R E S EARCH ART I C L E

CANCER

STING agonist formulated cancer vaccines can cureestablished tumors resistant to PD-1 blockadeJuan Fu,1 David B. Kanne,2 Meredith Leong,2 Laura Hix Glickman,2 Sarah M. McWhirter,2

Edward Lemmens,2 Ken Mechette,2 Justin J. Leong,2 Peter Lauer,2 Weiqun Liu,2 Kelsey E. Sivick,2

Qi Zeng,1 Kevin C. Soares,3 Lei Zheng,3 Daniel A. Portnoy,4 Joshua J. Woodward,5

Drew M. Pardoll,3 Thomas W. Dubensky Jr.,2* Young Kim1,3*

Dow

nloaded from

Stimulator of interferon genes (STING) is a cytosolic receptor that senses both exogenous and endogenous cytosoliccyclic dinucleotides (CDNs), activating TBK1/IRF3 (interferon regulatory factor 3), NF-kB (nuclear factor kB), and STAT6(signal transducer and activator of transcription 6) signaling pathways to induce robust type I interferon and proinflam-matory cytokine responses. CDN ligandswere formulatedwith granulocyte-macrophage colony-stimulating factor (GM-CSF)–producing cellular cancer vaccines—termed STINGVAX—that demonstrated potent in vivo antitumor efficacy inmultiple therapeutic models of established cancer. We found that rationally designed synthetic CDN derivative mole-cules, includingonewith anRp,Rpdithio diastereomer andnoncanonical c[A(2′,5′)pA(3′,5′)p] phosphatebridge structure,enhancedantitumorefficacyof STINGVAX inmultipleaggressive therapeuticmodelsofestablishedcancer inmice.Antitumoractivity was STING-dependent and correlated with increased activation of dendritic cells and tumor antigen–specific CD8+ Tcells. Tumors from STINGVAX-treatedmice demonstratedmarked PD-L1 (programmed death ligand 1) up-regulation, whichwas associatedwith tumor-infiltrating CD8+IFNg+ T cells. When combinedwith PD-1 (programmed death 1) blockade,STINGVAX induced regression of palpable, poorly immunogenic tumors that did not respond to PD-1 blockade alone.

http

by guest on A

pril 1, 2020://stm

.sciencemag.org/

INTRODUCTION

The efferent arm of the immune system has been a principal target inthe development of cancer immunotherapies (1, 2), but the innate im-mune system plays a pivotal role inmodulating the potency and specific-ity of these active vaccination strategies (3, 4). Clinical therapeutic cancervaccines, therefore, have been formulated with antigen-presenting cell(APC)–activating adjuvants that typically stimulate the MyD88-TRIFsignaling pathway (5). To date, these formulations with various formsof cancer vaccineshavenot yielded clinical efficacy.Recently, a prime-boostregimen combining an allogeneic granulocyte-macrophage colony-stimulating factor (GM-CSF)–secreting vaccine with a mesothelin-expressing Listeria monocytogenes vaccine demonstrated a survivaladvantage in pancreatic carcinomapatients (6). This vaccine trial illustratesthe concept of combining tumor antigens (mesothelin), an APC-expanding cytokine (GM-CSF), and an APC-activating vector (Listeria).

Initially characterized as ubiquitous bacterial secondarymessengers, cy-clic dinucleotides (CDNs) [cyclic di-GMP (guanosine 5′-monophosphate)(CDG), cyclic di-AMP (adenosine 5′-monophosphate) (CDA), andcyclic GMP-AMP (cGAMP)] were shown to constitute a class of pathogen-associated molecular pattern molecules (PAMPs) that activate theTBK1/interferon regulatory factor 3 (IRF3)/type 1 interferon (IFN)signaling axis via the cytoplasmic pattern recognition receptor stimula-tor of interferon genes (STING) (7–15). Induction of IFN in Listeria-infected cells is STING-dependent, and it is lost in goldenticket miceharboring a mutant STING allele (13). Other observations, including the

1Department of Otolaryngology—Head andNeck Surgery, JohnsHopkins University, Schoolof Medicine, Baltimore, MD 21231, USA. 2Aduro Biotech Inc., Berkeley, CA 94710, USA.3Department of Oncology and the Sidney Kimmel Comprehensive Cancer Center, JohnsHopkins University School of Medicine, Baltimore, MD 21231, USA. 4Department ofMolecular and Cell Biology and School of Public Health, University of California, Berkeley,Berkeley, CA 94720, USA. 5Department ofMicrobiology, University ofWashington, Seattle,WA 98195, USA.*Corresponding author. E-mail: ykim76@jhmi.edu (Y.K.); tdubensky@adurobiotech.com (T.W.D.J.)

www.Scie

CDG-STING cocrystal structures, demonstrated that cytosolic microbialCDNs bind to STING to elicit an IFN and proinflammatory signaling cas-cade (16). The STING signaling pathway has emerged as a central Toll-likereceptor (TLR)–independentmediator ofhost innatedefense stimulatedbycytosolic nucleic acids, either through direct binding of exogenous CDNsfrom bacteria or through binding of a structurally distinct CDN producedby a host cyclic GMP-AMP synthetase (cGAS) in response to cytosolicdouble-stranded DNA (dsDNA) (17–20). The STING pathway representsa central node linking cytosolic nucleic acids to a transcriptional responseresulting in a MyD88-independent production of type I IFN.

Here, we demonstrate that CDNs are potent adjuvants in vaccineformulations that can provide therapeutic immunity against malignancies(21, 22). We have used CDNs to create a cell-based cancer vaccine—STINGVAX—that is ready for translation in clinical trials. We also de-scribe the rational development of synthetic CDNderivativesmodified tohave increased stability in vivo and to enhance binding to human STING(hSTING). When coformulated with an irradiated GM-CSF–secretingwhole-cell vaccine in the formof STINGVAX, the syntheticCDNs increasedthe antitumor efficacy in all the tumor models tested. STINGVAX-treatedmice were characterized by enhanced tumor-infiltrating lym-phocytes (TILs) along with up-regulation of programmed death ligand1 (PD-L1), indicating that STINGVAX is ideally suited for combinationwith (programmeddeath 1) PD-1 blockade treatment (23–27). STINGVAXcombined with PD-1 blockade did, indeed, induce regression ofestablished tumors. These results support the rationale for clinical eval-uation of STINGVAX, particularly in settings where immune checkpointblockade alone is not effective.

RESULTS

STINGVAX is a potent cancer vaccineWe initially found that CDNs induced potent STING-dependent CD4+-,CD8+-, and T helper 1 (TH1)–biased humoral immunity that was specific

nceTranslationalMedicine.org 15 April 2015 Vol 7 Issue 283 283ra52 1

R E S EARCH ART I C L E

for the coformulated ovalbumin (OVA) antigens (fig. S1). From theseobservations, we hypothesized that CDNs can expand antitumor cyto-toxic T lymphocytes (CTL) elicited by cancer vaccines.We demonstratedthat STINGVAX induced activation of dendritic cells (DCs) in vivo in thedraining lymph nodes (DLNs), and observed that CDNs were compara-ble, if not superior, to lipopolysaccharide (LPS) in their capacity to acti-vate DCs in the DLNs (Fig. 1A). GM-CSF–expressing vaccine cells alonedid not induce a significant activation response in our in vivo assay (Fig.1A, left panel). DC activation was associated with STING-dependent in-crease of phosphorylated IRF3 (Fig. 1A, right panel).

