Structure of the complex of a yeast glucoamylase with acarbose

Structure of the complex of a yeast glucoamylase withacarbose reveals the presence of a raw starch binding siteon the catalytic domainJozef Sevcık1, Eva Hostinova1, Adriana Solovicova1, Juraj Gasperık1, Zbigniew Dauter2

and Keith S. Wilson3

1 Institute of Molecular Biology, Slovak Academy of Sciences, Bratislava, Slovakia

2 Synchrotron Radiation Research Section, Macromolecular Crystallography Laboratory, NCI, Argonne, IL, USA

3 York Structural Biology Laboratory, University of York, UK

In addition to catalyzing the removal of b-d-glucosefrom the nonreducing ends of starch and other related

poly and oligosaccharides, glucoamylase is able to

degrade a-1,6-glucosidic linkages, although much less

effectively. The enzyme is produced by many moulds

and yeasts. The primary industrial use of glucoamylase

is in the production of glucose and fructose syrups,

which in turn serve as a feedstock for biological fer-

mentations in the production of ethanol or in the

production of high fructose sweeteners [1]. Using the

classification of glycoside hydrolases into nearly 100

families on the basis of sequence similarity, glucoamy-

lase belongs to family 15 [2] (http://afmb.cnrs-mrs.fr/

CAZY/).

The most thoroughly studied glucoamylase is that

from Aspergillus awamori variety X100. The three-

dimensional structure of its catalytic domain has been

described in detail at a range of pH [3,4]. Subse-

quently, its interactions with different carbohydrate

inhibitors were defined by the determination of

Keywords

acarbose; glucoamylase; starch binding site;

sugar tongs; X-ray structure

Correspondence

J. Sevcık, Institute of Molecular Biology,

Slovak Academy of Sciences, Dubravska

cesta 21, 84551 Bratislava, Slovakia

Fax: +421 259307416

Tel: +421 259307435

E-mail: [email protected]

(Received 16 January 2006, revised 10

March 2006, accepted 15 March 2006)

doi:10.1111/j.1742-4658.2006.05230.x

Most glucoamylases (a-1,4-d-glucan glucohydrolase, EC 3.2.1.3) have

structures consisting of both a catalytic and a starch binding domain. The

structure of a glucoamylase from Saccharomycopsis fibuligera HUT 7212

(Glu), determined a few years ago, consists of a single catalytic domain.

The structure of this enzyme with the resolution extended to 1.1 A and that

of the enzyme–acarbose complex at 1.6 A resolution are presented here.

The structure at atomic resolution, besides its high accuracy, shows clearly

the influence of cryo-cooling, which is manifested in shrinkage of the mole-

cule and lowering the volume of the unit cell. In the structure of the com-

plex, two acarbose molecules are bound, one at the active site and the

second at a site remote from the active site, curved around Tyr464 which

resembles the inhibitor molecule in the ‘sugar tongs’ surface binding site in

the structure of barley a-amylase isozyme 1 complexed with a thiomalto-

oligosaccharide. Based on the close similarity in sequence of glucoamylase

Glu, which does not degrade raw starch, to that of glucoamylase (Glm)

from S. fibuligera IFO 0111, a raw starch-degrading enzyme, it is reason-

able to expect the presence of the remote starch binding site at structurally

equivalent positions in both enzymes. We propose the role of this site is to

fix the enzyme onto the surface of a starch granule while the active site

degrades the polysaccharide. This hypothesis is verified here by the prepar-

ation of mutants of glucoamylases Glu and Glm.

Abbreviations

Glu, glucoamylase structure at 1.7 A (1AYX); Glu-A, glucoamylase–acarbose complex at 1.6 A resolution; Glu1.1, glucoamylase at 1.1 A

resolution.

FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS 2161

structures in complex with 1-deoxinojirimycin [5], acar-

bose [6] and d-gluco-dihydroacarbose [7,8]. These

structures define the positions of malto-oligosaccharide

residues in at least the )1 and +1 subsites labeled

according to the nomenclature proposed by [9] and

identify interactions between substrates and active site

amino acid side-chains. The structure of the starch

binding domain of A. niger glucoamylase was solved

by NMR in its native state [10] and in a complex with

b-cyclodextrin [11]. Crystal structures of an intact two-

domain prokaryotic glucoamylase were determined

from the clostridial species Thermoanaerobacterium

thermosaccharolyticum with and without acarbose [12].

In all of these enzymes the N-terminal starch binding

domain has 18 antiparallel strands arranged in b-sheetsof a super-b-sandwich, while the C-terminal catalytic

domain is an (a ⁄a)6 barrel.Different strains of the dimorphous yeast Saccharo-

mycopsis fibuligera produce a set of closely related

glucoamylases. Two of them, (Glu; strain HUT7212)

and Glm (strain IFO 0111) from the GLU [13] and

GLM [14] genes, consist of 492 and 489 amino acid

residues, respectively, with a sequence identity of

60% and a similarity of 77%, Fig. 1. The two enzymes

differ in biochemical properties, in particular in the

ability to digest raw starch. While Glu adsorbs to, but

does not digest raw starch, Glm adsorbs well to starch

granules and is capable of raw starch digestion. The

glucoamylases from Aspergillus niger and A. awamori

prefer longer malt-oligosaccharides as substrates,

which is also the case for S. fibuligera glucoamylases

[15].

