Vol. 2, 225-233, May 1991 Cell Growth & Differentiation 225

Structure, Mapping, and Expression of fisp- 12,a Growth Factor-inducible Gene Encodinga Secreted Cysteine-rich Protein

RoIf-Peter Ryseck,’ Heather Macdonald-Bravo, Marie-Genevieve Matt#{233}i,and Rodrigo Bravo2Bristol-Myers Squibb Pharmaceutical Research Institute, Department ofMolecular Biology, Princeton, New Jersey 08543 [R-P. R., H. M-B.,R. B.], and Institut National de Ia Sante et de Ia Recherche M#{233}dicale0242, Centre de G#{233}n#{233}tiqueM#{233}dicale,H#{244}pitald’Enfants de Ia Timone,i3385 Marseille, France [M-C. M.]

AbstradWe have charaderized a growth fador-inducible gene,fisp-i2, previously isolated by differential screening ofa lambda complementary DNA library of RNA fromserum-stimulated NIH 3T3 cells, and have shown that itencodes a cysteine-rich secreted protein of 348 aminoacids. The indudion of fisp-12 mRNA is rapid andremains for at least 8 h at a high level of expression.The increased level of lisp-i 2 mRNA following serumstimulation is mainly due to transcriptional adivation.Studies on the genomic strudure reveal that the lisp-i 2transcription unit is 3.1 kilobases long and split intofive exons. The 5’ flanking region does not containserum-responsive elements normally found in otherimmediate early genes. Immunoprecipitation analysesshow that the protein is rapidly induced followingserum stimulation and that it is efficiently secreted inan unglycosylated form to the medium. The lisp-i 2gene maps to the [iOA3-iOBi] region of the murinegenome.

lntrodudionGrowth factors and other mitogens are capable of rapidlyinducing a complex set of genes in quiescent fibroblasts(1-4). These genes, which have been named immediateearly or early response genes, are transcriptionally acti-vated within minutes after growth factor or mitogenaddition, independent of de novo protein synthesis. Theexpression of some of these immediate early genes,which include the protooncogenes c-los (5, 6), c-jun (7,8), c-rel (9), and c-myc (iO), are thought to act as “thirdmessengers” in the cascade of events triggered by growthfactors. This notion has been further supported by thefinding that other immediate early genes encode bonafide or putative transcription factors such as fosB (1 1), fra-1 (12, 13), fra-2 (14, 15), junB (16), nur77/NGFI-B/NiO(i7-i9), Krox-24/zi168/egr-i/NGFI-A (20-24), and Krox-20/egr-2 (25-27). However, not all ofthe immediate earlygenes induced in a given cell by external stimulus need

to be part of the mitogenic response of that same cell. Itis possible that many of these gene products are neededto integrate and coordinate complex biological proc-esses, such as differentiation and wound healing, inwhich cell proliferation is a common event. This hypoth-esis has been strengthened by the observation that otherimmediate early genes encode for secreted molecules,some of which are known or proposed cytokines, includ-ing gro/KC/MCSA/N5i (28-31), which has been dem-onstrated to have growth-promoting activity and to be aneutrophil chemoattractant (32), JE (33), which has beenshown to be a monocyte chemoattractant (34), andcyr6i/cef-i0, whose function is as yet unknown (35, 36).Furthermore, two other genes encoding secretory pro-teins which participate in well characterized physiobogi-cal events that occur during wound healing have beenidentified as immediate early genes. These genes aretissue factor (TF) (37) and plasminogen activator inhibitor(PA!) (38, 39). TF is a component ofthe extrinsic pathwayin blood coagulation and, when complexed with factorVIla, a serine protease, it catalyzes the activation of factorIX (Christmas factor) in the intrinsic pathway in bloodcoagulation. On the other hand, PA! blocks the activationof plasminogen to plasmin, a serum protease that cleavesfibrin by inhibiting plasminogen activator and allowingthe fibrin clots to persist for a longer period.

Here, we present a detailed characterization of animmediate early gene, fisp-12,3 which was previouslyisolated by differential screening of a cDNA library ofserum-stimulated NIH 3T3 cells (4), and show that it

encodes a cysteine-rich protein that belongs to a newemerging family of secreted molecules.

Results

Regulation of fisp-i2 Expression. To study the kinetic ofinduction of lisp-i 2, RNA was isolated at different periodsof time following serum stimulation of quiescent NIH3T3 cells and analyzed by Northern blots. The 2.3-kblisp-i2 mRNA is very low in quiescent cells but rapidlyincreases, reaching a maximal level of expression be-tween i and 2 h, which represents an increase of ap-proximately 50-fold with respect to that present in non-stimulated cells. Thereafter, it slowly decreases, beingstill significantly high at 8 h (Fig. iA). The levels of lisp-i2 mRNA are superinduced when quiescent cells areserum stimulated in the presence of protein synthesisinhibitors, as shown in Fig. 1A, suggesting that lisp-12mRNA is an unstable molecule. In order to determine

Received i/i 5/91.1 R-P. Ryseck was supported by a fellowship from the Boehringer Ingel-heim Fonds.

2 To whom requests for reprints should be addressed, at Bristol-MyersSquibb Pharmaceutical Research Institute, Department of Molecular Bi-ology, P.O. Box 4000, Princeton, NJ 08543.

3 The abbreviations used are: fisp, fibroblast-inducible secreted protein;cDNA, complementary DNA; kb, kilobase(s); bp, base pair(s); kbp, kilo-base pair(s); poly(A)�, polyadenylated; SRE, serum-responsive elements;kd, kilodalton(s); aa, amino acids; FCS, fetal calf serum; SDS, sodiumdodecyl sulfate; SSC, standard saline citrate; DMEM, Dulbecco’s modifiedEagle’s medium; cHx, cycloheximide.

FCS FCS+CHX0130, lh 2h 4h 8hU3O lh 2h 4h 8h

1��

FCS + Act D

A

I o’ 30’ 60’ 90’ 2h 4h

#{149}..B #{149}#{149}#{149}SO#{149}+CHX

FCS

C FCS+CHX

fig. I � A, Northern blot analysis of lisp- i 2 mRNA from serum-stimulated

cells. Quiescent ells )Q) were stimulated with serum for the indicatedperiods of time in the aI)sence (ICS) or presence of cycloheximide (FCS+ CHX). A i .i -kbp lisp- 1 2 cDNA was used as a probe. B, stability of lisp-12 mRNA. Quiesent �.lIs were stimulated with serum in the presenceof cycloheximide for 4 h (0’) followed by actinomycin D (Act 0) treatmentin the absence ).- CIIX( or presence )+ CHX) of cycloheximide. C.transcriptional activation of lisp-12. Nuclei were isolated from quiescentcells (Q) or from cells stimulated with serum alone (ICS) or in thepresence of cycloheximide (FCS + CHX) for the indicated periods of

time, and their transcriptional activity was determined by nuclear run-onassays (4). The labeled transcripts were hybridized against 1 �g of recom-

binant pUC19 containing a i.i-kbp lisp-i2 cDNA spotted onto Gene-

Screen Plus membrane.

226 Iisp-i2 Structure, Mapping, and Expression

Transcriptional activation

0 15’ 30’ lh 2h 4h 8h

. .#{149}.........

the half-life of fisp-i2 rnRNA, quiescent NIH 3T3 cellswere serum stimulated in the presence of cycloheximidefor 4 h and subsequently treated with actinomycin D inthe absence or presence of cycboheximide. This allowsestimation of the degradation of the accumulated lisp-i 2

transcripts in the absence of de novo transcription. Thelevels of fisp-i2 mRNA rapidly decrease after transcrip-tional inhibition by actinornycin D, with a half-life ofapproximately iO to iS mm, becoming undetectable at2 h (Fig. i B). However, in the presence of cycbohexirnide,the half-life of fisp-i2 mRNA is extended 5- to iO-fold,as indicated by the high levels of this transcript 4 h afteractinornycin D addition.