To test antitumor efficacy in vivo, we treated mice bearing palpableB16 melanoma tumors with a single dose of STINGVAX injected into

www.Scie

the contralateral side from the site of established tumor. Compared tothe unformulated GM-CSF–secreting tumor cell vaccine (GM-vaccine;see Materials and Methods) (28) and its combination with other con-trol adjuvants including monophosphoryl lipid A (MPL), poly(I:C)(polyinosinic-polycytidylic acid), and R848, STINGVAX (formulatedwithCDAas theCDN) demonstrated an increased antitumor response(Fig. 1B and fig. S2). Dose-response experiments revealed that the an-titumor effect of STINGVAX was diminished when formulated withless than 20 mg CDNs per 106 vaccine cells per mouse (Fig. 1B). Directtumor cell killing was not observed with CDA alone (fig. S3), suggestingthe requirement for vaccine cell–induced CD8+ T cell priming. When thetumor tissue was analyzed, STINGVAX-treated tumors had quantitatively

nceTranslationalMedicine.org

by guest on April 1, 2020

http://stm.sciencem

ag.org/D

ownloaded from

FcIRvpwavasBw(1bafratdinMtr[uctudinco(fwStrrefrctrooinknStr(Sw

ig. 1. STINGVAX is a potent cancer vac-ine. (A) STINGVAX can activate DLN DC via

F3 phosphorylation. CDNs, STINGVAX, GM-accine (GM-vac), LPS with GM-vaccine, orhosphate-buffered saline (PBS) controlas inoculated into naïve C57BL/6 mice,nd DLNs from the site of injectionwere har-ested after 3 days. DCs gated with CD11cnd MHCII were examined for CD86 expres-ion [% mean fluorescence intensity (MFI)].one marrow–derived DCs were treatedith C-di-AMP [CDNs (20 mg/ml) and LPS0 mg/ml) for 24 hours], and the Westernlot was probed with antibodies to pIRF3nd b-actin. STING−/− labeled samples wereom goldenticketmice that have a function-lly defective STING gene. (B) STINGVAXreatment of established B16 melanomaemonstrated a significant antitumor effectvivo, and this effect was dose-dependent.ice bearing palpable B16 melanoma wereeated with a single injection of STINGVAXsing 2 to 200 mg of CDNs (CDA) per vac-ine], with STINGVAX showing a better anti-mor effect than GM-vaccine or CDNs atoses greater than 20 mg. (C) STINGVAXcreased tumor-infiltrating CD8+ T lympho-ytes. B16 tumors treated with either GM-vacr STINGVAX were stained with aCD8-FITCluorescein isothiocyanate) andcounterstainedith DAPI (4′,6-diamidino-2-phenylindole).cale bar, 100 mm. CD8+IFNg+ TILs from theseeated mice were harvested and quantitatedlative to tumor mass. Data are means ±SEMom five tumor samples. (D) STINGVAX in-reased the number of tumor-specific CTL ineated mice. In vivo CTL assay was performedn day 20. Splenocytes were isolated from eachf the treatedgroups, andp15Epeptide–specificvivo T cell activity (y axis labeled as “%specificilling”) was measured. Data are means ±SEM,= 3. (E) The in vivo efficacy of STINGVAX wasTING-dependent. Palpable B16 tumors wereeated in wild-type (WT) and goldenticketTING−/−) mice. The animals were treatedith STINGVAX (20mgof CDA), and the tumors

were compared as in (B). (F) STINGVAX (CDA)

was used to treat tumor-bearingmice subjected to CD4 (GK1.5) or CD8 (c2.43) depletion (left panel). STINGVAX (CDA) antitumor efficacywas abrogated in IFNaR−/−

mice (right panel). For (B), (E), and (F), each group had 10 mice, and data represent means ± SEM. Each graph is representative of five experiments.

15 April 2015 Vol 7 Issue 283 283ra52 2

R E S EARCH ART I C L E

by guest on April 1, 2020

http://stm.sciencem

ag.org/D

ownloaded from

increased CD8+ TILs (Fig. 1C). This increase in TILs in STINGVAX-treated mice correlated with increased tumor antigen–specific primingas demonstrated by in vivo CTL assay (Fig. 1D). STINGVAX efficacywas indistinguishable regardless ofwhether it was formulatedwith equi-molar CDA or CDG (fig. S4).

To determine whether the increased antitumor efficacy of STINGVAXrequired STING signaling, we performed the B16 treatment assay inSTING-mutant goldenticket mice and found that the antitumor efficacyof STINGVAX required functional STING (Fig. 1E). In addition,STINGVAX efficacy was diminished in CD8+ T cell–depleted mice(Fig. 1F, left panel), demonstrating that CD8+ T cells were essential forinhibition of tumor outgrowth. Depletion of CD4+ T cells only partiallyabrogated the antitumor effect, probably due to the depletion of bothregulatory and nonregulatory CD4+ T cells (Fig. 1F, left panel). Whenwe tested STINGVAX in IFNaR−/−mice, the antitumor effect was largelylost, demonstrating the importance of type I IFN in its efficacy (Fig. 1F,right panel).

We also tested STINGVAX in colon carcinoma (CT26), upper aero-digestive squamous cell carcinoma (SCCFVII), and pancreatic carcinomamodels (Panc02), and found that the in vivo antitumor responses forSTINGVAX were better than those for GM-vaccine in all the tumormodels tested (Fig. 2). Once again, subcutaneous injection of CDNalone had no effect on the in vivo growth rate of these tumors. In apancreatic cancer model, Panc02 tumor cells inoculated into the hemi-spleenmetastasize to the liver via splenic vessels, and themouse survivalis directly dependent on liver metastatic burden (29, 30). As shown inFig. 2C, STINGVAX increased the survival in this model of metastaticpancreatic cancer (31).

Synthetic CDN derivatives have potent humanimmunostimulatory capacityWe then sought to develop synthetic CDN compounds with increasedactivity compared to the natural canonical STING ligands produced bybacteria or by host cGAS.We alsowanted to address the polymorphismof the hSTING alleles that may not be responsive to bacterial CDNs(32). To reduce degradation by phosphodiesterases, dithio analogs ofCDG, in which the nonbridging oxygens were replaced with sulfuratoms, were previously synthesized (33). Recognizing that the phospho-rus atoms in the internucleotide phosphate bridge constitute a chiralcenter, we tested the immunostimulatory properties of purified [RP,RP]and [RP,SP] dithio CDA diastereomers, separated by preparatoryhigh-performance liquid chromatography (Fig. 3A and fig. S5). Thephosphodiesterase-resistant [RP,RP] dithio CDA diastereomer (RR-S2CDA) induced higher levels of IFNb in murine DC2.4 cells than the[RP,SP] dithio CDA diastereomer (RS-S2 CDA), which was comparableto the unmodified parent molecule (Fig. 3, B and C).

Specific polymorphisms of hSTING have been shown to be refrac-tory to bacterial CDNs with canonical 3′,5′ phosphate bridge linkages,but retain responsiveness to c[G(2′,5′pA(3′,5′)p] (2′-3′cGAMP) producedbyhost cell cGAS (16–18,32).ToadvanceSTINGVAXfor clinical trials,wesynthesized CDN compounds that contained the same 2′-5′, 3′-5′ non-canonical (or mixed) linkage phosphate bridge as 2′-3′cGAMP (fig. S5).The noncanonical mixed linkage (ML) has been reported to increase thebinding affinity for hSTING by at least 10-fold (34), resulting in a 20-Åligand-induced conformational shift of the STING homodimer (35).

To determine the activity of these synthetic CDNs in vitro, we initiallymeasured induction of TBK1-dependent (IFNb), nuclear factor kB(NF-kB)–dependent [tumor necrosis factor–a (TNFa), interleukin-6

www.Scie

(IL-6)], and signal transducer and activator of transcription 6 (STAT6)–dependent [monocyte chemoattractant protein 1 (MCP-1)] cytokines inmurine bone marrow macrophages (BMMs) by quantitative reversetranscription polymerase chain reaction (qRT-PCR). Dithio modifi-cation, but not the structure of the phosphate linkage, conferred themost robust induction of cytokines, whereas no cytokine expressionwas noted in STING-null mice (Fig. 3D).

In contrast to murine cells, synthetic CDNs containing a 2′-3′ MLphosphate bridge were more potent activators of human APCs com-pared to canonical CDNs (Fig. 4). In THP1 cells, which contain theHAQ STING allele (H71, A230, R232, 293Q), theML phosphate bridgeconferred increased signalingof both adenosine andguanosinenucleotide–based molecules compared to canonical CDNs (Fig. 4A). The [RP,RP]dithiomodification of both canonical and noncanonicalMLCDNs alsoincreased IFN levels (Fig. 4A).Whenmonocytes andDCs isolated from

Fig. 2. STINGVAX inducedantitumor responses in all the tumormodelstested. (A) Balb/cmice bearing palpable CT26 colon carcinomawere treated

with STINGVAX (CDA), GM-vac, CDNs (CDA), and PBS controls. STINGVAX sig-nificantly decreased CT26 tumor growth compared to GM-vaccine or CDNs(CDA) alone in vivo. (B) C3H/HeOUJ mice bearing palpable SCCFVII tonguecarcinomas were treated with STINGVAX, GM-vac (from SCCFVII–GM-vac),CDNs, and PBS controls. (C) STINGVAX was used in a liver metastasis modelof Panc02 pancreatic carcinoma inoculated into a hemispleen. Cyclophos-phamide (Cy) was injected to reduce regulatory T cells for all the groups.Survival was monitored for 90 days. STINGVAX-treated mice demonstratedsignificantly improved overall survival compared to control groups (log-ranktest). (A) to (C) were replicated five times with 10 mice per group. Data aremeans ± SEM for (A) and (B).