The determination of the crystal structure of recom-

binant glucoamylase Glu at 1.7 A resolution was

reported earlier [16]. The core of the enzyme is an

(a ⁄a)6 barrel known in SCOP nomenclature [17] as a

six-helical hairpin toroid, and is closely similar to that

of the catalytic domain of A. awamori and T. thermos-

accharolyticum glucoamylases, with the active site at

the narrower end of barrel. There is no terminal

starch-binding domain, and this is clearly also true for

the closely related Glm, for which a homology model

was proposed [14]. Thus the S. fibuligera glucoamylas-

es Glu and Glm differ from the other characterized

glucoamylases in that the raw-starch affinity site is an

integral part of the single catalytic domain.

In this paper, two structures are described: that of

the glucoamylase Glu with the resolution extended to

Fig. 1. Sequences of glucoamylases Glu

(upper line) and Glm (lower line). Identical

residues are underlined. Catalytic residues

(Glu210, Glu456) are marked with an arrow.

Residues which represent the raw starch

binding site (Arg15, His447, Asp450,

Thr462, Tyr464) are in bold.

Glucoamylase raw starch binding site J. Sevcık et al.

2162 FEBS Journal 273 (2006) 2161–2171 ª 2006 The Authors Journal compilation ª 2006 FEBS

1.1 A (Glu1.1) and that of its complex with acarbose

at 1.6 A resolution (Glu-A). One acarbose binds at the

expected catalytic site, and we propose that the second

site corresponds to the remote starch binding site. Five

residues (Arg15, His447, Asp450, Thr462 and Tyr464)

which are important in the remote starch binding site

in Glu are conserved in Glm (Arg15, His444, Asp447,

Thr459 and Phe461). However, a key residue which is

central for the remote acarbose binding is different in

the two enzymes: Tyr464 in Glu versus Phe461 in Glm

(Fig. 1). To confirm that the remote binding site is

essential for raw starch binding, the above amino acids

were mutated and the mutants tested for their ability

to adsorb to and digest raw starch.

Results and discussion

Description of the structures

There is one molecule in the asymmetric unit of both

structures composed of a single domain consisting of

14 helices, 12 of them forming an (a ⁄a6) barrel as

expected from our previous native structure [16]. The

active site is at the narrower end of the barrel as

mapped by the presence of ligands (Tris in Glu1.1 or

acarbose in the Glu-A structure).

Accuracy of models

As expected, the accuracy of the structure Glu1.1 at

atomic resolution is higher than that of Glu-A or Glu.

The overall coordinate error for Glu1.1 and Glu-A

estimated from the rA plot [18], estimated standard

uncertainty (ESU) based on R and Rfree factors (the

Cruickshank’s dispersion precision indicator DPI [19],

and the average temperature factors for protein atoms,

water molecules and ligands are given in Table 1. The

temperature factors are in good agreement with esti-

mates from the Wilson plot [20].

The Ramachandran plot [21] calculated by the pro-

gram procheck [22] for Glu1.1 and Glu-A shows that

in both structures, there are >92% of residues in the

most favored regions, the rest in additionally allowed

regions except Ala339 and Ser357 which are in gener-

ously allowed regions. The electron density for both

residues in the two structures is clear and all main-

chain atoms are well ordered, which confirms that the

deviation of torsion angles from ideal geometry of

these two residues is an intrinsic feature of the struc-

ture. In Glu1.1 there is another residue, Ser305 in the

generously allowed region. This residue is part of the

loop Gly302–Ser306, which is poorly ordered in this

structure (see below).

In both structures for most of the residues the xangle deviates significantly from planarity. This is

reflected in the G-factor calculated by procheck

(Table 2) in which the x angles score for Glu1.1 and

Glu-A has a value of )0.05 and )0.06, respectively,

with 489 contributors. This confirms that the peptide

bond deviates from planarity by up to 20� as observed

in a number of atomic resolution structures. The aver-

age value for x angle in Glu1.1 and Glu-A structures

Table 1. Refinement statistics. ESU, estimated standard uncer-

tainty.

Glu-A Glu1.1

Molecules in asymmetric unit 1 1

R (%) 12.0 14.6

Rfree (%) 16.0 16.1

Model – atom sites 3946 3853

Solvent molecules 810 949

Average B-values (A2)

Protein atoms 13.7 13.4

Tris 17.8

Acarbose 12.7 ⁄ 33.1Phosphate anion 32.0

Solvent molecules 33.2 33.5

Wilson plot (A2) 15.6 10.4

Coordinates ESU based

on R ⁄Rfree (A)

0.117 ⁄ 0.077 0.033 ⁄ 0.031

rA error estimate (A) 0.04 0.02

Stereochemical restraints r.m.s. (r)

Bond distances (A) 0.011 (0.021) 0.007 (0.021)

Bond angles (�) 1.609 (1.965) 1.204 (1.939)

Chiral centers (A3) 0.159 (0.200) 0.079 (0.200)

Planar groups (A) 0.015 (0.020) 0.008 (0.020)

B-factors restraints

Main-chain bond (A2) 0.938 (1.500) 0.838 (1.500)

Main-chain angle (A2) 1.535 (2.000) 1.389 (2.000)

Side-chain bond (A2) 2.237 (3.000) 1.812 (3.000)

Side-chain angle (A2) 3.318 (4.500) 2.684 (4.500)

Table 2. G-factors calculated by PROCHECK.