To investigate whether changes in lisp-i 2 mRNA levels

served after serum stimulation are due to transcriptionalactivation, nuclei were isolated at different periods oftime following serum addition to quiescent cells in theabsence or presence of cycboheximide, and in vitro nu-clear run-on transcription assays were performed (Fig.

iC). The level of transcription of uisp-i2 is very low inquiescent cells, but it rapidly increases after serum stim-ulation, presenting a considerable activation at is mmand reaching a maximum at i h. Thereafter, the transcrip-tional activity of lisp-i2 slowly decreases, still presentinga high level of transcription at 8 h. The presence of theprotein synthesis inhibitor prolongs the maximal tran-scriptional activation for several hours (Fig. iC).

Sequence of fisp-12 and Genomic Structure. To furthercharacterize fisp-i2, several clones were isolated from acDNA library prepared from poIy(A)� RNA of NIH 3T3cells serum stimulated for 4 h in the presence of cyclo-heximmde using as a probe Ai2, the original i.i-kbpcDNA clone (4). The longest cDNA isolated, of approxi-mately 2.3 kbp, appeared to be full length and wascompletely sequenced. The cDNA, comprising 2,252nucleotides, contains a large open reading frame of i ,044nucleotides encoding a 348-amino acid protein with apredicted molecular weight of 37,792 (Fig. 2). The 5’untranslated region of the lisp-i2 cDNA is i30 nucleo-tides long, and oligonucleotide primer extension analysisrevealed that the mRNA cap site is 89 nucleotides up-stream from the 5’ end of the clone (Fig. 2). The 3’ endnoncoding i ,07i -nucleotides-long region contains sev-eral in-frame stop codons and terminates with a stretchof adenine residues located 22 nucleotides downstreamof the consensus polyadenylation signal. The 3’ untrans-bated region contains twice the ATTTA sequence, whichis possibly involved in the rapid turnover of mRNA (40).This is in agreement with the short half-life of lisp-i2mRNAofapproximately iOto iS mm.

The predicted lisp-i2 protein sequence of 348 aminoacids has an isoelectric point of 7.8 and presents no N-linked glycosylation sites. It contains a very hydrophobicamino terminus with a predicted signal cleavage sitebetween glycine 25 and glutammne 26, suggesting that itis a secreted molecule. The protein is rich in cysteine,containing 39 cysteine residues, which represents i i%of the total number of amino acids.

To further study the lisp-i2, the 2.3-kbp cDNA wasused to screen a mouse genomic lambda library. Twolambda clones were isolated from approximately i x i06phage plaques screened. One of them, clone AF27,which hybridized with probes from the 5’ and 3’ untrans-lated regions of fisp-i2 cDNA, was selected for furthercharacterization by restriction mapping and Southernblotting. As summarized in Fig. 3, the 20-kbp mousegenomic DNA fragment present in XF27 contained theentire lisp-i2 gene. A fragment of 6 kbp which includesthe entire lisp-i2 cDNA was chosen for sequencing.Comparison of the genomic DNA and cDNA sequencesallowed the precise location of the intron/exon bounda-ries (Fig. 2). The lisp-i2 gene contains five exons and fourintrons. A TATA sequence is present 29 nucleotidesupstream of the mRNA cap site, determined by oligo-nucleotide primer extension. The consensus sequenceSRE, found in the 5’ upstream region of several imme-diate early genes (4i), is not present in a region of 800bp 5’ upstream ofthe lisp-i2 gene. One APi-like bindingsite and an inverted repeat are the only two recognizablemotifs 5’ upstream of the TATA box. Two other consen-sus sequences that we noticed are one Spi binding sitebetween the TATA box and the rnRNA cap site and anAPi-like sequence in the 5’ untranslated region of lisp-12 mRNA. From the TATA box to the poly(A)� addition

158

178

180

-8 32 TCTTTCTTCTCCCACTATATTCCCTGACACTTAGGCTTCTGAAGATAGCCATTTGGTCTG

-7 72 AACTCATAAACTTATTTTTCTAGAAAACCATGCCCAGTCATACCCCTTGCCTGCCTGGAC

-7 12 CCTGAAGACAAGTTCTTACATAA-AGAGTGCTGAAAATCTTCCTGGGAACCTACATCCTTG

- 6 52 GCTTTCATATC’TTTCAGCCATCAAAATGGCCATCTCCAGTGACCAAAGATCAATGCCTG?

-S 92 ATTTCAGATACAAAAGTTGCACATAGGAATTCTGGGAGGAGAGGAGGCATTTCAAATGGC

-S 32 TATAAGCACCCTTCTCCTCTCAGTAGAAGAACACCAAGAGACTACAGCCCCGTAAAGA��A

- 4 72 AAAAAAAAAAAATCCAAAACAAAGAAAAAGAAATATTTTTTTTAATTTCTAGGGGCCCAT

Api

-4 1 2 GGTATTTGCCTCTTGAGCTAT GAGTC GAGAAGTTTTTATGTCAGTAGCCAGAACTG

- 3 52 GCAAAGAGATTTTTAAGAAGAAAAGATCAGAGAAATAATCGTTTATTTCTAAGTTATATT

-2 92 TCATCAGGAGGGGTGAGAAGACGATATGGAGAAAGTTTTACTTCTTGGTGTTGTGCTGGA

-2 32 AACACAGCGCCTTTTTTTTTTTTTTCCTGGCGAGCTAAAGTGTGCCAGCT?TTTCAGACG

- 1 72 GAGGAATG?GGAGTGTCAAGGGGTCAGGATCAATCCGGTGTGAGTTGATGAGGCAGGAAG

-1 12 GTGGGGAGGAATGTGAGGAATGTCCCTGTTTGTGTAGGACTTCATTCAG?TCTTTGGCGA

___���VL�__ TATA-Sox ,,3pj_- 52 �

9 �

69 GACGGCAGCAGCCCCAGCCCAGCCGACAACCCCAGACGCCACCGCCTGGAGCGTCCAGAC

1 2 9 ACCAACCTCCGCCCC?GTCCGAATCCAGGCTCCAGCCGCGCCTCTCGTCGCCTCTGCACC

1 8 9 CTGCTGTGCATCCTCCTACCGCGTCCCGATCATGCTCGCCTCCGTCGCAGGTCCCATCAG

N L A S V A G P I S 10

2 4 9 CCTCGCCTTGGTGCTCCTCGCCCTCTGCACCCGGGTAAGCCCCGGGACTGACGGAAGGGA

30 9 CGGAGGGAGGGcAGAGTGAGcTGCGATCAcAGACTGACCTCCCTCCCCTTCCTCTCCGCA

3 6 9 “�CCTGCTACGGGCCAGGACTGCAGCGCGCAATGTCAGTGCGCAGCCGAAGCAGCGCCGCA

P A T G Q C C S A Q C Q C A A S A A P S 41

42 9 CTGCCCCGCCGGCGTGAGCCTGGTGCTGGACGGCTGCGGCTGCTGCCGCGTCTGCGCCAA

C P A G V S L V L 0 G C G C C S V C A S 61

4 8 9 GCAGCTGGGAGAACTGTGTACGGAGCGTGACCCCTGCGACCCACACAAGGGCCTCTTCTG

a L G S L C T S S D P C D P � S G L F C 81

S 4 9 CGATTTCGGCTCCCCCGCCAACCGCAAGATTGGAGTGTGCACTGGTAAGACCCTCAGCCC

S F G S P A S S S I G V C T A 96

6 09 CATTCCAGCCCCCTT?GCAGAGGCCTCACC?TTTGGTGTTGGACCACCACCTCTCTCAAG

669 TCCAGCGTGATACCCTCTAGAAAAAGAAAAGCCCCTATCCGCAGCTGCTTCCAACCGGCC

729 CCCTGCAGTCCTGACCCTAGCTCGTCACCTTGACATGTACAGTGATATAGCTAGCTGTTC

7 8 9 TGATCCCTGTGACCCTACGCCTGACCTCTACAACTTTGTCTTCCTCTCCTGC��CCAAAG

S 0 98

849

L A L V L L A L C V S 21

290

310

330

348

1989

2049

2109

2169

2229

2289

2349

2409

2469

2529

2589

2649

2709

2769

2829

2889

2949

3009

3069

G A P C V F G G S V V S S G S S F Q S S 118

V

AUG

amino acids. Exons 3, 4, and 5 encode for similar numberof amino acids, 85, 70, and 98, respectively. The longestexon of all is exon 5 (i,364 nucleotides long) containingi,071 nucleotides ofthe 3’ untranslated region.