nceTranslationalMedicine.org 15 April 2015 Vol 7 Issue 283 283ra52 3

R E S EARCH ART I C L E

by guest on April 1, 2020

http://stm.sciencem

ag.org/D

ownloaded from

Fig. 3. RR-S2 CDNs have increased activity compared to canonicalCDNs. (A) Structure of RR-S2 and RS-S2 CDA diastereomers showing

IFNb in DC2.4 cells was tested as in (B). (D) CDNs mixed with Effectenereagent (Qiagen) were added to BMMs isolated from WT or goldenticket

alternative positions of sulfur (S) atom substitutions for nonbridgingoxygens. (B) Induction of IFNb in mouse DC2.4 cells. IFNb was measuredusing L929-ISRE IFN reporter cells. Data are means ± SD of five samples.HBSS, Hanks’ balanced salt solution. (C) The indicated CDN (100 mM) wasincubated overnight with snake venom phosphodiesterase (SVPD; 0.1 mg/ml).After boiling and centrifugation, the capacity for the samples to induce

www.Scie

(STING−/−) mice at 5 mM. After 6 hours of incubation, induced down-stream expression of IRF3-dependent (IFNB1), NF-kB–dependent (TNF,IL-6), and STAT6-dependent (CCL2/MCP-1) proinflammatory cytokineswas assessed by qRT-PCR, and relative expression was determined bycomparison with unstimulated BMMs and Gapdh and Yhwaz referencegenes.

nceTranslationalMedicine.org 15 April 2015 Vol 7 Issue 283 283ra52 4

R E S EARCH ART I C L E

by guest on April 1, 2020

http://stm.sciencem

ag.org/D

ownloaded from

Fig. 4. ML–RR-S2–CDApotently activateshumanAPCs. (A) HumanTHP1-Blue cells with IRF3 reporter gene were stimulated with 50 mM of CDNs,

ulation withML–RR-S2–CDA (bottom). (D) Synthetic noncanonical CDNs canstimulate all the hSTING alleles with increased potency. Human PBMCs from

and the concentration of secreted embryonic alkaline phosphatase (SEAP)reporter was measured by spectrophotometry. Histogram represents mean ±SD of triplicate samples. (B) PBMCs from a WT STING human donor werestimulated with 50 mM of the indicated CDNs. After 24 hours, intracellularIFNa on gated CD14+ monocytes or on CD11c+HLA-DR+ DCs (mDCs) wasmeasured by fluorescence-activated cell sorting (FACS). (C) Cultured humanDCswere stimulatedwith 50mMsynthetic CDNsor LPS (1mg/ml) as apositivecontrol. After 48 hours, MHCI (HLA-ABC), CD80, CD83, and CD86 were mea-sured on the gated CD11c+ DCs. Bar graphs indicate the average MFI (toppanel); representative histograms show CD80, CD86, CD83, and MHCI ex-pression in human DCs. Filled histograms correspond to unstimulated cells,the dotted line represents LPS stimulation, and the solid line represents stim-

www.Scie

four donors, each with a different STING genotype (STINGWT, STINGHAQ,STINGWT/REF, or STINGHAQ/REF), were stimulated with 10 mM of the indicatedCDNs. After 6 hours of incubation, the supernatants were harvested for anal-ysis of TNFa protein (top), and the cells were harvested for analysis of IFNbinduction by qRT-PCR (bottom). (E) CDN-stimulated DCs can activate TH1 re-sponse in human T cells. Human DCs (CD11c+ cells) were probed for IL-12expression after treatment with GM-CSF, LPS, or ML–RR-S2–CDA. HumanDCs treatedwith GM-CSF, LPS, orML–RR-S2–CDAwere used inMLRs to stim-ulate human T cells (gated for CD8+ cells). Intracellular IFNgwasmeasured inCD8+-gated cells. Left panels display mean MFI (IL-12, left; IFNg, right), andright panels show representative histograms from gated flow analysis. Dataare means ± SD of five samples.

nceTranslationalMedicine.org 15 April 2015 Vol 7 Issue 283 283ra52 5

R E S EARCH ART I C L E

Dow

nloaded

a donor homozygous for wild-type STING (hSTINGWT) (36) weretested, 2′-3′ CDNs potently stimulated the production of IFNa in humanmonocytes and DCs (Fig. 4B). Additionally, all of the CDNs testedenhanced major histocompatibility complex class I (MHCI) and costimu-latory marker (CD80, CD83, and CD86) expression to a similar extent asdid LPS (Fig. 4C).

We tested these synthetic CDNs on peripheral blood mononuclearcells (PBMCs) from other donors with different STING genotypes(STINGWT, STINGHAQ, STINGWT/REF, and STINGHAQ/REF), and wefound that they can stimulate human monocytes with greater potencythan canonical CDNs, regardless of the STING genotypes (Fig. 4D)(37). CDG and CDA containing both the ML and dithio configurationrobustly induced type I IFN transcript in all the genotypes tested,whereas both canonical and noncanonical CDA containing the dithiomodification appeared superior at inducing secretion of TNFa.

Because these synthetic CDNs activated human APC, we sought todetermine whether DCs activated by CDNs could stimulate TH1 re-sponses in vitro. Consistent with the human APC activation data shownabove, our synthetic ML RR-CDN also induced a potent enhancementof IL-12 on human DCs (Fig. 4E). When these activated DCs were usedin mixed lymphocyte reaction (MLR), CDN-treated DCs induced an

www.Scie

enhanced IFNg response that was stronger than the response inducedwith GM-CSF–treated DCs (Fig. 4E).

STINGVAX with modified CDNs has enhancedantitumor efficacyGiven these in vitro findings showing increased STING signaling withour rationally designed CDNs, we compared STINGVAX potency whenformulated with RR-S2 CDA or with canonical CDA. STINGVAX for-mulated with RR-S2 CDA conferred higher efficacy in both the B16andTRAMP treatmentmodels as compared to the parental CDAmole-cule (Fig. 5A). Because murine STING lacks the polymorphisms ofhSTING alleles, we compared two formulations of STINGVAX (RR-S2CDA versus ML–RR-S2–CDA) and, as expected, found only modestdifferences in their antitumor activity (fig. S6). To test whether theenhanced in vivo responses seen in Fig. 5Awere activating the STINGpathway, we performed Western blots to test whether RR-S2 CDAenhanced IRF3 phosphorylation in vivo (Fig. 5B). Additionally, afterincubating murine DCs with CDA and RR-S2 CDA, we detected en-hanced IFNa expression with RR-S2 CDA in comparison to the ca-nonical CDA (Fig. 5C).Wedid observe some increased IFNa responsein goldenticket mice with RR-CDA that may be potentially STING-

nceTranslationalMedicine.org

by guest on April 1, 2020

http://stm.sciencem

ag.org/from

independent. Cumulatively, these find-ings demonstrated that CDNs with RRdithio linkage would provide improvedSTING-dependent IRF3 and type I IFNresponses as a vaccine adjuvant in pre-clinical settings, whereas the ML and RR-S2 modifications should be appropriatein clinical trials.

STINGVAX with PD-1blockade cures mice bearingestablished tumorsAlthough we showed that STINGVAX isa potent, antigen-specific CTL-generatingvaccine, we were concerned that the in-duction of immune checkpoint moleculeswithin the tumormicroenvironment (TME)might blunt antigen-specific T cell responsesgenerated against the tumor. When weprobed the TME for the up-regulation ofPD-L1 on tumor cells in vaccine-treatedmice,we found that CDN-dependent CD8+IFNg+

Tcell infiltration correlatedwith an increasedexpression of PD-L1 (Fig. 6A).Mice treatedwith IFNg neutralizing antibody showedno up-regulation of PD-L1, consistent withanadaptive immune resistancemechanismfor PD-L1 induction on tumors (fig. S7).Wereasoned, therefore, that blocking the PD-1–PD-L1 interaction would unleash thetumor-specificCTL response. PD-1–blockingantibody and GM-vac alone modestly en-hanced the antitumor response comparedto the HBSS control group (Fig. 6B, upperpanel). However, when PD-1–blocking anti-body was combinedwith STINGVAX for-mulated with RR-S2 CDA, much improved

Fig. 5. Synthetic RR-S2 CDA increased STINGVAX’s potency. (A) STINGVAX was formulated with eithercanonical CDA or RR-S2 CDA, with equimolar CDN amounts permouse (20 mg per vaccine), and used to treat

palpable B16 and TRAMP tumors. To improve the sensitivity of the in vivo treatment assay between thedifferent STINGVAX formulations, we increased the initial tumor burden for the B16 tumor to 105 cellsper inoculation for these experiments. Each group had 10 mice, and data represent means ± SEM. Eachgraph is representative of three to five experiments. (B) WT and goldenticket (STING−/−) bone marrow–derived murine DCs were incubated with CDA, and the cell lysates were probed with pIRF3 antibody. (C)DCs harvested from lymph nodes of WT and goldenticket (GT) mice were incubated with CDNs overnight,and their IFNa levels were quantitated by flow cytometry. Shown are the data for CD11c+B220+-gated DCsand the MFI change relative to untreated WT DC controls (WT). Bottom panel illustrates the IFNa MFIchange relative toWTuntreatedDC (WT), and the top panel is a representative histogram. Three replicateswere performed, and data represent means ± SEM.