Glu1.1 Glu-A

Dihedral angles (�)Phi–Psi distribution 0.15 0.15

Chi1–Chi2 distribution 0.02 0.02

Chi1 only 0.13 0.10

Chi3 and Chi4 0.51 0.32

Omega )0.46 )0.43Average score )0.05 )0.06

Main-chain covalent forces

Main-chain bond lengths (A) 0.63 0.56

Main-chain bond angles (�) 0.44 0.39

Average score 0.52 0.46

Overall average 0.18 0.15

J. Sevcık et al. Glucoamylase raw starch binding site


is 179.6 and 179.5, respectively, with rmsd of 5.7� in

both.

The Glu1.1 structure

The Glu structure (1AYX) was described in detail pre-

viously. Superposition of the structures Glu1.1 and

Glu based on all CA atoms, calculated by the program

lsqkab, shows that the two structures are nearly iden-

tical with rmsd 0.38 A. The maximum deviation

(3.63 A) does not represent any important difference

as it relates to the C-terminal residue. Omitting 16

atoms from the surface loops for which deviation was

above 1 A, the rmsd falls to 0.32 A. The superposition

reveals that the molecule contracts on cryo-cooling

with the surface regions being shifted towards the cen-

tre by �0.3 A, keeping the central part of the molecule

intact. This is reflected in the unit cell volume which is

510 156 A3 at 292 K but falls to 479 022 A3 at 110 K.

Some of the residues poorly determined in the Glu

structure became clearer in the Glu1.1 and all six resi-

dues with two conformations in Glu have a single con-

formation in Glu1.1.

Inspection of the Glu1.1 electron density shows that

it is very clear in the entire molecule with only a single

conformation for each residue suggesting that the

molecule has a rigid fold. Nevertheless the segment

Gly302-Glu303-Ser304-Ser305-Ser306 located at the

opposite end of the barrel to the active site has weaker

electron density and the temperature factors of the

atoms in this segment are �31 A2, 2.35 times above

the average B for the structure. The high flexibility of

this loop does not appear to be connected with the cat-

alytic function. One explanation lies in the fact that

the loop protrudes from the surface of the molecule

and does not form any additional contacts with the

molecule.

The Glu-A structure

The Glu-A structure was refined to a low R factor

(Table 1) and the electron density is clear through the

whole structure. While the Gly302-Ser306 loop has an

average temperature factor of 26 A2, compared with

an average value for the whole protein of 13.7 A2, the

electron density is considerably better in comparison

to the Glu1.1 structure. This is due to the close prox-

imity of a phosphate anion (sodium phosphate buffer

was used in purification) which fills the gap between

the loop and the rest of the protein (Fig. 2B) forming

a number of direct and water-mediated hydrogen

bonds. One of the phosphate oxygen atoms forms

hydrogen bonds with a water molecule which belongs

to the cluster of water molecules and the Asp379 carb-

oxyl liganded to a Na+ ion. Another Na+ ion, sur-

rounded by five water molecules is bound to Ile177

carbonyl. All distances between the Na+ and the sur-

rounding oxygen ligands are close to 2.42 A, the aver-

age distance observed in a set of protein structures

[23].

Superposition of the Glu-A and Glu1.1 structures

gives r.m.s. and maximum displacement of 0.47 and

4.47 A, respectively. Glu-A differs from Glu1.1 mainly

in the loop Ser9-Asn10-Tyr11-Lys12-Val13-Asp14-

Arg15-Thr16 where the differences between CA atoms

are up to 4.5 A (at Asn10). This conformational

change is caused by Arg15 which moves (CA moves

1.2 A) in order to interact with the acarbose sugar +1

causing reorientation of the whole loop.

Catalytic site

The catalytic reaction of glucoamylases proceeds with

inversion of configuration at the anomeric carbon

which requires a pair of carboxylic acids at the active

A B

Fig. 2. Glu with two acarbose molecules

and a phosphate anion. The anion is hidden

below the active site acarbose in (A), but is

clearly visible in (B). The two views are rela-

ted by rotation around y-axis by 90� (drawn

using MOLSCRIPT [50]).



site, one acting as general acid and the other as general

base [24]. The mechanism of hydrolysis consisting of

three steps involves proton transfer to the glycosidic

oxygen of the scissile bond from a general acid cata-

lyst, formation of oxocarbenium ion and a water-assis-

ted nucleophilic attack by a general base catalyst [24–

27]. In the glucoamylase from A. awamori and A. niger

Glu179 was identified as the general acid and Glu400

as the general base [4–6,28,29]. Superposition of

the A. avamori and A. niger structures with those of

S. fibuligera glucoamylase complexes with Tris and

acarbose shows that the corresponding residues are

Glu210, general acid and Glu456, general base. In the

Glu-A and Glu1.1 structures the distances between the

CA atoms of these two residues are 14.8 and 14.7 A

and the shortest distances between the two carboxyl

groups are 7.3 and 7.6 A, respectively. The carboxyl

groups can easily adopt a distance of 9.2 A, typical for

inverting glycoside hydrolysis [24,30,31].

