Structure and nucleotide sequence of a Drosophila melanogaster

The EMBO Journal vol.6 no.2 pp.433-441, 1987

Structure and nucleotide sequence of a Drosophila melanogasterprotein kinase C gene

Arnon Rosenthal, Lucy Rhee, Ramin Yadegari,Renato Parol, Axel Ullrich and David V.Goeddel

Genentech, Inc., 460 Point San Bruno Boulevard, South San Francisco, CA94080, and 'Department of Biochemistry, Stanford University MedicalCenter, Stanford, CA 94305, USA

Communicated by R.A.Flavell

Genomic and cDNA clones encoding a Drosophilamelanogaster protein kinase C (PKC) homologue were iden-tified using a bovine PKC cDNA probe. The cDNA clonescontain a single open reading frame that encodes a 639 aminoacid, 75-kd protein having extensive homology with bovine,human and rat PKC and homology with the kinase domainsof other serine, threonine and tyrosine kinases. TheDrosophila PKC gene is localized to region 53E ofchromosome 2. The gene spans - 20 kb and contains at least14 exons. Messenger RNA for PKC could not be detected in0-3 h Drosophila embryos. Adult flies contain three PKCtranscripts of 4.3, 4.0 and 2.4 kb.Key words: Drosophila melanogasteriprotein kinase C/nucleo-tide sequence

IntroductionThe character of a cell is largely defined by a diverse set ofspecific cell surface receptors which translate external stimuliinto physiological responses. The mechanisms by which cellularsignalling cascades generate cell type-dependent and agonist-specific responses are only partially understood but are thoughtto involve reversible activation of substrate-specific proteinkinases (Greengard, 1978; Nishizuka, 1980). These phospho-kinases are modulated either direcfly following receptor stimula-tion (as in the case of tyrosine kinase receptors; for review see

Hunter and Cooper, 1985) or through the generation of secon-

dary messengers, cAMP (activation of cAMP dependent proteinkinase; Kuo and Grengard, 1969), cGMP (activation of cGMPdependent protein kinase; Kuo, 1974), and calcium (activationof calcium calmodulin-dependent protein kinases; Cohen et al.,1978; Dabrowska and Hartshorne, 1978; Payne and Soderling,1980).Recently another receptor-controlled signalling mechanism that

utilizes novel second messengers and activates a different typeof protein kinase has been described (Hokin and Hokin, 1954;Durell et al., 1969; Michell, 1975; Takai et al., 1979a,b; forreview see Nishizuka, 1984, 1986). In this system, agonist recep-tor interaction results in a G protein-mediated activation ofphospholipase C (Cockcroft and Gomperts, 1985; Paris andPouyssegur, 1986). Phospholipase C catalyzes the hydrolysis ofphosphatidylinositol-4,5-bisphosphate, a minor membrane phos-pholipid, and transiently generates two secondary messengers:inositol-1,4,5-trisphosphate (Ins-1,4,5-P3) and 1,2-sn-diacyl-glycerol (1,2-DG) (Hokin and Hokin, 1954; for review see

IRL Press Limited, Oxford, England

Hokin, 1985). Ins-1,4,5-P3 promotes calcium release from in-ternal non-mitochondrial sources (Streb et al., 1983; for reviewsee Berridge and Irvine, 1984), while 1,2-DG activates proteinkinase C (PKC), a 75- 80-kd phospholipid- and calcium-dependent serine and threonine-specific protein kinase (Takai etal., 1979a,b; Kishimoto et al., 1980; for review see Nishizuka,1984, 1986).PKC appears to mediate some of the mitogenic effects observed

in response to the 'competence factors' platelet-derived growthfactor (Berridge et al., 1984; Coughlin et al., 1985), fibroblast-derived growth factor (Stiles et al., 1979; Rozengurt, 1981),cartilage-derived growth factor (Macara, 1985), bradykinin(Coughlin et al., 1985; Yano et al., 1984), bombesin (Brownet al., 1984), vasopressin (Rozengurt, 1981), thrombin(Pouyssegur et al., 1982), prostaglandin F2cr (MacPhee et al.,1984), phytohemagglutinin antigens (Coggeshall and Cambier,1984), interleukin-2 (Farrar and Anderson, 1985), andinterleukin-3 (Farrar et al., 1985), partially through activationof the proto-oncogenes c-fos (Greenberg and Ziff, 1984) and c-myc (Muller et al., 1984). PKC also phosphorylates and possiblymediates diminished response to agonists of receptors for epider-mal growth factor (Cochet et al., 1984), insulin (Jacobs et al.,1983), somatomedin C (Jacobs et al., 1983), transferrin (Mayet al., 1984), interleukin-2 (Schackelford and Trowbridge, 1984),3-adrenergic (Sibley et al., 1984), nicotinic acetylcholine(Huganir et al., 1984), and immunoglobulin E (Teshima et al.,1984), and thus acts as a negative regulator of biologicalresponses. It is involved in differentiation of keratinocytes (Yuspaet al., 1985), murine erythroleukemia cells (Faletto et al., 1985),F9 embryonal carcinoma cells (Kraft and Anderson, 1983),thymocytes (Kaibuchi et al., 1985) and B lymphocytes (Guy etal., 1985). Activation of PKC through an increase in inositollipid turnover is thought to mediate part of the transformingphenotype induced by the oncoproteinsfes, frs, p6Ov-src (Macaraet al., 1984), p68v-ros (Sugimoto et al., 1984), and ras (Wakelamet al., 1986), and its direct activation is involved in the tumor-promoting action of phorbol esters (Castagna et al., 1982; Parkeret al., 1984). PKC is also involved in regulation and secretionof enzymes, neurotransmitters and hormones, and plays a rolein neuronal excitation, synaptic plasticity, and learning (for reviewsee Nishizuka, 1986).PKC occurs throughout the animal kingdom, has a broad tissue