15 April 2015 Vol 7 Issue 283 283ra52 6

R E S EARCH ART I C L E

antitumor responses were observed, with some of the established B16tumors showing regression (Fig. 6B, lower panels).When we tested thiscombinatorial therapy in the CT26 model, all established tumors re-

www.Scie

gressed (Fig. 7). In these mice that showed regression of the primarytumor, a second inoculation of CT26 cells resulted in no tumor growth,demonstrating that this combined therapy resulted in long-term tumor-

nceTranslationalMedicine.org

specificmemory (fig. S8). Notably, neitherB16 nor CT26 regressed in response to anti–PD-1 treatment alone when treatment wasstarted in mice with established tumors(Figs. 6 and 7).

by guest on April 1, 2020

http://stm.sciencem

ag.org/D

ownloaded from

DISCUSSION

The potent IFN responses elicited fromcytosolic dsDNA as danger signals, as wellas pathogen-derived CDNs, have evolvedto demarcate “affected” cells that may re-quire closer immunosurveillance (36).Withthe emergence of STING as a central regu-lator of this innate immune response, wehave engineered STINGVAX, a combinatorialcancer vaccine that targets the STINGpathway and colocalizes CDNs with tumorantigens and GM-CSF to amplify tumor-specific CTL in the context of establishedtumor.A critical element of our vaccinede-sign revolves around the structural specific-ity of CDNs binding to STING. [RP,RP]configuration (RR-S2 CDA) in combinationwith thenoncanonical 2′,3′phosphatebridgelinkage alterations can enhance hSTING ac-tivation. Our report illustrates the tight linkbetween the structural binding mechanismsof CDNs to STING and the activation of in-nate immunity to generate clinically effica-cious adjuvants for cancer vaccines.

Our study is limited by using non-autochthonous models that may not di-rectly address toleragenic TME. However,all our transplanted tumor treatments wereinitiated once the tumors were palpable, bywhich point tumor tolerance should be al-ready established. Future preclinical studieswill need to be directed toward OVA or he-magglutinin transgenicmodels amenable toamore robust inquiry intohowCDNsaffectantigen-specific tolerance. This report is alsolimited inmechanistic details onhowCDNsconfer increased immunologicpotencywhencoformulatedwithGM-vaccinecells.Ween-vision several possibilities that include (i)activation of the STING in the tumor cellvaccine to activate recruited DCs, (ii) MHCup-regulation in STINGVAX to activate pre-existing tumor-primed T cells, and (iii) thetumor cell vaccine simply serving as a CDNdepot. These possiblemechanisms of actionare notmutually exclusive andwill need tobe investigated in future studies.

Fig. 6. STINGVAX can up-regulate PD-L1. (A) STINGVAX treatment induces up-regulation of PD-L1 ontumors, correlating with increased infiltration of IFNg+CD8+ T cells. Scale bars, 100 mm. Harvested tumor

tissues from treated mice were probed with CD8, IFNg, and PD-L1 conjugates, followed by DAPI counter-stain. Colocalized CD8 and IFNg costaining positive cells are shown in yellow; CD8, green (FITC); IFNg, red[phycoerythrin (PE)]. PD-L1–PE conjugate (red) was used for the right panel. DAPI (blue) was used as a coun-terstain. The absolute number of CD8+IFNg+ and PD-L1+ cells per mass of tumor tissue is shown in the rightpanels. Data are means ±SEM from five samples. (B) Combination of STINGVAX (with CDA) and PD-1–blocking antibody slightly improved the antitumor response of established B16 tumors compared to theSTINGVAX, but did not reach statistical significance (toppanel). However, the combination of STINGVAX (RR-S2CDA) + anti–PD-1 significantly improved the antitumor response when compared against the combinationof STINGVAX (CDA) + anti–PD-1. The smaller panels on the bottom right are volume plots of individual mice(overlapping curves represent multiple mice with regression). Each group had 10 mice, and data representmeans ± SEM. The graph is representative of five experiments. n.s., not significant.

15 April 2015 Vol 7 Issue 283 283ra52 7

R E S EARCH ART I C L E

by guest on April 1, 2020

http://stm.sciencem

ag.org/D

ownloaded from

The ease of STINGVAX formulation, the proven safety profile of GM-CSF–secreting vaccines in multiple clinical trials, and the recent efficacyof these cellular vaccine platforms combined with Listeria vaccines inpancreatic cancer patients all provide rationale for translation ofSTINGVAX (6). Although a recent report showed that CDG can pro-vide therapeutic benefit to 4T1 tumors, these canonical CDNs havelimited translational value given the presence of hSTING alleles thatare refractory to canonicalCDNs (38). Furthermore, although this studysuggested direct tumor cell toxicity as the mechanism, we did not ob-serve this in our in vitro or in vivo studies.Wehad initial concerns aboutpotential STINGVAX toxicity because it is a potent inducer of IFN.However, none of the mice injected with STINGVAX showed gross ev-idence of cytokine storm, even when the dose of CDNs reached 200 mgper mouse.

The up-regulation of PD-L1 on the tumor and the associated abilityto induce regression of tumors treatedwith the combination of STINGVAXand anti–PD-1 illustrate the adaptive immune resistance mechanism(25, 27). As a potent inducer of IFNg-secreting T cells and PD-L1 inthe TME, STINGVAX (ML–RR-S2–CDA) is well suited for clinicalcombination with immune checkpoint–blocking antibodies, particular-ly anti–PD-1. The recent clinical trials with nivolumab and ipilimumabdemonstrated durable responses in advanced cancer patients, but theoverall response rates ranged from 20 to 40% of the patients treated(24). Because preclinical studies have shown improved in vivo responseswhen vaccines are combined with both PD-1 and CTLA-4 blockade(39), combiningmultiple immune checkpoint inhibitors with STINGVAXis also a valid clinical strategy. Recent reports that cumulatively demon-strated colocalization of CD3, IFNg, and PD-L1 in multiple human tu-mor types complement our mechanistic studies on the induction ofPD-L1 on tumor cells (40). Cumulatively, our findings justify the needfor combining STINGVAX with immune checkpoint inhibition inclinical trials.

MATERIALS AND METHODS

Study designThis was a preclinical study of CDNs as adjuvants for cancer vaccines.We hypothesized that CDNs formulated with an APC-mobilizing vac-

www.Scie

cine in the formof STINGVAXcan induce a potent IFN response in theTME to render a tumor more responsive to checkpoint inhibition. Weused multiple murine models to test if STINGVAX can induce an an-titumor response in vivo in established tumors. Each treatment andcontrol group had 10 mice per group, and the experiments were repli-cated at least three to five times. To ensure translatability of CDNs, ra-tionally synthesized CDNs were screened for optimal IFN responses inhumanmyeloid cells. We also modeled the human TME to ensure thatthese myeloid-activating CDNs can induce IFNg responses in hu-man lymphocytes. Finally, we formulated these synthetic CDNs intoSTINGVAXand combined themwith PD-1 blockade inmurinemodelsthat were refractory to PD-1 blockade alone.