In the active site of the native Glu1.1 there is a Tris

molecule which forms direct hydrogen bonds with

Arg69, Asp70 and one bond, mediated by a water

molecule, with Glu210. Hydrogen bonds formed

between the enzyme and Tris are the same as observed

previously [16].

In the Glu-A complex there are two acarbose mole-

cules: one in the active site and the other on the sur-

face of the enzyme about 25 A away, Fig. 2. The

active site acarbose fits tightly into the pocket (Fig. 3)

and the electron density for all the acarbose atoms is

very clear (Fig. 4A). The acarbose has a well-defined

conformation that corresponds to that observed in the

complex with the fungal glucoamylase from A. awa-

mori var. X100 at pH 4 [8]. The sugars )1 and +1,

labeled according to the nomenclature proposed by [9],

form several hydrogen bonds with the enzyme and

confirm the identity of the active site residues. Sugars

+2 and +3 do not form any hydrogen bonds with the

enzyme, however, they do stack nicely against the aro-

matic rings of Tyr351 and Trp139, respectively. The

distances between the sugars and the aromatic rings of

the two residues are �4 A. The mode of acarbose

binding to the active site readily explains the exogluca-

nase activity.

Raw starch binding site

The electron density for the surface acarbose (Fig. 4B),

is not as clear as that for the active site acarbose, sug-

gesting a higher mobility or a reduced occupancy,

probably caused by a neighboring molecule at a dis-

tance of about 3.5 A. This is reflected in the average

temperature factors which are 33 A2 for the surface

Fig. 3. Hydrogen bonds formed by acarbose

with the active site residues in stereo. The

catalytic residues are Glu210 and Glu456

(drawn using MOLSCRIPT).

Fig. 4. Electron density for (A) the active site and (B) the remote

surface acarbose (drawn using BOBSCRIPT [51]).



acarbose in contrast to the 13 A2 for the active site

ligand. The surface acarbose in the Glu-A structure,

which we propose to correspond to a raw starch bind-

ing site, is localized in the crevice formed by Arg15,

His447, Asp450, Thr462, Tyr464 and Ser465. There

are six H-bonds between this remote acarbose and the

enzyme, two direct, His447 ND1 – O3 (+ 2), Thr462

O – O2 (+ 2) and four mediated through one or two

water molecules, Asp450 N–W – O3 (+ 1), Asp450

OD1–W – O2 ()1), Asn451 N–W–W-O4 ()1), Ser465N–W – O3 (+ 1). The second sugar ring of the acar-

bose stacks against the planar Arg15 guanidino group.

A space-filling model of glucoamylase with both

acarbose molecules is shown in Fig. 5. The surface

acarbose is curved around Tyr464 in the form of a

semicircle (Fig. 6) and captures the inhibitor molecule

as seen in the ‘sugar tongs’ binding site in barley

a-amylase isozyme 1 complexed with the substrate

analogue, methyl 4¢,4¢¢,4¢¢¢-trithiomaltotetraoside

[32,33] and a true oligosaccharide substrate [34]. A

similar situation was seen in the structure of the amy-

lomaltase–acarbose complex [35,36] in which the acar-

bose molecule winds around Tyr54. However, in those

structures the raw starch binding site is not part of the

catalytic but is located on a separate domain.

Mutations at the remote ligand binding site

To verify the hypothesis that the site on the Glu sur-

face interacting with acarbose represents the starch

binding site, the point mutants R15A, H447A, T462A

and a double mutant H447A, D450A were prepared

and tested for affinity to starch. Two approaches were

used: adsorption of enzymes in a test tube assay on a

native granular starch and mobility of enzymes in

native gels with and without copolymerized boiled

granular starch.

Adsorption of the wild-type Glu, its mutants and

Glm in test tube experiments is presented in Fig. 7.

The results show that affinity of Glu to native raw

starch was observed only at a high raw starch–enzyme

ratio: at a ratio of 100 mg raw starch)50 lg Glu only

10% of the enzyme was bound. Under the same condi-

tions, >95% of the wild-type Glm was bound. The

Glu mutants did not bind at all.

The electrophoretic mobility of Glu and its mutants

are presented in Fig. 8. In a standard native gel

(Fig. 8A) the Glu and its mutants move to nearly the

same position while in the gel with a copolymerized

boiled granular starch (Fig. 8B) all Glu mutants move

significantly faster indicating that their affinity to the

gel matrix is lower.

As documented in our previous work [37], a similar

situation was found with the raw starch degrading

Glm. The Glm H444A, D447A mutant in the gel

containing starch moved faster than wild-type Glm

because of its impaired affinity towards the substrate.

The changes in electrophoretic mobility of native and

Fig. 5. A space filling model showing the complex of glucoamylase

with acarbose. Both acarbose molecules are in yellow. Tyr464 is in

green, Asp450 in red and Arg15 in blue. The rest of residues inter-

acting with the surface acarbose are hidden below it.

Fig. 6. Stereo picture of the surface acar-

bose curved around Tyr464 and the interact-

ing partners Arg15, His447, Asp450 and

Thr462 drawn using MOLSCRIPT.



mutant glucoamylases demonstrate that mutations of

the amino acids proposed to be involved in binding of

the surface acarbose caused reduction of enzyme

adsorption on starch, proving that these amino acids

are involved in starch binding site in spite differing in

a key residue – Tyr464 in Glu versus Phe461 in Glm.