Comparison of the predicted sequence of lisp-i 2 pro-tein (FISP-i2) with several protein databases revealed ahigh similarity to CEF-lO, a chicken protein sequencededuced from a src-inducible cDNA clone (36), and tothe recently described mouse homologue of CEF-iO,CYR-6i, isolated as an immediate early gene (Ref. 35;

H S � Fig. 4). These proteins also contain a putative leaderI I .Cx i-� sequence. The overall identity between FISP-i2 and

CYR-6i/CEF-iO is 65%. The 38 cysteine residues of FISP-i2 present after the signal cleavage site are conserved inCYR-6i/CEF-iO, suggesting that the cysteines have an

____________ #{176};�:‘ important role in the function of these molecules. A largervariability is found between amino acids 166 and 198 of

o� FISP-i2 compared to CYR-6i in a region where no cys-i-i teine residues are present. It is interesting to note that

the same region presents a significant divergence be-tween CYR-6i and CEF-iO. In contrast to FISP-i2, bothCYR-6i and CEF-lO contain several acidic residues inthis area.

Expression of fisp-i2 mRNA in Adult Organs. Theexpression of lisp-i2 mRNA was examined in differentadult mouse organs by Northern blots using a i.i-kbplisp-i2 cDNA as a probe (Fig. 5). A mRNA molecule of

Cell Growth & Differentiation 227

90 9 GCTGCAAATACCAATGCACTTGCCTGGATGGGGCCGTGGGCTGCGTGCCCCTATGCAGCA

C � I Q C T C L 0 0 A V G C V P 1. C S W 138

969 TGGACGTGCGCCTGCCCAGCCCTGACTGCCCCTTCCCGAGAAGGGTCAAGCTGCCTGGGA

D V S L P S P 0 C P P P 1 5 V S 1. P G S

1 029 AATGCTGCAAGGAGTGGGTGTGTGACGAGCCCAAGGACCGCACAGCAGTTGGCCCTGCCC

C C S #{163}S V C D I P K D S V A V G PAL

1 0 8 9 TAGCTG�GAGTTGTCTCCTTCAAAGTTACTGTTATTCATTCTCCCCAACTTCAGGCCAAA A

1 1 4 9 TGCCCAAGTCCACCAAATTAAGGGGAAATTGTCCTATCCGGATGTTTTACCTTGTGTT?G

1 2 09 TGTGTTCTGCTCTCACAGCCTACCGACTGGAAGACACATTTGGCCCAGACCCAACTATGA

V S L I S V P C P 0 P V N Ii 194

1 2 69 TGCGAGCCACTGCCTGGTCCAGACCACAGAGTGGAGCGCCTGTTCTAAGACCTGTGGAA

S A S C L V Q V V I V S A C S S T C G 81 214

I 329 TGGGCATCTCCACCCGAGTTACCAATGACAATACCTTCTGCAGACTGGAGAAGCAGAGCC

0 I S V S V T S 0 II V P C S L I S Q S S 234

1 389 GCCTCTGCATGGTCGGCCCTGCGAAGCTGACCTGGAGGAAAACATTAAGGTACATCCTC

L C S V S P C S A S L I S S I S 250

1 4 4 9 TGCCCCTAGTCACTCCGTTTTACAGAATGACAGGGAAGAGAACCGAGCTGGCTGTCTCAC

1 50 9 CTCCCATGTTATTAGAGGCCTGTTGTC?CCAGAAATATCTAACCGTGGAGCTGTCTGGCT

1 569 AGAATGAGAGATGCIGTAACAACAGCTGCCAGTTTTCCACTACAAAATTCCCCGTGGTGC

1 629 TAGTTAATTCAAGACACTCCAAATGAGGCCATGGCTATTTTTGGGAAACTGGCAAATGAA

1 68 9 ACTCCCAGTCTCTCCCCTCAGAATATAAACACAAGTCAGATGACATAGGGCTAGTCTACA

1 7 49 AAGGCTTGAGGAAGGCCACTCCCGTTGTAGTAATTGCTGTTTCTCCTTCTGTCTTCCTTA

1 80 9 GAAGGGCAAAAAGTGCATCCGGACACCTAAAATCGCCAAGCCTGTCAAGTTTGAGCTTTC

K G S S C I S T P 1 I A S P V K P 1 L S 270

1 8 69 TGGCTGCACCAGTGTGAAGACATACAGGGCTAAGTTCTGCGGGGTGTGCACAGACGGCC0

G C V S V S V V ft A S P C C V C V C G S

I 92 9 CTGCTGCACACCGCACAGAACCACCACTCTGCCAGTGGAGTTCAAATGCCCCGATGGCGA

C C V P � ft V V T L P V I P K C P S CS

GI�TCATGAM�AAGAATATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCTGG

I S S S ai s ii r I S V C A C H V ii C PG

GGAC Ak TGAC ATCT TTGAGTCCCT ST AC TAC AGGAAGATGT ACGGAGAC A TGGCGT AAAG

D II D I P 5 8 L V V S S Ii V G D S A#{149}

CCAG0AAGTAAGGGACACGAACTCATTAGACTATAACTTGAACTGACTTGCATCTCATTT

TCTTCTGTAAAAACAATTACAGTAGCACATTA5LLL5AATCTGTGTTTTTAACTACCGTG

55 AGGAAC TA TC CC ACCAAAGTGAGAAC 57? ATGTC ATGGCC AT AC AAGT AG TC TGTC AA

CCTCAGACACTGGTTTCGAGACAGTTTACACTTGACAG?TGTTCATTAGCGCACAGTGCC

AGAACGCACACTGAGGTGAGTCTCCTGGAACAG?GGAGATGCCAGGAGAAAGAAAGACAG

GTACTAGCTGAGGTTATTTTAAAAGCAGCAGTGTGCCTACTTTTTGGAGTGTAACCGGGG

AGGGAAATTATAGCA?GCTTGCAGACAGACCTGCTCTAGCGAGAGCTGAGCATGTGTCCT

CCACTAGATGAGGCTGAGTCCAGCTGTTCTTTAAGAACAGCAGT??CAGCCTCTGACCAT

TCTGATTCCAGTGACACTTGTCAGGAGTCAGAGCCT?GTCTGTTAGACTGGACAGCTTGT

GGCAAGTAAGTTTGCCTGTAACAAGCCAGATTTTTATTGATATTGTAAATATTGTGGATA

TATATATATATATATATATTTGTACAGTTATCTAAGTTA�,LIAAAGTCATTTGTTTTTG

TTTTAAGTGCTTTTGGGATTTTAAACTGATAGCCTCAAACTCCAAACACCATAGGTAGGA

CACGAAGCTTATCTGTGATTCAAAACAAAGGAGATACTGCAGTGGGAATTGTGACCTGAG

TGACTCTCTGTCAGAACAAACAAATGCTGTGCAGGTGATAAAGCTATGTATTGGAAGTCA

GA TT TC T AG? AGGAAATG TGGTC AAATCCC TGTTGGTGAAC AAATGGCCT 7? AT 7 AAG AA

ATGGCTGGCTCAGGGTAAGGTCCGATTCCTACCAGGAAGTGCTTGCTGCTTCTTTGATTA

TGACTGGTTTGGGGTGGGGGGCAGTTTATTTGTTGAGAGTGTGACCAAAAGTTACATGTT

3 1 2 9 ?GCACCTTTCTAGTTGAA�5�5�AGTATATATATATTTTTTATATGAAAGGCTTGGCTGT

3 1 8 9 TCA?TCTTGTAAACAAAACAAGGAAAACCCGGGTGTAAGCAAGAAGTTCATATTTATCTT32 4 9 AAGGTAATTCACTAGGAAGTTTACAAATACCTTTGATATGCATGAATC