Mice, cell lines, and antibodiesSix- to 10-week-old femaleC57BL/6, Balb/c, C3H/HeOUJ, C57BL/6-Tg8247Ng/J (TRAMP), and C57BL/6J-Tmem173gt/J (goldenticket) mice(The Jackson Laboratory) were housed according to the rules of theJohns Hopkins Hospital Animal Care and Use Committee. B16,CT26, SCCFVII, Panc02, B16 GM-vaccine, SCCFVII GM-vaccine, andPanc02 GM-vaccine were cultured in RPMI 1640 medium containing10% fetal bovine serum (FBS). GM-vaccine cells were prepared fromGM-CSF–expressing autologous tumor cells that were lethally irradiatedwith 150 Gy before injection. CT26 GM-vaccine consisted of lethallyirradiatedCT26 andallogeneicB78H1 secretingGM-CSF. For all the vac-cines, GM-CSF expression ranged from 50 to 500 ng per 106 cells per24 hours. Antibodies against CD3, CD4, CD8, CD11c, CD14,HLA-DR,MHCII, IFNa, IFNg, CD80, CD83, andCD86were purchased fromBDBiosciences. CD11c+ cellswere isolatedby anti-mouseCD11cMicroBeads(Miltenyi). GK1.5 and clone 2.43 (InVivoMAb)were used to deplete CD4and CD8, respectively. Hybridoma expressing PD-1–blocking antibody(clone G4) was obtained from C. Drake.

Vaccine formulationsSTINGVAX was prepared by incubating 2 to 200 mg of CDNs withlethally irradiated (150 Gy) GM-vaccine cells (106) at 4°C for 30 min.STINGVAX for each tumor type was formulated from each of theGM-vaccine derived from B16, CT26, SCCFVII, TRAMP, and Panc02tumor lines. CDNs used for STINGVAX formulation consisted ofCDA, CDG, RR-S2 CDA, or ML–RR-S2–CDA. The standard CDN

Fig. 7. STINGVAXwith PD-1 blockade can induce tumor regression. Combination of STINGVAX (RR-S2 CDA) and PD-1–blocking antibody can cure all ofthemicewith establishedCT26 tumors. The right panel depicts themice and tumors at day 20. Eachgrouphad10mice, anddata representmeans±SEM. The

graph is representative of five experiments.

nceTranslationalMedicine.org 15 April 2015 Vol 7 Issue 283 283ra52 8

R E S EARCH ART I C L E

by guest on April 1, 2020

http://stm.sciencem

ag.org/D

ownloaded from

amount used was 20 mg per vaccine. STINGVAX was injected sub-cutaneously into the contralateral limb of tumor-bearing mice. Forthe Panc02 model, the vaccines were injected subcutaneously intothe flanks after cyclophosphamide injection.

In vivo tumor modelsC57BL/6 mice were injected with 1 × 104 to 5 × 104 B16 cells in thefootpads. In some cases, 105 B16 were injected to increase the tumorburden at the time of treatment initiation. Once palpable tumor devel-oped (7 to 10 days), 100 ml of 106 B16 GM-vaccine or STINGVAX wasinjected subcutaneously into the contralateral limb. Palpable tumormeasurements were initiated once all three dimensions reached be-tween 2 and 4 mm, and the tumor volume was calculated by thefollowing formula: length (mm) × width (mm) × height (mm) ×0.5326 × 0.01 (41). C3H/HeOUJ mice and Balb/c mice were used withSCCFVII/SF and CT26 cells, respectively, with comparable methods(42). Tumors were measured daily. For the Panc02 hemispleen model,C57BL/6 mice were inoculated with 2 × 106 Panc02 tumor cells into asingle hemispleen, thereby seeding the liver via splenic vessels (43). Asingle dose of cyclophosphamide (100 mg/kg) was administered intra-peritoneally on day 3 after tumor injection for all the groups. Panc02STINGVAX was administered daily on days 4, 7, and 14. For the PD-1 blockade experiments, anti–PD-1 (G4) (100 mg per mouse per injection)was injected intraperitoneally twice a week once the tumor was palpable.Neutralizing IFNg (Bio-XCell) antibodywas given intraperitoneally twice aweek during the duration of the vaccine treatments in some experiments.

Western blotMurine DCs (BMM or DLN) were treated with CDNs (20 mg/3 ml) for24 hours, rinsed, lysed [radioimmunoprecipitation assay (RIPA),Sigma, 20min on ice], and fractionated (20 mg of protein per lane) with10% SDS–polyacrylamide gel electrophoresis gel. After transferringonto nitrocellulose membrane and blocking [TBST—5% nonfat milk,50mM tris-HCl (pH 7.5), 150mMNaCl, 0.1%Tween 20], themembranewas probed with phospho-IRF3 (Millipore) and b-actin (Cell Signaling)antibodies. The membranes were washed three times with TBST and in-cubated with the appropriate horseradish peroxidase–conjugatedsecondary antibody (1 hour, room temperature), and the peroxidase activ-ity was detected with enhanced chemiluminescence reagent (Pierce).

In vitro leukocyte activation assaysCD3- andCD19-depleted (Dynabeads)DCswere culturedwithGolgiStop(BD) and LPS (0.1 mg/ml) or CDNs (2 to 20 mg/ml) for 5 hours. DCs werestained for anti-mouse CD11c, CD86, CD80, andMHCII. GatedDC pop-ulation (CD11c+MHCII+) was probed for intracellular cytokine analysis(IL-12, IFNa/b, and TNFa) after permeabilization with Cytokit (BD).For the lymphocyteanalysis, harvested splenocytesor lymphnode lympho-cytes were stimulated with phorbol 12-myristate 13-acetate (PMA;1 mM/ml) and ionomycin (1 mg/ml) and GolgiStop. Suspended cellswere stained formouseCD3, CD4, CD8, and intracellular IFNg. Isotypecontrols were used to delineate positive staining.

IFN induction assayTHP1-Blue cells (4 × 105), a human monocyte cell line stably trans-fected with an IRF-inducible SEAP reporter gene (InvivoGen), wereincubated with 50 mM CDNs or controls for 30 min at 37°C. After30 min, cells were washed, plated in RPMI containing 10% FBS,and incubated at 37°C with 5% CO2. Twenty ml of the supernatant

www.Scie

was collected after overnight incubation and added to 180 ml ofQUANTI-Blue reagent (InvivoGen). After 45 min of incubation, ab-sorbance (655 nm) measurements were taken. Data are representativeof at least two independent experiments. For the luciferase assay, mouseDC2.4 cells (1×105) were incubated with CDNs or controls for 30 minat 37°C. Cells were washed with RPMI containing 10% FBS, and incu-bated at 37°C with 5% CO2 for 4 hours. Ten ml of supernatants wereincubated with L929 cells (5×104). After 4 hours, lucerifase activity wasquantified by addition of luciferin reagent (Promega) and reading on aluminometer.

Stimulation of human monocytes and DCsHumanPBMCs obtained fromhealthy donors were stimulatedwith 50 mMCDNs for 6 hours, followed by brefeldin A for an additional 16 hours.Gatedmonocytes (CD14+) ormDCs (CD11c+,HLA-DR+)were stainedwith intracellular anti-IFNa. Human CD11c+ cells were cultured withGM-CSF (50 ng/ml) and IL-4 (25 ng/ml) (R&D) for 7 days and thenstimulated for 48 hours with LPS (1 mg/ml) or 50 mM CDNs. Surfaceexpression of MHCI, CD80, CD83, and CD86 was determined byFACS. In some cases, human PBMCs obtained from donors with allthe different STING alleles (HemaCare) were sequenced as follows: ge-nomic DNA isolated from 104 PBMCs (Epicentre) was used to amplifyregions of exons 3, 6, and 7 of hSTING. Primers for amplification wereas follows: hSTING exon 3, GCTGAGACAGGAGCTTTGG (forward)and AGCCAGAGAGGTTCAAGGA (reverse); hSTING exon 6,GGCCAATGACCTGGGTCTCA (forward) andCACCCAGAATAG-CATCCAGC (reverse); hSTING exon 7, TCAGAGTTGGGTATCA-GAGGC (forward) and ATCTGGTGTGCTGGGAAGAGG(reverse). The same primers used for amplification were used for se-quencing. Genotypes were determined as outlined in (32). For qRT-PCRassay for IFNb1 expression, 106 cells were stimulated with 10 mMCDNs.Relative normalized expression was determined with unstimulated cellsserving as a control for each donor, and GUSB and PGK1 were used asreference genes. TNFa protein in the cell supernatantswasmeasured usingCBA Flex Sets according to the manufacturer’s instructions.