Biochemical analysis has shown that the double muta-

tion H444A, D447A retained specific activity on sol-

uble starch identical but caused significant reduction of

raw starch hydrolysis (to 12%) in comparison with the

wild-type enzyme.

Conclusions

The structures of the glucoamylases from S. fibuligera

belong to family 15 of the glycoside hydrolases. Most

of the currently characterized family members have a

two-domain structure, the small domain playing the

role of binding the enzyme to starch, allowing the lar-

ger catalytic domain to hydrolyze the starch substrate.

We showed previously that the S. fibuligera Glu

enzyme lacked the independent starch binding domain

while the catalytic domain was very similar to that of

other family 15 members. The close similarity in

sequence of the Glm enzyme indicated that it too

lacked the binding domain, and the modeled structure

was like that of Glu with a single domain.

Our present work has improved the resolution of

the native Glu structure, but has in addition revealed

the presence of a second acarbose (substrate analogue)

binding site on the surface of the enzyme, 25 A remote

from the catalytic site. The key residues involved in

the binding at this remote site have been mutated, and

the mutants shown to have greatly reduced starch

binding properties. These results strongly support the

hypothesis that the S. fibuligera glucoamylases have

evolved a starch binding site on the catalytic domain

quite distinct from that seen in other family 15 glyco-

side hydrolases.

Experimental procedures

In vitro mutagenesis

Site-directed mutagenesis was performed by Quick-

ChangeTM site-directed mutagenesis kit (Stratagene,

La Jolla, USA). Plasmid pVT100L-Glu [38] was used as a

template. The following oligonucleotides were used: GLU

R15A forward (5¢-ATTCAAACTATAAAGTTGACGCAA

CTGACTTGGAAACCTTC-3¢), GLU R15A reverse (5¢-GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT

TGAAT-3¢); GLU H447A forward (5¢- GCAAGTCATTT

TGGATGCTATTAATGATGATGGCTC-3¢), GLU H447A

reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA

TGACTTGC-3¢); GLU T462A forward (5¢- GAACAACTT

AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU

T462A reverse (5¢- GGCACCGGTGGAATAACCGGCA

TATCTGTTAAGTTGTTC-3¢); GLU H447A, D450A for-

ward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTG

ATGGCTCCTTGAATGAAC-3¢), GLU H447A, D450A

Fig. 7. Adsorption to raw starch of Glu and R15A, H447A, T462A,

H447A + D450A mutants (A) and Glm (B) (n, wild types; d,

mutants). Enzyme at a level ranging from 0.01 to 0.5 mg were

added to a suspension of 100 mg of raw corn starch in 1 mL of

0.05 M sodium acetate, pH 5.6 (Glu) and pH 4.5 (Glm). The amount

of bound protein was calculated from the differences between the

initial enzyme activity and the free enzyme activity after binding.

A B

Fig. 8. Native PAGE without (A) and with boiled granular starch (B)

of Glu. Lanes 1,6, wt enzyme; lanes 2,7, mutant R15A; lanes 3,8,

mutant H447A; lanes 4,9, double mutant H447A, D450A; lanes

5,10 mutant T462A.



reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT

AGCATCCAAAATGACTTGC-3¢).All mutations were verified by DNA sequencing.

Enzyme preparation and purification

The recombinant glycosylated glucoamylases were prepared

in Saccharomyces cerevisiae AH22 as described previously

[14,38]. Yeast transformants were grown in medium con-

taining 1% yeast extract, 2% peptone, 2% glucose, for

48 h. Proteins which showed electrophoretic homogeneity

were obtained from extracellular media after ultrafiltration

through Amicon PM-30 membrane, molecular sieving chro-

matography on Superose 12P and ion exchange chromato-

graphy on FQ (both from Amersham Bioscience, Vienna,

Austria).

Polyacrylamide gel electrophoresis

Polyacrylamide gel electrophoresis was performed under

native conditions. Concentration gel was omitted. Two

types of gels were used: (1) Standard 10% polyacrylamide

gel: 1.25 mL of 1.5 m TrisHCl buffer, pH 8.8, 1.45 mL of

water, 2.2 mL of acrylamide solution (30%), 60 lL of 10%

ammonium persulfate solution and 2.5 lL N,N,N¢,N¢-tetra-methylethylendiamine (TEMED) were mixed together. (2)

Polyacrylamide gel (7.5%) with copolymerized boiled gran-

ular corn starch: a suspension of 37.5 mg of starch in

1.25 mL of 1.5 m TrisHCl buffer, pH 8.8, and 2 mL of

water was boiled for 5 min and after cooling to room tem-

perature, 1.65 mL of acrylamide solution (30%), 60 lL of

10% ammonium persulfate solution and 2.5 lL TEMED

were added. The positions of glucoamylases were detected

with Coomassie Brilliant Blue R-250 staining (Merck,

Darmstadt, Germany).

Raw starch binding assay

The purified enzymes, in amounts of 0.01–0.5 mg mL)1

protein, were added to a suspension of 100 mg of raw corn

starch in 1 mL of 0.05 m sodium acetate at pH 5.6 and 4.5

for Glu and Glm, respectively, which are optimal values for

soluble starch hydrolysis. The mixture was gently stirred

for 1 h at +4 �C. After centrifugation at 13 000 g for

5 min, the protein content expressed as enzyme activity of

the supernatant was assayed. The amount of the bound

protein was calculated from the difference between the ini-

tial enzyme activity and the free enzyme activity in the

supernatant after binding.

