STUDIES ON THERAPEUTIC POTENTIAL OF MEDICINAL PLANTS

i

STUDIES ON THERAPEUTIC POTENTIAL OF

MEDICINAL PLANTS AGAINST HEPATITIS C VIRUS

TARIQ JAVED

NATIONAL CENTRE OF EXCELLENCE IN MOLECULAR BIOLOGY

UNIVERSITY OF THE PUNJAB

LAHORE, PAKISTAN

(2014)

ii

Studies on Theraputic Potential of Medicinal Plants

against Hepatitis C Virus

A DISSERTATION

Submitted to

UNIVERSITY OF THE PUNJAB

In fulfillment

of the requirement for the degree

DOCTOR OF PHILOSOPHY

IN

MOLECULAR BIOLOGY

BY

TARIQ JAVED

Supervisor:

Dr. Tayyab Husnain

Professor & Acting Director

National Centre of Excellence in Molecular Biology

University of the Punjab, Lahore Pakistan.

(2014)

iii

In The Name Of Allah, the Beneficent, Merciful.

iv

CERTIFICATE

This is to certify that the research work described in this thesis is the original

work of the author Mr Tariq Javed and has been carried out under my direct

supervision. I have personally gone through the raw data and certify the

correctness/authenticity of all results reported herein. I further certify that these data

have not been used in part or full, manuscript already submitted or in the process of

submission in partial/complete fulfillment of the award of any other degree from any

other institution at home or abroad. It is also certified that the enclosed manuscript,

has been prepared under my supervision according to the prescribed format and I

endorse its evaluation for the award of PhD degree through the official procedures of

the University.

In accordance with the rules of the Centre, data book No. M-126, 904 and 985

are declared as unexpandable document that will be kept in the registry of the Centre

for a minimum of three years from the date of the thesis defense examination.

Signature of the Supervisor: __________________

Name: Dr. TAYYAB HUSNAIN

Designation: Professor & Acting Director

v

DEDICATION

“I dedicate my dissertation work to whom, who taught me even a single word, being my

teachers, I am indebted to them.

Mentor of the Universe

vi

SUMMARY

Medicinal plants are the natural reservoir of many antiviral, antimicrobial and anticancer agents.

Globally most of the population still relies on traditional medicinal plants for their primary health care.

Medicinal plants are considered to be less toxic, more effective and economical. Pakistan has a diverse flora

which potentially offers many unique phytochemicals against number of human diseases. Although there is

need for scientific analysis and research to be conducted on these medicinal plants used by the indigenous

people from centuries. Based on traditional knowledge, present study has identified some of the native

medicinal plants which possess activity against hepatitis C virus.

Hepatitis C virus infection is a serious health problem which causes liver damage, hepatocellular

carcinoma and ultimately leads to death. So far, it has affected more than 170 million individual worldwide and

10 million people in Pakistan are living with Hepatitis C virus. HCV genotype identification is most important

for prediction of treatment response and to determine the duration of antiviral therapy. The present HCV

regimen is administration of peglated interferon (PEG-IFN) and ribavirin, has limited efficacy, severe adverse

effects, and high cost. Moreover, HCV genotype 1 and 4 are more resistant to peg-interferon and rabavirin

therapy than other genotypes.

The present study was designed to search for phytochemicals from traditional medicinal plants against

Hepatitis C Virus (HCV) and study synergistic effect of purified fractions with interferon alpha which will

provide potential for future HCV drug development. Therefore, an in-vitro bioassay was developed for studying

the activity of plant extracts by infecting HCV inoculums of genotype 1a and 3a into Huh-7 cell line to screen

out potential phytochemicals against Hepatitis C virus.

vii

Twenty four medicinal plants were collected and extracted for toxicological studies on liver (Huh-7)

and fibroblast (CHO) cells lines by trypan blue dye explosive method and methylthiazol phenyltetrazolium

bromide (MTT) cell proliferation assay. Three plant extracts designated as NJ, PN and VJ showed toxic effect

in hepatoma cells, so there were excluded for further screening against Hepatitis C virus. For further antiviral

screening, HCV infected liver cells were treated with plant extracts at non toxic doses. It was found that five out

of twentyfour medicinal plant extracts designated as SN, GA, SC, AM and FC showed antiviral effect against

HCV 1a and 3a genotype in our in vitro assay. The HCV viral titer was analyzed through Quantitative Real

Time PCR and was further screened against HCV-NS3 proteases of genotype 1a and 3a. In order to identify the

active compound, corresponding plant extracts were separated into different fractions by thin layer

chromatography (TLC) and column chromatography. Purified effective fractions were then tested to find 50%

Effective concentration (EC50), and synergistic effect if any between purified fraction and interferon alpha

against Hepatitis C virus. Three fractions designated as SN8, GA15 and SC14 were active against HCV in a

dose dependent manner, and had synergistic effect when combined with interferon. The EC50 values of SN8,

GA15 and SC14 for HCV genotype 3a were 24.94 µg/ml, 9.46 µg/ml and 31.75 µg/ml and 1a were 47.68

µg/ml, 10.13 µg/ml and 71.96 µg/ml respectively.

In these in vitro studies three active fractions were identified that showed potential against HCV.

Therefore, these finding suggest that medicinal plants contain potential antiviral agents against HCV and

combination of these antiviral agents with interferon (IFN) will be better option for future HCV therapy.

viii

Acknowledgment

Praise be to Allah the most Merciful and Beneficent. Who created everything from atom to

universe and has shown us light in the darkness. Whose perpetuate patronage is treasure of my life.

Secondly, praise worthy His last Prophet (P.B.U.H) who is the torch of knowledge for humanity. It is

he, who showed us the way to success in this life and life hereafter.

I am grateful to my kind and worthy supervisor, Professor Dr. Tayyab Husnain, Director,

National Centre of Excellence in Molecular Biology, University of the Punjab, who provided me with

all possible research facilities in this institution.

I am highly gratified to Professor Dr. Sheikh Riazuddin (Ex- Director) National Centre of

Excellence in Molecular Biology, University of the Punjab, for his encouragement and scholarly

guidance during the course of my research. My work may not have seen the light of day without the

skilled advices and encouragement of Professor Dr. Shaheen N.Khan.

I would like to thank all people who have helped and inspired me during my doctoral study.

My cordial thanks go to Dr. Usman Ali Ashfaq, at National Centre of Excellence in Molecular

Biology, for his skillful support, guidance and cooperation all the time.

I am lucky enough to have prerogative to express my deep and sincere gratitude to my

seniors Dr. Tanveer Qasir, Dr. Rana Amjad, Dr. Muhammad Sharif Masoud, Dr. Muhammad Qasim

and Dr. Tahir Sarwar for helping me to get through the difficult times, and for all the emotional

support, camaraderie, entertainment, and caring; they provided, invaluable suggestions and their

sincere attitude throughout the course of my research. For me, they have been a source of great help

and inspiration.

I owe a special dept of cordial gratitude to my chums Muhammad Sohail Anjum, Muhammad

Ali Rana, Sultan Asad, Mureed Hussain, Muhammad Afzal, and Abdul Hafeez who are kind hearted,

compassionate and always there to help me whenever I needed. They always kept my spirits high.

particularly, their support, guidance, encouragement and prayers kept me to the road of optimism

and success. I am grateful I wish to extend my thanks to members of Molecular Medicine, Functional

Genomics and Stem Cell Lab, all the Scientific, Para scientific and Administrative staff of CEMB,

those had been directly and indirectly instrumental in my research work.

Special feeling of gratitude is towards my great parents, brothers Muhammad Tahir,

Muhammad Sajid, Muhammad Rashad, Muhammad Majid, Muhammad Adil and sisters, they are

outstanding their love and assistance is an asset of my life.

Finally, I bow my head before Almighty Allah, for giving me reverence for being the part of

this, most privileged and prestigious research institute CEMB, Which opens new horizons for being

explored.

I am obliged to acknowledge the Higher Education Commission (HEC) of Pakistan for

granting me a fully funded merit scholarship to meet my finances during PhD studies.

Tariq Javed

Dated: 10 -02- 2014

ix

ABBREVIATIONS AND SYMBOLS

°C Degrees Celsius

% Percentage

ABI Applied Biosystems

bp Base pair

cDNA Complementary DNA

CHO Chineese hamster ovary cells

dH2O Distilled water

DMEM DULBECCO'S MODIFIED EAGLE'S MEDIUM

DMSO Dimethyl sulfoxide

DNA Deoxyribonucleic acid

RNA Ribonucleic acid

dNTPs Deoxyribonucleotide triphosphate

EDTA ETHYLINEDIAMINE TETRAACETIC ACID

FBS Fetal Bovine Serum

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

HAV Hepatitis A virus

HBV Hepatitis B virus

HCV Hepatitis C virus

x

HEV Hepatitis E virus

HIV Human Immunodeficiency virus

Huh-7 Human Hepatoma cell line

IFN Interferon

IRES Internal Ribosomal Entry Site

Kb Kilo base

kDa Kilo Dalton

L Liter

LDL Low density lipoprotein

LDL-R Low density lipoprotein recepter

MDBK Madin-Darby bovine kidney

Mg Magnesium

MgCl2 Magnesium Chloride

min Minute

ml Milliliter

mM Millimolar

mRNA Messenger ribonucleic acid

MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide)

NANBH Non-A, non B hepatitis

NC Non-coding

NCBI National Commission on Biotechonolgy

ng Nanogram

xi

NS Non-structural

ORF Open Reading Frame

PBS Phosphate buffer Saline

PCR Polymerase Chain Reaction



RNAase Ribonuclease enzyme

rpm Revolution per minute

RT-PCR Revesre Transcription PCR

SDS Sodium Dodecyl Sulphate

SVR Sustained viral response

Taq Thermus aquaticus

TNF-α Tumor necrosis factor alpha

UTR Untranslated region

UV Ultraviolet

μg Microgram

μl Microlitre

xii

TABLE OF CONTENTS

Certificate IV

Summary VI-VIII

Acknowledgements IX

Abbreviations ans Symbols X-X11

List of Tables XVI

List of Figures XVII

1 INTRODUCTION 1-4

2 LITERATURE REVIEW 5-21

2.1 History of Traditional Medicinal Plants 5

2.2 Ethnobotanic Flora of Pakistan 6

2.3 Cytotoxicity of Antiviral Phytochemicals 7

2.4 Antiviral Activity of Medicinal Plants 7

2.5 Medicinal Plants against Hepatitis C Virus 8

2.6 Future of Medicinal Plants 9

2.7 Hepatitis C virus (HCV) 11

2.8 HCV Molecular Evolution 11

2.9 Genotype and Ethnic Origion 12

2.10 Genetic Organization of HCV 14

2.10.1 Structural Proteins 15

xiii

2.10.2 Nonstructural Proteins 15

2.11 Model Systems for Investigating Life Cycle of HCV 15

2.11.1 Cell Lines and Primary Cell Culture 15

2.11.2 The Replicon System 16

2.11.3 Animal Models 18

2.12 Hepatitis C Virus Drug Development 19

2.12.1 NS3 Serine Protease as a Drug Target 19

2.13 HCV NS3 Protease Inhibitors 19

2.14 Disease Management 20

3 MATERIALS AND METHODS 22–34

3.1 Medicinal Plants Collection and Solvent extraction 22

3.2 Serum Samples Collection 23

3.3 Cell Lines 25

3.4 Plasmids 25

3.5 Chemicals 25

3.6 Primers Designing 26

3.7 Trypan Blue Dye Explosive Method for Cellular Toxicity 26

3.8 MTT Cell Proliferation Assay 27

3.9 Antiviral Analysis of Compounds in Liver Cells 28

3.10 Transfection of Huh-7 cells with pCR3.1/Flag TAG/HCV Nonstructural Gene 29

3.11 Co-transfection of Huh-7 cells with pCR3.1/FlagTAG/HCV Nonstructural 29

xiv

Gene and Plant Extracts

3.12 Pharmacological Analysis of isolated Fractions 31

3.13 Antiviral Analysis of Effective Fractions Along with Interferon 31

3.14 Protein Isolation and Estimation 32

3.15 Western Blotting 32

3.16 Separation and Purification Techniques 33

3.16.1 Thin Layer Chromatography 33

3.16.2 Column Chromatography 34

3.16.3 High Pressure Liquid Chromatography (HPLC) 34

3.17 Statistical Analysis 34

4 RESULTS 35-75

4.1 Medicinal Plants Collection and Solvent extraction 35

4.2 Cytotoxicity Study of Plant Extracts 35

4.3 Cellular Toxicity Through MTT Assay 37

4.4 Antiviral Effect of Plant Extracts against HCV of Genotype 3a and 1a 40

4.5 Antiviral Effect of Solanum nigrum against HCV Genotype 3a and 1a 41

4.5.1 Antiviral effect of Solanum nigrum against HCV-NS3 Proteases of Genotype 3a and 1a 42

4.5.2 Separation & Purification of Solanum nigrum Fractions by Chromatography 45

4.5.3 Antiviral Effect of Solanum nigrum Fractions 46

4.5.4 Dose Response Assay of Active Fraction of Solanum nigrum 49

xv

4.5.5 Synergistic Effect of Solanum nigrum Active Fraction (SN8) along with interferon (IFN) 51

4.6 Antiviral Effect of Grewia asiatica against HCV Genotype 3a and 1a 52

4.6.1 Antiviral Effect of Grewia asiatica against HCV-NS3 Proteases of Genotype 3a and 1a 55

4.6.2 Separation & Purification of Grewia asiatica Fractions by Chromatography 56

4.6.3 Antiviral Effect of Grewia asiatica Fractions 57

4.6.4 Dose Response Assay of Active Fraction of Grewia asiatica 60

614.6.5 Synergistic effect of Grewia asiatica Active Fraction (GA15) with Interferon (IFN) 62

4.7 Antiviral Effect of Syzgium cumine against HCV Genotype 3a and 1a 63

4.7.1 Antiviral Effect of Syzgium cumine against HCV-NS3 Proteases of Genotype 3a and 1a 64

4.7.2 Separation & Purification of Syzgium cumine Fractions by Chromatography 67

4.7.3 Antiviral Effect of Syzgium cumine Fractions 68

4.7.4 Dose Response Assay of Active Fraction of Syzgium cumine 71

4.7.5 Synergistic Effect of Syzgium cumine Active Fraction (SC14) with Interferon (IFN) 73

4.8 HPLC Analysis of Active Fractions 74

5 DISCUSSION 76-87

7 REFERENCES 88-99

8 APPENDICES

AppendixI 100-103

Appendix II (Publications) 104

xvi

LIST OF TABLE

Table 3.1 List of selected medicinal plants used for anti HCV activity 22

Table 3.2 Patients selected for medicinal plants screening, their viral loads and infecting

Genotype of HCV 24

Table 3.3.1 Primers of HCV Non-structure (NS3) gene of genotype 3a 26

Table 3.3.2 Primers of HCV Non-structure (NS3) gene of genotype 1a 26

Table 3.3.3 Primers for Glyceraldehyde-3-Phosphate Dehydrogenase gene (GAPDH) 26

xvii

LIST OF FIGURES

Figure 2.1 Hepatitis C virus (HCV): model structure 13

Figure 2.2 The HCV genome and expressed polyprotein 14

Figure 2.3 Hepatitis C virus (HCV) genome and potential drug discovery targets 20

Figure 4.1 Toxicological analysis of Plant Extracts in Huh-7 and CHO cells 36

Figure 4.2 Toxicological study of plant extracts in Huh-7 through MTT cell proliferation assay 38

Figure 4.3 Toxicological studies of SNSM, GALM and SCLM extracts in Liver (Huh-7) cells

through MTT cell proliferation assay 39

Figure 4.4 Antiviral effect of Plant extracts against HCV 3a and 1a genotype in liver cells 40

Figure 4.5 Antiviral effect of Solanum nigrum against HCV 3a and 1a genotype in liver cells 41

Figure 4.5.1.1 Antiviral effect of Solanum nigrum against HCV NS3 gene of genotype 3a and 1a

in liver cells 43

Figure 4.5.1.2 Real Time PCR analysis of Solanum nigrum against HCV NS3 gene of genotype

3a and 1a in Huh-7 cells 43

Figure 4.5.1.3 Antiviral effect of Solanum nigrum in different solvents against HCV NS3 gene

of genotype 3a and 1a in liver cells 44

Figure 4.5.1.4 Real Time PCR analysis of Solanum nigrum in different solvents against HCV

NS3 gene of genotype 3a and 1a in liver cells 44

Figure 4.5.2.1 TLC Chromatogram of Solanum nigrum (SN) 45

xviii

Figure 4.5.3.1 Antiviral effect of purified fraction of Solanum nigrum (SN8) against HCV

3a and 1a genotype in liver cells 46

Figure 4.5.3.2 Antiviral effect of column fractions (1-13) from Solanum nigrum against HCV


Figure 4.5.3.3 Real Time PCR analysis of Solanum nigrum active fraction (SN8) against HCV


Figure 4.5.3.4 HCV NS3 gene inhibition by S.nigrum at protein level 48

Figure 4.5.4.1 Dose dependant inhibition of active fraction (SN8) of Solanum nigrum against

HCV genotype 3a and 1a 49

Figure 4.5.4.2 Antiviral effect of active fraction (8th

) from Solanum nigrum in different

concentrations against HCV NS3 gene of genotype 3a and 1a in liver cells 50

Figure 4.5.5 Synergy in the antiviral activity of Solanum nigrum active fraction (SN8)

with interferon 51

Figure 4.6 Antiviral effect of Grewia asiatica against HCV 3a and 1a genotype in liver cells 52

Figure 4.6.1.1 Antiviral effect of Grewia asiatica against HCV NS3 gene of genotype 3a and 1a

in liver cells 54

Figure 4.6.1.2 Real Time PCR analysis of Grewia asiatica against HCV NS3 gene of genotype 3a and 1a in

liver cells 54

Figure 4.6.1.3 Antiviral effect of Grewia asiatica in different solvents against HCV NS3 gene of genotype

3a and 1a in Liver cells 55

xix

Figure 4.6.1.4 Real Time PCR analysis of Grewia asiatica in different solvents against HCV NS3 gene of

genotype 3a and 1a in liver cells 55

Figure 4.6.2.1 TLC Chromatogram of Grewia asiatica (GA) 56

Figure 4.6.3.1 Antiviral effect of purified fraction of Grewia asiatica (GA15) against HCV 3a and 1a

genotype in liver cells 57

Figure 4.6.3.2 Antiviral effect of column fractions (1-16) from Grewia asiatica against HCV NS3 gene of


Figure 4.6.3.3 Real Time PCR analysis of Grewia asiatica active fraction (GA15) against HCV NS3 gene of