Real-time RT-PCR assay on BMMsBMMswere isolated from tibias and femurs of C57BL/6 and goldenticketmice and cultured in RPMImediumwith 5% colony stimulating factor 1,5%FBS, 1× L-glutamine, and 1× penicillin/streptomycin for 7 days beforeuse. BMMs (106) were stimulated with CDNs at 5 mM in HBSS with theaddition of Effectene (Qiagen) transfection reagent (per kit protocol) for6 hours at 37°C, 5%CO2.After 6 hours of incubation, the gene expressionof type I IFNb (Ifnb1), proinflammatory cytokines MCP-1 (Ccl2), Tnfa,and Il-6was assessed by RT-PCR using the PrimePCR RNA purificationand cDNA analysis system, run on a CFX96 gene cycler (Bio-Rad). Rel-ative normalized expression was determined for each gene (with wild-typeunstimulated BMMs as a control) to account for the different efficienciesof PCR amplification for the target (Etarget) and the reference (Ereference)and transform the logarithmic scaled rawdata unit of cycle threshold (CT)into the linear unit of normalized expression. The reference genes usedwere Gapdh and Ywhaz, confirmed to have a coefficient variable (CV)below 0.5 and anM value below 1, and thus not vary with different treat-ment conditions. Data are representative of two independent experiments.

In vivo CTL assaySplenocytes were labeled with 0.5 and 5 mM carboxyfluoresceinsuccinimidyl ester (CFSE; Molecular Probes). The 5 mM CFSE–labeled

nceTranslationalMedicine.org 15 April 2015 Vol 7 Issue 283 283ra52 9

R E S EARCH ART I C L E

http://stD

ownloaded from

cells were pulsed with P15E (10 mg/ml) (KSPWFTTL) peptide. The0.5 mM CFSE–labeled cells were pulsed with b-galactosidase (b-gal)peptide (TPHPARIGL). Mice were injected intravenously with a 1:1 mix-ture of these cells, and the splenocytes were isolated after 24 hours andanalyzed by flow cytometry. Antigen-specific killing was calculatedusing the following formula: (1 − % of CFSEP15E/% of CFSEb-gal) × 100.

ImmunohistofluorescenceFrozen sections (10 mm thick) were fixed with acetone and blockedwith1% bovine serum albumin (BSA) for 30 min at room temperature. Forparaffin-embedded tissue, the sections were fixed in 4% paraformaldehydebefore blocking with 1% BSA. aCD4 and aCD8 FITC conjugates andaIFNg and aPD-L1 primary antibodies were incubated for 1 hour at 4°C.Cy3 conjugate antibody was used as secondary antibody in some cases.DAPI was used as the nuclear counterstain. Positive cells in 10 randomlyselected fields at ×40 magnification were quantitated. Images were takenon a Nikon Eclipse E800 microscope with a Nikon DS-Qi1Mc cameraand NIS-Elements Advanced Research 3.0 software.

Statistical analysisWe used paired t test to calculate two-tailed P values to estimate thestatistical significance of differences between two treatment groupsusing Excel software. Error bars are SEM. P values are labeled in thefigures. Kaplan-Meier curves were generated using GraphPad Prismsoftware and analyzed with log-rank test.

by guest on April 1, 2

m.sciencem

ag.org/

SUPPLEMENTARY MATERIALS

www.sciencetranslationalmedicine.org/cgi/content/full/7/283/283ra52/DC1Materials and MethodsFig. S1. CDNs can induce cellular and humoral immunity.Fig. S2. CDNs are more potent adjuvants than TLR agonists.Fig. S3. CDNs do not kill tumor cells directly.Fig. S4. CDA and CDG are equally effective when formulated into STINGVAX.Fig. S5. CDNs with dithiophosphate backbone can be synthesized.Fig. S6. 2′-3′ linkage did not have improved antitumor efficacy in the murine system.Fig. S7. PD-L1 induction with STINGVAX treatment is IFNg-dependent.Fig. S8. STINGVAX-treated mice become immune to repeat tumor challenge.Reference (44)

020

REFERENCES AND NOTES

1. R. A. Morgan, M. E. Dudley, J. R. Wunderlich, M. S. Hughes, J. C. Yang, R. M. Sherry, R. E. Royal,S. L. Topalian, U. S. Kammula, N. P. Restifo, Z. Zheng, A. Nahvi, C. R. de Vries, L. J. Rogers-Freezer,S. A. Mavroukakis, S. A. Rosenberg, Cancer regression in patients after transfer of geneticallyengineered lymphocytes. Science 314, 126–129 (2006).

2. J. Scholler, T. L. Brady, G. Binder-Scholl, W. T. Hwang, G. Plesa, K. M. Hege, A. N. Vogel,M. Kalos, J. L. Riley, S. G. Deeks, R. T. Mitsuyasu, W. B. Bernstein, N. E. Aronson, B. L. Levine,F. D. Bushman, C. H. June, Decade-long safety and function of retroviral-modified chimericantigen receptor T cells. Sci. Transl. Med. 4, 132ra53 (2012).

3. R. M. Steinman, Decisions about dendritic cells: Past, present, and future. Annu. Rev. Immunol.30, 1–22 (2012).

4. I. Mellman, Dendritic cells: Master regulators of the immune response. Cancer Immunol.Res. 1, 145–149 (2013).

5. T. W. Dubensky Jr., S. G. Reed, Adjuvants for cancer vaccines. Semin. Immunol. 22, 155–161(2010).

6. D. T. Le, A. Wang-Gillam, V. Picozzi, T. F. Greten, T. Crocenzi, G. Springett, M. Morse, H. Zeh,D. Cohen, R. L. Fine, B. Onners, J. N. Uram, D. A. Laheru, E. R. Lutz, S. Solt, A. L. Murphy, J. Skoble,E. Lemmens, J. Grous, T. Dubensky Jr., D. G. Brockstedt, E. M. Jaffee, Safety and survival WithGVAX pancreas prime and Listeria monocytogenes–expressing mesothelin (CRS-207) boostvaccines for metastatic pancreatic cancer. J. Clin. Oncol. JCO.2014.57.4244 (2015).

www.Scien

7. D. K. Karaolis, T. K. Means, D. Yang, M. Takahashi, T. Yoshimura, E. Muraille, D. Philpott, J. T. Schroeder,M. Hyodo, Y. Hayakawa, B. G. Talbot, E. Brouillette, F. Malouin, Bacterial c-di-GMP is an immu-nostimulatory molecule. J. Immunol. 178, 2171–2181 (2007).

8. S. M. McWhirter, R. Barbalat, K. M. Monroe, M. F. Fontana, M. Hyodo, N. T. Joncker, K. J. Ishii,S. Akira, M. Colonna, Z. J. Chen, K. A. Fitzgerald, Y. Hayakawa, R. E. Vance, A host type Iinterferon response is induced by cytosolic sensing of the bacterial second messengercyclic-di-GMP. J. Exp. Med. 206, 1899–1911 (2009).

9. J. R. Barker, B. J. Koestler, V. K. Carpenter, D. L. Burdette, C. M. Waters, R. E. Vance, R. H. Valdivia,STING-dependent recognition of cyclic di-AMP mediates type I interferon responses duringChlamydia trachomatis infection. MBio 4, e00018-13 (2013).

10. J. J. Woodward, A. T. Iavarone, D. A. Portnoy, c-di-AMP secreted by intracellular Listeriamonocytogenes activates a host type I interferon response. Science 328, 1703–1705 (2010).

11. D. L. Burdette, K. M. Monroe, K. Sotelo-Troha, J. S. Iwig, B. Eckert, M. Hyodo, Y. Hayakawa, R. E. Vance,STING is a direct innate immune sensor of cyclic di-GMP. Nature 478, 515–518 (2011).

12. R. Tamayo, J. T. Pratt, A. Camilli, Roles of cyclic diguanylate in the regulation of bacterialpathogenesis. Annu. Rev. Microbiol. 61, 131–148 (2007).

13. J. D. Sauer, K. Sotelo-Troha, J. von Moltke, K. M. Monroe, C. S. Rae, S. W. Brubaker, M. Hyodo,Y. Hayakawa, J. J. Woodward, D. A. Portnoy, R. E. Vance, The N-ethyl-N-nitrosourea-inducedgoldenticket mouse mutant reveals an essential function of Sting in the in vivo interferon re-sponse to Listeria monocytogenes and cyclic dinucleotides. Infect. Immun. 79, 688–694(2011).

14. G. N. Barber, Cytoplasmic DNA innate immune pathways. Immunol. Rev. 243, 99–108 (2011).15. Y. Tanaka, Z. J. Chen, STING specifies IRF3 phosphorylation by TBK1 in the cytosolic DNA

signaling pathway. Sci. Signal. 5, ra20 (2012).16. D. L. Burdette, R. E. Vance, STING and the innate immune response to nucleic acids in the

cytosol. Nat. Immunol. 14, 19–26 (2013).17. E. J. Diner, D. L. Burdette, S. C. Wilson, K. M. Monroe, C. A. Kellenberger, M. Hyodo, Y. Hayakawa,

M. C. Hammond, R. E. Vance, The innate immune DNA sensor cGAS produces a noncanonicalcyclic dinucleotide that activates human STING. Cell Rep. 3, 1355–1361 (2013).