distribution (Kuo et al., 1980; Blumberg et al., 1983) and actson a variety of substrates (Nishizuka, 1986). Recent cDNA clon-ing experiments demonstrated the existence of a family of relatedPKC molecules (Coussens et al., 1986; Knope et al., 1986) whichare likely to function in diverse cellular processes previously at-tributed to a single PKC.To investigate the role of PKC in cellular signalling pathways

in both cultured cells and during development of intact organisms,we characterized cDNA and genomic clones coding for a Droso-phila protein with extensive homology to mammalian PKC.

433

A.Rosenthal et at.

CyS~~~~~~~~~~;l:SerHisfLVsAspPh1E

11-1,Cle:1)LAs I euTrO 1 g]T~~Cfl~~UAT~~ICGLU CTCCTGIATGGCATT I ~-1r(? TvI'J Sy- A

Me/PlnVauI'lisj IaArgs(Lys V½rSI uy.s* .p... i .. rhACCTGCATGCCCCTGCAMGGAGA.ACCr~rrk:

rl"A.ACG'T("iCAC;CTGCAA'.Ci(:..1

Cy.s.

*P'Cys

Cys~~~~~~~~~~~~y;

.ys Cys

Fig. 1. Combined nucleotide sequence of two overlapping cDNAs from phage 8 (nucleotides 1-1702) and 101.1 (nucleotides 13 12-3243) and predictedamino acid sequence of Drosophila protein kinase C. Intron positions are marked by numbered arrows, translation termination codons are boxed, the putativepolyadenylation site is underlined and cysteines are darkly shaded. The putative ATP binding site is marked with asterisks (*), the repeated cysteine structureis lightly shaded, and differences found in the dPKC gene are written below (nucleotides) and above (amino acids) the cDNA sequences.

434

.Cys.

Structure and sequence of Drosophila PKC gene

Results and Discussion ther analyzed and subsequenfly categorized into four groupsDrosophila protein kinase C cDNA clones represented by phage 2, 4, 8 and 10 (Figure 5). EcoRI hybridiz-A 2.3-kb bovine PKC (bPKC)ct cDNA fragment from a clone ing fragments from phage 4 (2.9 kb; E-5) and 10 (3.5 kb; E-8)XbPKCcv3O6 (Parker et at., 1986) was used as hybridization probe (Figure 5) were isolated, digested with Sau3A or RsaI, and thefor screening a Drosophila melanogaster (Canton S strain) par- resulting fragments were cloned into M13 vectors for subsequenttial EcoRI genomic DNA library (provided by N.Davidson; nucleotide sequence analysis. Both EcoRI genomic fragmentsFyrberg et al., 1980). Screening of -l05 plaques contained regions homologous to bPKCa which were separated(20 x Drosophila genome) under low stringency conditions (see by non-homologous intron-like stretches of DNA. Based on thisMaterials and methods) yielded 42 positives; 12 phage were fur- homology (60-80% at amino acid level) the fragments were

11 T,- 7 vI .7 Ji, L

TY LT FC 1-4 C"S

V PT17 ,7

Li 7-y C-'U

c-PTTi T C r"

'W'r Q7

T: V: F

F

F

I'-T

',y-LLFF LQK~

T T ~~~~~~FK

Fig. 2. Homology between Drosophila protein kinase C (dPKC), bovine protein kinase C family (bPKCcr, bPKC13, bPKC-y), human PKC family (hPKCaz,hPKC3, hPKCy) (Parker et at., 1986; Coussens et at., 1986), and rat PKC famtily (rPKC1 (-y), rPKC2 (13), rPKC3 (A), rPKC4 (at) (Knope et at., 1986).

Homologous regions between dPKC and either bovine, human or rat PKC are shaded. Rat PKCl and PKC2 (Knope et at., 1986) were identified as members

of the PKC-y and families, respectively. The tryptic peptides from rat brain PKC described in Knope et~al. (1986) were identified as part of a PKCai-likeprotein. Intron positions are marked by numbered arrows, and ATP binding site is marked by asterisks (*).

435

v*6

-~~~~~~~~ iILNSU.,~~~~~~

1'53SF"7, IKI

il ..,

T. T T

V CL

j.L 7

T T

'P,: TV Vi 1

7L T T C 7

L:p v

y y1".

E y Y I"7 v VI'

Y y

V'v,

ur- y

14

u

y I p

GC G'-'

Lu

L0

GC G

A.Rosenthal et al.

A

0-

.- C

C; C ; \A C: A/4 C .8MA

C

C

-.

C) G-, A

:.C .. AA iC, 7AM XC

1.