Figure 4.6.3.4 HCV NS3 gene inhibition by G. asiatica at protein level 59

Figure 4.6.4.1 Dose dependent inhibition of active fraction of Grewia asiatica (GA15) against HCV of 3a

and 1a genotype 60

Figure 4.6.4.2 Antiviral effect of active fraction (15th

) from Grewia asiatica in different concentrations

against HCV NS3 gene of genotype 3a and 1a in liver cells 61

Figure 4.6.5 Synergy in the antiviral activity of Grewia asiatica active fraction (GA15) with

interferon (IFN) 62

Figure 4.7 Antiviral effect of Syzgium cumine against HCV 3a and 1a genotype in liver cells 63

Figure 4.7.1.1 Antiviral effect of Syzgium cumine against HCV NS3 gene of genotype 3a and 1a 65

Figure 4.7.1.2 Real Time PCR analysis of Syzgium cumine against HCV NS3 gene of genotype

3a and 1a in liver cells 65

Figure 4.7.1.3 Antiviral effect of Syzgium cumine in different solvents against HCV NS3 gene of


xx

Figure 4.7.1.4 Real Time PCR analysis of Syzgium cumine in different solvents against HCV


Figure 4.7.2.1 TLC Chromatogram of Syzgium cumine (SC) 67

Figure 4.7.3.1 Antiviral effect of purified fraction of Syzgium cumine against HCV 3a and 1a

genotype in liver cells 68

Figure 4.7.3.2 Antiviral effect of column fractions (1-15) from Syzgium cumine against HCV


Figure 4.7.3.3 Real Time PCR analysis of Syzgium cumine active fraction (SC14) against HCV


Figure 4.7.3.4 HCV NS3 gene inhibition by S. cumine at protein level 70

Figure 4.7.4.1 Dose dependent inhibition of Active fraction of Syzgium cumine against HCV

of 3a and 1a genotype 71

Figure 4.7.4.2 Antiviral effect of active column fraction (14th

) from Syzgium cumine in different

concentrations against HCV NS3 gene of genotype 3a and 1a in liver cells 72

Figure 4.7.3 Synergy in the activity of Syzgium cumine active fraction (SC14) with

interferon (IFN) 73

Figure 4.8 The HPLC Chromatogram of purified fraction (A) SN8 (B) GA16 and (C) SC14 75

1

INTRODUCTION Traditional use of medicinal plants implies in ethnobotanical literature. In developing

countries, the majority of the people rely on medicinal plants for health care. South East

Asian countries possess a rich, diverse and unique flora. Therefore, people in these countries

depend upon traditional medicinal plants against variety of ailments. According to an

estimate less than 10% of ethnic medicinal plants have been scientifically analyzed for any

bioactivity (Mohanty and Cock, 2012). Plant extracts, infusions and powders have been used

for treatment of numerous ailments and have shown potential against different human

diseases (Vijayan et al., 2004). About 25% of the frequently used medicines are derived

from plant source (Mukhtar et al., 2008) which includes aspirin isolated from Salix alba, and

quinine extracted from bark of cinchona tree (Newman et al., 2000).

Phytochemicals like tannins, flavonoides, glycosides and alkaloids present in these

plants are found to be active against herpes simplex virus (Cavallaro et al., 1995), influenza

virus, hepatitis B and C viruses (Hudson, 1989; Kitazato et al., 2007). These phytochemicals

either inhibit the viral DNA or RNA formation or hinder the viral reproduction (Hudson et

al., 1991). However, few of the endemic herbs are used for the treatment of various viral

diseases including Hepatitis C virus.

Several antiviral drugs have severe side effects which discontinue the standard

regimen therapy of interferon and ribavirin. So, there is an ever increasing need for the

search of phytochemicals possessing antiviral potential (De Clercq, 2002). Since, herbal

medication is perceived to be less toxic, and more efficacious (Pak et al., 2004) which makes

them more advantageous for the population of low income countries.

2

Hepatitis is the foremost issue to community health worldwide which may further

develop liver fibrosis, cirrhosis, hepatocellular carcinoma. According to an estimate about

170 million people worldwide (Ge et al., 2009) and approximately 10% of Pakistani

population is living with HCV (Idrees et al., 2008). There are seven major genotypes of

HCV (Nakano, T., 2012) and more than 80 subtypes (Kuiken et al., 2005). Some of them are

distributed worldwide, while others confined geographically. More than 90% of the

infections in America, Europe, Russia, Central Asia are caused by HCV genotype 1a, 1b, 2a,

2b, 2c and 3a (Simmonds, 2004). Genotype 3 and its other subtypes are highly prevalent in

South Asian countries. In Pakistan, the subtype 3a is the most frequent HCV genotype

(49.05%) and other genotypes have different distribution (Idrees et al., 2008) whereas

genotype 4, 5 and 6 are rare ones (Attaullah et al., 2011).

However, the preventive measures are limited and about 50% patients are unable to

show response for current therapies including peglated Interferon and Ribavirin (Bacon et al.,

2009). Interferon monotherapy or combination of interferon with ribavirin both are

successful treatment in some of the patients (Moradpour et al., 2005), while the modified

forms of Interferon including peglated Interferon-α have sustained virologic response (SVR)

of 41% (Manns et al., 2001). Similarly, the treatment with combination therapy of IFN α and

ribavirin in patients with chronic hepatitis C has sustained virologic response of about 10%

(Bacon et al., 2009).

The side effects of Interferon and Peglated Interferon treatment include depression,

fatigue, headache, myalgia and thrombocytopenia. Meanwhile, as a result of these adverse

effects 10% of HCV patients discontinue this therapy. HCV genotype 1 patients are the most

3

complicated to treat and their SVR rate is approximately 40% after 48 weeks of therapy

(McHutchison et al., 2009).

To reduce the HCV viral load, a number of recent therapies are at different stages of

clinical trials (Zeuzem et al., 2011). These drugs include direct acting antiviral (DAA)

agents, which acts on the target during the viral life cycle. Recently, NS3/4A inhibitors are

the most widely studied and are successful direct acting antiviral therapy (Asselah and

Marcellin, 2011). The ultimate target of HCV eradication is to develop a shorter, more

efficient treatment schedule comprising of oral dosage that have a few side effect profile than

peglated Interferon α and ribavirin. Preliminary studies in this area are focusing on the

combination therapy of a protease and polymerase inhibitors (Jazwinski and Muir, 2011).

The triple combination of peglated Interferon, ribavirin plus a protease inhibitor has

increased sustained virologic response to about 60% in HCV genotype 1 patients (Asselah et

al., 2009; Asselah and Marcellin, 2011).

This study was an attempt to find out medicinal plants with potential antiviral agents.

Therefore, the twenty four medicinal plants were selected and their methanolic extracts were

concentrated and dried. In vitro toxicity of extracts was checked in Huh-7 and CHO cell lines

at 100 µg/µl concentration. Subsequently, blood serum from HCV positive patients of

genotype 3a and 1a were collected and pooled to evaluate the antiviral effect of extracts in

liver cell line and level of HCV-RNA was detected by Quantitative Real Time PCR. It was

found that five out of twenty four medicinal plants designated as SN, GA, SC, AM and FC

showed antiviral effect against HCV genotypes 3a and 1a in in vitro assay. Plant extracts

with antiviral potential were further fractionated by various chromatography techniques and

4

purified fractions were tested for antiviral activity against Hepatitis C virus, alone and in

combination with Interferon.

Present study shows that Pakistan‘s diverse flora has many potent antiviral plants.

Moreover, after determination of their chemical species responsible for anti HCV activity

and in combination therapy with interferon will help to develop future HCV therapies.

Therefore, more research is required on medicinal plants which are used by indigenous

people for treatment of Hepatitis C.

5

LITERATURE REVIEW

2.1 History of Traditional Medicinal Plants

The history of medicine dates back to the origin of human race. The use of plants as a

remedy of different diseases has been inherited and is an important element of health care

scheme worldwide. From last two decades use of traditional medicinal plants against various

ailments has increased. These medicinal plants are considered too rich in photochemicals of

interest for drug development (Calland et al., 2012). Traditional medical practitioners used to

hide the formulation and identity of plants used for the cure and healing of different diseases.

The reason behind was that patients should not learn to treat themselves.

The use of folk medicines throughout the world commonly depends upon local flora

and traditional experiences. For example, most of the Chinese people even now use Chinese

herbs from ancient times. In China, almost 5000 medications are in use by traditional healers

and these medicines account for roughly one fifth of the whole Chinese pharmaceutical

market (Murphy et al., 2002). Likewise Ayurveda includes herbal remedies is a traditional

Indian medical system for disease prevention and treatment (Morgan, 1994).

To avoid the adverse effects of synthetic medication, most of the people rely on

traditional medicinal plants. The first effort for the development of an antiviral agent was

performed by Boots a Drug Company of England for developing drug against influenza

virus and they screened more than 280 plants (Mukhtar et al., 2008). In the latter part of the

20th

century plant based medicine or ‗Alternative Medicine‖ became very common in USA

and western countries because of its natural origin. Traditional medicine use centuries old

plant formulations while modern plant based medicine use extraction of active

phytochemicals provides as raw material for synthesis of different drugs.

6

2.2 Ethnobotanic Flora of Pakistan

In countries like Japan, India, China, Pakistan, Srilanka, Thailand and neumerous

African countries large number of people depend upon herbal drugs to cure different diseases

(Hoareau and DaSilva, 1999). Pakistan possesses a very rich and unique flora with variety of

medicinal plants due to topography and distinct four seasons. About 6,000 species of

flowering plants have been reported from Pakistan and Kashmir and nearly 372 plant species

are endemic (Qureshi et al., 2009). In Pakistan about 75% of the population resides in

villages and remote areas with lack of health facilities. Most of these poor and ignorant

people have no option except to practice traditional medicines (Azaizeh et al., 2003). A vast

knowledge about use of local medicinal plants is expected to be present in such areas (Diallo

et al., 1999).

For the treatment of various diseases, traditional practitioners (Hakeems) utilize

remedies based on different parts of the plant for medicinal purposes. For instance, for the

cure of wounds the powdered leaves and bark of Caryopteris odorata is used. Likewise, the

bark and leaves of Daphne papyracea used as poultice for tumors and whole plant of

Cichorium intybus is used for jaundice and hepatitis while aerial parts of this plant are used

for asthma, typhoid, and ulcer (Abbasi et al., 2009; Haq and Rehman, 1990; Zafar and Ali,

1998). So, there is a need of scientific research to identify potential phytochemicals from

these traditional medicinal plants (Nisar et al., 2011).

7

2.3 Cytotoxicity of Antiviral Phytochemicals

The potential phytochemicals or bioactive compounds have to be confirmed as non

toxic to life for the production of new antiviral drug. For this reason, different cytotoxic

assays are performed by utilizing cell culture system. Cells may behave differently as a

result of phytochemical treatment. While evaluation, cells may found as lysed, reduced

growth or even apoptosis (programmed cell death). Some of the integral cytotoxic assays

includes, cell viability and proliferation assay which are based on evaluation of different

parameters.

Moreover, colorimeteric and luminescence based assay use microliter plate reader or

ELISA plate reader to measure the toxicity of bioactive compounds. To determine membrane

integrity, vital dyes assay can be performed such as trypan blue, intracellular components of

cell dyed with trypan blue dye, if cell membrane is ruptured (Jauregui et al., 1981). MTT is

another colorimetric assay for the measurement of reducing potential of metabolically active

cells. Tetrazolium salt (3-[4, 5-dimethylthiazol-2-y1]-2, 5- diphenyltetrazolium bromide)

(MTT) will reduce to blue colored formazan by viable cells (Dhawan, 2012).

2.4 Antiviral Activity of Medicinal Plants

World Health Organization (WHO) estimates that globally about 80% the people

fulfills their health care issues by utilizing phytochemicals (Grossmann et al., 2010;

Nascimento et al., 2000). Antiviral potential of several phytochemicals has been reported by

several research groups. Taking into account the vast number of plants and diversity of their

8

chemical constituents, there is a need to screen plants for their antiviral domain. Therefore,

utilizing these potent phytochemicals can be the better option for the treatment of viral

diseases in future.

Studies have also suggested the antiviral effect of medicinal herbs extract on various

viruses which includes herpes simplex virus type 2 (HSV-2), (Vermani and Garg, 2002) HIV

and Hepatitis B Virus (HBV) (Kapusta et al., 1999). Syzygium aromaticum (clove) is used in

traditional medical practice for its main compound, eugenol has many therapeutic benefits

including antiseptic, antibacterial, analgesic, antifungal, anticancer, antioxidant, anti-

inflammatory (Hussain et al., 2009) antimutagenic and as pesticidal agent against several

pests. The essential oil of S. aromaticum has number of antimicrobial agents for aquaculture

(Kumar et al.). Recently, Syzygium aromaticum has shown to possess antiviral potential, in

combination with acyclovir against HSV-1. Furthermore, it also limited the replication of

cytomegalovirus (CMV). Another cosmopolitan medicinal herb Solanum nigrum is

beneficial for the treatment of ulcers, nervous system disorders, liver disorders (Khattak et

al.; Saleem et al., 2010).

2.5 Medicinal Plants against Hepatitis C Virus

Recently, natural products are enormously employed for anti HCV activity. Studies

and clinical trials have shown that Glycyrrhiza uralensis (licorice root), glycyrrhizin sulphate

is involved in inhibition of HIV replication and induces IFN activity (Jatav et al., 2011).

Silybum marianum (milk thistle) possesses antioxidant, anti inflammatory,

immunomodulating and liver regeneration capacity with therapeutic effects against fatty

liver, cirrhosis and viral hepatitis (Ashfaq et al., 2011). Viscum album extract stabilizes liver

9

function and cyclosporine-A has shown effect in limiting the HCV RNA below the detection

level (Li et al., 2012; Wang et al., 2013).

Beneficial extracts obtained from plants such as Piper cubeba, Trachyspermum ammi,

Embelia schimperi, Boswellia carterii, Quercus infectoria, and Syzygium aromaticum were

examined for in vitro antiviral activity against HCV proteases (Kitazato et al., 2007).

Therapeutic phytochemicals includes terpenoids, triterpenoids, fatty component, thiophenes,

flavonoids and steroids which exhibited promising antiviral effect against different viral

infections. There is enormous potential of useful phytochemicals to expose, evaluate and

exploit for therapies against diverse viral family like HCV (Jassim and Naji, 2003). The

different species of genus Grewia are used for their medicinal importance throughout the

world. The roots of G.abutilifolia are helpful against abscesses, and G. asiatica leaves are

utilized in pustular eruptions (Ahaskar et al., 2007; Zia-Ul-Haq et al., 2012).

Hepatoprotective effect of Ayurvedic herb for antituberculosis treatment has been

studied to assess the hepatopprotective effect of some Ayurvedic herbs. Hydroalcoholic root

extract of Berberis aristata (Daruha ridra), Aloe vera (Ghritakumari) ariel parts and Solanum

nigrum (Kakmachi) whole plant, herb Phyllanthus fraternus (Bhumayamalaki) exhibited

hepatoprotective efficiency (Sharma et al., 2004).

2.6 Future of Medicinal Plants

Medicinal plants have a promising future, as more than 500,000 uninvestigated

medicinal plants throughout the world (Hassan, 2012). These potential therapeutic plants

needs to be explored, some of them possess even more potential than expected. On the other

10

hand, many food contents contain non-nutritive phytochemicals such as flavonoids, phenolic

acids and carotenoids, which are considered to provide protective effect against chronic

diseases (Boyer and Liu, 2004). These antioxidants reduce the threat of free radicals and

improve the immune response. According to research of Block and coworkers, people who

eat more fruits and vegetables have limited risks of cancers (Block et al., 1992).

So far, the research on medicinal plant based drugs has shown some exceptional

characteristics when used for treatment. They can act as synergic medicine to interact

simultaneously, thus their possible adverse effects are neutralized. Some plant base drugs can

be used for the support of approved medicine during the treatment of complex diseases like

cancers, so play an effective role and even reduces the side effect of synthetic medicines

(Hassan, 2012). Another important character of medicinal plants is their behavior as

preventive medicine, possess ability to prevent diseases; despite of synthetic medicines

which can only be used when the disease occurs.

Therefore, a systematic scientific study is required to identify and isolate bioactive

compounds from traditional medicinal plants. This should include cytotoxic effect followed

by invitro and invivo animal models and finally clinical trials. After passing through this

route promising novel bioactive compounds can be optimized and new medicinal plants

derived drugs can be introduced in the market for the improvement of individual‘s health all

over the world.

11

2.7 Hepatitis C Virus (HCV)

Hepatitis C virus (HCV) is a foremost health dilemma globally. World Health

Organization (WHO) appraised about 170 million infected people though out the world with

Hepatitis C Virus (Ghany et al., 2011). HCV virus is an envelope RNA virus, first identified

by Choo et al in 1989. Formerly, HCV was named as ―non A, non B (NANB) Hepatitis‖. It

is among seven different hepatotrapic viruses identified today, the other viruses include

Hepatitis A, B, D, E and G Virus (Bostan and Mahmood, 2010) (Lanford et al., 1994).

HCV was identified and characterized by molecular cloning techniques using serum

from a NANB hepatitis virus from infected chimpanzee and based on the similarity of the

genomic organization and hydropathy profiles of several precursor proteins. It is classified as

a member of Flaviviridae family (Collett et al., 1988) which also includes Dengue virus.

Hepatitis C Virus encodes for single polyprotein of about 3010 amino acid. However, the low

sequence homology compared to other flaviviruses ultimately lead to its classification into a

hepacivirus which is different from other flavivirus members (Bollati et al., 2010).

2.8 HCV Molecular Evolution

To estimate the origin of HCV, when it was introduced into human population,

remains hard to know because its inability to identify HCV or HCV like variants in Ape

species (Simmonds, 2004). However, in theory, it may be possible to calculate the

divergence time of the main clades and splitting of subtypes by using the constant nucleotide

substitution rate over time. The rate of HCV sequence change in whole genome is 1.44 x 10-3

nucleotide changeover per site per year. An evolutionary rate of 7.4 x 10 -4

nucleotide

replacement per site per year for E1 gene and 4.1x 10-4

or the NS5B gene was calculated by

12

Smith in 1997. The subtypes deviate around 300 years ago, and the variance of different

genotypes occurred around 500-2000 years ago (Smith et al., 1997).

2.9 Genotype and Ethnic Origin

Identification of Hepatitis C virus genotype is critically important and responsible for

the response and time period required for treatment (Noppornpanth et al., 2006). According

to facts, genotype 1 and 4 are more resistant to peg-IFN and ribavirin, standard therapy than

genotype 2 and 3. Furthermore, severe liver disease is reported in case of patients with

chronic HCV genotype 1b. (Trinks et al., 2012). In epidemiological studies HCV genotyping

is an easy method utilize genotype specific HCV antibodies.