18. A. Ablasser, M. Goldeck, T. Cavlar, T. Deimling, G. Witte, I. Röhl, K. P. Hopfner, J. Ludwig, V. Hornung,cGAS produces a 2′-5′-linked cyclic dinucleotide second messenger that activates STING.Nature 498, 380–384 (2013).

19. P. Gao, M. Ascano, Y. Wu, W. Barchet, B. L. Gaffney, T. Zillinger, A. A. Serganov, Y. Liu, R. A. Jones,G. Hartmann, T. Tuschl, D. J. Patel, Cyclic [G(2′,5′)pA(3′,5′)p] Is the metazoan second messengerproduced by DNA-activated cyclic GMP-AMP synthase. Cell 153, 1094–1107 (2013).

20. L. Sun, J. Wu, F. Du, X. Chen, Z. J. Chen, Cyclic GMP-AMP synthase is a cytosolic DNA sensorthat activates the type-I interferon pathway. Science 339, 786–791 (2013).

21. T. Ebensen, R. Libanova, K. Schulze, T. Yevsa, M. Morr, C. A. Guzmán, Bis-(3′,5′)-cyclic dimer-ic adenosine monophosphate: Strong Th1/Th2/Th17 promoting mucosal adjuvant. Vaccine29, 5210–5220 (2011).

22. A. S. Madhun, L. R. Haaheim, J. K. Nøstbakken, T. Ebensen, J. Chichester, V. Yusibov, C. A. Guzman,R. J. Cox, Intranasal c-di-GMP-adjuvanted plant-derived H5 influenza vaccine induces multi-functional Th1 CD4+ cells and strong mucosal and systemic antibody responses in mice.Vaccine 29, 4973–4982 (2011).

23. J. R. Brahmer, S. S. Tykodi, L. Q. Chow, W. J. Hwu, S. L. Topalian, P. Hwu, C. G. Drake, L. H. Camacho,J. Kauh, K. Odunsi, H. C. Pitot, O. Hamid, S. Bhatia, R. Martins, K. Eaton, S. Chen, T. M. Salay,S. Alaparthy, J. F. Grosso, A. J. Korman, S. M. Parker, S. Agrawal, S. M. Goldberg, D. M. Pardoll,A. Gupta, J. M. Wigginton, Safety and activity of anti–PD-L1 antibody in patients with ad-vanced cancer. N. Engl. J. Med. 366, 2455–2465 (2012).

24. J. D. Wolchok, H. Kluger, M. K. Callahan, M. A. Postow, N. A. Rizvi, A. M. Lesokhin, N. H. Segal,C. E. Ariyan, R. A. Gordon, K. Reed, M. M. Burke, A. Caldwell, S. A. Kronenberg, B. U. Agunwamba,X. Zhang, I. Lowy, H. D. Inzunza, W. Feely, C. E. Horak, Q. Hong, A. J. Korman, J. M. Wigginton,A. Gupta, M. Sznol, Nivolumab plus ipilimumab in advanced melanoma. N. Engl. J. Med. 369,122–133 (2013).

25. J. M. Taube, R. A. Anders, G. D. Young, H. Xu, R. Sharma, T. L. McMiller, S. Chen, A. P. Klein,D. M. Pardoll, S. L. Topalian, L. Chen, Colocalization of inflammatory response with B7-h1expression in human melanocytic lesions supports an adaptive resistance mechanism ofimmune escape. Sci. Transl. Med. 4, 127ra37 (2012).

26. S. L. Topalian, F. S. Hodi, J. R. Brahmer, S. N. Gettinger, D. C. Smith, D. F. McDermott, J. D. Powderly,R. D. Carvajal, J. A. Sosman, M. B. Atkins, P. D. Leming, D. R. Spigel, S. J. Antonia, L. Horn, C. G. Drake,D. M. Pardoll, L. Chen, W. H. Sharfman, R. A. Anders, J. M. Taube, T. L. McMiller, H. Xu, A. J. Korman,M. Jure-Kunkel, S. Agrawal, D. McDonald, G. D. Kollia, A. Gupta, J. M. Wigginton, M. Sznol,Safety, Activity, and immune correlates of anti–PD-1 antibody in cancer. N. Engl. J. Med.366, 2443–2454 (2012).

27. J. Fu, I. J. Malm, D. K. Kadayakkara, H. Levitsky, D. Pardoll, Y. J. Kim, Preclinical evidence thatPD1 blockade cooperates with cancer vaccine TEGVAX to elicit regression of establishedtumors. Cancer Res. 74, 4042–4052 (2014).

28. G. Dranoff, E. Jaffee, A. Lazenby, P. Golumbek, H. Levitsky, K. Brose, V. Jackson, H. Hamada,D. Pardoll, R. C. Mulligan, Vaccination with irradiated tumor cells engineered to secretemurine granulocyte–macrophage colony-stimulating factor stimulates potent, specific,and long-lasting anti-tumor immunity. Proc. Natl. Acad. Sci. U.S.A. 90, 3539–3543 (1993).

ceTranslationalMedicine.org 15 April 2015 Vol 7 Issue 283 283ra52 10

R E S EARCH ART I C L E

http://stm.sciencem

Dow

nloaded from

29. K. Yoshimura, A. Jain, H. E. Allen, L. S. Laird, C. Y. Chia, S. Ravi, D. G. Brockstedt, M. A. Giedlin,K. S. Bahjat, M. L. Leong, J. E. Slansky, D. N. Cook, T. W. Dubensky, D. M. Pardoll, R. D. Schulick,Selective targeting of antitumor immune responses with engineered live-attenuated Listeriamonocytogenes. Cancer Res. 66, 1096–1104 (2006).

30. K. C. Soares, K. Foley, K. Olino, A. Leubner, S. C. Mayo, A. Jain, E. Jaffee, R. D. Schulick, K. Yoshimura,B. Edil, L. Zheng, A preclinical murine model of hepatic metastases. J. Vis. Exp. 51677 (2014).

31. I. C. Leao, P. Ganesan, T. D. Armstrong, E. M. Jaffee, Effectivedepletion of regulatory T cells allowsthe recruitment ofmesothelin-specific CD8+ T cells to the antitumor immune response against amesothelin-expressing mouse pancreatic adenocarcinoma. Clin. Transl. Sci. 1, 228–239 (2008).

32. G. Yi, V. P. Brendel, C. Shu, P. Li, S. Palanathan, C. Cheng Kao, Single nucleotide polymorphismsof human STING can affect innate immune response to cyclic dinucleotides. PLOS One 8,e77846 (2013).

33. H. Yan, X. Wang, R. KuoLee, W. Chen, Synthesis and immunostimulatory properties of thephosphorothioate analogues of cdiGMP. Bioorg. Med. Chem. Lett. 18, 5631–5634 (2008).

34. P. Gao, M. Ascano, T. Zillinger, W. Wang, P. Dai, A. A. Serganov, B. L. Gaffney, S. Shuman, R. A. Jones,L. Deng, G. Hartmann, W. Barchet, T. Tuschl, D. J. Patel, Structure-function analysis of STINGactivation by c[G(2′,5′)pA(3′,5′)p] and targeting by antiviral DMXAA. Cell 154, 748–762 (2013).

35. X. Zhang, H. Shi, J. Wu, X. Zhang, L. Sun, C. Chen, Z. J. Chen, Cyclic GMP-AMP containingmixed phosphodiester linkages is an endogenous high-affinity ligand for STING. Mol. Cell51, 226–235 (2013).

36. R. E. Vance, R. R. Isberg, D. A. Portnoy, Patterns of pathogenesis: Discrimination of pathogenicand nonpathogenic microbes by the innate immune system. Cell Host Microbe 6, 10–21 (2009).

37. T. W. Dubensky Jr., D. B. Kanne, M. L. Leong, Rationale, progress and development of vaccinesutilizing STING-activating cyclic dinucleotide adjuvants. Ther. Adv. Vaccines 1, 131–143 (2013).

38. D. Chandra, W. Quispe-Tintaya, A. Jahangir, D. Asafu-Adjei, I. Ramos, H. O. Sintim, J. Zhou,Y. Hayakawa, D. K. Karaolis, C. Gravekamp, STING ligand c-di-GMP improves cancer vacci-nation against metastatic breast cancer. Cancer Immunol. Res. 2, 901–910 (2014).