!i 1.!-if k1)i.1%s .-A,/1N1 1.1%L (!.:

K C S A C

C: F.':, A -. ~ R C I C E C

R N

M' K P .C S L C*-. . - -T !rL. ^1 s C

Fig. 3. Structure of dPKC putative metal DNA binding domains and its homology to other DNA binding proteins. (a) Possible structure of dPKC putativemetal and DNA binding domain (Miller et al., 1985; Berg, 1986). Amino acids that can interact with DNA are circled, cysteines forming the metal bindingdomains are shaded, and metal position is marked by M. (b) Structural homology between the cysteine-rich putative DNA binding domains of Drosophilaprotein kinase C (dPKC), human glucocorticoid receptor (hGR) (Weinberger et al., 1985), human estrogen receptor (hER) (Greene et al., 1986), andadenovirus early region protein products (Ad2,5,7,12) (Berg, 1986). Cysteines forming the putative metal binding domains are shaded.

identified as part of a Drosophila PKC (dPKC) gene and weretherefore used as probes for screening cDNA libraries.Using the genomic EcoRI E-5 and E-8 fragments (Figure 5)

as probes in high stringency hybridization experiments, threeXgtlO cDNA libraries representing RNAs from 0-3 h embryo,5.5 -7.5 day early pupal and adult Drosophila strain Oregon R(a gift from Dr Thomas Kornberg) (Poole et al., 1985) werescreened. Out of 4 x 106 phage analyzed (- 1.3 x 106 phageper library), 12 positives were obtained (seven from male adult,two from 5.5 -7.5 day early pupal, and three from early em-bryo). The two clones having the largest cDNA inserts, phage101.1 ( 1.9 kb, hybridized only with probe E-8), and phage8 ( 1.7 kb, hybridized with both E-5 and E-8 probes) were sub-cloned and sequenced (Figure 1).The two cDNAs were found to overlap and together span 3243

nucleotides. A polyadenylation signal which was not used by thecloned cDNA can be found between nucleotides 3159 and 3164.A single open reading frame contained in the combined sequenceextends from nucleotide 887 through 2864, encoding a 657 aminoacid, 75-kd protein. The putative dPKC translation initiation siteACAATGT is preceded by termination codons in all threereading frames. The triplet ATG appears 10 times in the 5' un-

translated region, implying that either internal initiation, termina-tion and reinitiation, or relaxed scanning of ATG sites by the40S ribosomal subunit is required for generation of the correctprotein (Kozak, 1986). dPKC shows 64% identity with bPKCcx,62% identity with bPKC3, 58% identity with bPKC&y and similarhomology with the human and rat PKC family (Figure 2). The

436

amino terminal cysteine-rich repeat domain, which was identifiedas a conserved feature of mammalian PKC variants (Coussenset al., 1986) is also present in dPKC and shows about 77% iden-tity with mammalian PKC. The carboxy terminal putative kinasedomain (aa -340-610) shows -88% identity with mammalianPKC. The cysteine-rich amino terminus region forms a perfectrepeat of the structure Cys-X2-Cys-X13-Cys-X2-Cys-X7-Cys-X7-Cys at amino acids 59-95 and at amino acids 124-160(Figure 1) and could form a metal binding configuration (Figure3a; Miller et al., 1985; Rosenberg et al., 1985; Vincent et al.,1985; Berg, 1986). Similar structures have been observed in avariety of nucleic acid binding proteins, including steroid recep-tors, transcription factors and viral DNA binding proteins (Figure3b; Miller et al., 1985; Weinberger et al., 1985; Greene et al.,1986; Berg, 1986). The existence in PKC of a putative DNAbinding domain raises the intriguing possibility of direct andsequence-specific binding ofPKC to DNA, enabling phosphoryla-tion of adjacent, already bound factors (i.e. histones, high mobili-ty group proteins, topoisomerases, transcription activators andsuppressors) with subsequent modulation of gene expression.Alternatively, the cysteine-rich repeat region might be involvedin calcium binding, interaction with other proteins or in forma-tion of the PKC tertiary structure.The only non-homologous regions span amino acids 1-30 (VI

region), 174-191 (V2 region), 300-340 (V3 region) and637 -657 (V4 region; Coussens et al., 1986) (Figure 2). Theseregions are also varible in all mammalian PKC variants (Coussenset al., 1986) and might serve as spacer regions between func-

B

fV


I~~~Lu bSF~~~G- V L.L G G F G V L.L G

FG

K V L GG, FL uS G.

R PFFL

PI L

7 Y A L H

LF HA E G L

uT P~~~~~~~~CGT

u

Y AFPC,G T P' Y APE II

U P ~~~~WA PFw A L E

G T PuT-- *-* * A.WAF

F N EK-T E K- -

r- ~ K-N K-

j t" '.

.I

V L

Q L..-" Ill:I--

F Q'rT 'I~, i-IFI:F:iT

Y RD LK N

D LKL

ElLK NLR D L N

YV V D

y D w

DL

U t FA VF

!p A..

k-3~~~~~~~~

* P~~~~~~~~~~~~

D:F~~ ~ ~ ~ ~

G.-~~ ~ ~ ~ TF

V\K

C..Vil-'C

tF F DF E S

L G P2FF.P; G

D GG EG;

..EL

* E

F

- I

I- 0 S L.-F s

F--

-.p

PFA:A-..KG 7K PNKPL.--K1K '.i.

K

AF;.

K

LI F N. N

Fig. 4. Homology between Drosophila protein kinase C (dPKC) and other serine threonine/tyrosine kinases. Homology between dPKC and bovine cAMP-dependent protein kinase catalytic subunit (cAMPc), bovine cGMP-dependent protein kinase (cGMP), rabbit skeletal muscle phosphorylase kinase -y subunit(phos-y), Rous sarcoma virus p60V2sc protein (v-src), human epidermal growth factor receptor (c-erbB) proviral v-mos protein of Moloney sarcoma virus (v-mos), human insulin receptor (HIR). (Amino acid sequences of cAMPc, cGMP, phos-y, v-src, c-erbB, v-mos and HIR were compiled by the NationalBiomedical Research Foundation, Georgetown University Medical Center, Washington, DC 20007.)