Presently, three broad patterns of Hepatitis C virus genotype distribution exists (Fretz

et al., 1995). Genetically most diverse genotype pattern are 1 and 2 prevalent in West

African regions (Ndjomou et al., 2003). On the other hand, in developing countries and under

developed counties, there is lack of authentic data about the disease burden. One fifth of the

world‘s population resides in China, where HCV seroprevalence is about 4.9%. In South

Asian countries including India, Indonesia and Pakistan, seroprevalence ranges from 0.9 % to

6.5%. The most prevalent HCV genotype in Pakistan is genotype 3, which is also most

frequent genotype in northern and northeastern, and central India, with high infection rates of

more than 70% acute and more than 80% chronic hepatitis patients (Chaudhuri et al., 2005;

Hissar et al., 2006).

In China and Japan most HCV infections are with genotype 1b, whereas genotype 4

is frequently found in Middle East and North Africa and genotype 5a in South Africa, while

genotype 6 is frequent in Hong Kong (Dusheiko et al., 1994; Simmonds, 2004). Asian and

13

African countries are reported to have highest prevalence of HCV as compared to rest of the

world. Moreover, the rate of seroprevalence is 20% in Central Africa and Egypt, 4% in Asian

and Mediterranean countries (ANNEMARIE WASLEY and Alter, 2000).

On the contrary, the developed nations of North America, Western Europe and

Australia have low HCV seroprevalence rate i.e. in Germany 0.6%, Canada 0.08%, France

and Australia have 1.1% (Shepard et al., 2005). Slightly higher seroprevalence is reported in

some other developed countries including USA 1.8%, Japan 1.5-2.3% and Italy 2.2%

(Shepard et al., 2005).

Figure 2.1: Hepatitis C virus (HCV): Model structure Image taken from Louis E. Henderson (Frederick

Cancer Research Center)

14

Figure 2.2: The HCV genome and expressed polyprotein: Translation depends on an internal ribosome entry

site (IRES) within the 5‘ non translated region (NTR). The polyprotein precursor is posttranslationally

processed by host and viral proteases and the HCV structural and nonstructural proteins are localized within

the endoplasmic reticulum membrane.

2.10 Genetic Organization of HCV

HCV genome is comprised of open reading frame (ORF) and at 5‘ and 3‘ ends very

stable non translated regions (NTR) which further forms secondary and tertiary structures.

During translation, the polyprotein is processed from 5‘ to 3‘ reigon to produce core (C),

envelope E1, E2, p7, NS2, NS3, NS4A, NS5A and NS5S (Bartenschlager and Lohmann,

2000). All the substructures have different tasks in HCV life cycle.

15

2.10.1 Structural Proteins

The structural protein which form viral particles, have following order; core,

enveloped E1, E2 and p7. According to different studies, core protein affects the cellular

functions of host including gene transcription, apoptosis and signaling pathways

(Tellinghuisen and Rice, 2002). The envelope proteins are supposed to involve in cell entry

(Bartosch et al., 2003a). P7 has vital role in assembly and release of virus particles

depending upon the viral genotype (Steinmann et al., 2007).

2.10.2 Nonstructural Proteins

The second part of HCV genome encodes numerous NS proteins such as: NS2, NS3,

NS4A, NS4B and NS5A. The function of NS2 protein is not elucidated so far (Duvet et al.,

1998) whereas, NS3 serine protease influences the cellular host defense has emerged as

antiviral target (Foy et al., 2005; Meylan et al., 2005). For the development of anti HCV oral

drugs, NS3-4A serine protease and central component of HCV replicase NS5B are

considered to be most attractive targets (De Francesco and Migliaccio, 2005; Kolykhalov et

al., 1997).

2.11 Model Systems for Investigating Life Cycle of HCV

2.11.1 Cell Lines and Primary Cell Culture

Since HCV was identified in 1989, serological and epidemiological studies seemed to

be unsusceptible to HCV infection. The major limitation for hepatitis C virus research was

the lack of cell culture system. Moreover, Flaviviruses including HCV like other positive

16

strand viruses replicate by means of a negative strand RNA intermediate. Therefore, in in

vitro studies to detect negative sense molecule strand specific RT-PCR is used (Yan et al.,

2000).

Significant increase in HCV positive strand RNA has also been reported within the

first four days of infection in chimpanze by using strand specific RT-PCR. On contrary, the

negative strand RNA signal become detectable on day four and increases afterwards.

Furthermore, Lanford and colleagues noted that from baboons, primary liver cells isolated

are not vulnerable to infection sustaining the idea that HCV has only limited hosts. Several

studies on HepG2 and Huh-7 liver cell lines remained unsuccessful although there were

comprehensive variations in experimental conditions (Lanford et al., 1994). A large number

of potent targets for direct acting antiviral (DAA) agents has been identified through

replicative cell culture system and resolution of three dimentional structures of HCV protein

(Sarrazin and Zeuzem, 2010).

2.11.2 The Replicon System

However, the primary cell culture provided some insight into the basic principles of

HCV infection. The heterogeneity of the inoculums and the low RNA replication rate has

made it complicated to analyze all the features of viral life cycle. Later on, neomycin

selectable HCV mini genome (replicon) based on the Con1 consensus genome cloned from

liver derived viral RNA was created (Krieger et al., 2001). At first, a full-length genome was

used to transfect various cell lines and primary human hepatocytes.

17

Therefore, a full length genome was used to transfect various cell lines. The full

length RNA failed to replicate to generate a 16 number of bicistronic construct, with 5‘HCV

internal ribosomal entry sites (IRES) neomycin phosphotransferase gene, the genotype 1b

non-structural genes NS2 or NS3 to NS5B under the control of encephalomyocarditis virus

(EMCV) the HCV 3‘ nontranslated region (NTR). Distinctive to the full length counterparts

the subgenomic replicons replicated to a high level, was credited to cell culture based

mutations in the NS3, NS5A and NS5B region of HCV genome (Blight et al., 2003; Krieger

et al., 2001).

On these findings, several groups successfully generated full length replicons with

single amino acid substitutions in the genes encoding the non structural viral proteins (Blight

et al., 2000; Pietschmann et al., 2001). As expected these cell culture adaptive mutations

clearly improved RNA levels as well as the incidence of cells supporting replication.

Nevertheless, Huh-7 cells harbouring full length replicons of the prototypic viral strains

Con1 and HCV-H, still failed to produce infectious particles although the Con1 strain was

infectious in vivo (Bukh et al., 2002). Furthermore, the number of HCV-RNA replication

competent cells within the total population remained low even for adapted replicons,

suggesting that the cellular background was major determinant of replication efficiency

(Blight et al., 2003).

To enhance permissiveness of the Huh-7 cell line, cells were transfected with

subgenomic replicons with either the wild type amino acid sequence a serine to leucin

substitution (S2204I) in the NS5A region, or a 47 amino acid NS5A deletion (5AD47). Cells

supporting viral replication were chosen and cured of HCV-RNA by extended treatment with

interferon (IFN) α. The resulting clonal cell lines were then tested for their ability to support

18

HCV replication following transfection with subgenomic and full length replicons (Wakita et

al., 2005). However, mutation in RIG-I eliminates pathogen associated molecular patterns

(PAMP) signalling to IRF3, thus inhibiting the cellular antiviral response and presenting an

increased permissiveness for HCV RNA replication in Huh-7.5 cells (Sumpter et al., 2005).

The replicon system provides a important tool to study HCV replication. However, it

does not allow studies of virus attachment and entry (Baumert et al., 1998). Development of

infectious HCV pseudoparticles (HCVpp) by several research groups expressing the E1/E2

structural proteins in 293T cells with a packaging construct encoding the HIV genome minus

the envelop gene, and the gag and pol genes of murine leukaemia virus (MLV) (Bartosch et

al., 2003b). Huh-7 cells can be infected by; 293T cells secreted virus pseudoparticle which

can further be evaluated by luciferase or GFP assays (Cai et al., 2005; Hsu et al., 2003). The

Coexpression of these constructs led to the assembly of infectious replication deficient HCV

pseudoparticles, which makes it possible to study details of virus attachment (Yi et al., 2006).

2.11.3 Animal Models

The chimpanzees were the only animal model available since last two decades for the

study of HCV infection. Similar to humans, after few days of infection, chimpanzees also

have 105 and 10

7 RNA genome copies/ml in serum and raised aminotransferase (ALT) levels

(Tan, 2006).

Finally, the chimpanzee model was considered to be successful model system for the

establishment of molecular clones of HCV (Kolykhalov et al., 2000). Human beings are

mostly asymptomatic, which makes it difficult to study the acute phase of infection.

Researchers have reported the creation of chimeric (xenograft) mice harbouring human

19

hepatocytes (Mercer et al., 2001) are immunodeficient and suffer from severe, chronic liver

disease caused by over expression of the noxious protein urokinase. Chimeric mice, such as

the SCID/uPA mouse, are successfully infected with HCV derived from 21 human sera and

have shown to support viral replication at relevant titers (Meuleman et al., 2005).

2.12 Hepatitis C Virus Drug Development

2.12.1 NS3 Serine Protease as a Drug Target

So for the protease inhibitors are considered to be promising target for treatment of

severe viral diseases including HIV. Viral RNA replication can be inhibit by the NS3 protein

(Locarnini and Bartholomeusz, 2002). An additional task is to develop a molecule that mimic

the natural peptide ligand (peptidomimetic), where the cleavable amide bond is substituted

with a non cleavable isostere (Leung et al., 2000).

2.13 HCV NS3 Protease

NS3 protease is a small protein which belongs to sub-class of small chymotrypsin like

protease (Bazan and Fletterick, 1988). There are several compounds that influence the

activity of the NS3 protease and the drugs that inhibit NS5B polymerase are presently in

clinical trials, and will likely to become the next generation of anti HCV drugs. The segment

of HCV which acts as a helicase has attracted the attention of researchers interested in

developing novel antiviral drugs and interaction of proteins with nucleic acid.

20

Figure 2.3: Hepatitis C virus (HCV) genome and potent drug discovery targets (Asselah and Marcellin,

2011)

2.14 Disease Management

Timely clearance of HCV to prevent the risk of hepatocellular carcinoma (HCC) and

to decrease mortality is the aim of antiviral remedy in patients with HCV infection. In past,

several studies have reported that using 3 million International units (MIU) of IFN, thrice a

week for 6 to 24 weeks or similar dose of IFN intravenously for 4 to 7 weeks are beneficial

in clearing virus and normalizing ALT levels. Use of IFN (3 MIU, 3 times in a week)

intramuscularly for 4 weeks has shown similar results (Dhiman and Chawla, 2005).

Since 2001, recombinant interferon is replaced by pegylated interferon α (Peg-IFN α)

with Ribavirin (RBV) and more sustained virologic response has been observed in genotype

1 patients of chronic Hepatitis C (Ghany et al., 2011). The Peg-IFN and RBV therapy has

shown an efficacy limit to 30% with severe side effect. This combination therapy shown

21

better results in patients with HCV genotype 2 and 3 although only small numbers of patients

have shown complete clearance of virus by this method (Sánchez–Tapias et al., 2006).

Furthermore, the disease management in patients with HCV genotype 1 has low response to

combination therapy of pegylated interferon and rebavirin. (Biselli et al., 2006).

Recently, number of new HCV inhibitors has reached clinical trials at different

stages. However, only few NS3/4A protease inhibitors have studied on patients with HCV

genotype other than 1. Similarly, telaprevir has shown response against genotype 3 and a

limited effect on genotype 4, boceprevir has shown modest antiviral effect is shown in

genotype 2 and 3 (Tong et al., 2012). Adverse effects of telaprevir includes anemia, rash,

pruritus and these effects are sometimes more severe with limited treatment options

(Cunningham and Foster, 2012). This emphasizes the need for more efficient and less toxic

antiviral therapy against Hepatitis C Infection.

22

MATERIALS AND METHODS

3.1 Medicinal Plants Collection and Solvent Extraction

Medicinal plants were collected from different climat zones of Pakistan based on

indigenous knowledge (undocumented reports from Hakeems) and then shade dried.

Extraction of different parts of plants was carried out by simple maceration process with n-

hexane, chloroform, acetone and methanol successively at room temperature (25C0) for 24

hours. Extracts were concentrated by Rotavapor-R200 (Buchi) at 35ºC and stored at -70C0.

Stock solutions of each extract were prepared in DMSO (Dimethyl sulfoxide). The working

stock solution of plant extracts was prepared from main stock by diluting these in the culture

medium.

Table 3.1: List of selected medicinal plants used for anti HCV activity

Sr.# Plant Name Family Abbr. Part

Use

Local/

Vernacular

Name

Local use

1 Chenopodium

album

Amaranthaceae CAAM Arial Bathu Hepatoprotective ,

Antibactrial

2 Phyllanthus amarus Euphorbiaceae PALM Leaves Amla Kidney stone,

Hypertention,

Jaundice.

3 Nordastachys

jatamansi

Valerianaceae NJRM Root Balcher,

jatamansi

Hypoglycemic

4 Trianthema

portulacastrum

Aizoacae TPAM Arial It sit,

Lalsabooni,

Baskhipra

Anthelmintic,

Hypoglycemic,

5 Syzygium

aromaticum

Myrtaceae SALM Leaves Clove,

lavang

Carminative, pain

killer

6 Moringa oleifera Moringaceae MOPM Pods Sohanjna Antidiabetic,

Hepatoprotective,

7 Momordica

charantia

Cucurbitaceae MCLM Leaves Karela, Antiviral, dyspepsia

8 Nigella sativa Rununculaceae NSSM Seeds Kalvanje Anticancer

http://en.wikipedia.org/wiki/Cucurbitaceae

http://en.wikipedia.org/wiki/Dyspepsia

23

9 Avicennia marina Acanthaceae AMLM Fruit Mangrove Antiviral

10 Colocasia esculenta Araceae CELM Leaves Kachalu,

Arvi

Antidiarrhea,

Antipyretic

11 Citrus sinensis Rutaceae CSLM Leaves Purtkal,Mal,

Musammi

Antifungal,

Antipyretic

12 Piper nigrum Piperaceae PNSM Seeds Fulful siah,

Kali mirch,

mirch siah

Antibacterial, Anti

Trypanosoma

13 Morus alba Moraceae MALM Leaves Toot safeed,

Shahtoot

Antimicrobial

14 Cucurbita pepo Cucurbitaceae CPLM Leaves Kaddu,

Gheeya

Anti depressant,

Antibacterial

15 Grewia asiatica Malvaceae GALM Leaves Falsa Antifungal,

Antiviral

16 Terminalia arjuna Combretaceae TALM Leaves Arjun, Parth Hepatoprotective

17 Cichorium intybus Compositae CISM Seeds Chakori,

kasni

Jaundice,gallstone

18 Hibiscus sinunsis Malvaceae HSFM Fruit Rozeela Antibacterial,

Antipyretic

19 Valeriana jatamansi Valerianaceae VJAD Arial Tagar,

Mushk bala,

Neer bala

Anxiolytic ,

Insecticidal

20 Syzygium cumini Myrtaceae SCLM Leaves Jamu, Jamun Antibacterial, Anti-

inflammatory

21 Fagonia cretica Zygophylaceae FCWM Arial Dramah,

Damah

Antitumour,

Antibacterial

22 Cordia dicotoma Boraginaceae CDLM Leaves Clammy,

Lasoori

Anti-inflammatory

23 Solanum nigrum Solanaceae SNSM Seeds Black Night

Shade,

Mako

Mouth Ulcer,

Antitumour

24 Trachyspermum

ammi

Apiaceae TASM Seeds Ajowan,

Caraway

Digestive aid,

Antiseptic

3.2 Serum Samples Collection

Serum samples were collected from 20 HCV patients who were chronically infected

and without any previous history of antiviral drug treatment regimen, from The National

Center of Excellence in Molecular Biology (CEMB) virology and diagnostic laboratory

under the Provision of Institutional Review Board (IRB) Lahore, Pakistan (Table 3.2). For

http://en.wikipedia.org/wiki/Araceae

24

this study, participating subjects (Male & Female) were agreed on detail consent for the

collection of blood samples. The expected period of HCV infection varied from 6 months to

12 years. Both male and female patients were included in HCV blood sampling without

children. The chronic HCV diagnosis was based on high levels of serum ALT (SGPT) and

AST (SGOT), histological assessment, and regular recognition of serum HCV RNA for at

least 6 months. In each patient, anti-HCV antibodies (3rd

generation ELISA) were present

and all patients included in this study were negative for HBs Ag.

Table 3.2: Patients selected for medicinal plants screening, their viral loads and infecting genotype of

HCV

Patient Age Sex Serum Titer

(IU/ml)

Genotype Serum

Volume

1 36 M 154×105 3a 500µl

2 48 F 232×105 3a 500 µl

3 41 M 173×105 3a 650 µl

4 53 M 627×105 3a 500 µl

5 37 M 513×105 3a 500 µl

6 54 F 291×105 3a 600 µl

7 53 F 826×105 3a 500 µl

8 46 M 182×105 3a 500 µl

9 41 F 751×105 3a 500 µl

10 29 M 483×105 1a 500 µl

11 38 M 532×105 1a 500 µl

12 43 F 139×105 1a 500 µl

13 47 F 476×105 1a 500 µl

14 28 M 372×105 1a 750 µl

15 51 M 271×106 1a 500 µl

16 35 F 181×105 1a 500 µl

17 46 F 538×105 1a 500 µl

18 52 M 354×105 1a 600 µl

19 39 M 137×105 1a 500 µl

20 36 M 128×105 1a 500 µl

25

3.3 Cell Lines

Huh-7 and MDBK cells were propagated in Dulbecco‘s modified Eagle medium

(DMEM) with addition of cell culture tested 10% fetal bovine serum, 100IU/ml penicillin

and 100µg/ml streptomycin, in 37°C incubator of an atmosphere of 5% CO2. The cells of

Chinese Hamster Ovary (CHO) were cultured in DMEM Hams F12, adding 100IU/ml

penicillin and 100µg/ml streptomycin and 5% fetal bovine serum. The cells of Huh-7 cell

line were generously presented by Dr. Zafar Nawaz (Biochemistry and Molecular Biology

Department, University of Miami, USA). CHO cell line was a kind gift of Dr. Ahmad Usman

Zafar (Biopharmaceutical Lab CEMB, Lahore).

3.4 Plasmids

PCR 3.1 containing NS3 gene of genotype 3a and 1a was taken from functional

Genomics Lab, CEMB Lahore.

3.5 Chemicals

HCV-NS3 specific monoclonal antibody (Sc-52806) was purchased from Santa

Cruiz Biotechnology. Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) and secondary

gout antimouse monoclonal antibodies from Sigma Aldrich (St. Louis, MO, USA) were

purchased. TLC 60 F254 plates were obtained from Merck (Germany) and silica gel with

binder and fluorescent indicator (Cat# 34644-6) from Sigma Aldrich (St. Louis, MO, USA).