Enzyme activity

Glucoamylase activity was determined in the reaction mix-

ture containing 0.9% Leulier soluble starch in 0.05 m

sodium acetate, pH 5.6 and 4.5 for Glu and Glm, respect-

ively, incubated with enzyme at 40 �C for 15 min. An incre-

ment of glucose was measured as described previously [14].

Glucoamylase Glu

Crystallization, data collection and processing

The recombinant nonglycosylated Glu was prepared essen-

tially as reported in [39]. The enzyme was crystallized from

a protein solution of 10 mgÆmL)1 in 50 mm acetate buffer

at pH 5.4 and 15% PEG 8K, as described earlier [40].

Protein for preparation of the glucoamylase–acarbose

complex was isolated in the same way as before, but Tris

was replaced by sodium phosphate buffer to avoid Tris

binding at the active site. Native crystals of the enzyme

were prepared as above and then 1 lL of the mother liquor

enriched by acarbose at a concentration of 10 mm was

added to drops (5 lL) containing native crystals a few days

before data collection.

X-ray data from native and complex crystals were collec-

ted at 110 K on EMBL beam lines BW7B to 1.1 A and

X11–1.6 A resolution, respectively, at the DORIS storage

ring (DESY, Hamburg, Germany). Each data set was col-

lected from a single crystal with a MAR Research (Ham-

burg, Germany) imaging plate scanner and processed with

denzo and scalepack [41]. A summary of data collection

and processing is given in Table 3.

Structure determination and refinement

All subsequent calculations were performed with programs

from the CCP4 package [42] unless otherwise indicated. As

the unit cell parameters of glucoamylase at 1.1 A resolution

(Glu1.1) and the glucoamylase–acarbose complex (Glu-A)

Table 3. Data statistics. Values in parentheses refer to the highest

resolution shell.

Glu-A Glu1.1

EMBL-Hamburg X-ray

source

Beamline X11 Beamline BW7B

Wavelength (A) 0.9096 0.834

Temperature (K) 100 100

Resolution range (A) 10–1.6 (1.62–1.60) 15–1.1(1.12–1.10)

Space group P212121 P212121

Cell parameters

a (A) 56.6 56.9

b (A) 85.3 85.7

c (A) 97.5 98.2

Unique reflections 59266 184868

Completeness (%) 94.5 (85.8) 93.5 (84.8)

R(I)mergea (%) 4.3 (14.4) 5.9 (15.3)

I ⁄r(I) 17.5 (4.2) 16.9 (2.4)

a R(I)merge ¼ Sh Si |Ii–<I>| ⁄ Sh SiI



were slightly different from those of Glu (1AYX), molecu-

lar replacement molrep [43], was used to position the

model in the new cells. Both structures were refined with

the program refmac [44] against 95% of the data with the

remaining 5% randomly excluded for cross-validation using

the free R factor (Rfree) [45]. All data were included in the

final refinement step. After each refinement step, ARP [46]

was used for modeling and updating the solvent structure.

The Glu1.1 and Glu-A structures were initially refined

with isotropic temperature factors and in the later stages

with anisotropic temperature factors including the contribu-

tions from the hydrogen atoms. Hydrogen atoms were gen-

erated according to established geometrical criteria on their

parent C, N and O atoms. The temperature factors of the

hydrogen atoms were set equal to those of their parent

atom. Isotropic and anisotropic temperature factors, bond

lengths, and bond angles were restrained according to the

standard criteria employed by refmac. Occupancies of

water molecules were set to unity and not refined. The

models were adjusted manually between refinement cycles

on the basis of (3Fo-2Fc, ac) and (Fo–Fc, ac) maps using the

programs o [47] and xtalview [48]. The refinement statis-

tics are given in Table 1.

Glucoamylase Glm

Modeling of the structure

A model of the glucoamylase Glm structure was generated

using the modeller w4 package [49] using the known

structure of glucoamylase Glu and the sequence similarity

between the two enzymes [14].

Data Bank accession numbers

The atomic coordinates have been deposited in the Protein

Data Bank for Glu-A (2F6D) and Glu1.1 (2FBA). Gen-

Bank accession no(s) M17355 and AJ311587 belong to

GLU and GLM genes, respectively.

Acknowledgements

This work was supported by Howard Hughes Medical

Institute grant no. 75195–574601 and the grants

1 ⁄ 0101 ⁄ 03 and 2 ⁄ 1010 ⁄ 96 awarded by the Slovak

Grant Agency VEGA.

References

1 Saha BC & Zeikus JG (1989) Microbial glucoamylases:

biochemical and biotechnological features. Starch 41,

57–64.

2 Henrissat B (1991) A classification of glycosyl hydrolas-

es based on amino acid sequence similarities. Biochem J

280, 309–316.

3 Aleshin AE, Golubev A, Firsov LM & Honzatko RB

(1992) Crystal structure of glucoamylase from Aspergil-

lus awamori var. X100–2.2 A resolution. J Biol Chem

267, 19291–19298.

