM, Roe JL, Nagar S, Ou S, Feiler HS, Durfee T, Miller AB, Gruissem W, Robertson D & Hanley-Bowdoin L (2000) A geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection in plants. EMBO J 19: 3485-3495.

Laufs J, Traut W, Heyraud F, Matzeit V, Rogers SG, Schell J & Gronenborn B (1995) In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus. Proc Natl Acad Sci USA 92: 3879-3883.

Mahillon J & Chandler M (1998) Insertion sequences. Micobiol Mol Biol Rev 62: 725-774. Malik PS, Kumar V, Bagewadi B & Mukherjee SK (2005) Interaction between coat protein and replication initiation protein of Mungbean yellow mosaic India virus might lead to control of viral DNA replication. Virology 337: 273-283.

Messer W (2002) The bacterial replication initiator DnaA. DnaA and oriC, the bacterial mode to initiate DNA replication. FEMS Microbiol Rev 26: 355-374.

Orozco BM, Kong L, Batts LA, Elledge S & Hanley-Bowdoin L (2000) The multifunctional character of a geminivirus replication protein is reflected by its complex oligomerization properties. J Biol Chem 275: 6114-6122.

Acc

epte

d A

rtic

le


Otten L, Canaday J, Gerard J, Fournier P, Crouzet P & Paulus F (1992) Evolution of Agrobacteria and their Ti plasmids-A Review. Mol Plant-Microbe Interact 5: 279-287.

Paulus F, Ride M & Otten L (1989) Distribution of two Agrobacterium tumefaciens insertion elements in natural isolates: Evidence for stable association between Ti plasmid and their bacterial hosts. Mol Gen Genet 219: 145-152.

Rawat P, Kumar S, Pental D & Burma PK (2009) Inactivation of a transgene due to transposition of insertion sequence (IS136) of Agrobacterium tumefaciens. J Biosci 34: 199-202.

Sanchez-Duran MA, Dallas MB, Ascencio-Ibanez JT, Reyes MI, Arroyo-Mateos M, Ruiz-Albert J, Hanley-Bowdoin L & Bejarano ER (2011) Interaction between geminivirus replication protein and the SUMO-conjugating enzyme is required for viral infection. J Virol 85: 9789-9800.

Settlage SB, Miller AB & Hanley-Bowdoin L (1996) Interaction between geminivirus replication proteins. J Virol 70: 6790-6795.

Shen W & Hanley-Bowdoin L (2006) Geminivirus infection upregulates the expression of two Arabidopsis protein kinases related to yeast SNF1 and mammalian AMPK-activating kinases. Plant Physiol 142: 1642-1655.

Siguier P, Filee J & Chandler M (2006) Insertion sequences in prokaryotic genomes. Curr Opin Microbiol 9: 526-531.

Singh DK, Malik PS, Choudhury NR & Mukherjee SK (2008) MYMIV replication initiator protein (Rep): Roles at the initiation and elongation steps of MYMIV DNA replication. Virology 380: 75-83.

Southern EM (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98: 503-517.

Töpfer R, Matzeit V, Gronenborn B, Schell J & Steinbiss H (1987) A set of plant expression vectors for transcriptional and translational fusions. Nucleic Acids Res 15: 5890.

Ülker B, Li Y, Rosso MG, Logemann E, Somssich IE & Weisshaar B (2008) T-DNA- mediated transfer of Agrobacterium tumefaciens chromosomal DNA into plants. Nat Biotechnol 26: 1015-1017.

Vanderleyden J, Desair J, De Meirsman C, Michiels K, Van Gool AP, Chilton M & Jen JC (1986) Nucleotide sequence of an insertion sequence (IS) element identified in the T-DNA region of a spontaneous variant of the Ti-plasmid pTiT37. Nucleic Acids Res 14: 6699-6709.

Acc

epte

d A

rtic

le


Wood DW, Setubal JC, Kaul R et al. (2001) The genome of natural genetic engineer Agtrobacterium tumefaciens C58. Science 294: 2317-2323.