22 4.5 62 12 2.9 7.8 4.3 3.51

E

PHAGE No.E E

82410

E E B CC BHECC

II I 'Irr Y,I

E E E E E

E E C CE

.I.mai'FM 4 ,k

0- 500bpFl Non-coding exons

+ Coding exons

Fig. 5. Structure of Drosophila protein kinase C gene. Genomic phages are numbered 8, 2, 4, 10. EcoRI fragments are numbed E-1I to E-8 and theirrespective sizes are written above. E = EcoRI, B = BamHl, C = Cla, H = HindHI.

437

.i 7

"..,

.1 N

PA KV

I 1,

;. T1

I - k.,L;:

T

1.: N 7"

T K.L L

iT 'Lk KT -IL.

K

't 1P4

ckI c r-j. , Z.

.1

1

1:

A.Rosenthal et al.

Met.erG1uGWySerAspAstnAsnG1yAspProG1nInrIiGr(yA aJ 71 1 TGTCGGAGGGCAGCGATAACAACGGGGATCCCCAGCAGCACGGGGGCG

GhuGlyGIuAIaVaIGIy& tuAsnlLysMetLysSerArg'LeuArgLysGIyA' aLeuLysLysLysAsnVaI'PheAsnValLysAspHisCy-sPheIleA1aArgPhePheLysClnProGAGGGGGAGGCGGTGGGCGAGAACAAAATGAAGTCC f('T "~CCAAAGGAGCrCTrMGACAAGAAGAA/ GTCTTCAATGTCAAGGATCACTGCTICATCGCCCGGTTCTTCAAGCAGCCC

ThrPheCysSerH isCysLysAspPheIl]eTrAC (TTCTGCTC CACTCAAGWGA(TTTTPTT CT

PG&yPheGtIyLysGI[n&fyPheGnIrCvsG'ln'UGGCTTCGGAAMGCAAGGATTTrAGTGCCPAA Tl'T

ysSerTyrVa I VaIHiisLysArgCysHtisCG1IuTyrVaIThirPheIIe1y)sP oG]Iy-LysAsp[ ysG1IyI eAspSet,GCTCCTATGTGGTGCACM,GCGGTGCCACGAATATGTCACCTTCATCTGCCrGCGICAAGGATAAGGGCATCGATTC'G:

AspSerProLysThrGlnHi sAsnPheGluProPheTh~-T'yrA laGlyProThrPheCysAspHisCysGlySerLeuLeuT.yr:GACTCACC:AAAAACTCAACACAATTTCGAGCCATTCACATACGIACGGACCCACGTTCTCCGATCATTGTGGGTCCCTGCTGTAT

G lyl lei'yrHisG InGIyLeuLysCysSeri.GGCATTTACCACCAGGGTCTCkAAATGrTCAC:

iaCysAspHetA~snVa1 HisAlaArgCysLysGluAsn Val ProSerLeuCysGlyCysAs.pHisThrGluArgArgGlyAr,gl eT:CATGTGACATGAACGTGCATGCCCl,GCTGCAAGGAGAACGTGCCCAGCCTTTGCGGATGCGATCACAC:GGAGCGGCGGGCTCGCATTT

*yrLeuGlulleAsniValLysGluAsnLeuLeuThrValGlnI*ATCTGGAGATCAATGTCAAGGAGAATrTGCTAACTGTCCAGA..

')eLysGl uGlyArgAsnLeu IleProMetAspProA.svGlyLeuSeTCAAGGAGGGTCGCAATCTCATACCCATGGACCCAAACGGACTGAG

rAs.pProTyrValLysValLysLeul )eProAspAspLysAspGlnSerLysLysLysTrhrArgThrlleLysAlaCysteuAsnProValTrpAsn$iuThrLeuThrTy

rAspLeuLysProGluAs.pLysAspArgArgl leLe-ulleGluVaITTGATCTAAAGCCCGAAGACAAGGATCGACGCATCCTGATCGAAGTGT

*.rpAspTrpAspArgThrSerArgAsnAspPheMetGlyAl akeuSerPheGlyl leSerGiul letleLysAs:nProThrAsnGlyTrpPh.eLysLeuLeuThrGlnAspGluGly-GluT

*yrTIyrAsnValPrsCysAl aAspAspGluGlnAspteuLeuLysLeuLysGTnLysPro$erGlnLysLysProMetValMetArgSerAspmhrAsThrflisThrSer-SerLysLysAACACAGGCAGGGATAGGAGACATAGCCACGAACTGAAGAGCAGTATCCGG*AGAA*TC'CT,rCAAG

*spMetlle-ArgAlaThrAspPheAsnPhel leLysValLeu:GlyLysGlySerPheGlyILysATATGATCCGGGCCACGG,ACTTTAATTTCATCAAAGTTCTCGGCAAGGGCTCATTTGGAAAG-

ValLeuLeuAlaGluArgLysGlySerGIuGluL.euT'yrAIafleLysl leLeuLysLysAsptal l]elleGlnAspAspAspta]Glu.CysI:GTTTTGCTGGCTGAGCGCAAAGGCAGCGAGGAGTTGTATGCCATTAAGATACTCAAAAAGGATGTGATCATTCAGGACGArGACGTCGAGTGCA