4 Aleshin AE, Hoffman C, Firsov LM & Honzatko RB

(1994a) Crystal structure of glucoamylase from Aspergil-

lus awamori var. X100–2.2 A resolution. J Mol Biol 238,

575–591.

5 Harris EMS, Aleshin AE, Firsov LM & Honzatko RB

(1993) Refined structure for the complex of 1-deoxyno-

jirimycin with glucoamylase from Aspergillus awamori

var. X100–2.4 A resolution. Biochemistry 32, 1618–1626.

6 Aleshin AE, Firsov LM & Honzatko RB (1994b)

Refined structure for the complex of acarbose with glu-

coamylase from Aspergillus awamori var. X100–2.4 A

resolution. J Biol Chem 269, 15631–15639.

7 Stoffer B, Aleshin AE, Firsov LM, Svensson B & Hon-

zatko RB (1995) Refined structure for the complex of

d-gluco-dihydroacarbose with glucoamylase from Asper-

gillus awamori var. X100–2.2 A resolution: dual confor-

mations for extended inhibitors bound to the active site

of glucoamylase. FEBS Lett 358, 57–61.

8 Aleshin AE, Stoffer B, Firsov LM, Svensson B & Hon-

zatko RB (1996) Crystallographic complexes of glucoa-

mylase with maltooligosaccharide analogs: relationship

of stereochemical distortions at the nonreducing end to

the catalytic mechanism. Biochemistry 35, 8319–8328.

9 Davies GJ, Wilson KS & Henrissat B (1997) Nomencla-

ture for sugar-binding subsites in glycosyl hydrolases.

Biochem J 321, 557–559.

10 Sorimachi K, Jacks AJ, Le Gal-Coeffet MF, Williamson

G, Archer DB & Williamson MP (1996) Solution struc-

ture of the granular starch binding domain of glucoa-

mylase from Aspergillus niger by nuclear magnetic

resonance spectroscopy. J Mol Biol 259, 970–987.

11 Sorimachi K, LeGal-Coeffet MF, Williamson G, Archer

DB & Williamson MP (1997) Solution structure of the

granular starch binding domain of Aspergillus niger

glucoamylase bound to beta-cyclodextrin. Structure 5,

547–661.

12 Aleshin AE, Feng PH, Honzatko RB & Reilly PJ (2003)

Crystal structure and evolution of a prokaryotic glucoa-

mylase. J Mol Biol 327, 61–73.

13 Itoh T, Ohtsuki L, Yamashita I & Fukui S (1987) Nucleo-

tide sequence of the glucoamylase gene GLU1 in the

yeast Saccharomycopsis fibuligera. J Bacteriol 169, 4171–

4176.

14 Hostinova E, Solovicova A, Dvorsky R & Gasperık J

(2003) Molecular cloning and 3D structure prediction of

the first raw-starch-degrading glucoamylase without a

separate starch-binding domain. Arch Biochem Biophys

411, 189–195.

15 Solovicova A, Christensen T, Hostinova E, Gasperık J,

Sevcık J & Svensson B (1999) Structure–function



relationships in glucoamylases encoded by variant Sac-

charomycopsis fibuligera genes. Eur J Biochem 264, 756–

764.

16 Sevcık J, Solovicova A, Hostinova E, Gasperık J, Wil-

son KS & Dauter Z (1998) Structure of glucoamylase

from Saccharomycopsis fibuligera at 1.7 A resolution.

Acta Cryst D54, 854–866.

17 Lo Conte L, Ailey B, Hubbard TJ, Brenner SE, Murzin

AG & Chothia C (2000) SCOP: a structural classification

of proteins database. Nucleic Acids Res 28, 257–259.

18 Read RJ (1986) Improved Fourier coefficients for maps

using phases from partial structures with errors. Acta

Cryst A42, 140–149.

19 Cruickshank DWJ (1996) Macromolecular Refinement.

In Proceedings of the CCP4 Study Weekend (EJ Dod-

son, M Moore, A Ralph & S Bailey, eds), pp. 11–23.

SERC Daresbury Laboratory, Warrington, UK.

20 Wilson AJC (1942) Determination of absolute from rel-

ative X-ray data intensities. Nature 150, 151–152.

21 Ramakrishnan C & Ramachandran GN (1965) Stereo-

chemical criteria for polypeptide and protein chain con-

formations. II. Allowed conformations for a pair of

peptide units. Biophys J 5, 909–933.

22 Morris AL, Macarthur MW, Hutchinson EG & Thorn-

ton JM (1992) Stereochemical quality of protein struc-

ture coordinates. Proteins 12, 345–364.

23 Harding MM (2002) Metal-ligand geometry relevant to

proteins and in proteins: sodium and potassium. Acta

Cryst D58, 872–874.

24 McCarter JD & Withers SG (1994) Mechanisms of

enzymatic glycoside hydrolysis. Curr Opin Struct Biol 4,

885–892.

25 Sinnott ML (1990) Catalytic mechanism of enzymic

glycosyl transfer. Chem Rev 90, 1171–1202.

26 Konstantinidis A & Sinnot ML (1991) The interaction

of 1-fluoro-d-glucopyranosyl fluoride with glucosidases.

Biochem J 279, 587–593.