Fig. 2. Nucleotide sequence ofthe fisp-12 gene. V, the site oftranscriptional initiation, as determined by oligonucleotide primer extension analysis; V,the first and last nucleotides ofthe fisp-12 cDNA. The ATTTA sequences present in the 3’ noncoding region and the polyadenylation signal AATAAA areunderlined. Broken arrows, the intron-exon boundaries. The TATA box and other consensus sequences are also indicated. I�R, inverted repeat.

signal AATAAA, the lisp-12 gene is 3,176 nucleotideslong. The region containing the coding part of lisp-i2 isdistributed in a genomic fragment of approximately i .9kbp. The first exon of the fisp-i2 gene contains thecomplete 5’ untranslated region and encodes the first 2iamino acids belonging to the signal peptide. The shortestintron separates it from the second exon, encoding 74

H S� S

MANA � 1

p,�s�S II

� a g

Fig. 3. Cenomic structure of the fisp-12 gene. A restriction map of the20-kbp A genomic clone F27 coveringthe complete (isp-i 2 gene is shown.An enlargement of the (isp-i 2 gene structure is shown underneath. Boxes,

exons. Shaded areas in the gene and mRNA correspond to the codingregions. In the protein, the shaded area corresponds to the processedform of the molecule. B, BamHl; E, EcoRl; H, Hindlll.

i2 mRNA was found in intestine, liver, and thymus.Rehybridization of the blots with a glyceraldehyde-3-phosphate dehydrogenase probe indicated that differ-ential tissue expression of lisp-i2 rnRNA was not due tovariable amounts of poly(A)� RNA applied in the respec-tive lanes (data not shown). This expression pattern offisp-12 is similar to that described for cyr-6i (35).

Expression of fisp-12. In order to investigate whetherthe FISP-i2 signal cleavage site was functional, the com-plete coding sequence of uisp-i2 cDNA was cloned intothe T3/T7 promoter-based vector Bluescript KS(+) andtranscribed in vitro using T7 polymerase. The RNA tran-script was translated in a rabbit reticulocyte Iysate systemin the absence or presence of microsomes. The identityof the in vitro translated products was confirmed byimmunoprecipitation using a polycbonal antiserum raisedagainst a FISP-i2 fusion protein. The in vitro synthesizedpolypeptide in the absence of microsomes migrates as a

312 FISP-12 37 kd protein, which is in good agreement with the� � predicted molecular weight of FISP-i2 (Fig. 6). In vitro

translation of the RNA in the presence of microsomes348 FISP-12 generates a smaller molecular weight protein of approx-�:;: �;=� imately 35 kd, indicating that FISP-i2 contains a func-

tional signal cleavage site and possibly is a secretedprotein.

In Vitro Products

0)U) .� C >�0)_ 0)0)

� Q) C

Ow- �LL�I-.E U) �

C/)

L� �) t E .�

> :, � .C.J�jI�- � -69

-46

f -.�i !�� $�Vj $ -2.3kb

Fig. 5. Expression of lisp-12 mRNA in mouse adult tissues. Two �g of

poly)AC RNA were applied in each case. As control, 0.2 gg of poIy(A)�mRNA from serum-stimulated cells for 4 h in the presence of the cyclo-heximide has been inc luded.

-30

-21

fig. 6. In vitro expression of FISP-i 2 protein. In vitro translation productsof lisp-i2 mRNA using a rabbit reticulocyte system in the absence (-) orpresence (+) of dog pancreas microsomes. In vitro translated productsimmunoprecipitated with an anti-FISP-i 2 antibody (cs-fISP- 12).

228 tisp-12 Structure, Mapping, and Expression

HLASVAGP I � 5 0 F I SP -12�.4SSSTFRTLA\4**I44). :1IRH* . S1�A)4�H�LE � 4 7 CYR- 61

�4GSAGARP . AI1�1A4i4ctI . AIRJ4AJLGSPI�J)��AA � 4 7 CEF- 10

DGCGC CAKQ ER C KG PANRKIftftj�C.D� 99 FISP-12

DGCGC CAPCQ K? C KG F SSTALc�’4I4QSE� 97 CYR-61

DGCGC CAR AT C KG SPAAT04�I�4AJQSF� 97 CEF-lO

A�v FGGSVf�R ES? CT GAVG L ?4DVRfi�SP p 149 FISP-12

14’cjEYNSR4A�Q ES? CT GAVG I L QEL�LP�NL P 147 CYR-61

R��YNSKIt5IQ E F CT �V I L QELSI0,�NL P 147 CEF-lO

�‘�9f�L wvco KDRTAVGP ?�i�,4�YR4�ij. . . . 186 FISP-12

)PP�Llv4� WVCD SIKDSLDDQDDL. . . . � 193 CYR-61

[��JL)y��v WVCD .S.KDALEELEGFFSKEFdIJ4AJSSG�Lt�RNNE 195 CEF-lO

F D�. . TMM Ak QT S 212 FISP-12

LIAIGXGSSLKRLP F E�. . RVLFNPLHAHGQ QT S 241 CYR-61

LIAIVKG.GLR84LP F !�QSRAFENP T S 238 CEF-lO

(�.$:; ISTRVTND)4T R S RPC ADLEEN EGEX Ii8fijP�IA 262 FISP-12

IT�ISTRVTND* R RPC QPVYSS EGEX )$!�4i�P 291 CYR-61�$ISTRVTND* A RPC QPSYAS KGKI( iihJK�P 288 CEF-lO

�“* ��FNKT�A YNC 1$�2IFESI�JYRKMYc�4A . ...

s)K�8 .)I�QS�X YNC H9$ASFRI)S). . SLFS4,�IHKFRD

:it�s .NQ�R YNC H*A.YPFISJ. .RLVS�IHKFRD

Fig. 4. Comparison among the predicted amino acid sequences of FISP-

i2, CYR-61, and CEF-lO. Identical residues in the three sequences arehosed and shaded. Identical residues present in two of the three Se-

quences are only shaded.

identical size (2.3 kb) to the one detected in stimulatedNIH 3T3 cells was present in poly(A)� RNA samples fromtestis, spleen, kidney, lung, heart, and brain. The lowestlevel of expression is observed in testis and the highestin lung. The latter, however, is approximately iO to 20times lower than the level of expression observed inserum-stimulated NIH 3T3 cells. No expression of lisp-

a-FISP-1 2

- + l_

. _c;.

- . __� -‘��r-

a-FISP-1 2

FCS - Tunicamycin

46-

30-

___________________ MediumI FCS4h

FCS + Tunicamycin Tunicamycin

I � I I I

Q lh 2h 4h 8h Q lh 2h 4h 8h - +

�:T:�

A B C

Cell Growth & Diflerentiation 229

Fig. 7. Synthesis of FISP-i2.Synthesis was determined by im-

munoprecipitating FISP-i2 fromthe medium of serum-stimulatedNIH 3T3 cells for the indicated

periods of time in the absence(A) or presence (B) of tunicamy-cm using an anti-FISP-12 anti-body. C, effect of tunicamycin in

the glycosylation of the serum-inducible glycoprotein p45 (42).