26

3.6 Primers Designing

For primers designing, sequences of HCV specific nonstructural gene (NS3) of 3a

and 1a genotype were retrieved from NCBI. The NCBI sequence was altered into FASTA

format and primers were designed through primer 3 software.

Table 3.3.1: Primers of HCV Non-structure (NS3) gene of genotype 3a

S. No Primer Sequence (5‘-3‘) Length

1 NS3F 3a GACCATTGTGACCAGCTTGA 20

2 NS3R 3a GCGGGTGACCAAGTACAAGT 20

Table 3.3.2: Primers of HCV Non-structure (NS3) gene of genotype 1a


1 NS3F 1a GGACGACGATGACAAGGACT 20 2 NS3R 1a CCTCGTGACCAGGTAAAGGT 20

Table 3.3.3: Primers for Glyceraldehyde-3-Phosphate Dehydrogenase gene (GAPDH)


1 GAPDH F ACCACAGTCCATGCCATCAC 20

2 GAPDH R TCCACCACCCTGTTGCTGTA 20

3.7 Trypan Blue Dye Explosive Method for Cellular Toxicity

For verification of Huh-7 and CHO cells viability, trypan blue dye explosive method

was employed before antiviral screening of plant extracts. Liver cells (Huh-7) were cultured

in concentration of 8×104 in twelve well plates for toxicological analysis of plant extracts.

First two wells of plate were considered as control and in the remaining wells plant extracts

from lower to higher concentrations were added. After 24 hours cells were trypsinized with

Trypsin EDTA solution, a suspension in 1:1ratio of trypan blue dye and cell suspension was

made and 10µl of this mixture was dispensed on a glass slide and the viable cells were

counted by using hemocytometer under the microscope.

27

3.8 MTT Cell Proliferation Assay

MTT (3-[4, 5-dimethylthiazol-2-y1]-2, 5- diphenyltetrazolium bromide) is a quick,

precise and sensitive in-vitro method to evaluate the toxicity of plant extracts in cell cultures.

The MTT is a yellow colour dye which is reduced to succinic dehydrogenases in living

(attached to bottom of the flask) cells to purple colour formazan crystals which are

precipitated and become insoluble in aqueous medium. The spectrophotometric absorption

wavelength of dissolved purple colour formazan in the visible range shows a direct

relationship with the quantity of cells attached to the bottom (viable cells) (Mosmann, 1983a)

In order to study the toxicity of Huh-7 and CHO cells, 4×104

cells/well of these cells was

cultured in 96 well cell culture plates. The test plant extracts of different concentrations were

added in culture plates after 24 hrs, and kept in an atmosphere of 5% CO2 at 37°C for 24 h.

After that the media having test plant extracts was removed and 100µl fresh media and 30µl

of MTT mixture (5mg/ml in PBS) were dispensed to all wells (1-12) of the 96 well plate. The

plate was wrapped with aluminium foil sheet and placed in 37°C incubator for 3-4 hrs. The

media was removed cautiously and the formazan crystals in all 1-12 columns were dissolved

in 100µl of Dimethyl sulfo-oxide (DMSO). The formazan end product was deduced by

measuring spectrophotometric absorbance at 570 nm (test wavelength) and 620 nm

(reference wavelength) by Enzyme Linked Immunosorbent Assay (ELISA) plate reader.

The viability of cells was determined by following equation.

Cell Viability (Percent) = (Test 570nm-620nm) / (Control 570nm-620nm) × 100

28

3.9 Antiviral Analysis of Compounds in Liver Cells

Liver cells (Huh-7) were propagated in 6 well plates at a concentration of 3×105 cells

per plate. After an incubation period of 24 hrs, 1xPBS was used to wash the cells thrice.

Then, HCV viral inoculations at concentrations of 105 IU of genotype 3a and 1a were added

in each well. In 6 well plate, the first well was chosen as control (only HCV contaminated

serum and the solvent) and dispensed a dose of test plant extract (minimum number of cell

death) in the remaining wells of culture plate for studying the antiviral effect of plant extracts

on the same day. Total RNA was extracted by Gentra RNA isolation kit (Gentra System

Pennsylvania, USA) in accordance with manufacturer‘s protocol. Briefly, cells attached to

bottom of the plate were scratched with cell lysis solution and the pallet of RNA was mixed

homogeneously in 1% Diethyl pyrocarbonate (DEPC) treated water. Then 5µl internal

control (Sacace Biotechnologies Caserta, Italy) was added in each tube. The absolute

quantification of HCV-RNA samples was performed by Real Time PCR Smart Cycler II

system (Cepheid Sunnyvale, USA) by using the Sacace HCV quantitative analysis kit

(Sacace Biotechnologies Caserta, Italy) in accordance with manufacturer‘s protocols.

Calculation of HCV RNA Concentrations

In order to determine the quantity of HCV-RNA, following formula was used.

Where IC represents the internal control for a particular lot prepared.

29

3.10 Transfection of Huh-7 Cells with pCR3.1/Flag TAG/HCV

Nonstructural Gene

Huh-7 (liver) cells were rapidly transfected by HCV non structural gene of 3a and 1a

genotype with constructed plasmids in a dose dependant mode, using LipofectamineTM

2000

(Invitrogen) in accordance with manufacturer‘s instructions. Briefly, 300µl of DMEM

medium and 18µl of transfection reagent were mixed in an eppendroff and allowed to

incubate for 5 minutes at room temperature. DMEM medium of 300µl concentration and

mammalian expression vector of construct pCR3.1/ FlagTAG/HCV non structural gene were

mixed in separate eppendroff and allowed to incubate for 5 min at room temperature and

then, both mixtures were combined in a tube and incubated for 30 minutes at a temperature

of 37°C. The 1XPBS was used to wash the 6 well plate with 24 h incubated cells and 2ml

DMEM medium without any antibiotic and transfection reagent with pCR3.1/FlagTAG/HCV

non structural gene mammalian expression vector mixture in 500µl of media were dispensed

to all wells of the plate in drops and incubated in an atmosphere of 5% CO2 for 24 hrs, at

37°C.

To authenticate the results after transfection, cells were propagated from 24 h to 48 h

of post transfection for nonstructural gene transcription and expression studies.

3.11 Co-transfection of Huh-7 Cells with pCR3.1/FlagTAG/HCV

Nonstructural Gene and Plant Extracts

Huh-7 cells were propageted in DMEM medium, supported with fetal bovine serum

(10%) and antibiotics (1% penicillin/streptomycin) in an atmosphere of 5% CO2 at 37°C. For

transfection analysis, liver cells at 3×105 concentration were seeded in six well culture plates

30

for a period of 24 hrs. The medium was removed gently and cells were rinsed with 1X PBS

twice. Then the cells were momentarily transfected with expression plasmids of HCV

nonstructure gene with test plant extracts by LipofectamineTM

2000 (Invitrogen life

technologies, Carlsbad, CA) in accordance with the manufacturer‘s instructions. The trizol

reagent (Invitrogen life technologies, Carlsbad, CA) was used to extract the total RNA from

each sample according to the manufacturer‘s guidelines. To study the antiviral potential of

test plant extracts against HCV NS3 gene of 3a and 1a genotype, complementary DNA

(cDNA) library was formed with RNA concentration of 1µg, by using Revert Aid TM

First.Strand cDNA Synthesis.Kit (Fermentas, St. Leon-Rot/Germany). HCV-NS3 gene

expression study was performed by Polymerase Chain reaction (PCR) (Applied.Biosystems

Inc, USA) using 2X PCR Master Mix (Fermentas). For amplification of NS3 3a genotype,

following primers were used: forward primer:.GACCATTGTGACCAGCTTGA;.reverse

primer: GCGGGTGACCAAGTACAAGT;. 1a genotype: Forward

primer:.GGACGACGATGACAAGGACT;. Reverse primer:

.CCTCGTGACCAGGTAAAGGT;. while. GAPDH .Forward: primer

CCACAGTCCATGCCATCAC;. and GAPDH. Reverse;. TCCACCACCCTGTTGCTGTA.

Polymerase Chain Reaction was carried out by starting the initial denaturation step at a

temperature of 95°C for 5 minutes following 35 cycles. During PCR each step of

denaturation at 94°C for 1 min, annealing temperature was 58°C for 45sec and extension

time for 10 minutes at a temperature of 72°C. The final amplified DNA products were run on

2% agarose gel. Ultra Violet (UV) light was used to visualize the DNA bands and the gel

photographs were taken with gel documentation system (UVP).

31

3.12 Pharmacological Analysis of Isolated Fractions

After performing the antiviral screening of test plant extracts, the toxicological

studies of the effective extracts was done at higher doses. In order to study the effect of

active fractions at different dosed, liver cells at a concentration of 3×105 cell/well were

propagated in 6 well culturing plates. After 24 hrs of incubation period, cells were treated

with HCV virus copies (2×105) of 3a and 1a genotype in the absence and presence of

different concentrations of three antiviral fractions. For an additional 24 hours of incubation,

Huh-7 cells were kept in CO2 incubator at temperature of 37°C. After incubation period, cell

lysis solution was used to scratch the attached cells and total RNA (cells and serum) was

extracted. The absolute quantification of HCV-RNA was performed by Real Time PCR by

using the Sacace HCV quantitative analysis kit (Sacace.Biotechnologies Caserta,.Italy) in

accordance with the manufacturer‘s guidelines.

3.13 Antiviral Analysis of Effective Fractions along with Interferon (IFN)

After performing the pharmacological studies of isolated fractions, effective fractions

were examined in combination with interferon. Due to the presence of interferon receptors on

MDBK cell line, it is used as a model cell line for the assay of interferon (IFN) (Yanai et al.,

2001), For this purpose, MDBK cells were harvested in six well culturing plates at cell

density of 3×105 per well in DMEM rich medium supported with FBS (10% ) and placed in

incubator of 37C0 for 24hrs. The cells were then tested with active fractions singly and/or in

combination with interferon (IFN) and allowed to incubate for 6 hrs. After incubation time,

cells were treated with inoculums of 2× 105

IU of HCV genotype 3a and 1a per well and

32

again placed in incubator for another 18 hrs. After 24 hrs of incubation time, total RNA

(serum and cells) was take out by RNA isolation kit, and the Real Time Quantitative RT-

PCR was used to find the concentrations of HCV-RNA remaining.

3.14 Protein Isolation and Estimation

After 24 hrs of transfection period, the cells were propagated and protein extraction

was performed for expression studies of NS3 protease. 1X PBS (twice) was used to wash the

transfected cells. Cells were dislocated by adding 500µl of TEN buffer to the cells in

culturing plate and then peeled off after 20 sec. The scratched cells were taken in eppendorf

and centrifuged the cells for 10 min at 13000 rpm (Max. speed) at 4°C to pellet them down.

The cell lysis buffer (50mM Tris-Cl, pH 8.0, 150mM NaCl, 0.02% sodium azide, 1% Triton

X-100, 1µg/ml protease inhibitors, and 100 µg /ml PMSF) 100µl was added to pellet of cells

to homogenize them, allowed to incubate on ice cubes for 15 minutes and placed in

centrifuge at 13000 rpm (Max. speed) at temperature of 4°C for 30 minutes. In eppendorf,

supernatant liquid was taken out by pipette containing protein and freezed at -20°C for

further process. The spectrophotometric method was used to quantify the extracted protein.

Briefly, protein sample of 1µl was added in 800µl volume of 1x PBS and 200µl of Bio Red

dye. Then absorption of sample solutions was noted at 595nm of wavelength.

3.15 Western Blotting

Western blotting gives informative data about the presence of a protein, molecular

weight, and/or quantity of a specific antigen by protein separation in discrete bands via gel

electrophoresis, with specific recognition antigenic sites by antibodies. In order to investigate

protein expression analysis of HCV genes and potential HCV inhibitory potential of plant

33

extracts and their fractions, total protein samples of 100µg were loaded on 10% Sodium

Dodisyl Sulphate (SDS) Polyacrylamide Gel Electrophoresis (PAGE) and allowed to blot on

nitrocellulose membrane (Bio-Rad) electrophoretically. A solution of phosphate buffer saline

was mixed with 5% skim milk to block the membranes at room temperature for 1 h and

treated with HCV specific primary antibody. Then 1x PBS was used to wash the membrane

keeping Tween 20 in 0.1% of concentration. After washing, the nitrocellulose membranes

were placed on smooth surface and treated these membranes with monoclonal antibodies of

HCV-NS3 gene and GAPDH (Santa.Cruiz Biotechnology) specifically. Now the membranes

were washed thrice with 1X TBST and then treated with anti-mouse secondary antibody for a

period of 1 hour. Protein expression analysis was performed by using chemiluminescence

detection kit (Sigma) after washing with TBST thrice. The potential inhibitory effect of

different fractions was analyzed by the intensity of bands on photographic film after ECL.

3.16 Separation and Purification Techniques

3.16.1 Thin Layer Chromatography

Separation of plant extracts were made on precoated silica gel 60 F254 plastic sheets of

thin layer chromatography (TLC) by Merk, Germany. Briefly, 5ml solvent was taken to

prepare 1% sample solution and passed through 0.22µm filter. TLC plate (20×20cm2) was

cut in 10 cm length and 3cm width small plates. 3mm diameter of test sample was spotted on

plates. The spots on plates were air dried and put in chromatography tank, having a

homogeneous mixture of suitable mobile phase. The mobile phase moved on TLC plate for

half an hour. Chromatogram was taken out of tank and solvent front was marked. The

34

chromatogram was air dried and observed under UV light of 254nm and 366nm wavelength.

Marked the spots and Rf value of each spot was calculated.

3.16.2 Column Chromatography

Separation and isolation of compounds from active plant extracts on large scale was

achieved by column chromatography, with silica gel mesh size (70-230µ) as adsorbent with

suitable mobile phase. Flow rate of the eluents on column were 1ml/min at room

temperature.

3.16.3 High Pressure Liquid Chromatography (HPLC)

The active fractions of medicinal plants were analyzed by High Pressure Liquid

Chromatography (HPLC) of Shimadzu LC-10A system. A model LC 10 AT pump along

with wave length detector SPD-10A and CBM-10A were equipped with HPLC. An interface

module class LC-10 HPLC software and a Rheodyne injection valve with a 20 μL loop were

used. By using a Merck C-18 column 250×4.6, i.d., 5 μm particle size, chromatographic

separation was performed. The mobile phase was double distilled methanol and injection

volume was 20µl and with constant flow rate.

3.17 Statistical Analysis

All statistical data analysis was carried out by using GraphPad Prism 4.0 software

(GraphPad.Software, San.Diego, CA, USA). Data is presented as mean ± SE. Numerical data

was analyzed using 1 way ANOVA. *P value ˂ 0.05 and **P value ˂ 0.005 were considered

statistically significant.

35

RESULTS

4.1 Medicinal Plants Collection and Solvent Extraction

Medicinal plants were drawn together from different regions of Pakistan, based on

their local use and undocumented reports against viruses. Different parts (fruit, leaves, bark,

pods or aerial parts) were kept under shade for drying and ground in a grinding mill.

Extraction from these plants was carried out by simple maceration process. List of medicinal

plants with their local use is given in Table 3.1.

4.2 Cytotoxicity Study of Plant Extracts

Before the antiviral screening of plant extracts against Hepatitis C virus, toxicological

study of twenty four plant extracts were found out by treating cells of Huh-7 and CHO cell

line with different concentrations. In order to study the toxicological effect of plant extracts

to other cells of the body, Chinese Hamster Ovary (CHO) cells were utilized as a control cell

line. Figure 4.1 a, b and c show cytotoxicity analysis of three plants extract and demonstrates

the liver and CHO cells viability at a concentration of 100µg is not affected. For remaining

twenty one plant extracts similar results were observed at concentrations ranging from 10 to

100 µg.

a)

36

b)

c)

Figure 4.1: Toxicological analysis of Plant Extracts in Huh-7 and CHO cells. The cells of both cell lines

were plated at concentration 3×105 cells in six well culture plates. After 24 h of incubation period, cells were

immersed with extracts of different concentrations and control well hold solvent in which extract was dissolved.

After incubation period of 24 h, cells were detached and counted by haemocytometer and trypan blue dye

explosive methods (a) Toxicological analysis of SNSM extract in Huh-7 and CHO cells. (b) Toxicological

analysis of GALM extract in Huh-7 and CHO cells. (c) Toxicological analysis of SCLM extract in Huh-7 and

CHO cells.

37

4.3 Cellular Toxicity Through MTT Assay

MTT is a quick and sensitive in-vitro method to evaluate cellular toxicity of plant

extracts. The MTT is a yellow colour dye which is reduced to succinic dehydrogenases in

living (attached to bottom of the flask) cells to purple colour formazan crystals which are

precipitated and become insoluble in aqueous medium. Cytotoxic effect of plant extracts

were analyzed in Huh-7 cells after 24 hrs of incubation with different concentrations of

medicinal plant extracts. Figure 4.2 exhibits that cell proliferation of liver cells is influenced

at concentration up to 40µg for extracts NJRM, PNSM and VJAD while all other extracts

were unaffected up to 100 µg concentrations. After toxicological analysis, the plant extracts

at non toxic concentrations were screened for antiviral activity against Hepatitis C virus.

Figure 4.3 demonstrates toxicological analysis of SNSM, GALM and SCLM extracts from

10 to 100 µg concentrations respectively.

38

Figure 4.2: Toxicological study of plant extracts in Huh-7 through MTT cell proliferation assay. Liver

cells (Huh-7) were plated at concentration of 2 x 104

cells in 96 well culture plates. After 24 h of incubation

period, cells were immersed with different concentration of extracts and control well hold solvent in which

extract was dissolved. After additional 24 h of incubation period, MTT solution was put in all wells and placed

the plate in incubator for 3 to 4 h at 37°C. The viable cells changed MTT to purple colour formazan crystals.

Added 100µl DMSO to mix the formazan crystals and absorbance was noted at 570 nm and 620 nm.

a)

b)

39

c)

Figure 4.3: Toxicological studies of SNSM, GALM and SCLM extracts in liver (Huh-7) cells through

MTT cell proliferation assay. Liver cells (Huh-7) were plated at concentration of 2 x 104

cells in 96 well

culture plates. After 24 h of incubation period, cells were immersed with different concentration of extracts and

control well hold solvent in which extract was dissolved. After additional 24 h of incubation period, MTT

solution was put in all wells and placed the plate in incubator for 3 to 4 h at 37°C. The viable cells changed

MTT to purple colour formazan crystals. Added 100µl DMSO to mix the formazan crystals and absorbance was

noted at 570 nm and 620 nm. (a) Toxicological study of SNSM extract in liver (Huh-7) cells through MTT cell

proliferation assay (b) Toxicological studies of GALM extract in liver (Huh-7) cells through MTT cell

proliferation assay (c) Toxicological studies of SCLM extract in liver (Huh-7) cells through MTT cell

proliferation assay.

