Stem Cells and DNA Fingerprinting Catalyst:

What is the complementary strand of DNA to ACTTGCTACG?

We’ve talked a lot about genetically engineering human beings. Do you think it is morally acceptable to genetically engineer non-human life forms? (Plants, non-human animals, etc.). Explain why or why not.

Introduction As we have learned over the

last few days, humans can genetically engineer organisms Directly alter genes and cells

We haven’t yet reached the point of Gattaca—but we’re getting there…

Transgenic Organisms Transgenic organism: an organism

that has DNA from another species put inside of it by scientists Trans-: across -Genic: gene

Key Point #1: Scientists use restriction enzymes

to create transgenic organisms

Restriction Enzymes Restriction enzymes cut out the

gene from one organism, so it can be placed into another

CGAATGGGCCCAATTCTCGCTTACCCGGGTTAAGAG

CCCAATTCTCGGGTTAAGAG

GloFish!

Ditteaux!

Adult Stem CellsIn Louisiana, it is ILLEGAL to create embryonic stem cells

So all local research is done using adult stem cells New Orleans Mandeville!?

While You Are Waiting… Write a letter to the editor of the New

Orleans Times-Picayune Identify applications of stem cell research Explain your position on stem cell researchIs embryonic stem cell research morally acceptable?

Is adult stem cell research morally acceptable?

Why or why not?

Exit QuestionNext week, we will study cloning. Please tell me everything you already know about cloning.

Please tell me everything you don’t know but want to find out about cloning.