Cells were continuously labeledwith [35S]methionine.

To study the expression of FISP-12 and to confirm thatit is a secreted protein, quiescent NIH 3T3 cells wereserum stimulated and continuously labeled with [355]

methionine for different periods of time. The synthesisof FISP-12 was determined by immunoprecipitating themedium at the indicated times with anti-FISP-i 2 antibodyfollowed by gel electrophoresis. As shown in Fig. 7A,FISP-i2 rapidly accumulates in the medium of serum-stimulated cells. Longer exposure times revealed that theprotein is already present in the medium at significantlevels after i h stimulation. The amount of secreted FISP-i2 remains relatively constant after 4 h. To establish

whether the two proteins immunoprecipitated from themedium correspond to the precursor and processed formof FISP-i2, their migration was compared to that of thein vitro translated FISP-i2. The results reveal that thefaster migrating band present in the medium correspondsto the processed form of FISP-i2; however, the upperband does not comigrate with the unprocessed in vitrotranslated FISP-i2, suggesting that this could be due toposttranslation modifications. Although the sequence ofFISP-i2 does not contain putative N-linked glycosylationsites, experiments to confirm this were performed in thepresence of 5 jog/mI of tunicamycin. As shown in Fig. 7B,tunicamycin does not affect the proportion of the twoforms precipitated by the anti-FISP-i2 antibody but af-fects that of another major glycosylated protein, p45,previously shown to be a serum-induced glycoprotemn(Ref. 42; Fig. 7C). To further confirm that the highermolecular weight protein immunoprecipitated by anti-FISP-i2 antibody was not glycosylated, cells were labeledwith [3H]mannose and [3H]glucosamine for several hoursfollowing stimulation. Then the medium was immuno-precipitated with anti-FISP-i2 antibody and analyzed bygel electrophoresis. No radioactivity was incorporatedinto the two forms, demonstrating that none of them is aglycoprotein (data not shown). To prove the relationbetween the two proteins immunoprecipitated by theanti-FISP-i 2 antibody, one-dimensional peptide map-ping of the proteins was performed. The results demon-

strated that, indeed, the proteins are highly related (datanot shown). There are two main possible explanationsfor the appearance ofthe different forms of FISP-12. Thefirst explanation is that the lisp-i2 gene generates twoproducts by differential splicing or alternative transcrip-tional initiation sites. Indeed, intron 3 has a continuousopen reading frame in phase with exons 3 and 4; there-fore, if no splicing occurs, a longer FISP-i2 could begenerated. To investigate this possibility, polymerasechain reaction analysis was performed, using as primersoligonucleotides from position 999 to i,OiO and 1,293to i,3i2 in the opposite direction (see Fig. 2) from mRNAof stimulated NIH 3T3 cells. Only a fragment of 320 bpwas found, corresponding to the fisp-12 transcript with aspliced intron (data not shown), eliminating the possibilitythat the higher molecular weight protein recognized bythe anti-FISP-i2 antibody is generated by alternativesplicingofthe intron 4 ofthe lisp-i2 gene. However, thisdoes not exclude the existence of two lisp-i 2 transcripts.A second explanation would be that the anti-FISP-i2antibody cross-reacts with the highly related proteinCYR-6i, or with yet another unknown member of thefamily which is also secreted and serum inducible.

To determine how rapidly FISP-i2 was secreted fromthe cells and to ascertain its half-life in the medium,pulse-chase experiments were performed. Cells wereserum stimulated in the presence of cycboheximide for 2h to superinduce the uisp-i2 mRNA and then labeledwith [35S]methionine for 20 mm and chased for differentperiods of time. As shown in Fig. 8, after 30 mm chase,nearly the same amount of FISP-i2 is already found inthe medium as compared to that remaining in the cells,demonstrating that FISP-i2 is rapidly secreted after beingsynthesized. Only a very small amount of protein remainsin the cell after 2 h chase. The amount of labeled FISP-12 present in the medium starts decreasing after 1 hchase, indicating that the protein is unstable. The half-life of FISP-i2 has been estimated to be approximately60 to 90 mm. From the results shown in Fig. 8, it is alsoevident that the ratio of the two polypeptides immuno-

4

I

r1�1�

230 lisp- 1 2 Stru ture, Mapping. and Expression

S

ct-FISP-1 2

Chase

Medium Cells

0’ 30’ ih 2h 4h 30’ ih 2h

_

4h

fig.8. Stabilityof FISP-i2. Serum-stimulated NIH 3T3 cells were labeledfor 20 nun with [35S]methionine and then chased for the indicated Periods

of time. FISP-i2 present in cells and medium was determined by inimu-nopre ipitation with anti-FISP- 1 2 antibody.

precipitated by anti-FISP-i2 antibody does not signifi-cantly change during the chasing period, as would be

expected for a precursor and its processed form or forposttranslational modifications.

Chromosomal Localization of fisp-i2 Gene. To deter-mine the chromosomal localization of the lisp-i2 gene,in situ hybridization experiments were performed usingmetaphase spreads from a WMP male mouse. The corn-plete coding region of fisp-12 cloned in Bluescript was

used as a probe. In the 100 metaphase cells examinedafter in situ hybridization, there were 138 silver grains

associated with chromosomes, and 46 of these (33.3%)were located on chromosome 10 (Fig. 9). The distributionof the grains in this chromosome was not random: 38 of46 (82.6% of them) mapped to the (A3-B1) region ofchromosome iO. These results allow us to map the lisp-12 gene to the [iOA3-iOBl] region of the murine ge-nome.

Discussion

In this report, we describe the characterization of lisp--46 12, an immediate early gene previously isolated in our

laboratory by differential screening of a lambda libraryprepared with RNA from quiescent NIH 3T3 cells treated

with serum for 4 h in the presence of cycloheximide. We- 30 have shown that accumulation oflisp-i 2 mRNA following

serum stimulation is due to a dramatic increase in itstranscription rate. In contrast to the transient expressionof other immediate early genes, the expression of lisp-i 2lasts many hours. The half-life of fisp-i2 mRNA is ap-proximately i S mm, and its expression, as for many otherimmediate early genes, is superinduced in the presenceof protein synthesis inhibitors.

fisp-i2 encodes a 38 kd cystemne-rich protein contain-ing an NH2-terminal secretory signal, indicating that theprotein may be secreted from the cell. We have dem-onstrated in a cell-free protein translation system that theNH2-terminal secretory signal and cleavage site of FISP-12 are functional.

FISP-12 rapidly appears in the medium following stim-ulation of quiescent NIH 3T3 cells, resembling the kinet-ics of the mRNA. The protein is efficiently secreted bythe cell, and its half-life is approximately 60 to 90 mm,as determined by pulse-chase experiments. Tunicamy-cm, which is known to interfere with the addition of N-linked carbohydrate units to asparagine without affectingmembrane insertion and cleavage of the signal sequence,has no effect in the electrophoretic mobility of FISP-i2,

Fig. 9. Localization of the fisp-i2

gene to mouse chromosome 1 0 byin situ hybridization. Left, two par-

hal WMP mouse metaphases,showing the specific site of hybrid-izatton to chromosome iO. Top.

arrowheads indicate silver grainson Giemsa-stained chromosomes,after autoradiography. Bottom,chromosomes with silver grains

were subsequently identified by R-banding. Right, diagram of WMPmouse Rb (iO;i7) chromosome,indicating the distribution of Ia-beled sites.

Cell Growth & Differentiation 231

demonstrating that it is not glycosylated. This was con-firmed by the finding that neither radioactive mannosenor glucosamine is incorporated into FISP-i2.