40

4.4 Antiviral Effect of Plant Extracts against HCV of Genotype 3a and 1a

The replication of HCV in cell culture system is restricted to human hepatocytes

(Liver cells) and their derivates, previous data have demonstrated that HCV has a potential to

replicate in liver cells through identification of viral genes and copy number by Real Time

PCR in both cells and supernatant (Buck M and Molina S., 2008). In this study Huh-7 cells

were treated with HCV infected serum of genotype 3a and 1a. Figure 4.4 demonstrates that

SNM, GAM, SCM, AMM, and FCM extracts caused 45%, 51%, 44%, 37%, 33% reduction

of Hepatitis C virus of genotype 3a and 37%, 39%, 31%, 29%, 32% of genotype 1a at a

concentration of 100 µg respectively while PAM extract showed no inhibition in HCV titer.

Importantly, the antiviral suppression mediated by these plant extracts is independent of

cytotoxicity.

a) b)

Figure 4.4: Antiviral effect of Plant extracts against HCV 3a and 1a genotype in liver cells. Huh-7 cells

were treated with 2×105 copies of HCV 3a & 1a genotype serum in the presence and absence of 100 µg

concentration of (SNSM), (GALM) (SCLM), (AMLM), (FCAM) and (PALM) extracts per well. After 24 h of

incubation, total RNA (serum &cells) was take out by Gentra RNA extraction kit, and the real time Quantitative

RT-PCR assay was used to determine the levels of HCV RNA remaining and represented as percentage of HCV

RNA survival in cells. Three independent experiments are performed to represent average and standard error of

the results. *P value ˂ 0.05 vs control is statistically significant. (a) Antiviral effect of plant extracts against

HCV of genotype 3a by Real Time Quantitative PCR. (b) Antiviral effect of plant extracts against HCV of

genotype 1a by Real Time Quantitative PCR.

41

4.5 Antiviral Effect of Solanum nigrum against HCV Genotype 3a and 1a

In order to find the antiviral effect of Solanum nigrum (SN), HCV infected liver cells

were treated with Solanum nigrum seeds extract of 100 µg concentrations. Total RNA (serum

& cell) was isolated through Gentra kit and viral titer of HCV was found out by Real Time

Quantitative RT-PCR through HCV specific labeled primers. Figure 4.5 proves that S.

nigrum extract showed 45% and 37% reduction of HCV 3a and 1a genotype respectively at

100µg of concentrations. Notably, the antiviral suppression mediated by S. nigrum is

independent of cytotoxicity.

a) b)

Figure 4.5: Antiviral effect of Solanum nigrum against HCV 3a and 1a genotype in liver cells. Huh-7 cells

were treated with 2×105 copies of HCV 3a & 1a genotype serum in the absence and presence of 100 µg

concentration of Solanum nigrum seeds methanol (SNSM) extract. After 24 h of incubation, total RNA (serum

&cells) was take out by Gentra RNA extraction kit, and the real time Quantitative RT-PCR assay was used to

determine the levels of HCV RNA remaining and represented as percentage of HCV RNA survival in cells.

Three independent experiments are performed to represent average and standard error of the results. *P value ˂

0.05 vs control is statistically significant. (a) Antiviral effect of SNSM against HCV of genotype 3a by Real

Time Quantitative PCR. (b) Antiviral effect of SNSM against HCV of genotype 1a by Real Time Quantitative

PCR.

42

4.5.1 Antiviral Effect of Solanum nigrum against HCV-NS3 Proteases of

Genotype 3a and 1a

To evaluate the antiviral effect of Solanum nigrum (SN) against HCV-NS3 proteases,

liver (Huh-7) cells were seeded in six well plates. After the incubation period, cells were

propagated, RNA was isolated and complementary DNA (cDNA) was produced by ologo dT

priming. PCR was used to amplify cDNA using NS3-3a and NS3-1a gene specific primers of

HCV. The amplification of GAPDH mRNA served as internal control. The result of this

study reveals that methanolic extract of S. nigrum (SNSM) decreases the expression of HCV

RNA significantly at a concentration of 100 µg, while the expression of GAPDH mRNA is

not affected by the addition of extract (Figure 4.5.1.1). Figure 4.5.1.3 showed that S. nigrum

seeds chloroform (SNSC) and methanol (SNSM) extracts reduced the expression of HCV-

NS3 proteases while n-Hexane (SNSH) extract had no effect on HCV-NS3 proteases in Huh-

7 cells at a concentration of 100 µg. Similarly, Real Time PCR results exhibits that SNSM

extract resulted in 52% and 43% inhibition of HCV NS3 proteases level of genotype 3a and

1a respectively at a non toxic concentrations (Figure 4.5.1.2). Figure 4.5.1.4 demonstrates

that SNSH, SNSC and SNSM extracts inhibits 6%, 50%, 61% of NS3 protease level of

genotype 3a and 0%, 41%, 68% of genotype 1a respectively. Collectively, the data

demonstrate that phytochemicals present in medicinal plants significantly inhibit HCV-NS3

Protease expression in Huh-7 cells. Importantly, the antiviral suppression mediated by these

extracts is independent of cytotoxicity.

43

a) b)

Figure 4.5.1.1 Antiviral effect of Solanum nigrum against HCV NS3 gene of genotype 3a and 1a in liver

cells:Liver (Huh-7) cells were transfected with NS3 gene in the absence and presence of 100µg concentration of

Solanum nigrum seeds methanol (SNSM) extract. After 24 h incubation time, RNA was taken out and the level

of HCV NS3 gene was checked by RT-PCR. GAPDH is used as internal control. (a) Antiviral effect of SNSM

against HCV NS3 protease of genotype 3a by RT-PCR. (b) Antiviral effect of SNSM against HCV NS3

protease of genotype 1a by RT-PCR.

a) b)

Figure 4.5.1.2 Real Time PCR analysis of Solanum nigrum against HCV NS3 gene of genotype 3a and 1a

in Huh-7 cells: Liver (Huh-7) cells were transfected with NS3 gene in the absence and presence of Solanum

nigrum seeds methanol (SNSM) extract of 100 µg concentration. After 24 h of incubation, total RNA was

taken out and the level of HCV NS3 gene was checked by Real Time PCR. *P value ˂ 0.05 vs control is

statistically significant. (a) Antiviral effect of SNSM against HCV NS3 protease of genotype 3a by Real Time

PCR. (b) Antiviral effect of SNSM against HCV NS3 protease of genotype 1a by Real Time PCR.

44

a) b)

Figure 4.5.1.3: Antiviral effect of Solanum nigrum in different solvents against HCV NS3 gene of

genotype 3a and 1a in liver cells. Liver (Huh-7) cells were transfected with NS3 gene in the absence and

presence of 100 µg concentrations of Solanum nigrum seed extracts (n-Hexane, chloroform, and methanol).

After 24 h of incubation time, total RNA was taken out and the level of HCV SN3 gene was checked by RT-

PCR. GAPDH is used as internal control. (a) Antiviral effect of SN solvent extracts against HCV NS3 protease

of genotype 3a by RT-PCR. (b) Antiviral effect of SN solvent extracts against HCV NS3 protease of genotype

1a by RT-PCR.

a) b)

Figure 4.5.1.4: Real Time PCR analysis of Solanum nigrum in different solvents against HCV NS3 gene of


presence of 100 µg concentrations of S. nigrum seeds n-hexane (SNSH), chloroform (SNSC), and methanol

(SNSM) extracts. After 24 h of incubation time, total RNA was taken out and the level of HCV NS3 gene was

checked by RT-PCR. *P value ˂ 0.05 vs control is statistically significant. (a) Antiviral effect of SN solvent

extracts against HCV NS3 protease of genotype 3a by Real Time PCR. (b) Antiviral effect of SN solvent

extracts against HCV NS3 protease of genotype 1a by Real Time PCR.

45

4.5.2 Separation & Purification of Solanum nigrum Fractions by

Chromatography

Crude methanol extract of S. nigrum seeds (SNSM) was fractioned by thin layer

chromatography (TLC). The seeds extract separates into thirteen components on TLC plate

in (C: M: W 7:2:1) solvent system with Rf value 0.86, 0.80, 0.77, 0.64, 0.51, 0.44, 0.38, 0.29,

0.15, 0.13, 0.10, 0.08, and 0.05 respectively (Figure 4.5.2.1). For large scale purification

column chromatography was performed and more than 60 fractions were collected. Each

fraction was run on TLC plate and then combined fractions on the basis of their Rf values.

The isolated fractions were then dissolved in DMSO and assessed for antiviral screening

against HCV.

Figure 4.5.2.1: TLC Chromatogram of Solanum nigrum (SN). S. nigrum seeds methanol (SNSM) extract

was run on TLC plate. The crude extract (SNSM) and pure fraction (SN8) was visualized under UV light of

254nm wavelength. In first lane, SNSM extract separates into thirteen components in solvent system

(chloroform: methanol: water 70:20:10) with Rf values 0.86, 0.80, 0.77, 0.64, 0.51, 0.44, 0.38, 0.29, 0.15, 0.13,

0.10, 0.08 and 0.05 respectively. Second lane shows pure SN8 fraction (Rf 0.29).

46

4.5.3 Antiviral Effect of Solanum nigrum Fractions

The individual fractions of S. nigrum seeds (SNSM) were dissolved in DMSO, and

examined for antiviral activity against Hepatitis C Virus. Figure 4.5.3.1 demonstrates that

SN8 results in 76% and 65% reduction in HCV titer of genotype 3a and 1a respectively by

Real Time Quantitative PCR. Figure 4.5.3.2 shows HCV-NS3 protease expression of SNSM

fractions (1-13) and SN8 significantly reduced proteases level at 100 µg of concentration.

The results in Figure 4.5.3.3 shows 85% and 83% inhibition of HCV NS3 proteases of

genotype 3a and 1a respectively by Real Time PCR analysis.

a) b)

Figure 4.5.3.1: Antiviral effect of purified fraction of Solanum nigrum (SN8) against HCV 3a and 1a

genotype in liver cells. Huh-7 cells were treated with 2×105 copies of HCV 3a & 1a genotype serum in the

absence and presence of 100 µg concentration of purified fraction of Solanum nigrum (SN8). After 24 h of

incubation, total RNA (serum &cells) was take out by Gentra RNA extraction kit, and the real time Quantitative

RT-PCR assay was used to determine the levels of HCV RNA remaining and represented as percentage of HCV

RNA survival in cells. Three independent experiments are performed to represent average and standard error of

the results. *P value ˂ 0.05 and **P value <0.005 vs control were statistically significant. (a) Antiviral effect of

SN8 against HCV of genotype 3a by Real Time Quantitative PCR. (b) Antiviral effect of SN8 against HCV of

genotype 1a by Real Time Quantitative PCR.

47

a) b)

Figure 4.5.3.2: Antiviral effect of column fractions (1-13) from Solanum nigrum against HCV NS3 gene of

genotype 3a and 1a in liver cells. Liver (Huh-7) cells were transfected with NS3 gene in 100µg concentrations

of Solanum nigrum thirteen column fractions. After 24 h of incubation time, total RNA was taken out and the

level of HCV NS3 gene was checked by RT-PCR. GAPDH was used as internal control. (a) Antiviral effect of

SNSM fractions (1-13) against HCV NS3 protease of genotype 3a by RT-PCR. (b) Antiviral effect of SNSM

fractions (1-13) against HCV NS3 protease of genotype 1a by RT-PCR.

a) b)

Figure 4.5.3.3: Real Time PCR analysis of Solanum nigrum active fraction (SN8) against HCV NS3 gene

of genotype 3a and 1a in liver cells: Liver (Huh-7) cells were transfected with NS3 gene in the absence and

present of 100 µg concentration of Solanum nigrum active fraction (SN8). After 24 h of incubation time, total

RNA was taken out and the level of HCV NS3 gene was checked by Real Time PCR. **P value ˂ 0.005vs

control is statistically significant. (a) Antiviral effect of SN8 against HCV NS3 protease of genotype 3a by Real

Time PCR. (b) Antiviral effect of SN8 against HCV NS3 protease of genotype 1a by Real Time PCR.

48

Additionally, the antiviral effect of S. nigrum active fraction (SN8) was also

evaluated against nonstructural gene by transfection of NS3 gene in liver cells. The lysates

from the Huh-7 cells transfected with HCV NS3 gene were studied by western blot, using

HCV NS3 specific antibodies and GAPDH served as internal control. There was a

remarkable decrease in HCV NS3 protein level in cells treated with S. nigrum active fraction

(SN8) where as the GAPDH protein expression level remained same in control as compare to

treated cells (Figure 4.5.3.4).

Figure 4.5.3.4: HCV NS3 gene inhibition by S.nigrum at protein level: Protein expression level was

determined by transfection of Huh-7 cells with NS3 gene in presence of S.nigrum seeds n-hexane (SNSH)

extract and active fraction (SN8). After 48 h of incubation time, protein was extracted and analyzed by western

blot with HCV NS3 monoclonal antibody and GAPDH monoclonal antibody serves as internal control.

49

4.5.4 Dose Response Assay of Active Fraction of Solanum nigrum

The results of our studies demonstrate that S. nigrum fraction (SN8) has antiviral

potential against HCV in a dose dependant manner (Figure 4.5.4.1). The results revealed that

SN8 fraction resulted in 50% reduction (EC50 value) in HCV titer of genotype 3a and 1a at a

concentration of 24.94±3.46µg and 47.68±5.73µg respectively. At a concentration of 100 µg,

viral inhibition of HCV genotype 3a and 1a was reached up to 88% and 81% by SN8

fraction. Similarly, Figure 4.5.4.2 shows dose dependant inhibition of HCV NS3 protease of

genotype 3a and 1a expression while GAPDH remains constant.

a) b)

Figure 4.5.4.1: Dose dependant inhibition of active fraction (SN8) of Solanum nigrum against HCV

genotype 3a and 1a. Huh-7 cells were treated with 2×105 copies of HCV 3a and 1a genotype per well. After 24

h of incubation, total RNA (serum &cells) was take out by Gentra RNA extraction kit, and the real time

Quantitative RT-PCR assay was used to determine the levels of HCV RNA remaining and represented as

percentage of HCV RNA survival in cells. Three independent experiments are performed to represent average

and standard error of the results. *P value < 0.05 and **P value ˂ 0.005 vs control were considered statistically

significant. (a) Dose Response Assay of SN8 fraction against HCV of genotype 3a by Real Time Quantitative

PCR. (b) Dose Response Assay of SN8 fraction against HCV of genotype 1a by Real Time Quantitative PCR.

50

a) b)

Figure 4.5.4.2: Antiviral effect of active fraction (8th

) from Solanum nigrum in different concentrations

against HCV NS3 gene of genotype 3a and 1a in liver cells: Liver (Huh-7) cells were transfected with NS3

gene in different concentrations of Solanum nigrum 8th

column fraction. After 24 h of incubation time, total

RNA was taken out and the level of HCV NS3 gene was determined by RT-PCR. GAPDH serves as internal

control. (a) Dose Response Assay of SN8 fraction against HCV NS3 protease of genotype 3a by RT-PCR. (b)

Dose Response Assay of SN8 fraction against HCV NS3 protease of genotype 1a by RT-PCR.

51

4.5.5 Synergistic Effect of Solanum nigrum Active Fraction (SN8) along

with Interferon (IFN)

Synergism is the combined action of two or more compounds when taken together

produces an effect greater than the sum of their individual effects. Figure 4.5.5 shows that S.

nigrum active fraction (SN8) exhibited 51% and 49% decline in HCV titer alone but when it

was pooled with interferon (IFN) resulted in 84% and 75% decrease in viral titer of HCV

genotype 3a and 1a respectively.

a) b)

Figure 4.5.5: Synergy in the antiviral activity of Solanum nigrum active fraction (SN8) with interferon

(IFN). Active fraction of S. nigrum (SN8) shows synergistic effect along with interferon-α (25 IU/well) against

HCV in MDBK cell line. After 6 h of incubation with active fraction (SN8) of S. nigrum and interferon (IFN)

alone, or combination of active fraction of S. nigrum and interferon in six well plate. The cells were then treated

with 2×105 copies of HCV genotype 3a and 1a per well and allowed to incubate for additional 18 h. After 24 h

of incubation time, total RNA (serum &cells) was take out by Gentra RNA extraction kit, and the Real Time

Quantitative PCR assay was used to determine the levels of HCV RNA remaining and represented as


and standard error of the results. *P value ˂ 0.05 and **P value ˂ 0.005 vs control were considered statistically

significant. (a) Synergistic effect of SN8 and Interferon (IFN) against HCV of genotype 3a by Real Time

Quantitative PCR. (b) Synergistic effect of SN8 and Interferon (IFN) against HCV of genotype 1a by Real Time

Quantitative PCR.

52

4.6 Antiviral Effect of Grewia asiatica against HCV Genotype 3a and 1a

To evaluate the antiviral effect of Grewia asiatica (GA), HCV infected liver (Huh-7)

cells were treated with 100 µg concentration of Grewia asiatica leaves extract. Total RNA

(serum & cell) was isolated through Gentra kit solutions and quantification of HCV titer was

found out by Real Time Quantitative RT-PCR through HCV specific labeled primers. Figure

4.6 proves that G. asiatica extract showed 42% and 39% reduction of HCV 3a and 1a

genotype respectively at concentrations of 100 µg. Notably, the antiviral inhibition mediated

by G. asiatica is independent of cytotoxicity.

a) b)

Figure 4.6: Antiviral effect of Grewia asiatica against HCV 3a and 1a genotype in liver cells. Huh-7 cells


concentration of G. asiatica leaves methanol (GALM) extract. After 24 h of incubation, total RNA (serum

&cells) was take out by Gentra RNA extraction kit, and the Real Time Quantitative RT-PCR assay was used to



0.05 vs control is statistically significant. (a) Antiviral effect of GALM against HCV of genotype 3a by Real

Time Quantitative PCR. (b) Antiviral effect of GALM against HCV of genotype 1a by Real Time Quantitative

PCR.

53

4.6.1 Antiviral effect of Grewia asiatica against HCV-NS3 Proteases of

Genotype 3a and 1a

To evaluate the antiviral effect of Grewia asiatica (GA) against HCV-NS3 proteases,

liver (Huh-7) cells were propagated in six well culture plates. After the incubation period,

cells were propagated, RNA was isolated and complementary DNA (cDNA) was produced

by ologo dT priming. PCR was used to amplify cDNA using NS3-3a and NS3-1a gene

specific primers of HCV. The amplification of GAPDH messenger RNA is used as internal

control. The result of this study demonstrates that methanolic extract of G. asiatica (GALM)

decreases HCV RNA level significantly at a concentration of 100 µg, while the expression of

GAPDH messenger RNA is not affected by the addition of plant extract (Figure 4.6.1.1).