*hrMetlIleGluLysAry VaILeuA'iaLeuGlyGl.uLysPrcProPbeLeuValGThLeu-HisSerCysPheGnTthrMetCCATGATCGAGAAGCGTGTCCTGGCGCTGGGCGAMAAGCCACCTTTCCTGGTCCAATTACACTCCTGCTTTCAGACGATC

AspArgLeas PhePheVPa'iMetUlIul!yr hIa lAsa-GlyG lyAhpLeuMetPheGIn l]eGInGIn PheG lyLys PheLysGiuPro VaIA.] aVaGACGTTT'GTTCTTTGTAATGGAGTATGTGAATGGCGG,CGATTTGATGTTCCAAATCCAACAG:TTTC,GCAAGTTTAAGGAACCAGTGGCCGT!

I PheTyrAlaAlaGlul leAlaAlaGlyLeuPhePheLeuHisThrLysGlylleC'euTyrAr.gAspLeuLy..ATTTTATGCCGCTGAAATAGCAGCTGGACTTTTCTTCCTTCATACCAAGGGCATACTGTATCGAGATCTAAA

eAlaProG]u 'eI]eLleeulyrGlnProTyrGlytysSerValAspTrpTrpA* TGCTCCAGAG . ATAATACTGTACCAGCCCTATGGAAAATCGGTGGACTGGTG&CG* laT'yrGlyValLeuLeuiyrGluMetLeuVal G)yGlniProProPheAspGlyG?IuAspGluGIuGluLeuPheAlaAlaI leThrAspHiPsAsnValSerTyrProLysSerLeuSerL

ysGIuAlaLysGluAlaCysLysGly PheLeuThrLysGlnProAsnLysArgLeuGAAGAiGGCCAAAGAGGCCTGCAAGGGC TTCCTAACTAAGCAGCCAAATAAGCGTFTGG

IyCysGlySerSerGlyGluGlujAspValArqteuHisProPhieSerAryArql IeAspTrpGluLysIlIeGluAsntArgGluValGlnPro~roPheLysProLysIlie

LysTliIsArgLysMetCysProThrteu'ThrSer5erSerHisGl nAryLysGi nThrQP,~:AAAkCACCGCAAGATGTGTCCAACTTTGACAAGCAGTTCACATCAGAGAAAACAGACTTGAC 2---:-~"''.'

1TVIILu.im.<v:..t K., * *, *, ,, ., *u~ ~ ~~~~'~* . ;; Ui2.*,(

:>..ikTi>;..c., .*:;<y;,...4*:*i:-T.T

Fig. 6. Nucleotide sequence and predicted amino acids of the Drosophila protein kinase C gene. Untranslated exons are lightly shaded. Coding exons aredarkly shaded. Introns are unshaded. Translation termination codons are boxed, putative polyadenylation site is underlined, putative ATP binding site ismarked with asterisks (*).

438


Fig. 7. (hrIn BKjhc.Ii1/dIir 1

hi iI .I t Ct I'lI C Lh dPiK( )\ A\t12 l).Hri..(annI. II t IIr'

tional domains. Alternatively, the variable regions might be in-volved in determining biological specificity and may be sites ofinteraction with substrate or agonist molecules. In addition, dPKCis 10 amino acids longer at the amino terminus and 35 aminoacids shorter at the carboxyl terminus than mammalian PKCs.dPKC homology with the kinase domain of other serine,

threonine and tyrosine kinases (Figure 4) is highest in a regionbetween amino acids 350 and 585. This region, which containsa consensus sequence for an ATP binding site (amino acids345 -374) (Figure 1) (Hannink and Donoghue, 1985) and is themost conserved region between Drosophila and mammalianPKCs. The fact that removal of the amino terminus results ina constitutively active kinase independent of calcium and phos-pholipids (Inoue et al., 1977) implicates the amino terminus as

a calcium, 1,2-DG and phospholipid binding domain, and in-dicates that the kinase domain is masked when the protein is in-active. No obvious hydrophobic phospholipid binding sites can

be identified in this amino terminal regulatory domain, andalthough calcium probably binds to the protein directly at multi-ple sites (Wolf et al., 1985), no homology with putative calciumbinding sites from other proteins could be found. The calciumbinding site suggested for bPKCa around amino acids 300-3 10(Parker et al., 1986) is not conserved in Drosophila.Structure of the Drosophila protein kinase C gene

In order to identify further putative functional domains (Gilbert,1978) in dPKC, its gene structure was determined. Genomicphage 2, 4, 8 and 10, initially isolated using the bPKCa probe(see previous section), were mapped using restriction enzymesEcoRI, HindIll, BamHI and ClaI. Overlapping regions were

determined and eight EcoRI fragments (E-1 to E-8) spanning32.6 kb of the dPKC gene (Figure 5) were subcloned. Regionsthat hybridized with the dPKC cDNA were subcloned into M 13vectors and sequenced. The dPKC spans 20 kb and contains13 coding exons and at least one untranslated exon at its 5' end.Exon sizes range from 32 bp to at least 623 bp and intron sizesrange from 54 bp to > 8000 bp (Figures 5 and 6).The kinase domain spans at least exons 8, 9, 10, 11, 12 and

13. Homology with other protein kinases starts within the 3'boundary of exon 8 and ends within exon 13 (Figure 4). Exon8 entirely contains the region between amino acids 300 and 340,