FISP-i2 shows strong similarity to another cysteine-rich protein, CEF-iO, originally described in chicken as asrc-inducible protein (36) and recently identified as animmediate early gene in mouse and named CYR-6i (35).The most striking observation is that the 38 cysteinespresent in the processed forms of these three proteinsare all conserved. The role ofthese residues is not known,but their conservation during evolution from avian tomammal supports the idea that they have an important

functional role. As no other proteins have been describedto contain an identical cysteine distribution, FISP-i2 andCYR-61/CEF-i0 are possibly the first members of anemerging family of secreted proteins of unknown func-tion. It is important to note that these proteins contain intheir amino terminal part (FISP-i2 aa 47 to 68 and CYR-6i aa 45 to 66) a region including five cysteines whichpresents a significant similarity (60% identity) with theinsulin-like growth factor-binding protein-i (aa 26 to 49)(43). As it has been shown that the 75 NH2-terminalamino acids of insulin-like growth factor-binding protein-1 are involved in the binding of insulin-like growthfactor-i (44), it is tempting to postulate that FISP-1 2 andCYR-6i are putative growth factor-binding proteins. Atpresent, the role of these molecules in the proliferativeresponse of fibroblasts is unknown, but we favor the ideathat FISP-12 might be part of a mechanism necessary tocoordinate and integrate the different events that mustoccur in an ordered fashion in biological responses suchas wound healing, in which several cell types are in-volved. Therefore, FISP-i2 could be required by somecell types to migrate and remain in the damaged areauntil healing is completed.

In the 5’ upstream region of the lisp-i2 gene, no SREhas been found in up to 800 nucleotides. This cis-actingelement has been identified in immediate early genes,which present a rapid but transient induction followingserum stimulation (for a review, see Ref. 41). In contrastto these genes, the expression of lisp-i 2 as shown by therun-on experiments lasts several hours. It is possible thatthe absence of a SRE is responsible for this type ofexpression, as it has been demonstrated that this elementis essential for the transrepressing activity displayed bythe c-los protein (45-47) and could be involved in switch-ing off the expression of some immediate early genes(47). It will be of interest to determine whether the regionthat we have characterized has the capacity of conferringserum responsiveness to a reporter gene. This wouldallow the identification of new elements involved in thecontrol of gene expression.

Materials and Methods

Cell Culture. NIH 3T3 cells were routinely grown inDMEM supplemented with 10% FCS and antibiotics (iOOunits/mb penicillin and 50 zg/ml streptomycin). Confluentcells were made quiescent by incubating them for 48 hin i% FCS. For stimulation, quiescent cells were incu-bated in iO% FCS for the indicated periods of time.When used, cycboheximide was added at 10 ,zg/ml, ac-tinomycin D at i �g/ml, and tunicamycin at 5 zg/mI.

RNA Extradion and Northern Blot Analysis. Total RNAwas prepared from cells and tissues using the guanidinehydrochloride procedure (48). To obtain poly(AY� RNA,

total RNA was dotted onto messenger-activated paper(Organics, Ltd.), washed twice for i 5 mm in buffer (0.5M NaCI-i mM EDTA-20 m�i Tris-HCI, pH 7.6), and thenwashed with 70% ethanol for 10 mm. After the messen-ger-activated paper was dried, the poIy(A)� RNA wasreleased by incubation in water at 70#{176}Cfor 5 mm. ForNorthern blot analysis, RNA was separated in i % agarosegels containing 6% formaldehyde (49) and blotted ontoCeneScreen Plus membrane (NEN-DuPont). A purifiedinsert was labeled by nick-translation to a specific activityofi to 5 x 108 cpm/zg (50). The hybridization was carriedout in 50% formamide, 0.5% SDS, 5x SSC (ix SSC =

i50 mr�i NaCI-i5 mM sodium citrate) and 5x Denhardt’ssolution at 42#{176}Cfor 40 h. Filters were extensively washedin 0.iX SSC containing 0.5% SDS at 60#{176}C.

Genomic Library Screening and Southern Blotting. Thegenomic library was generated by cloning fragments froma partial digestion of mouse DNA with Sau 3a into A Dashvector (Stratagene). A total of 1 x i0� phage plaqueswere screened as described (Si). The complete originallisp-i2 (A12) cDNA, nick-translated to a specific activityof S x i o� cpm/zg, was used as a probe (SO). For Southernblotting experiments, restriction fragments from phageDNA were separated on 1 .2% agarose gels and trans-ferred to a GeneScreen Plus membrane as described(52). Hybridization and washing was carried out as mdi-cated above. One of the clones, XF27, containing a 20-kbp mouse genomic fragment, was further characterized.

DNA Sequencing and Analysis. The 2.3-kbp lisp-i 2cDNA and a 6-kbp DNA fragment isolated from XF27and containing the complete lisp-12 gene, including the5’ and 3’ flanking sequences, were subcboned into Blue-

script KS(+), and nested deletions were performed using

a Pharmacia kit. Fragments corresponding to a series ofapproximately 250 bp deletions were used for sequenc-ing. Double stranded sequencing (53) of each clone wasperformed by the dideoxy chain termination method (54)using the 17 DNA sequencing kit (Pharmacia). Nucleo-tide and amino acid sequence analyses were carried outusing the University of Wisconsin Genetics Computer

Group Sequence Analysis Software Package, Version 6.2.Antiserum. To raise antiserum against FISP-12, a (rag-

ment encoding the last 169 amino acids of FISP-i2 wasrecloned into pEX 34a (55), and the fusion protein wasexpressed in Escherichia co/i K537. After purification, the

fusion protein was injected into rabbits using routineprotocols. The specificity of the antibody was tested byimmunoprecipitation and immunoblotting.

Cell Labeling and Immunoprecipitation. For pulse-chase experiments, quiescent NIH 3T3 cells were in-

duced with iO% FCS in the presence of cycloheximidefor 2 h, and then the inhibitor was removed by washingtwice with iO% dialyzed FCS in methionine-free DMEMand incubated for i S mm. The cells were labeled for 20mm with i mCi/mI of [35S]methionine in DMEM minusmethionine supplemented with 10% dialyzed FCS andchased with DMEM containing cold methionine (iO timesthe normal DMEM concentration) for the indicated times.For continuous labeling with [35S]methionine, quiescentNIH 3T3 cells were rinsed twice with DMEM plus methi-onine and then labeled for different times with 1 mCi/mIof [35S]methionine in DMEM without methionine supple-mented with iO% dialyzed FCS. To determine the effect

232 fisp-i2 Structure, Mapping, and Expression

of tunicamycin, cells were preincubated with the drugfor i h and labeled as above in the presence of tunica-mycin. The cellulose lysis was performed in denaturingbuffer (50 mM Tris-HCI, pH 7.5, 0.5% SDS, and 70 m�ifl-mercaptoethanol), boiled for iO mm, and then dilutedby adding 4 volumes of radioimmunoprecipitation assaybuffer without SDS (iO m�i Tris-HCI, pH 7.5, i% sodiumdeoxycholate, i% Nonidet P-40, 150 m�i NaCI, and 0.25mM phenylmethylsulfonyl fluoride). The media fromthese labeling experiments were lyophilized and thenresuspended in denaturing buffer and processed as thecellular preparations.

Lysates (final volume, 1 ml) were incubated with anti-serum (12 �I) for i h on ice followed by incubation with30 zl of Protein A-Sepharose CL-4B (Pharmacia) for 3 hon a roller system at 4#{176}C.The immunocomplexes withthe Protein A-Sepharose beads were washed twice withbuffer A (10 mM Tris-HCI, pH 7.5, iSO m�i NaCI, 2 m�iEDTA, and 0.2% Nonidet P-40), once with buffer B (iOmM Tris-HCI, pH 7.5, 500 m�i NaCI, 2 m� EDTA, and0.2% Nonidet P-40), and once with buffer C (10 mt�i Tris-HCI, pH 7.5). After boiling the samples in 2X Laemmlisample buffer, they were run overnight on a i 5% acryl-amide-bisacrylamide gel (200:i) at i2 mA/gel. Fixed gelswere incubated in Entensify (NEN-DuPont), dried, andexposed to Kodak X-OMAT AR film at -70#{176}Cfor differ-ent times.