Figure 4.6.1.3 showed that G. asiatica methanol (GALM) extract reduced the expression of

HCV-NS3 proteases while chloroform (GALC) and acetone (GALA) extracts had no effect

on HCV-NS3 proteases in Huh-7 cells at a concentration of 100 µg. Similarly, Real Time

PCR results exhibits that GALM extract resulted in 59% and 35% inhibition of HCV NS3

proteases level of genotype 3a and 1a respectively at a non toxic concentrations (Figure

4.6.1.2). Figure 4.6.1.4 demonstrates that GALC, GALA and GALM extracts inhibits 3%,

4%, 72% of NS3 protease level of genotype 3a and 0%, 3%, 91% of genotype 1a

respectively. Collectively, the data demonstrate that phytochemicals present in medicinal

plants significantly inhibit HCV-NS3 Protease expression in Huh-7 cells. Importantly, the

antiviral suppression mediated by these extracts is independent of cytotoxicity.

54

a) b)

Figure 4.6.1.1: Antiviral effect of Grewia asiatica against HCV NS3 gene of genotype 3a and 1a in liver

cells: Liver (Huh-7) cells were transfected with NS3 gene in the absence and presence of 100µg concentration

of G. asiatica leaves methanol (GALM) extract. After 24 h incubation period, RNA was taken out and the level

of HCV NS3 gene was checked by RT-PCR. GAPDH is used as internal control. (a) Antiviral effect of GALM

against HCV NS3 protease of genotype 3a by RT-PCR. (b) Antiviral effect of GALM against HCV NS3

protease of genotype 1a by RT-PCR.

a) b)

Figure 4.6.1.2: Real Time PCR analysis of Grewia asiatica against HCV NS3 gene of genotype 3a and 1a

in liver cells. Liver (Huh-7) cells were transfected with NS3 gene in the absence and presence of G. asiatica

leaves methanol (GALM) extract of 100µg concentration. After 24 h of incubation, total RNA was taken out

and the level of HCV NS3 gene was checked by Real Time PCR. *P value ˂ 0.05 vs control is statistically

significant. (a) Antiviral effect of GALM against HCV NS3 protease of genotype 3a by Real Time PCR. (b)

Antiviral effect of GALM against HCV NS3 protease of genotype 1a by Real Time PCR.

55

a) b)

Figure 4.6.1.3: Antiviral effect of Grewia asiatica in different solvents against HCV NS3 gene of genotype

3a and 1a in Liver cells. Liver (Huh-7) cells were transfected with NS3 gene in the absence and presence of

100 µg concentrations of G. asiatica leaves chloroform (GALC), acetone (GALA) and methanol (GALM)

extracts. After 24 h of incubation time, total RNA was taken out and the level of HCV SN3 gene was checked

by RT-PCR. GAPDH is used as internal control. (a) Antiviral effect of GA solvent extracts against HCV NS3

protease of genotype 3a by RT-PCR. (b) Antiviral effect of GA solvent extracts against HCV NS3 protease of

genotype 1a by RT-PCR.

a) b)

Figure 4.6.1.4: Real Time PCR analysis of Grewia asiatica in different solvents against HCV NS3 gene of

genotype 3a and 1a in liver cells: Liver (Huh-7) cells were transfected with NS3 gene in the absence and

presence of G.asiatica leaves chloroform (GALC), acetone (GALA) and methanol (GALM) extracts of 100 µg

concentrations. After 24 h of incubation time, total RNA was taken out and the level of HCV NS3 gene was

checked by RT-PCR. **P value ˂ 0.005 vs control is statistically significant. (a) Antiviral effect of GA solvent

extracts against HCV NS3 protease of genotype 3a by real time PCR. (b) Antiviral effect of GA solvent extracts

against HCV NS3 protease of genotype 1a by Real Time PCR.

56

4.6.2 Separation & Purification of Grewia asiatica Fractions by

Chromatography

Crude methanol extract of G. asiatica leaves (GALM) was fractioned by thin layer

chromatography (TLC). The leaves extract separates into twelve components on TLC plate in

(C: M: EA: W 5:3:1:1) solvent system with Rf value 0.93, 0.89, 0.84, 0.80, 0.70, 0.66, 0.61,

0.55, 0.50, 0.47, 0.44 and 0.34 respectively. Furthermore, the spot on base line was again run

in (C: EA: AA: W 4: 3: 2: 1) solvent system and It separates into four components with Rf

value 0.93, 0.89, 0.72, and 0.21 respectively. On large scale purification column

chromatography was performed and more than 75 fractions were collected. Each fraction was

run on TLC plate and then combined fractions on the basis of their Rf values. The isolated

fractions were then dissolved in DMSO and tested for antiviral screening against HCV.

Figure 4.6.2.1: TLC Chromatogram of Grewia asiatica (GA). G. asiatica leaves methanol (GALM) extract

was run on TLC plate. the crude extract (GALM) and pure fraction (GA15) were visualized under UV light of

254nm wavelength. In first lane, GALM extract separates into four components in solvent system (C: EA: AA:

W 4: 3: 2: 1) with Rf values 0.93, 0.89, 0.72, and 0.21 respectively. Second lane shows pure GA15 fraction with

Rf value 0.72.

57

4.6.3 Antiviral Effect of Grewia asiatica Fractions

The individual fractions of G. asiatica leaves (GALM) were dissolved in DMSO, and

tested for antiviral activity against Hepatitis C Virus. Figure 4.6.3.1 demonstrates that GA15

results in 87% and 74% reduction in HCV titer of genotype 3a and 1a respectively by Real

Time Quantitative PCR. Figure 4.6.3.2 shows HCV-NS3 protease expression of GALM

fractions (1-16) and GA15 significantly reduced proteases level at 100 µg concentration. The

results in Figure 4.6.3.3 shows 91% and 87% inhibition of HCV NS3 proteases of genotype

3a and 1a respectively by Real Time PCR analysis.

a) b)

Figure 4.6.3.1: Antiviral effect of purified fraction of Grewia asiatica (GA15) against HCV 3a and 1a

genotype in liver cells. Huh-7 cells were treated with 2×105 copies of HCV 3a & 1a genotype serum in the

presence and absence of 100 µg concentration of purified fraction of G. asiatica (GA15). After 24 h of

incubation, total RNA (serum &cells) was take out by Gentra RNA extraction kit, and the Real Time



and standard error of the results. **P value ˂ 0.005 vs control was statistically significant. (a) Antiviral effect

of GA15 against HCV of genotype 3a by Real Time Quantitative PCR. (b) Antiviral effect of GA15 against

HCV of genotype 1a by Real Time Quantitative PCR.

58

a) b)

Figure 4.6.3.2: Antiviral effect of column fractions (1-16) from Grewia asiatica against HCV NS3 gene of

genotype 3a and 1a in liver cells. Huh-7 (liver) cells were transfected with NS3 gene in 100µg concentrations

of G. asiatica sixteen column fractions. After 24 h of incubation time, total RNA was taken out and the level of

HCV NS3 gene was checked by RT-PCR. GAPDH was used as internal control. (a) Antiviral effect of GALM

fractions (1-16) against HCV NS3 protease of genotype 3a by RT-PCR. (b) Antiviral effect of GALM fractions

(1-16) against HCV NS3 protease of genotype 1a by RT-PCR.

a) b)

Figure 4.6.3.3: Real Time PCR analysis of Grewia asiatica active fraction (GA15) against HCV NS3 gene

of genotype 3a and 1a in liver cells: Liver (Huh-7) cells were transfected with NS3 gene in the absence and

present of 100 µg concentration of G. asiatica active fraction (GA15). After 24 h of incubation time, total RNA

was taken out and the level of HCV NS3 gene was checked by Real Time PCR. **P value ˂ 0.005vs control is

statistically significant. (a) Antiviral effect of GA15 against HCV NS3 protease of genotype 3a by Real Time

PCR. (b) Antiviral effect of GA15 against HCV NS3 protease of genotype 1a by Real Time PCR.

59

Additionally, the antiviral effect of G. asiatica active fraction (GA15) was examined

against nonstructural gene by transfection of NS3 gene in liver cells. The lysates from the

Huh-7 cells transfected with HCV-NS3 gene were studied by western blot, by using HCV

NS3 specific antibodies and GAPDH served as internal control. There was a remarkable

decrease in HCV NS3 protein level in cells treated with G. asiatica active fraction (GA15)

where as the GAPDH protein expression level remained same in control as compare to

treated cells (Figure 4.6.3.4).

Figure 4.6.3.4: HCV NS3 gene inhibition by G. asiatica at protein level. Protein expression level was

determined by transfection of Huh-7 cells with NS3 gene in the presence of G. asiatica leaves chloroform

(GALC) extract and active fraction (GA15). After 48 h of incubation time, protein was extracted and analyzed

by western blot with HCV NS3 monoclonal antibody and GAPDH monoclonal antibody served as internal

control.

60

4.6.4 Dose Response Assay of Active Fraction of Grewia asiatica

The results of our studies demonstrate that G. asiatica fraction (GA15) has antiviral

potential against HCV in a dose dependent manner (Figure 4.6.4.1). The results revealed that

GA15 fraction resulted in 50% reduction (EC50 value) in HCV titer of genotype 3a and 1a at

a concentration of 9.46±2.93 µg and 10.13±2.75µg respectively. At a concentration of 50 µg,

viral inhibition of HCV genotype 3a and 1a was reached up to 91% and 86% by GA15

fraction. Similarly, Figure 4.6.4.2 shows dose dependant inhibition of HCV NS3 protease of


a) b)

Figure 4.6.4.1: Dose dependent inhibition of active fraction of Grewia asiatica (GA15) against HCV of 3a

and 1a genotype. Huh-7 cells were treated with 2×105 copies of HCV 3a and 1a genotype per well. After 24 h

of incubation, total RNA (serum &cells) was take out by Gentra RNA extraction kit, and the Real Time


percentage of HCV RNA survival in cells. Three independent experiments were performed to represent average


significant. (a) Dose Response Assay of GA15 fraction against HCV of genotype 3a by Real Time Quantitative

PCR. (b) Dose Response Assay of GA15 fraction against HCV of genotype 1a by Real Time Quantitative PCR.

61

a) b)

Figure 4.6.4.2: Antiviral effect of active fraction (15th

) from Grewia asiatica in different concentrations

against HCV NS3 gene of genotype 3a and 1a in liver cells. Liver (Huh-7) cells were transfected with NS3

gene in different concentrations of G. asiatica 15th

column fraction. After 24 h of incubation time, total RNA

was taken out and the level of HCV NS3 gene was determined by RT-PCR. GAPDH serves as internal control.

(a) Dose Response Assay of GA15 fraction against HCV NS3 protease of genotype 3a by RT-PCR. (b) Dose

Response assay of GA15 fraction against HCV NS3 protease of genotype 1a by RT-PCR.

62

4.6.5 Synergistic Effect of Grewia asiatica Active Fraction (GA15) with

Interferon (IFN)


produces an effect greater than the sum of their individual effects. Figure 4.6.5 shows that G.

asiatica active fraction (GA15) exhibited 53% and 51% decline in HCV titer alone but when

it was pooled with interferon (IFN) resulted in 90% and 82% decrease in viral population of

HCV 3a and 1a genotype respectively.

a) b)

Figure 4.6.5: Synergy in the antiviral activity of Grewia asiatica active fraction (GA15) with interferon

(IFN). Active fraction (GA15) of G. asiatica shows synergistic effect along with interferon α (25IU/well)

against HCV in MDBK cell line. After 6 h of incubation with active fraction (GA15) of G. asiatica and

interferon (IFN) alone, or combination of active fraction of G. asiatica and interferon in a six well plate. The

cells were then treated with 2×105 copies of HCV genotype 3a and 1a per well and allowed to incubate for

additional 18 h. After 24 h of incubation time, total RNA (serum &cells) was take out by Gentra RNA

extraction kit, and the Real Time Quantitative RT-PCR assay was used to determine the levels of HCV RNA

remaining and represented as percentage of HCV RNA survival in cells. Three independent experiments are

performed to represent average and standard error of the results. *P value ˂ 0.05 and **P value ˂ 0.005 vs

control were considered statistically significant. (a) Synergistic effect of GA15 and Interferon (IFN) against

HCV of genotype 3a by Real Time Quantitative PCR. (b) Synergistic effect of GA15 and Interferon (IFN)

against HCV of genotype 1a by Real Time Quantitative PCR.

63

4.7 Antiviral Effect of Syzgium cumine against HCV Genotype 3a and 1a

To study the antiviral effect of Syzgium cumine (SC), HCV infected liver (Huh-7)

cells were treated with 100 µg concentration of Syzgium cumine leaves extract. Total RNA

(serum & cell) was isolated through Gentra kit solutions and quantification of HCV titer was

found out by Real Time Quantitative RT-PCR through HCV specific labeled primers. Figure

4.7 proves that S. cumine extract showed 45% and 31% reduction of HCV 3a and 1a

genotype respectively at 100 µg concentrations. Notably, the antiviral inhibition mediated by

S. cumine is independent of cytotoxicity.

a) b)

Figure 4.7: Antiviral effect of Syzgium cumine against HCV 3a and 1a genotype in liver cells. Huh-7 cells


concentration of Syzgium cumine leaves methanol (SCLM) extract. After 24 h of incubation, total RNA (serum

&cells) was take out by Gentra RNA extraction kit, and the Real Time Quantitative RT-PCR assay was used to



0.05 vs control is statistically significant. (a) Antiviral effect of SCLM against HCV of genotype 3a by Real

Time Quantitative PCR. (b) Antiviral effect of SCLM against HCV of genotype 1a by Real Time Quantitative

PCR.

64

4.7.1 Antiviral Effect of Syzgium cumine against HCV-NS3 Proteases of

Genotype 3a and 1a

To evaluate the antiviral effect of Syzgium cumine (SC) against HCV NS3 proteases,

liver (Huh-7) cells were harvested in six well culture plates. After the incubation period, cells

were propagated, RNA was isolated and complementary DNA (cDNA) was produced by

ologo dT priming. PCR was used to amplify cDNA using NS3-3a and NS3-1a gene specific

primers of HCV. The amplification of GAPDH messenger RNA is used as internal control.

The result of this study demonstrates that methanolic extract of S. cumine (SCLM) reduces

HCV RNA expression level extensively at a concentration of 100 µg, while the expression of

GAPDH mRNA is not affected by the addition of the extract (Figure 4.7.1.1). Figure 4.7.1.3

showed that S. cumine methanol (SCLM) extract reduced the expression of HCV-NS3

proteases while chloroform (SCLC) and acetone (SCLA) extracts had no effect on HCV-NS3

proteases in Huh-7 cells at a concentration of 100 µg. Similarly, Real Time PCR results

exhibits that SCLM extract resulted in 48% and 34% inhibition of HCV NS3 proteases level

of genotype 3a and 1a respectively at non toxic concentrations (Figure 4.7.1.2). Figure

4.7.1.4 demonstrates that SCLC, SCLA and SCLM extracts inhibits 6%, 9%, 51% of NS3

protease level of genotype 3a and 3%, 0%, 79% of genotype 1a respectively. Collectively,

the results showed that phytochemicals present in medicinal plants significantly inhibited

HCV-NS3 protease expression in Huh-7 cells. Importantly, the antiviral inhibition mediated

by these plant extracts is independent of cytotoxicity.

65

a) b)

Figure 4.7.1.1: Antiviral effect of Syzgium cumine against HCV NS3 gene of genotype 3a and 1a in liver

cells. Liver (Huh-7) cells were transfected with NS3 gene in the absence and presence of 100µg concentration

of S. cumine leaves methanol (SCLM) extract. After 24 h incubation period, RNA was taken out and the level of

HCV NS3 gene was checked by RT-PCR. GAPDH is used as internal control. (a) Antiviral effect of SCLM

against HCV NS3protease of genotype 3a by RT-PCR. (b) Antiviral effect of SCLM against HCV NS3 protease

of genotype 1a by RT-PCR.

a) b)

Figure 4.7.1.2: Real Time PCR analysis of Syzgium cumine against HCV NS3 gene of genotype 3a and 1a

in liver cells. Liver (Huh-7) cells were transfected with NS3 gene in the absence and presence of 100µg

concentration of S. cumine leaves methanol (SCLM) extract. After 24 h of incubation, total RNA was taken out

and the level of HCV NS3 gene was checked by Real Time PCR. *P value ˂ 0.05 vs control is statistically

significant. (a) Antiviral effect of SCLM against HCV NS3 protease of genotype 3a by Real Time PCR. (b)

Antiviral effect of SCLM against HCV NS3 protease of genotype 1a by Real Time PCR.

66

a) b)

Figure 4.7.1.3: Antiviral effect of Syzgium cumine in different solvents against HCV NS3 gene of genotype

3a and 1a in liver cells. Liver (Huh-7) cells were transfected with NS3 gene in the absence and presence of 100

µg concentrations of S. cumine chloroform (SCLC), acetone (SCLA) and methanol (SCLM) extracts. After 24

h of incubation time, total RNA was taken out and the level of HCV SN3 gene was checked by RT-PCR.

GAPDH is used as internal control. (a) Antiviral effect of SC solvent extracts against HCV NS3 protease of

genotype 3a by RT-PCR. (b) Antiviral effect of SC solvent extracts against HCV NS3 protease of genotype 1a

by RT-PCR.

a) b)

Figure 4.7.1.4: Real Time PCR analysis of Syzgium cumine in different solvents against HCV NS3 gene of


presence of 100 µg concentrations of S. cumine leaves chloroform (SCLC), acetone (SCLA), and methanol

(SCLM) extracts. After 24 h of incubation time, total RNA was taken out and the level of HCV NS3 gene was

checked by RT-PCR. *P value ˂ 0.05 vs control is statistically significant. (a) Antiviral effect of SC solvent

extracts against HCV NS3 protease of genotype 3a by Real Time PCR. (b) Antiviral effect of SC solvent

extracts against HCV NS3 protease of genotype 1a by Real Time PCR.

67

4.7.2 Separation & Purification of Syzgium cumine Fractions by

Chromatography

Crude methanol extract of Syzgium cumine leaves (SCLM) was fractioned by thin

layer chromatography (TLC). The leaves extract separates into fifteen components on TLC

plate in (C: M: W 7:2:1) solvent system with Rf value 0.98, 0.97, 0.95, 0.93, 0.89, 0.82, 0.79,

0.63, 0.58, 0.24 and 0.02 respectively. Furthermore, the spot on base line was again run in

(C: EA: AA: W 4: 3: 2: 1) solvent system and it separates into four components with Rf

values 0.95, 0.91, 0.83 and 0.01 respectively. At large scale separation, column

chromatography was performed and more than 56 fractions were collected. Each fraction was

run on TLC plate and then combined fractions on the basis of their Rf values. The separated

fractions were then dissolved in DMSO and tested for antiviral screening against HCV.

a) b)

Figure 4.7.2.1: TLC Chromatogram of Syzgium cumine (SC). Syzgium cumine leaves methanol (SCLM))

extract was run on TLC plate. The crude extract (SCLM) and pure fraction (SC14) were visualized under UV

light of 254nm wavelength. a) SCLM extract separates into eleven components in solvent system (chloroform:

methanol: water 7:2:1) with Rf values 0.98, 0.97, 0.95, 0.93, 0.89, 0.82, 0.79, 0.63, 0.58, 0.24, and 0.02

respectively. b) SCLM separates into four components with Rfvalues 0.95, 0.91, 0.83, and 0.01 respectively

while pure fraction (SC14) with Rf value 0.83 in (C: EA: AA: W 4: 3: 2: 1) solvent system.