4

Fig. 8. Northern blot analysis of poly(A) selected mRNA (20 jg) from0-3 h embryo and from adult Drosophila fly (Oregon-R strain).(a) Drosophila protein kinase C cDNA was used as a probe. (b) A fragmentof Drosophila cytoplasmic C5 actin gene was used as a probe. An RNAladder (BRL) was used for size markers.

which is variable between the members of the PKC family (V3region, Coussens et al., 1986) and might define a substratespecificity determining domain. Exon 14 starts exactly wheredPKC diverges from mammalian PKCs (Figure 2). The othertwo regions where dPKC diverges from its mammalian homologsare contained within exon 2 (amino acids 1-30, VI region) andexon 6 (amino acids 174-189, V2 region). The cysteine-richrepeat region, putative metal and DNA binding regions (aminoacids 59-95 and 124-160) are included within exons 2-6. Thefirst repeat is included within exons 2-4 and the second repeatis included within exons 5 and 6. The two repeats are separatedby intron 4 and each repeat is split by an intron at the same place,the second amino acid of the second Cys-X2-Cys structure(amino acids 78 and 143), giving the structure Cys-X2-Cys-X13-Cys-X-intron-X-Cys-X7-Cys-X7-Cys (Figures 1 and 6).The general relation of exon- intron structure to functional do-

mains in dPKC is not always clear (intron 8 splits the putativeATP binding site) and might reflect either disruption of domainstructure in evolution by acquisition of introns or our ignorancein defining functional domains. Parker et al. (1986) suggestedthat the PKC gene, like the cGMP-dependent protein kinase, was

derived from a fusion of two genes providing regulatory andcatalytic domains. If so, this must have occurred at least 800million years ago and is not clearly reflected in the exon - intronstructure. Looking at the biggest - 8 kb intron (intron 5) as a

boundary between domains enables one to include the kinase part

439

b 0

I EoDwa

0

ro-0i EODlli

4-

Cl

.

.? '. )II

-I_

-7.5

-4.4

-2.4

A.Rosenthal et al.

(exons 8-13) of the protein within a single region, but resultsin separation of the cysteine-rich repeat regions (exons 5,6)(Figure 6).Comparison of nucleotide sequences between dPKC cDNA

(Oregon R strains) and genome (Canton S strain) revealed 16differences in the coding region. Fifteen of them are silent anddo not result in amino acid changes, and one (amino acid 428)results in a change from isoleucine (cDNA) to methionine(genome) (Figure 1). All six mammalian protein kinases havemethionine at this position (Figure 2). In addition there are threeinsertion/deletion changes of single nucleotides around poly(A)stretches in the 5'-untranslated region.To determine cytogenic localization of the dPKC gene,

biotinylated full-length cDNA and a genomic fragment (E-8) wereused as probes for in situ hybridization to polytene chromosomesof larval salivary glands. In parallel experiments, both probeshybridized to the same single site which was identified as posi-tion 53E on chromosome 2 (Figure 7).Expression of dPKC mRNAUsing dPKC cDNA as a probe, the size and level ofmRNA forPKC was measured in 0-3 h embryo and adult flies (OregonR strain). Northern blot analysis revealed the existence of threeequally abundant mRNAs of - 4.3, 4 and 2.4 kb in adult flytissues. No expression of dPKC RNA could be detected in 0-3 hembryo (Figure 8a). Actin mRNA could be detected in the sameblot using an 8.5-kb actin (SC) gene fragment as a probe (Fryberget al., 1983) in both 0-3 h embryo and adult fly (Figure 8b).The existence of three PKC mRNAs might reflect alternative in-itiation, terminationbor splicing events.The low levels of mRNA in 0-3 h embryo might reflect either

the utilization of maternal proteins at this time of development,the use of another PKC gene which was not detected under ourhybridization conditions, or indicate that dPKC is required onlyat later developmental stages. More detailed analysis of dPKCexpression patterns during development of both normal andmutated flies will help reveal the protein's function in a wholeorganism.

Materials and methodsScreening of genomic and cDNA libraryE. coli DpSO strain (for Charon 4 phage) and C600 HFL strain (for XgtlO phage)were infected with recombinant phage and replica plated on nitrocellulose fllters(30-100 x 103 phage per filter). Filters were baked at 80°C for 2 h,prehybridized for 3-4 h and then transferred to hybridization solution contain-ing 50% formamide,5 x SSC, 50mM sodium phosphate pH 6.8, 0.1% sodiumpyrophosphate,5 x Denhardt's, 50 /kg/m1 salmon sperm at 42°C. DNA probeswere labeled with 32p using synthetic random oligomers as primers in DNApolymerase extension reaction and then added to the hybridization solution. Filterswere hybridized for 12-16 h before washing in 0.2 x SSC, 0.1% SDS at thesame temperature. For low stringency hybridization with non-homologous pro-bes, 30% formamide was used in the hybridization solution and filters were washedas before.DNA sequencingDNA sequencing was done according to the standard dideoxy chain terminationmethod following subcloning into M13 derivatives (Smith, 1980). All sequenceswere determined at least twice.