Yin JCP & Reznikoff WS (1987) dnaA, an essential host gene, and Tn5 transposition. J Bacteriol 169: 4637-4645.

Zhao Z, Zhu Y, Erhardt M, Ruan Y & Shen W (2009) A non-canonical transferred DNA insertion at the BRI1 locus in Arabidopsis thaliana. J Integr Plant Biol 51: 367-373.

Figure legends

Fig. 1 (a) T-DNA map of pCam-SLCMV-Rep. A, B, primers designed to amplify the CaMV 35S promoter region; C, D, primers designed to amplify the CaMV 35S polyadenylation signal sequence; LB, T-DNA border left; RB, T-DNA border right; Rep, SLCMV Rep gene in sense orientation; In-I, filled triangle indicates the position of IS426 insertion in TC11, -12, -14, -15 and -16; In-II, filled triangle indicates the position of IS426 insertion in TC13. The lines marked as 1.7 kb and 1.4 kb are fragments released by HindIII and KpnI digestions, respectively. (b) Southern blot analysis of A. tumefaciens EHA105 transconjugants harbouring pCam-SLCMV-Rep with DNA rearrangements. One microgram of total DNA from the transconjugants (TC1-TC9) was digested with HindIII. One microgram of recipient (EHA105) DNA was used as the negative control and 1 ng of pCam-SLCMV-Rep plasmid DNA digested with HindIII (Bi) was used as the positive control. pCam-SLCMV-Rep, linearised with SmaI and labeled with [α-32P]dCTP, was used as the probe.

Fig. 2 Southern blot analysis of A. tumefaciens EHA105 transconjugants with pCam-SLCMV-Rep by multiple enzyme digestion. One microgram of total DNA from six transconjugants (TC11-TC16) was digested with HindIII or KpnI. One microgram of recipient DNA (EHA105) was used as the negative control and 100 pg pCam-SLCMV-Rep digested with HindIII or KpnI (Bi) was used as the positive control. Other details are as in Fig.1b.

Fig. 3 Partial sequences of IS426 and its flanking sequences in Agrobacterium transconjugants TC12 (a) and TC13 (b). TSD, target site duplication; IR, terminal inverted repeats; Rep, SLCMV Rep gene. Terminal TG and CA are marked in bold letters. The terminal inverted repeat sequences (IR) are underlined.

Fig. 4 Southern blot analysis of pCam-SLCMV-Rep conjugally mobilized into A. tumefaciens EHA105 (TC1-TC8, TC12) with the IS426 probe. The 1.3-kb IS element labeled with [α-32P]dCTP was used as the probe. Other details are as in Fig. 1b.

Fig. 5 (a) T-DNA map of pCam-SLCMV-asRep. (b) Southern blot analysis of the transconjugants harbouring pCam-SLCMV-asRep in EHA105. One microgram of DNA from transconjugants TC1-TC7 was digested with HindIII. Total DNA (1 microgram) from

Acc

epte

d A

rtic

le


the recipient (EHA105) was used as the negative control. pCam-SLCMV-asRep DNA (250 pg, 1 ng) digested with HindIII (Bi) was used as the negative control. The blot was probed with linearised pCam-SLCMV-asRep labeled with [α-32P]dCTP.

Fig. 6 Southern blot analysis of the transconjugants harbouring pCam-SLCMV-∆Rep in A. tumefaciens EHA105. Transconjugant (TC1-TC7, TC12) DNA was digested with HindIII. pCam-SLCMV-∆Rep DNA (250 pg) digested with HindIII was used as the positive control (Bi). Linearised pCam-SLCMV-∆Rep labeled with [α-32P]dCTP was used as the probe.

Acc

epte

d A

rtic

le


Acc

epte

d A

rtic

le


Acc

epte

d A

rtic

le


Acc

epte

d A

rtic

le


Acc

epte

d A

rtic

le


Documents

Sri Lankan cassava mosaic virus replication associated protein (Rep) triggers transposition of IS 426 in Agrobacterium