68

4.7.3 Antiviral Effect of Syzgium cumine Fractions

The individual fractions of Syzgium cumine leaves (SCLM) were dissolved in DMSO,

and tested for antiviral activity against Hepatitis C virus. Figure 4.7.3.1 demonstrates that

SC14 results in 76% and 62% reduction in HCV titer of genotype 3a and 1a respectively by

Real Time Quantitative PCR. Figure 4.7.3.2 shows HCV-NS3 protease expression of SCLM

fractions (1-15) and SC14 significantly reduced proteases level at 100 µg concentrations. The

results in Figure 4.7.3.3 shows 82% and 76% inhibition of HCV NS3 proteases of genotype

3a and 1a respectively by Real Time PCR analysis.

a) b)

Figure 4.7.3.1: Antiviral effect of purified fraction of Syzgium cumine against HCV 3a and 1a genotype in

liver cells: Huh-7 cells were treated with 2×105 copies of HCV 3a & 1a genotype serum in the presence and

absence of 100 µg concentration of purified fraction of of S. cumine leaves. After 24 h of incubation, total RNA

(serum &cells) was take out by Gentra RNA extraction kit, and the Real Time Quantitative RT-PCR assay was

used to determine the levels of HCV RNA remaining and represented as percentage of HCV RNA survival in

cells. Three independent experiments were performed to represent average and standard error of the results. *P

value ˂ 0.05 and **P value ˂ 0.005 vs control is statistically significant. (a) Antiviral effect of SC14 against

HCV of genotype 3a by Real Time Quantitative PCR. (b) Antiviral effect of SC14 against HCV of genotype 1a

by Real Time Quantitative PCR.

69

a) b)

Figure 4.7.3.2: Antiviral effect of column fractions (1-15) from Syzgium cumine against HCV NS3 gene of

genotype 3a and 1a in liver cells. Liver (Huh-7) cells were transfected with NS3 gene in 100µg concentrations

of S. cumine fifteen column fractions. After 24 h of incubation time, total RNA was taken out and the level of

HCV NS3 gene was checked by RT-PCR. GAPDH was used as internal control. (a) Antiviral effect of SCLM

fractions (1-15) against HCV NS3 protease of genotype 3a by RT-PCR. (b) Antiviral effect of SCLM fractions

(1-15) against HCV NS3 protease of genotype 1a by RT-PCR.

a) b)

Figure 4.7.3.3: Real Time PCR analysis of Syzgium cumine active fraction (SC14) against HCV NS3 gene

of genotype 3a and 1a in liver cells: Liver (Huh-7) cells were transfected with NS3 gene in absence and

presence of 100µg concentration of S. cumine active fraction (SC14). After 24 h of incubation time, total RNA

was taken out and the level of HCV NS3 gene was checked by Real Time PCR. **P value ˂ 0.005vs control is

statistically significant. (a) Antiviral effect of SC14 against HCV NS3 protease of genotype 3a by Real Time

PCR. (b) Antiviral effect of SC14 against HCV NS3 protease of genotype 1a by Real Time PCR.

70

Additionally, the antiviral effect of S. cumine active fraction (SC14) was analyzed

against nonstructural gene by transfection of HCV-NS3 gene in liver cells. The lysates from

the Huh-7 cells transfected with HCV NS3 gene were studied by western blot, by using

HCV-NS3 specific antibodies and GAPDH served as internal control. There was a

remarkable decrease in HCV NS3 protein level in cells treated with S. cumine active fraction

(SC14) where as the GAPDH protein expression level remained same in control as compare

to treated cells (Figure 4.7.3.4).

Figure 4.7.3.4: HCV NS3 gene inhibition by S. cumine at protein level. Protein expression level was

determined by transfection of Huh-7 cells with NS3 gene in presence of S. cumine leaves chloroform (SCLC)

extract and active fraction (SC14). After 48 h of incubation time, protein was extracted and analyzed by western

blot with HCV NS3 monoclonal antibody and GAPDH monoclonal antibody served as internal control.

71

4.7.4 Dose Response Assay of Active Fraction of Syzgium cumine

The results of our studies demonstrate that S. cumine fraction (SC14) has antiviral

potential against HCV in dose dependent manner (Figure 4.7.4a). The results exhibited that

SC14 fraction resulted in 50% reduction (EC50 Value) in HCV titer of genotype 3a and 1a at

a concentration of 31.75±3.28 µg and 71.96±8.67 µg respectively. At a concentration of 100

µg, viral inhibition of HCV genotype 3a and 1a was reached up to 76% and 68% by SC14

fraction. Similarly, Figure 4.7.4b shows dose dependant inhibition of HCV NS3 protease of


a) b)

Figure 4.7.4.1: Dose dependent inhibition of active fraction of Syzgium cumine against HCV of 3a and 1a

genotype. Huh-7 cells were treated with 2×105 copies of HCV 3a and 1a genotype per well. After 24 h of

incubation, total RNA (serum &cells) was take out by Gentra RNA extraction kit, and the Real Time




significant. (a) Dose Response Assay of SC14 fraction against HCV of genotype 3a by Real Time Quantitative

PCR. (b) Dose Response Assay of SC14 fraction against HCV of genotype 1a by Real Time Quantitative PCR.

72

a) b)

Figure 4.7.4.2: Antiviral effect of active column fraction (14th

) from Syzgium cumine in different

concentrations against HCV NS3 gene of genotype 3a and 1a in liver cells. Liver (Huh-7) cells were

transfected with NS3 gene in different concentrations of Syzgium cumine 14th

column fraction. After 24 h of

incubation time, total RNA was taken out and the level of HCV NS3 gene was determined by RT-PCR.

GAPDH serves as internal control. (a) Dose Response Assay of SC14 fraction against HCV NS3 protease of

genotype 3a by RT-PCR. (b) Dose Response Assay of SC14 fraction against HCV NS3 protease of genotype 1a

by RT-PCR.

73

4.7.5 Synergistic Effect of Syzgium cumine Active Fraction (SC14) with

Interferon (IFN)


produces an effect greater than the sum of their individual effects. Figure 4.7.3 shows that S.

cumine active fraction (SC14) exhibited 47% and 49% decline in HCV titer alone but when it

was pooled with interferon (IFN) resulted in 81% and 76% reduction in viral titer of HCV 3a

and 1a genotype respectively.

a) b)

Figure 4.7.5: synergy in the activity of Syzgium cumine active fraction (SC14) with interferon (IFN).

Active fraction of S. cumine (SC14) shows synergistic effect with interferon α (25IU/well) against HCV in

MDBK cell line. After 6 h of incubation with active fractions of S. cumine (SC14) and interferon (IFN) alone,

or combination of active fraction of S. cumine and interferonin a 6-well plate. The cells were then treated with

2×105 copies of HCV genotype 3a and 1a per well and allowed to incubate for additional 18 h. After 24 h of

incubation time, total RNA (serum &cells) was take out by Gentra RNA extraction kit, and the Real Time



and standard error of the results. *P value ˂ and **P value ˂ 0.005 vs control were considered statistically

significant. (a) Synergistic effect of SC14 and Interferon (IFN) against HCV of genotype 3a by Real Time

Quantitative PCR. (b) Synergistic effect of SC14 and Interferon (IFN) against HCV of genotype 1a by Real

Time Quantitative PCR.

74

4.8 HPLC Analysis of Active Fractions

a)

b)

75

c)

Figure 4.8: The HPLC chromatogram of purified fractions (a) SN8 (b) GA16 and (c) SC14

76

DISCUSSION

Medicinal plants are used for different ailments throughout the world. In Pakistan a

large number of indigenous populations utilize medicinal plants to fulfill their health care

needs. As medicinal plants are cheaper and easily accessible, local people prefer herbs

against different diseases. In present study different plants extracts were examined through

trypan blue dye and MTT cell proliferation assay for cytotoxic studies in fibroblast and liver

cells. Previous data showed cytotoxic activity of plant extracts in two cancer cell lines and

all the extracts have cytotoxic effect on HeLa (Human cervix cancer) and T47D (human

breast cancer) cells (Vega-Avila et al., 2009). Some plant's methanolic extracts revealed low

or no cytotoxicity against the MCF7, HepG2 and MDBK cell lines, whereas F. szowitsiana

showed the most potent cytotoxicity against all of them (Sahranavard et al., 2009). In our

studies, extracts presented the best cytotoxic effect in Huh-7 cells correspond to a potential

for cancer treatment (Figure 4.2). The extracts that were nontoxic to Huh-7 cells were

included for screening against Hepatitis C virus.

In present study, Twenty four medicinal plants were screened against HCV. Before

antiviral screening, the extracts were examined for toxicological effects, if any, in fibroblast

and liver cells through trypan blue dye exclusion method and results indicated that extracts

NJRM, PNSM and VJAD were toxic to hepatoma cells up to 40µg concentration while the

remaining extracts were non toxic to cells at 100µg of concentrations (Data not shown).

These results were further verified by MTT cell proliferation assay (Mosmann, 1983b) which

showed that extracts NJRM, PNSM and VJAD were toxic to liver cells (Figure 4.2) so, did

not permit them for further screening against HCV. Trypan blue dye method showed that

SNSM, GALM and SCLM extracts are nontoxic to Huh-7 and CHO cells at 100 µg

77

concentrations (Figure 4.2.2). Similarly, MTT assay proved that SNSM, GALM and SCLM

extracts are nontoxic to Huh-7 cells at a concentration of 100µg (Figure 4.3).

Subsequently, antiviral activities of all nontoxic extracts were investigated against

HCV by infecting liver cells with infectious viral particles. The present study showed that

five out of twenty one plant extracts exhibited anti-HCV effect. These extracts were

designated as Solanum nigrum (SN), Grewia asiatica (GA), Syzygium cumini (SC),

Avicennia marina (AM) and Fagonia cretica (FC). Interestingly, SNSM, GALM, SCLM,

FCAM and AMLM inhibited HCV 3a and 1a genotype and did not show appreciable toxicity

against Huh-7 and CHO cells (Figure 4.4). Hence, these extracts used for further cell culture

studies against HCV.

Solanum nigrum traitionaly named as Makoi or black nightshade, is a weed that

grows in variety of habitats and it belongs to family solanaceae (Kiran et al., 2009). Mostly

S.nigrum is used conventionally to treat a range of diseases which includes inflammation,

(Acharya and Pokhrel, 2006) dressing of warts (Moshi et al., 2009), erysipelas (acute

streptococcus bacterial infection) (Leporatti and Ghedira, 2009), stomach ulcer (Sivaperumal

et al., 2010), liver tonic, indigestion (Kala, 2005), increase fertility in women (Singh et al.,

2010) and treating asthma and whooping cough (Sikdar and Dutta, 2008).

Both the crude extract of S. nigrum and purified components showed antiproliferative

action on different cancer cell lines. The antiproliferative activity of crude plant extract and

isolated components were examined on cancerous liver cell line (HepG2) and colon (HT29

and HCT-116) (Ji et al., 2008; Lee et al., 2004), breast cancer (MCF-7) (Li et al., 2009),

cervical cancer cell line (U14) (Joo et al., 2009; Li et al., 2008) and HeLa cells (Son et al.,

78

2003). The results of this study demonstrated that SNSM extract is non toxic to Huh-7 and

CHO cells in trypan blue dye exclusion method (Figure 4.1) and MTT cell viability assay

(Figure 4.3) at 100 µg concentrations.

Traditionally used many medicinal plants and herbal formulations like Glycyrrhiza

glabra which was used in traditional medicine across the globe, reported to have strong

antiviral activity against RNA and DNA viruses (Saxena, 2005). In addition, the S. nigrum

crude extract declined the eminent levels of plasma alanine aminotransferase (ALT) and

billirubin level to normal value (Hsieh et al., 2008). Present study clearly demonstrated that

at a concentration of 100 µg S. nigrum seeds extract showed 45% and 37% reduction of HCV

3a and 1a titer respectively (Figure 4.5). Clinical trials on polyherbal formulation like Liv52,

includes S. nigrum as one of the major components, explore its hepatoprotective action

(Debajyoti et al., 2012). Similarly, 50% of the tumor size in mice was reduced by aqueous

extract of S. nigrum plant (Wang et al., 2010).

In this study, we found that S. nigrum seeds chloroform (SNSC) and methanol

(SNSM) extracts reduced the expression of HCV NS3 proteases (Figure 4.5.1.3) and our Real

Time PCR results showed that SNSM extract demonstrated 52% and 43% inhibition of HCV

NS3 proteases level of genotype 3a and 1a respectively (Figure 4.5.1.2). Furthermore, S.

nigrum methanolic extract was dissolved in different solvents from lower to higher polarity

and found that SNSH, SNSC and SNSM extracts inhibits 6%, 50%, 61% of HCV NS3

protease level of genotype 3a and 0%, 41%, 68% of genotype 1a respectively at 100 µg

concentrations (Figure 4.5.1.4). So, S. nigrum seeds extract has a potential to decrease HCV

titer of genotype 3a and 1a, which is most prevalent in Pakistan and Africa respectively.

79

The previous literature showed the presence of carbohydrates, coumarins,

phytosterols and flavonoids in ethanolic and aqueous extracts of S. nigrum (Ravi et al.,

2009). Ayesha mohy-ud-din in 2009 studied thin layer chromatography (TLC) of SN extract

and found 6 components with Rf values 0.93, 0.83, 0.58, 0.55, 0.36 and 0.15 in n-

butanol:acetic acid:water, with ratio of 4:1:5 (UD-DIN et al., 2009). In another study, it was

found that SN leaf consists of 11 flavonoids and 8 phenolic acids (Huang et al., 2010). In our

thin layer chromatography data S. nigrum extract separates into thirteen components on TLC

plate in (Chloroform- Methanol- Water 7:2:1) mobile phase with Rf value 0.86, 0.80, 0.77,

0.64, 0.51, 0.44, 0.38, 0.29, 0.15, 0.13,0.10, 0.08, 0.05 respectively and pure fraction SN8

with Rf value 0.29 (Figure 4.5.2.1). Then separated fractions were dissolved in DMSO to

find out fraction active against HCV and resulted that HCV viral titer is decreased 76% and

65% of genotype 3a and 1a respectively (Figure 4.5.3.1).

NS3 protease is considered to be most attractive target for drug development

because of the fact that is essential for the replication of hepatitis C virus (Kolykhalov et al.,

2000; Reed and Rice, 2000). The Figure 4.5.3.2 proves that HCV NS3 level is significantly

decreased by SN8 fraction as compare to remaining S. nigrum fractions and Real Time PCR

analysis shows 85% and 83% inhibition of HCV NS3 level of genotype 3a and 1a

respectively (Figure 4.5.3.3). Previously, it was noted that a small molecule BILN 2061

belongs to a group of potent HCV NS3 protease inhibitors (Lamarre et al., 2003) which

support our results of SN8 fraction. Previously, the inhibition of polyprotein processing via

NS3 and reduction of protein expression by BLN 2061 was observed in replicon system

80

(Lamarre et al., 2003). Figure 4.5.3.4 clearly shows reduced NS3 expression by SN8 fraction

at protein level and GAPDH protein expression remains constant.

The results in Figure 4.5.4.1 shows that S. nigrum active fraction (SN8) has antiviral

effect against HCV of genotype 3a and 1a in a dose-dependent manner and at 100 µg

concentration inhibition of HCV titer upto 88% and 81% respectively. Furthermore, EC50

value was calculated by using non linear regression equation and demonstrated 50%

reduction in HCV titer of genotype 3a and 1a at 24.94±3.46µg and 47.68±5.73µg

respectively. In Figure 4.5.4.2 the results investigated that expression of HCV NS3 level

decreases as we increase the dose of SN8 while GAPDH expression remains same at all

doses. In this findings it is demonstrated that 51% and 49% decrease in viral titer was

observed by S. nigrum active fraction (SN8) alone but in combination therapy with

interferon (IFN) exhibited 84% and 75% decrease in HCV viral load of genotype 3a and 1a

respectively (Figure 4.5.5).

Grewia asiatica is locally called as Falsa, it is Southern Asian native shrub belongs to

species of Grewia. The fruit is of 6 to 12 mm diameter, with purple black color when ripped.

Falsa is used as traditional medicine in South Asian countries including Ayurvedic Indian

system. Its extract is considered very useful and an important ingredient of many herbal

formulations. (Poonam and Singh, 2009); (Gupta et al., 2010). In this study, our findings

showed that Grewia asiatica extract has antiviral potential against Hepatitis C virus (Figure

4.4).

81

The previous studies demonstrated that G. asiatica has antibacterial (Duraipandiyan

et al., 2006), anti-platelet (Kumar et al., 2012), antidiabetic, hypoglycemic, antifertility,

antipyretic and analgesic activity (Zia-Ul-Haq et al., 2013). The results from this study

proves that G. asiatica extract showed 42% and 39% reduction of HCV 3a and 1a genotype

respectively at non toxic concentration of 100 µg. On the other, (Bhanuprakash et al., 2008)

any antiviral drug active against virus should be non toxic to host cells. Importantly, the

decrease in HCV titer mediated by G. asiatica is independent of cytotoxicity (Figure 4.6).

Hepatitis C virus junction, NS3-4A is made of NS3 and cofactor NS4A which is a

non covalent complex. NS3 is a 70 kDa multifactorial protein, with a serine protease domain

positioned in the N-terminal one third and an NTPase/RNA helicase domain in the C-

terminal two third (Pietschmann et al., 2001; Raney et al., 2010). In our study we have

evaluated that G. asiatica methanol (GALM) extract reduced HCV NS3 protease expression

while chloroform (GALC) and acetone (GALA) extracts had no effect on NS3 protease at

non toxic concentrations (Figure 4.6.1.3). In addition, our Real Time PCR data proves that

GALM extract resulted in 59% and 35% inhibition of HCV NS3 protease level of genotype

3a and 1a respectively at non toxic doses (Figure 4.6.1.2). When G. asiatica was macerated

in increasing polarities of solvents, resulted in 3%, 4%, 72% inhibition of NS3 protease level

of genotype 3a and 0%, 3%, 91% of genotype 1a by GALC, GALA and GALM extracts

respectively (Figure 4.6.1.4). The recent investigation reports that methanol extract of G.

asiatica exhibits antiplatelet (Zia-Ul-Haq et al., 2012) antitumor, cytotoxic (Marya et al.,

2011) analgesic and antipyretic activities (Debajyoti et al., 2012).