Northern blot analysisTwenty Ag of polyadenylated RNA from 0-3 h embryo and adult DrosophilaOregon-R strain (a gift from Dr Y.Yarden) were electrophoresed into aformaldehyde- 1.2% agarose gel, and blotted onto nitrocellulose. The nitro-cellulose filters were hybridized wtih 32P-labeled dPKC cDNA probe in 50%formamide, 5 x SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodiumphosphate (pH 6.8), 2 x Denhardt's solution, 10% dextran sulfate at 420C for15-20 h. Extensive washings were done in 0. 1 x SSC, 0.1% SDS at 60°C.

AcknowledgementsWe are grateful to Lisa Coussens for providing the bovine cDNA probe and fortechnical advice, Dr N.Davidson and Dr W.Mattor for providing the Drosophilagenomic DNA library, Dr T.Kornberg for providing cDNA libraries and actinprobe, Dr Yosef Yarden for gifts of RNA samples, Carol Morita for preparingthe figures, and Jeanne Arch for manuscript preparations. We also thank ElizabethGavis (Stanford University) for providing Drosophila tissues of differentdevelopmental stages and Dr Suzanne Pfeffer (Stanford University) for en-couragement.

References

Berg,J.M. (1985) Science, 232, 485-487.Berridge,M.J. and Irvine,R.F. (1984) Nature, 312, 315-321.Berridge,M.J, Heslop,J.P., Irvine,R.F. and Brown,K.D. (1984) Biochem.J.,

222, 195-201.Blumberg,P.M., Delclos,K.B. and Jaken,S. (1983) In Langenbach,R., Nesnow,S.

and Rice,J.M. (eds), Organ and Species Specificity in Chemical Carcinogenesis.Plenum Press, New York, pp. 201-227.

Brown,K.D., Blay,J., Irvine,R.F., Heslop,J.P. and Berridge,M.J. (1984) Bio-chem. Biophys. Res. Commun., 123, 377-384.

Castagna,M., Takai,Y., Kaibuchi,K., Sano,K., Kikkawa,U. and Nishizuka,Y.(1982) J. Biol. Chem., 257, 7847-7851.

Cochet,C., Gill,G.N., Meisenhelder,J., Cooper,J.A. and Hunter,T. (1984) J.Biol. Chem., 259, 2553-2558.

Cockcroft,S. and Gomperts,B.D. (1985) Nature, 314, 534-536.Coggeshall,K.M. and Cambier,J.C. (1984) J. Immunol., 133, 3382-3386.Cohen,P., Burchell,A., Foulkes,J.G., Cohen,P.T.W., Vanaman,T.C. and Naim,

A.C. (1978) FEBS Lett., 92, 287-293.Coughlin,S.R., Lee,W.M.F., Williams,P.W., Giels,G.M. and Williams,L.T.

(1985) Cell, 43, 243-251.Coussens,L., Parker,P.J., Rhee,L., Yang-Feng,T.L., Chen,E., Waterfield,M.D.,

Francke,U. and Ullrich,A. (1986) Science, 233, 859-866.Dabrowska,R. and Hartshome,D.J. (1978) Biochem. Biophys. Res. Commun.,

85, 1352-1359.Durell,J., Garland,J.T. and Friedel,R.O. (1969) Science, 165, 862-866.Faletto,C.L., Arrow,A.S. and Macara,I.G. (1985) Cell, 43, 315-325.Farrar,W.L. and Anderson,W.B. (1985) Nature, 315, 233-235.Farrar,W.L., Thomas,T.P. and Anderson,W.B. (1985) Nature, 315, 235 -236.Fyrberg,E.A., Kindle,K.L., Davidson,N. and Sodja,A. (1980) Cell, 19, 363-378.Fyrberg,E.A., Mahaffey,J.W., Bond,B.J. and Davidson,N. (1983) Cell, 33,

115-123.Gilbert,W. (1978) Nature, 271, 501.Greene,G.L., Gilna,P., Waterfield,M., Baker,A., Hort,Y. and Shine,J. (1986)

Science, 231, 1150-1154.Greenberg,M.E. and Ziff,E.B. (1984) Nature, 311, 433-438.Greengard,P. (1978) Science, 199, 146-152.Guy,G.R., Gordon,J., Michell,R.H. and Brown,G. (1985) Biochem. Biophys.

Res. Commun., 131, 484-491.Hannink,M. and Donoghue,D.J. (1985) Proc. Natl. Acad. Sci. USA, 82,

7894-7898.Hokin,L.E. (1985) Annu. Rev. Biochem., 54, 205-235.Hokin,M.R. and Hokin,L.E. (1954) J. Cell Chem., 209, 549-558.Huganir,R.L., Miles,K. and Greengard,P. (1984) Proc. Natl. Acad. Sci. USA,

81, 6968-6972.Hunter,T. and Cooper,J.A. (1985) Annu. Rev. Biochem., 54, 897-930.Inoue,M., Kishimoto,A., Takai,Y. and Nishizuka,Y. (1977) J. Biol. Chem., 252,

7610-7616.Jacobs,S., Sahyoun,N.E., Saltiel,A.R. and Cuatrecasas,P. (1983) Proc. Natl.

Acad. Sci. USA, 80, 6211-6213.Kaibuchi,K., Takai,Y. and Nishizuka,Y. (1985)J. Biol. Chem., 260, 1366-1369.Kishimoto,A., Takai,Y., Mori,T., Kikkawa,U. and Nishizuka,Y. (1980) J. Biol.