All lysates were initially absorbed with 3 z1 of rabbitpreimmune serum and incubated at 4#{176}Cfor i h in thepresence of 30 al of Protein A-Sepharose, and this su-pernatant was then used for the immunoprecipitationswith anti-FISP-i2.

Mouse Gene Mapping by in Situ Hybridization. In situhybridization experiments were carried out using meta-phase spreads from a WMP male mouse, in which all ofthe autosomes except i 9 were in the form of metacentricrobertsonian translocations. Concanavalin A-stimulatedlymphocytes were cultured at 37#{176}Cfor 72 h with 5-bromodeoxyuridine added for the final 6 h of culture (60�ig/ml of medium) to ensure a chromosomal R-bandingof good quality. The lisp-i2 clone containing an insert of2.3 kbp in Bluescript KS(+) was tritium labeled by nick-translation to a specific activity of i .4 x i08 dpm/zg. Theradiolabeled probe was hybridized to metaphase spreadsat a final concentration of 25 ng/mI of hybridizationsolution, as previously described (56). After coating withnuclear track emulsion (Kodak NTB2), the slides wereexposed for i8 days at 4#{176}Cbefore being developed. Toavoid any slipping of silver grains during the bandingprocedure, chromosome spreads were first stained withbuffered Giemsa solution, and metaphases were photo-graphed. R-banding was then performed by the fluoro-ch rome-photolysis-G iemsa method, and metaphaseswere rephotographed before analysis.

References

1. Cochran, B. H., Reffel, A. C., and Stiles, C. D. Molecular cloning ofgene sequences regulated by platelet derived growth factor. Cell, 33:939-947. i983.

2. Lau, 1. F., and Nathans, D. Expression of a set of growth-relatedimmediate early genes in BALB/c 3T3 cells: co-ordinate regulation withc-(os or c-myc. Proc. NatI. Acad. Sci. USA. 84: i 182-i i86, i987.

3. Lim, R. W., Varnum, B. C., and Herschman, H. R. Cloning of tetrade-canoyl phorbol ester-induced ‘primary response’ sequences and theirexpression in density-arrested Swiss 3T3 cells and a TPA non-proliferativevariant. Oncogene, 1: 263-270, i987.

4. Almendral, J. M., Sommer, D., Macdonald-Bravo, H., Burckhardt, J.,Perera, J., and Bravo, R. Complexity of the early genetic response togrowth factors in mouse fibroblasts. Mol. Cell. Biol., 8: 2140-2i48, 1988.

5. Greenberg, M. E., and ziff, E. B. Stimulation of 3T3 cells inducestranscription ofthe c-(os proto-oncogene. Nature (Lond.), 31 1: 433-438,1984.

6. MUller, R., Bravo, R., Burckhardt, J., and Curran, T. Induction of c-(osgene and protein by growth factors precedes activation of c-myc.Nature(Lond.), 312: 7i6-720, i984.

7. Ryder, K., and Nathans, D. Induction of protooncogene c-iunbyserum growth-factors. Proc. NatI. Acad. Sci. USA, 85: 8464-8467, 1988.

8. Ryseck, R-P., Hirai, S. I., Yaniv, M., and Bravo, R. Transcriptionalactivation of c-iun during the GO/Cl transition in mouse fibroblasts.Nature (Lond.), 334: 535-537, i988.

9. Bull, P., Hunter, T., and Verma, I. M. Transcriptional induction of themurine c-rel gene with serum and phorbol-12-myristate-i3-acetate infibroblasts. Mol. Cell. Biol., 9: 5239-5243, i989.

10. Kelly, K., Cochran, B. H., Stiles, C. D., and Leder, P. Cell specificregulation of the c-mycgene by lymphocyte mitogens and platelet-derived growth factor. Cell, 35: 603-610, 1983.

1 1 . Zerial, M., Toschi, I., Ryseck, R-P., Schuermann, M., MUller, R., andBravo, R. The product of a novel growth factor activated gene, los B,interacts with JUN proteins enhancing their DNA binding activity. EMBOJ.,8:805-813, 1989.

12. cohen, D. R., and Curran, T. ha-i: a serum-inducible, cellular im-mediate-early gene that encodes for a (os-related antigen. Mol. Cell. Biol.,8: 2063-2069, 1988.

13. Cohen, D. R., Ferreira, P. C. P., Centz, R., Franza, B. R., Jr., andCurran, T. The product of a (os-related gene, fra-i, binds cooperativelytothe AP-i site with Jun: transcription factor AP-l is comprised of multipleprotein complexes. Genes & Dev., 3: 173-184, 1989.

14. Matsui, M., Tokuhara, M., Konuma, Y., Nomura, N., and Ishizaki, R.Isolation of human (os-related genes and their expression during mono-cyte-macrophage differentiation. Oncogene, 5: 249-255, 1990.

15. Nishina, H., Sato, H., Suzuke, T., Sato, M., and ba, H. Isolation andcharacterization of (ra-2, an additional member of the los gene family.Proc. NatI. Acad. Sci. USA, 87: 36i9-3623, 1990.

16. Ryder, K., Lau, 1. F., and Nathans, D. A gene activated by growthfactors is related to the oncogene v-jun. Proc. NatI. Acad. Sci. USA, 85:1487-1491, 1988.

17. Hazel, T. C., Nathans, D., and Lau, L. F. A gene inducible by serum

growth factors encodes a member of the steroid and thyroid hormonereceptor superfamily. Proc. NatI. Acad. Sci. USA, 85: 8444-8448, 1988.

18. Milbrandt, J. Nerve growth factor induces a gene homologous to the

glucocorticoid receptor gene. Neuron, 1: 183-188, 1988.

19. Ryseck, R-P., Macdonald-Bravo, H., Matt#{233}i,M-G., Ruppert, S., andBravo, R. Structure, mapping and expression of a growth factor induciblegene encoding a putative nuclear hormonal binding receptor. EMBO J.,8: 3327-3335, i989.

20. Milbrandt, J. A nerve growth factor-induced gene encodes a possibletranscriptional regulatory factor. Science (Washington DC), 238: 797-799, 1987.

21. Christy, B. A., Lau, L. F., and Nathans, D. A gene activated in mouse3T3 cells by serum growth factors encodes a protein with #{176}zincfinger”sequences. Proc. NatI. Acad. Sci. USA, 85: 7857-7861, 1988.

22. Lemaire, P., Revelant, 0., Bravo, R., and Charnay, P. Two mousegenes encoding potential transcription factors with identical DNA-bindingdomains are activated by growth factors in cultured cells. Proc. NatI.Acad. Sci. USA, 85: 4691-4695, i988.

23. Sukhatme, V. P., Cao, X., Chang, L. L., Tsai-Morris, C. H., Stamen-kovich, D., Ferreira, P. C. P., Cohen, D. R., Edwards, S. A., Shows, T. B.,Curran, 1., Le Beau, M. M., and Adamson, E. D. A zinc-finger encodinggene coregulated with c-Fos during growth and differentiation, and aftercellular depolarization. Cell, 53: 37-43, 1988.

24. Lemaire, P., Vesque, C., Schmitt, J., Stunnenberg, H., Frank, R., andcharnay, P. The serum-inducible mouse gene Krox-24 encodes a se-quence-specific transcriptional activator. Mol. Cell. Biol., 10: 3456-3467,1990.

25. Chavrier, P., zerial, M., Lemaire, P., Almendral, J. M., Bravo, R., andCharnay, P. A gene encoding a protein with zinc fingers is activatedduring GO/Gi transition in cultured cells. EMBO J., 7: 29-35, 1988.