39. J. Duraiswamy, K. M. Kaluza, G. J. Freeman, G. Coukos, Dual blockade of PD-1 and CTLA-4combined with tumor vaccine effectively restores T cell rejection function in tumors.Cancer Res. 73, 3591–3603 (2013).

40. J. M. Taube, A. Klein, J. R. Brahmer, H. Xu, X. Pan, J. H. Kim, L. Chen, D. M. Pardoll, S. L. Topalian,R. A. Anders, Association of PD-1, PD-1 ligands, and other features of the tumor immunemicroenvironment with response to anti–PD-1 therapy. Clin. Cancer Res. 20, 5064–5074 (2014).

41. M. M. Tomayko, C. P. Reynolds, Determination of subcutaneous tumor size in athymic(nude) mice. Cancer Chemother. Pharmacol. 24, 148–154 (1989).

www.Scien

42. M. B. Davis, D. Vasquez-Dunddel, J. Fu, E. Albesiano, D. Pardoll, Y. J. Kim, Intratumoral ad-ministration of TLR4 agonist absorbed into a cellular vector improves antitumor responses.Clin. Cancer Res. 17, 3984–3992 (2011).

43. L. Zheng, K. Foley, L. Huang, A. Leubner, G. Mo, K. Olino, B. H. Edil, M. Mizuma, R. Sharma,D. T. Le, R. A. Anders, P. B. Illei, J. E. Van Eyk, A. Maitra, D. Laheru, E. M. Jaffee, Tyrosine 23phosphorylation-dependent cell-surface localization of annexin A2 is required for invasionand metastases of pancreatic cancer. PLOS One 6, e19390 (2011).

44. B. L. Gaffney, E. Veliath, J. Zhao, R. A. Jones, One-flask syntheses of c-di-GMP and the [Rp,Rp]and [Rp,Sp] thiophosphate analogues. Org. Lett. 12, 3269–3271 (2010).

Acknowledgments: We thank C. Drake and B. Francisca for reagents (clone G4) and for usefuldiscussions. Funding: NIH R01 CA178613 (Y.K.); Melanoma Research Alliance (Y.K. and D.M.P.);1PO1 AI63302 and 1R01 AI27655 (D.A.P.); NIH K23 CA148964-01, Viragh Foundation and the SkipViragh Pancreatic Cancer Center at Johns Hopkins, and the National Cancer Institute SpecializedPrograms of Research Excellence (SPORE) in Gastrointestinal Cancers P50 CA062924 (L.Z.). Y.K. hasreceived a sponsored research grant from Aduro Biotech Inc. Author contributions: J.F. designedand performed the experiments. D.B.K., M.L., L.H.G., S.M.M., E.L., K.M., J.J.L., P.L., W.L., K.E.S., Q.Z., K.C.S.,and L.Z. performed the experiments. D.A.P., J.J.W., and D.M.P. designed the experiments. D.M.P.,T.W.D.J., and Y.K. designed and wrote the manuscript. Competing Interests: D.M.P. is an un-compensated consultant for Amplimmune, Aduro Biotech, and ImmuneXcite. D.A.P. has a consult-ing relationship with and a financial interest in Aduro Biotech, and Y.K., D.A.P., and the companystand to benefit from the commercialization of the results of this research. Data and materialsavailability: Synthetic CDNs and GM-vaccines are available upon request. Cells, mice, antibodies,and cited reagents are all commercially available.

Submitted 4 December 2014Accepted 4 March 2015Published 15 April 201510.1126/scitranslmed.aaa4306

Citation: J. Fu, D. B. Kanne, M. Leong, L. H. Glickman, S. M. McWhirter, E. Lemmens,K. Mechette, J. J. Leong, P. Lauer, W. Liu, K. E. Sivick, Q. Zeng, K. C. Soares, L. Zheng,D. A. Portnoy, J. J. Woodward, D. M. Pardoll, T. W. Dubensky Jr., Y. Kim, STING agonistformulated cancer vaccines can cure established tumors resistant to PD-1 blockade. Sci.Transl. Med. 7, 283ra52 (2015).

a

ceTranslationalMedicine.org 15 April 2015 Vol 7 Issue 283 283ra52 11

by guest on April 1, 2020

g.org/

blockadeSTING agonist formulated cancer vaccines can cure established tumors resistant to PD-1

Joshua J. Woodward, Drew M. Pardoll, Thomas W. Dubensky, Jr. and Young KimJustin J. Leong, Peter Lauer, Weiqun Liu, Kelsey E. Sivick, Qi Zeng, Kevin C. Soares, Lei Zheng, Daniel A. Portnoy, Juan Fu, David B. Kanne, Meredith Leong, Laura Hix Glickman, Sarah M. McWhirter, Edward Lemmens, Ken Mechette,

DOI: 10.1126/scitranslmed.aaa4306, 283ra52283ra52.7Sci Transl Med

STINGVAX was very effective at killing even poorly immunogenic tumors.PD-L1, a protein that suppresses the immune response. Inhibiting the PD-L1 pathway in mice treated withantitumor activity. The authors also showed that treatment with STINGVAX caused cancer cells to up-regulate authors then modified the cyclic dinucleotides to strengthen their binding to human STING, increasing theircellular cancer vaccine called STINGVAX was effective against multiple types of tumors in mouse models. The

found that combining cyclic dinucleotides with aet al.an immune response in response to cyclic dinucleotides. Fu Stimulator of interferon genes, or STING, is a receptor that is found on a variety of cell types and activates

A therapy that STINGs tumors

ARTICLE TOOLS http://stm.sciencemag.org/content/7/283/283ra52

MATERIALSSUPPLEMENTARY http://stm.sciencemag.org/content/suppl/2015/04/13/7.283.283ra52.DC1

CONTENTRELATED

http://stke.sciencemag.org/content/sigtrans/9/422/ec78.abstracthttp://stke.sciencemag.org/content/sigtrans/12/593/eaay9834.fullhttp://science.sciencemag.org/content/sci/363/6431/eaat8657.fullhttp://science.sciencemag.org/content/sci/362/6411/eaar3593.fullhttp://science.sciencemag.org/content/sci/359/6382/1355.fullhttp://science.sciencemag.org/content/sci/353/6297/399.fullhttp://stke.sciencemag.org/content/sigtrans/10/460/eaae0435.fullhttp://stke.sciencemag.org/content/sigtrans/9/429/ec121.abstracthttp://stke.sciencemag.org/content/sigtrans/10/488/eaah5054.fullhttp://stke.sciencemag.org/content/sigtrans/8/373/ec104.abstracthttp://stke.sciencemag.org/content/sigtrans/10/477/eaan5400.fullhttp://stm.sciencemag.org/content/scitransmed/8/370/370ra180.fullhttp://stm.sciencemag.org/content/scitransmed/8/368/368ra171.fullhttp://science.sciencemag.org/content/sci/351/6280/1463.fullhttp://stm.sciencemag.org/content/scitransmed/8/334/334ra52.fullhttp://stm.sciencemag.org/content/scitransmed/8/334/334ps9.fullhttp://science.sciencemag.org/content/sci/352/6282/227.fullhttp://science.sciencemag.org/content/sci/350/6260/568.fullhttp://science.sciencemag.org/content/sci/348/6236/803.fullhttp://science.sciencemag.org/content/sci/348/6236/760.fullhttp://stm.sciencemag.org/content/scitransmed/4/134/134ra62.fullhttp://stm.sciencemag.org/content/scitransmed/5/172/172ra20.fullhttp://stm.sciencemag.org/content/scitransmed/6/232/232ra51.full

Terms of ServiceUse of this article is subject to the

registered trademark of AAAS. is aScience Translational MedicineScience, 1200 New York Avenue NW, Washington, DC 20005. The title

(ISSN 1946-6242) is published by the American Association for the Advancement ofScience Translational Medicine

Copyright © 2015, American Association for the Advancement of Science

by guest on April 1, 2020

http://stm.sciencem

ag.org/D

ownloaded from

REFERENCES

http://stm.sciencemag.org/content/7/283/283ra52#BIBLThis article cites 42 articles, 18 of which you can access for free

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

registered trademark of AAAS. is aScience Translational MedicineScience, 1200 New York Avenue NW, Washington, DC 20005. The title

(ISSN 1946-6242) is published by the American Association for the Advancement ofScience Translational Medicine

Copyright © 2015, American Association for the Advancement of Science

by guest on April 1, 2020

http://stm.sciencem

ag.org/D

ownloaded from