Chem., 255, 2273 -2276.Knopf,J.L., Lee,M.-H., Sultzman,L.A., Kriz,R.W., Loomis,C.R., Hewick,R.M.

and Bell,R.M. (1986) Cell, 46, 491-502.Kozak,M. (1986) Cell, 44, 283-292.Kraft,A.S. and Anderson,W.B. (1983) J. Biol. Chem., 258, 9178-9183.Kuo,J.F. (1974) Proc. Natl. Acad. Sci. USA, 71, 4037-4041.Kuo,J.F. and Greengard,P. (1969) Proc. Natl. Acad. Sci. USA, 64, 1348-1355.Kuo,J.F., Andersson,R.G.G., Wise,B.C., Mackerlova,L., Salomonsson,I.,

Brackett,N.L. Katoh,N., Shoji,M. and Wrenn,R.W. (1980) Proc. Natl. Acad.Sci. USA, 77, 7039-7043.

MacPhee,C.H., Drummond,A.H., Otto,A.M. and De Asua,L.J. (1984) J. Cell.Physiol., 119, 35-40.

Macara,I.G. (1985) Am. J. Physiol., 248, C3-CI1I.

440


Macara,I.G., Marinetti,G.V. and Balduzzi,P.C. (1984) Proc. Natl. Acad. Sci.USA, 81, 2728-2732.

May,W.S., Jacobs,S. and Cuatrecasas,P. (1984) Proc. Natl. Acad. Sci. USA,81, 2016-2020.

Michell,R.H. (1975) Biochim. Biophys. Acta, 415, 81-147.Miller,J., McLachlan,A.D. and Klug,A. (1985) EMBO J., 4, 1609-1614.Muller,R., Bravo,R., Burckhardt,J. and Curran,T. (1984) Nature, 312, 716-720.Nishizuka,Y. (1980) Mol. Biol. Biochem. Biophys., 32, 113-135.Nishizuka,Y. (1984) Nature, 308, 693-698.Nishizuka,Y. (1986) Science, 233, 305-313.Paris,S. and Pouyssegur,J. (1986) EMBO J., 5, 55-60.Parker,P.J., Stabel,S. and Waterfield,M.D. (1984) EMBO J., 3, 953-959.Parker,P.J., Coussens,L., Totty,N., Rhee,L., Young,S., Chen,E., Stabel,S.,

Waterfield,M.D. and Ullrich,A. (1986) Science, 233, 853-859.Payne,E.M. and Soderling,T.R. (1980) J. Bio. Chem., 255, 8054-8056.Poole,S.J., Kauvar,L.M., Drees,B. and Kornberg,T. (1985) Cell, 40, 37-43.Pouyssegur,J., Chambard,J.C., Franchi,A., Paris,S. and Van Obberghen-

Schilling,E. (1982) Proc. Natl. Acad. Sci.USA, 79, 3935-3939.Rosenberg,U.B., Schroder,C., Preiss,A., Kienlin,A., Cote,S., Riede,I. and

Jackle,H. (1985) Nature, 319, 336-339.Rozengurt,E. (1981) Adv. Enzyme Regul., 19, 61-85.Schackelford,D.A. and Trowbridge,I.S. (1984) J. Biol. Chem., 259,

11706-11712.Sibley,D.R., Nambi,P., Peters,J.R. and Lefkowitz,R.J. (1984) Biochem. Biophys.

Res. Comrnun., 121, 973-979.Smith,A.J.H. (1980) Methods Enzymol., 65, 560-580.Stiles,C.D., Capone,G.T., Scher,C.D., Antoniades,H.N., Van Wyk,J.J. and

Pledger,W.J. (1979) Proc. Natl. Acad. Sci. USA, 76, 1279-1283.Streb,H., Irvine,R.F., Berridge,M.J. and Schulz,I. (1983) Nature, 306, 67-69.Sugimoto,Y., Whitman,M., Cantley,L.C. and Erikson,R.L. (1984) Proc. Natl.

Acad. Sci. USA, 81, 2117-2121.Takai,Y., Kishimoto,A., Kikkawa,U., Mori,T. and Nishizuka,Y. (1979a)

Biochem. Biophys. Res. Commun., 91, 1218-1224.Takai,Y., Kishimoto,A., Iwasa,Y., Kawahara,Y., Mori,T. and Nishizuka,Y.

(1979b) J. Biol. Chem., 254, 3692-3695.Teshima,R., Ikebuchi,H. and Terao,T. (1984) Biochem. Biophys. Res. Communm.,

125, 867-874.Vincent,A., Colot,H.V. and Rosbash,M. (1985) J. Mol. Biol., 186, 149-166.Wakelam,M.J.O., Davies,S.A., Houslay,M.D., McKay,I., Marshall,C.J. and

Hall,A. (1986) Nature, 323, 173-176.Weinberger,C., Hollenberg,S.M., Rosenfeld,M.G. and Evans,R.M. (1985)

Nature, 318, 670-672.Wolf,M., LeVine,H.,1I, May,W.S.,Jr., Cuatrecasas,P. and Sahyoun,N. (1985)

Nature, 317, 546-549.Yano,K., Higashida,H., Inoue,R. and Nozawa,Y. (1984) J. Biol. Chem., 259,

10201 -10207.Yuspa,S.H., Kilkenny,A.E., Stanley,J. and Lichti,U. (1985) Nature, 314,459-462.

Received on 20 October 1986; revised on 28 November 1986

Note added in proofThese sequence data have been submitted to the EMBL/GenBank Data Librariesunder the accession number Y00042.

441

Documents

Structure and nucleotide sequence of a Drosophila melanogaster