26. Joseph, L. J., Le Beau, M. M., Jamieson, G. A., Acharya, S., Shows, 1.B., Rowley, I. D., and Sukhatme, V. P. Molecular cloning, sequencing,and mapping of [CR2, a human early growth response gene encoding aprotein with “zinc-binding finger” structure. Proc. NatI. Acad. Sci. USA,85: 7i64-7168, 1988.

Cell Growth & Differentiation 233

27. Chavrier, P., Vesque, C., Galliot, B., Vigneron, M., Doll#{233},P., Duboule,0., and Charnay, P. The segment-specific gene Krox-2O encodes a tran-scription factor with binding sites in the promoter region of the Hox-1.4

gene. EMBO J., 9: 1209-1218, 1990.

28. Anisowicz, A., Bardwell, 1., and Sager, R. Constitutive overexpressionof a growth-regulated gene in transformed chinese hamster and humancells. Proc. NatI. Acad. Sci. USA, 84: 7188-7192, 1987.

29. Oquendo, P., Alberta, J., Wen, 0., Craycar, J. 1., Derynck, R., andStiles, c. D. The platelet-derived growth factor-inducible K� gene en-codes a secretory protein related to platelet a-granule proteins. J. Biol.Chem., 264:4133-4137, 1989.

30. Richmond, A., Balentien, E., Thomas, H. C., Flaggs, C., Barton, D. E.,Spiess, J., Bordoni, R., Francke, U., and Derynck, R. Molecular character-ization and chromosomal mapping of melanoma growth stimulating ac-tivity, a growth factor structurally related to j9-thromboglobulin. EMBO J.,7: 2025-2033, 1988.

31. Ryseck, R-P., Macdonald-Bravo, H., Matt#{233}i,M-C., and Bravo, R.Cloning and sequence of a secretory protein induced by growth factorsin mouse fibroblasts. Exp. cell Res., 180: 266-275, 1989.

32. Robinson, E. A., Yoshimura, T., Leonard, E. J., Tanaka, 5., Griffin, P.R., Shabanowitz, J., Hunt, D. F., and Appella, E. Complete amino acidsequence of a human monocyte chemoattractant, a putative mediator ofcellular immune reactions. Proc. NatI. Acad. Sci. USA, 86: 1850-1854,1989.

33. Rollins, B. J., Morrison, E. D., and Stiles, C. D. Cloning and expressionofJE, a gene inducible by platelet-derived growth factors whose producthas cytokine-like properties. Proc. NatI. Acad. Sci. USA, 85: 3738-3742,1988.

34. Rollins, B. J., Stier, P., Ernst, T., and Wong, C. C. The human homologof the JE gene encodes a monocyte secretory protein. Mol. Cell. Biol., 9:4687-4695, 1989.

35. O’Brien, T. P., Yang, C. P., Sanders, 1., and Lau, 1. F. Expression ofcyr6l, a growth factor-inducible immediate-early gene. Mol. Cell. Biol.,10: 3569-3577, 1990.

36. Simmons, D. 1., Levy, 0. B., Yannoni, Y., and Erikson, R. Identificationof a phorbol ester-repressive v-src-inducible gene. Proc. NatI. Acad. Sci.USA,86: 1178-1182, 1986.

37. Hartzell, 5., Ryder, K., Lanahan, A., Lau, L. F., and Nathans, D. Agrowth factor-responsive gene of murine BALB/c 3T3 cells encodes aprotein homologous to human tissue factor. Mol. Cell. Biol., 9: 2567-2573, 1989.

38. Ny, T., Sawdey, M., Lawrence, 0., Millan, J. L., and Loskutoff. cloningand sequence of a cDNA coding for the human beta-migrating endothe-hal-cell type plasminogen activator inhibitor. Proc. NatI. Acad. Sd. USA,83: 6776-6780, 1986.

39. Bravo, R., zerial, M., Toschi, L., SchUrmann, M., Muller, R., Hirai, S.I., Yaniv, M., Almendral, J. M., and Ryseck, R-P. Identification of growthfactor inducible genes in mouse fibroblasts. Cold Spring Harbor Symp.Quant. Biol., 53: 901-906, 1988.

40. Shaw, C., and Kamen, R. A conserved AU sequence from the 3’untranslated region of CM-CSF mRNA mediates selective mRNA degra-dation. Cell, 46: 659-667, 1986.

41. Treisman, R. The SRE: a growth factor responsive transcriptionalregulator. Cancer Biol., 1: 47-58, 1990.

42. Santaren, J. F., and Bravo, R. Immediate function of a 45 KD secretedglycoprotein by serum and growth factors in quiescent mouse 3T3 cells.Exp. Cell Res., 168: 494-506, 1987.

43. Binkert, C., Landwehr, J., Mary, J-L., Schwander, J., and Heinrich, C.Cloning, sequence analysis and expression of a cDNA encoding a novelinsulin-like growth factor binding protein (ICFBP-i). EMBO I., 8: 2497-2502, 1989.

44. Huhtala, M-L., Koistinen, R., Palomaki, P., Bohn, H., and Seppala, M.Biologically active domain in the somatomedin-binding protein. Biochem.Biophys. Res. Commun., 141: 263-270, 1986.

45. K#{244}nig,H., Ponta, H., Rahmsdorf, U., Buscher, M., Sch#{246}nthal, A.,Rahmsdorf, H. J., and Herrlich, P. Autoregulation of fos: the dyad sym-metry element as the major target of repression. EMBO I., 8: 2559-2566,1988.

46. Lucibello, F. C., Lowag, C., Neuberg, M., and Muller, R. Transrepres-sion of the mouse c-los promoter: a novel mechanism of Fos-mediatedtrans-regulation. Cell, 59: 999-1007, 1989.

47. Cius, D., Cao, x., Fauscher, F. J., Ill, Cohen, R. D., Curran, T., andSukhatme, V. P. Transcriptional activation and repression by fos areindependent functions: the C terminus represses immediate-early geneexpression via CArC elements. Mol. Cell. Biol., 10: 4243-4255, 1990.

48. chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J.Isolation of biologically active ribonucleic acid from sources enriched inribonuclease. Biochemistry, 18: 5294-5299, 1979.

49. Thomas, P. 5. Hybridization of denatured RNA and small DNAfragments transferred to nitrocellubose. Proc. NatI. Acad. Sci. USA, 77:5201-5205, 1980.

50. Rigby, P. W. J., Dieckmann, M., Rhodes, C., and Berg, P. Labelingdeoxyribonucleic acid to high specific activity in vitro by nick translationwith DNA polymerase I. J. Mol. Biol., 1 13: 237-25i, 1977.

51. Maniatis, T., Fritsch, E. F., and Sambrook, J. Molecular Cloning: ALaboratory Manual. Cold Spring Harbor, NJ: Cold Spring Harbor Labora-

tory, 1982.

52. Southern, E. Gel electrophoresis of restriction fragments. MethodsEnzymol., 68: 152-176, 1979.

53. chen, E. J., and Seeburg, P. H. Laboratory methods; supercoil Se-quencing: a fast and simple method for sequencing plasmid DNA. DNA,4: 165-170, 1985.

54. Sanger, F., Nicklen, S., and Coulson, A. R. DNA sequencing withchain-terminating inhibitors. Proc. NatI. Acad. Sci. USA, 74: 5463-5467,1977.

55. Strebel, K., Beck, E., Strohmaier, K., and Schaller, H. Characterizationof foot-and-mouth disease virus gene products with antisera againstbacterially synthesized fusion proteins. J. Virol., 57: 983-991, 1986.

56. Matt#{234}i,M-C., Philip, N., Passage, E., Moisan, J. P., Mandel, J. L., andMatt#{233}i,J. F. DNA probe localization at lBpii3 band by in situ hybridi-

zation and identification of a small supernumerary chromosome. Hum.Cenet., 69: 268-271, 1985.