27 Tanaka Y, Tao W, Blanchard JS & Hehre EJ (1994)

Transition-state structures for the hydrolysis of alpha-d-

glucopyranosyl fluoride by retaining and inverting reac-

tions of glycosylases. J Biol Chem 269, 32306–32312.

28 Sierks MR, Ford C, Reilly PJ & Svensson B (1990) Cat-

alytic mechanism of fungal glucoamylase as defined by

mutagenesis of Asp176, Glu179 and Glu180 in the

enzyme from Aspergillus awamori. Protein Eng 3, 193–

198.

29 Svensson B, Clarke AJ, Svendsen I & Moller H (1990)

Identification of carboxylic acid residues in glucoamy-

lase G2 from Aspergillus niger that participate in cataly-

sis and substrate binding. Eur J Biochem 188, 29–38.

30 Davies GJ & Henrissat B (1995) Structures and mechan-

isms of glycosyl hydrolases. Structure 3, 853–859.

31 White A & Rose DR (1997) Mechanism of catalysis by

retaining beta-glycosyl hydrolases. Curr Opin Struct Biol

7, 645–651.

32 Robert X, Haser R, Svensson B & Aghajari N (2002)

Comparison of crystal structure of barley alpha-

amylase 1 and 2: implications for isozyme differences

in stability and activity. Biologia (Bratislava) 57 (Suppl.

11), 59–70.

33 Robert X, Haser R, Gottshalk TE, Ratajczak F,

Driguez H, Svensson B & Aghajari N (2003) The struc-

ture of barley alpha-amylase isozyme 1 reveals a novel

role of domain C in substrate recognition and binding:

a pair of sugar tongs. Structure 11, 973–984.

34 Robert X, Haser R, Mori H, Svensson B & Aghajari N

(2005) Oligosaccharide binding to barley a-amylase 1.

J Biol Chem 280, 32968–32978.

35 Przylas I, Terada Y, Fujii K, Takaha T, Saenger W &

Strater N (2000) X-ray structure of acarbose bound to

amylomaltase from Thermus aquaticus: implications for

the synthesis of large cyclic glucans. Eur J Biochem 267,

6903–6913.

36 Strater N, Przylas I, Saenger W, Terada Y, Fuji K &

Takaha T (2002) Structural basis of the synthesis of

large cycloamyloses by amylomaltase. Biologia (Brati-

slava) 57 (Suppl. 11), 93–99.

37 Gasperık J, Hostinova E & Sevcık J (2005) Acarbose

binding at the surface of Saccharomycopsis fibuligera

glucoamylase suggests the presence of a raw starch-

binding site. Biologia (Bratislava) 60 (Suppl. 16),

177–180.

38 Gasperık J & Hostinova E (1993) Glucoamylases

encoded by variant Saccharomycopsis fibuligera genes:

structure and properties. Curr Microbiol 27, 11–14.

39 Solovicova A, Gasperık J & Hostinova E (1996) High-

yield production of Saccharomycopsis fibuligera glucoa-

mylase in Escherichia coli, refolding, and comparison of

the nonglycosylated and glycosylated enzyme forms.

Biochem Biophys Res Com 224, 790–795.

40 Solovicova A, Gasperık J, Sevcık J & Hostinova E

(1997) Crystallization and preliminary X-ray analysis of

the Saccharomycopsis fibuligera glucoamylase expressed

from the GLU1 gene in Escherichia coli. Acta Cryst

D53, 782–783.

41 Otwinowski Z & Minor W (1997) Processing of X-ray

diffraction data collected in oscillation mode. Methods

Enzymol 276, 307–326.

42 Collaborative Computational Project, Number 4 (1994)

The CCP4 Suite: Programs for Protein Crystallography.

Acta Cryst. D50, 760–763.

43 Vagin A & Teplyakov A (1997) MOLREP: an auto-

mated program for molecular replacement. J Appl Cryst

30, 1022–1025.

44 Murshudov GN, Vagin A & Dodson EJ (1997) Refine-

ment of macromolecular structures by the maximum-

likelihood method. Acta Cryst D53, 240–255.

45 Brunger AT (1993) Assessment of phase accuracy by

cross validation: the free R value: methods and applica-

tions. Acta Cryst D49, 24–36.



46 Lamzin VS & Wilson KS (1997) Automated refinement

for protein crystallography. Methods Enzymol 277, 269–

305.

47 Jones TA, Zou JY, Cowan SW & Kjeldgaard M (1991)

Improved methods for building protein models in elec-

tron density maps and the location of errors in these

models. Acta Cryst A47, 110–119.

48 McRee DE (1993) Practical Protein Crystallography.

Academic Press, Inc., San Diego, New York, Boston,

London, Sydney, Tokyo, Toronto.

49 Sali A, Potterton L, Yuan F, van Vlijmen H & Karplus

M (1995) Evaluation of comparative protein modeling

by MODELLER. Proteins: Struct Funct Genet 23, 318–

326.

50 Kraulis PJ (1991) MOLSCRIPT: a program to produce

both detailed and schematic plots of protein structures.

J Appl Cryst 24, 946–950.

51 Esnouf RM (1999) Further additions to Molscript, Ver-

sion 1.4. including reading and contouring of electron-

density maps. Acta Cryst D55, 938–940.



Documents

Structure of the complex of a yeast glucoamylase with acarbose