82

In this study we also separated different fractions through thin layer and column

chromatography. Figure 4.6.2.1 shows TLC chromatogram of different components

separated from GALM extract and the pure fraction (GA15). The crude GALM extract

separated into sixteen components in (Chloroform: Methanol: Ethyl Acetate: Water 5:3:1:1)

followed by (Chloroform: Ethyl Acetate: Acetic Acid: Water 4: 3: 2: 1) solvent system. For

antiviral screening against HCV, each fraction was dissolved in DMSO and tested for

activity. In another study silymarin crude extract was observed to compromise HCV core

gene of genotype 3a in Huh-7 cells (Ashfaq et al., 2011).

In the reporter assay system hydroxyurea inhibited HCV RNA replication (Nozaki et

al., 2010). The results from this study demonstrate that each fraction was tested for antiviral

activity against HCV and found GA15 fraction reduced HCV titer 87% and 74% of genotype

3a and 1a respectively by Real Time Quantitative PCR analysis (Figure 4.6.3.1). Several

studies have shown that cellular targets of the NS3-4A protease are MAVS (blocking RIG-1

signaling), TRIF (blocking toll-like receptor 3 signaling), TC-PTP (enhance EGF signaling

and basal Akt activity) thereby inactivate mitochondrial host protein (Morikawa et al., 2011).

Similarly, the cleavage of IPS-1 adaptor molecule by HCV NS3/4A protease induced further

blocking of the interferon inducing signaling pathway (Foy et al., 2005). This study indicates

significant downstream blocking of HCV NS3 gene expression by addition of GA15 fraction

at nontoxic concentration of both 3a and 1a genotypes and GAPDH gene expression remains

constant (Figure 4.6.3.2). Our Real Time PCR data shows 91% and 87% inhibition of HCV

NS3 proteases level of genotype 3a and 1a respectively (Figure 4.6.3.3). HCV NS3 gene

expression was also examined at protein level and found significant decrease in NS3 protein

level by addition of GA15 fraction (Figure 4.6.3.4).

83

Dose dependent antiviral activity of active (GA15) fraction was found by serial

dilution method. The EC50 value is the amount of compound required to reduce the virus

50% of its control value (healthy cells). Previous literature indicates that EC50 values of

inhibition for L.radiata, P.lingua, A.annua and L. aggregata were 2.4±0.2, 34.5±2.6,

43.2±14.1 and 88.2±7.7 µg/ml respectively (Li et al., 2005). The results in this study show

that EC50 value of GA15 fraction is 9.46±2.93µg/ml and 10.13±2.75µg/ml for genotype 3a

and 1a respectively. Furthermore, GA15 fraction reduced viral titer of HCV genotype 3a and

1a upto 91% and 86% at 50µg concentration (Figure 4.6.4.1). Similarly, Figure 4.6.4.2 shows

downstream blocking of HCV NS3 protease of genotype 3a and 1a expression in a dose

dependent manner while GAPDH remains constant.

Previous results suggested that hydroxyurea would be an effective anti HCV agent

that can be used not only singly but also in combination with interferon to treat chronic

hepatitis C. Moreover, anti HCV activity of hydroxyurea was higher in combination with

IFN alpha than alone (Nozaki et al., 2010). In present study, the data indicates that GA15

fraction reduced HCV viral titer to 53% and 51% alone in combination with interferon,

resulted in 90% and 82% of genotype 3a and 1a respectively (Figure 4.6.5). These results

support the potential of anti HCV compound alone and also in combination with interferon to

treat chronic Hepatitis C.

Syzygium cumini extract decrease the growth and stimulate apoptosis in HeLa and

SiHa cancer cell lines (Barh and Viswanathan, 2008). In this research, S. cumini leaves

extract (SCLM) demonstrated the Huh-7 and CHO cells remained unaffected at 100 µg of

84

concentration in trypan blue dye explosive assay (Figure 4.1). The cytotoxic effect of

Syzygium cumini crude extract was determined by MTT assay on Huh-7 cells at different

concentrations (Figure 4.3). Recently, S. cumini aqueous extract was evaluated for cell

viability by MTT assay and found non toxic at 100 µg of concentration (Bellé et al., 2013).

Three major steps of Hepatitis C virus life cycle begins with: attachment and entry of

virus into its target cells, replication of genomic RNA, and assembly and release of viruses

from the infected cells (Calland et al., 2012). The mouse hepatocyte lines make it possible to

establish a HCV infection model with diverse applications (Aly et al., 2011). The present

study reports that S. cumine extract showed 45% and 31% inhibition of HCV 3a and 1a

genotype respectively at non toxic concentrations (Figure 4.7)

HCV NS3 protease is a vital component of viral replication and regarded as an

attractive target for patients infected with HCV (Gu and Rice, 2013). The present study

reveals that our methanol extract of S. cumine leaves down regulated the expression level of

HCV NS3 proteases while chloroform (SCLC) and acetone (SCLA) extracts showed no

effect in Huh-7 cells at a concentration of 100 µg and GAPDH expression remains constant

(Figure 4.7.1.3). Furthermore, our Real Time PCR analysis reveals 48% and 34% inhibition

of HCV NS3 proteases level of genotype 3a and 1a respectively at non toxic concentrations

(Figure 4.7.1.2). Similarly, Syzgium cumine leaves in different polarity solvents demonstrated

6%, 9%, 51% inhibition of NS3 protease level of genotype 3a and 3%, 0%, 79% inhibition of

genotype 1a respectively (Figure 4.7.1.4).

85

Phytochemical studies of Syzgium cumine extract contains flavonoids, cardiac

glycosides, terpenoids, phenols, saponins and tannins (Gowri and Vasantha, 2010). The

present study clearly reports that S. cumini leaves extract separates into fifteen components in

(C: M: W 7:2:1) solvent system and four more components in (C: EA: AA: W 4: 3: 2: 1)

mobile phase (Figure 4.7.2.1). All the fractions were dissolved in DMSO and tested against

HCV at nontoxic concentrations and found that fraction (SC14) results in 76% and 62%

decrease in HCV titer of genotype 3a and 1a respectively by Real Time Quantitative PCR

analysis (Figure 4.7.3.1). Previously, crude methanol extract of S. cumini led to the isolation

of 7-hydroxycalamenene, methyl-β-orsellinate , β-sitosterol and oleanolic acid (Sikder et al.,

2012).

The results of this study demonstrated that the expression level of HCV NS3 protease

is significantly reduced by SC14 fraction as compare to all other fractions isolated from S.

cumini leaves methanol (SCLM) extract while GAPDH expression remains constant for all

tested fractions (Figure 4.7.3.2). Furthermore, the results of SC14 fraction were verified by

Real Time PCR analysis and found the inhibition of NS3 protease level to 82% and 76% of

genotype 3a and 1a respectively (Figure 4.7.3.3). Previous literature of western blotting

revealed that the quantity of α-fetoprotein was reduced by 1.0 mg/ml of fucoidan in Huh-7

cells (Nagamine et al., 2009). Results in Figure 4.7.3.4 demonstrates that the protein level of

NS3 protease is decreased by SC14 fraction in Huh-7 cells and GAPDH protein expression

remains constant. So, SC14 fraction decreases HCV NS3 level at RNA as well as protein

level.

86

The outcome of this study exhibited that SC14 fraction reduced 50% (EC50 Value) of

HCV titer of genotype 3a and 1a at a concentration of 31.75±3.28 µg/ml and 71.96±8.67

µg/ml respectively (Figure 4.7.4a). Furthermore, Figure 4.7.4b shows dose dependant

inhibition of HCV NS3 protease of genotype 3a and 1a expression while GAPDH expression

remains constant.

It is well known that IFNs, importantly type I interferon plays a vital role in reducing

viral population through the motivation of interferon stimulating genes (ISGs) (O'Neill and

Bowie, 2010). Currently, peg-Interferon-α and ribavirin is the only standard remedy for all

genotypes of Hepatitis C Virus, but tolerability of this combination treatment is poor with

few side effects and an impaired quality of life (Asselah and Marcellin, 2011). In present

study, effective fraction SC14 was tested without or combination of interferon and viral titers

were quantified through Quantitative RT-PCR. S. cumini active fraction (SC14) exhibited

47% and 49% reduction in viral load, on the other hand its combination with interferon

shows 81% and 76% decline in HCV virus of 3a and 1a genotype respectively (Figure 4.7.5).

So we can suggest that the use of SC14 in combination with interferon would be encouraging

treatment for HCV patients.

The present study was designed to search for phytochemicals from traditional

medicinal plants against HCV. Therefore, an in-vitro bioassay was developed by using HCV

inoculums of genotype 3a and 1a into Huh-7 cell line for screening the active component

from selected plants. Twenty four medicinal plants were collected and their solvent

extraction was performed for further toxicological studies on liver (Huh-7) and fibroblast

(CHO) cells lines by colorimeteric methods, trypan blue dye and MTT cell proliferation

87

assay. Plant extracts designated as NJ, PN and VJ showed toxic effect on Huh 7 cell lines

cells, so excluded for further screening. For antiviral screening, HCV infected cells were

treated with plant extracts at non toxic doses. In in vitro assay on HCV 3a and 1a genotype

five medicinal plant extracts designated as SN, GA, SC, AM and FC showed antiviral

activity. Through Quantitative real time PCR, HCV titer was analyzed and further evaluated

against NS3 proteases of HCV genotype 1a and 3a. Potent plant extracts were fractionated

by thin layer chromatography (TLC) and column chromatography. These purified potent

fractions were then analyzed against Hepatitis C virus to find out EC50 (50% Effective

concentration) and synergistic effect with interferon alpha if exists. Finally, the active

fractions SN8, GA15 and SC14 were effective against HCV and had synergistic effect when

combined with IFN α.

Present in vitro study has identified three active fractions from traditional medicinal

plants as potential anti HCV candidates. Combination of these active ingredients with

interferon (IFN) will be a successful future therapy against Hepatitis C virus. Further studies

are necessary for the better understanding of mechanism to clarify their role in the treatment

of HCV.

88

REFERENCES

Abbasi, A.M., Khan, M.A., Ahmad, M., Zafar, M., Khan, H., Muhammad, N., and Sultana,

S. (2009). Medicinal plants used for the treatment of jaundice and hepatitis based on socio-

economic documentation. African journal of biotechnology 8.

Acharya, E., and Pokhrel, B. (2006). Ethno-medicinal plants used by Bantar of Bhaudaha,

Morang, Nepal. Our Nature 4, 96-103.

Ahaskar, M., Sharma, K., Singh, S., and Sisodia, R. (2007). Radioprotective effect of the

fruit extract of Grewia asiatica in Swiss albino mice against lethal dose of γ-irradiation.

Asian J Exp Sci 21, 295-308.

Aly, H.H., Oshiumi, H., Shime, H., Matsumoto, M., Wakita, T., Shimotohno, K., and Seya,

T. (2011). Development of mouse hepatocyte lines permissive for hepatitis C virus (HCV).

PLoS ONE 6, e21284.

ANNEMARIE WASLEY, S.D., and Alter, M.J. (2000). Epidemiology of hepatitis C:

geographic differences and temporal trends. Hepatitis C: State of the Art at the Millennium

20, 1.

Ashfaq, U.A., Javed, T., Rehman, S., Nawaz, Z., and Riazuddin, S. (2011). Inhibition of

HCV 3a core gene through Silymarin and its fractions. Virology journal 8, 1-7.

Asselah, T., Bieche, I., Sabbagh, A., Bedossa, P., Moreau, R., Valla, D., Vidaud, M., and

Marcellin, P. (2009). Gene expression and hepatitis C virus infection. Gut 58, 846-858.

Asselah, T., and Marcellin, P. (2011). New direct‐acting antivirals' combination for the

treatment of chronic hepatitis C. Liver International 31, 68-77.

Attaullah, S., Khan, S., and Ali, I. (2011). Hepatitis C virus genotypes in Pakistan: a systemic

review. Virol J 8, 433.

Azaizeh, H., Fulder, S., Khalil, K., and Said, O. (2003). Ethnobotanical knowledge of local

Arab practitioners in the Middle Eastern region. Fitoterapia 74, 98-108.

Bacon, B.R., Shiffman, M.L., Mendes, F., Ghalib, R., Hassanein, T., Morelli, G., Joshi, S.,

Rothstein, K., Kwo, P., and Gitlin, N. (2009). Retreating chronic hepatitis C with daily

interferon alfacon‐1/ribavirin after nonresponse to pegylated interferon/ribavirin: DIRECT

results. Hepatology 49, 1838-1846.

Barh, D., and Viswanathan, G. (2008). Syzygium cumini inhibits growth and induces

apoptosis in cervical cancer cell lines: a primary study. ecancermedicalscience 2.

Bartenschlager, R., and Lohmann, V. (2000). Replication of hepatitis C virus. Journal of

General Virology 81, 1631-1648.

89

Bartosch, B., Bukh, J., Meunier, J.C., Granier, C., Engle, R.E., Blackwelder, W.C., Emerson,

S.U., Cosset, F.L., and Purcell, R.H. (2003a). In vitro assay for neutralizing antibody to

hepatitis C virus: evidence for broadly conserved neutralization epitopes. Proc Natl Acad Sci

U S A 100, 14199-14204.

Bartosch, B., Dubuisson, J., and Cosset, F.-L. (2003b). Infectious hepatitis C virus pseudo-

particles containing functional E1–E2 envelope protein complexes. The Journal of

experimental medicine 197, 633-642.

Baumert, T.F., Ito, S., Wong, D.T., and Liang, T.J. (1998). Hepatitis C virus structural

proteins assemble into viruslike particles in insect cells. Journal of virology 72, 3827-3836.

Bazan, J.F., and Fletterick, R.J. (1988). Viral cysteine proteases are homologous to the

trypsin-like family of serine proteases: structural and functional implications. Proceedings of

the National Academy of Sciences 85, 7872-7876.

Bellé, L.P., Bitencourt, P.E.R., Abdalla, F.H., de Bona, K.S., Peres, A., Maders, L.D.K., and

Moretto, M.B. (2013). Aqueous seed extract of Syzygium cumini inhibits the dipeptidyl

peptidase IV and adenosine deaminase activities, but it does not change the CD26 expression

in lymphocytes in vitro. Journal of physiology and biochemistry 69, 119-124.

Bhanuprakash, V., Hosamani, M., Balamurugan, V., Gandhale, P., Naresh, R., Swarup, D.,

and Singh, R. (2008). In vitro antiviral activity of plant extracts on goatpox virus replication.

Indian journal of experimental biology 46, 120.

Biselli, M., Andreone, P., Gramenzi, A., Lorenzini, S., Loggi, E., Bonvicini, F., Cursaro, C.,

and Bernardi, M. (2006). Pegylated interferon plus ribavirin for recurrent Hepatitis C

infection after liver transplantation in naive and non-responder patients on a stable

immunosuppressive regimen. Digestive and liver disease 38, 27-32.

Blight, K.J., Kolykhalov, A.A., and Rice, C.M. (2000). Efficient initiation of HCV RNA

replication in cell culture. Science 290, 1972-1974.

Blight, K.J., McKeating, J.A., Marcotrigiano, J., and Rice, C.M. (2003). Efficient replication

of hepatitis C virus genotype 1a RNAs in cell culture. Journal of virology 77, 3181-3190.

Block, G., Patterson, B., and Subar, A. (1992). Fruit, vegetables, and cancer prevention: a

review of the epidemiological evidence. Nutrition and cancer 18, 1-29.

Bollati, M., Alvarez, K., Assenberg, R., Baronti, C., Canard, B., Cook, S., Coutard, B.,

Decroly, E., de Lamballerie, X., and Gould, E.A. (2010). Structure and functionality in

flavivirus NS-proteins: Perspectives for drug design. Antiviral research 87, 125-148.

Bostan, N., and Mahmood, T. (2010). An overview about hepatitis C: a devastating virus.

Critical reviews in microbiology 36, 91-133.

Boyer, J., and Liu, R.H. (2004). Apple phytochemicals and their health benefits. Nutr J 3, 12.

Bukh, J., Pietschmann, T., Lohmann, V., Krieger, N., Faulk, K., Engle, R.E., Govindarajan,

S., Shapiro, M., Claire, M.S., and Bartenschlager, R. (2002). Mutations that permit efficient

90

replication of hepatitis C virus RNA in Huh-7 cells prevent productive replication in

chimpanzees. Proceedings of the National Academy of Sciences 99, 14416-14421.

Cai, Z., Zhang, C., Chang, K.S., Jiang, J., Ahn, B.C., Wakita, T., Liang, T.J., and Luo, G.

(2005). Robust production of infectious hepatitis C virus (HCV) from stably HCV cDNA-

transfected human hepatoma cells. J Virol 79, 13963-13973.

Calland, N., Dubuisson, J., Rouillé, Y., and Séron, K. (2012). Hepatitis C virus and natural

compounds: a new antiviral approach? Viruses 4, 2197-2217.

Cavallaro, L., Garcia, G., Broussalis, A., Ferraro, X., Martino, V., Coussio, J., De Torres, R.,

and Campos, R. (1995). Antiherpetic in vitro activity of Gamochaeta simplicicaulis extract.

Phytotherapy Research 9, 176-179.

Chaudhuri, S., Das, S., Chowdhury, A., Santra, A., Bhattacharya, S., and Naik, T. (2005).

Molecular epidemiology of HCV infection among acute and chronic liver disease patients in

Kolkata, India. Journal of clinical virology 32, 38-46.

Collett, M.S., Larson, R., Gold, C., Strick, D., Anderson, D.K., and Purchio, A. (1988).

Molecular cloning and nucleotide sequence of the pestivirus bovine viral diarrhea virus.

Virology 165, 191-199.

Cunningham, M., and Foster, G.R. (2012). Efficacy and safety of telaprevir in patients with

genotype 1 hepatitis C infection. Therapeutic advances in gastroenterology 5, 139-151.

De Clercq, E. (2002). Cidofovir in the treatment of poxvirus infections. Antiviral research 55,

1-13.

De Francesco, R., and Migliaccio, G. (2005). Challenges and successes in developing new

therapies for hepatitis C. Nature 436, 953-960.

Debajyoti, D., Achintya, M., Debdas, D., Achintya, S., and Jayram, H. (2012). Evaluation of

antipyretic and analgesic activity of parusaka (Grewia asiatica Linn.): An indigenous Indian

plant. Int J Res Ayurveda Pharm 3, 519-524.

Dhawan, B. (2012). Anti-Viral Activity of Indian Plants. Proceedings of the National

Academy of Sciences, India Section B: Biological Sciences 82, 209-224.

Dhiman, R.K., and Chawla, Y.K. (2005). Herbal medicines for liver diseases. Digestive

diseases and sciences 50, 1807-1812.

Diallo, D., Hveem, B., Mahmoud, M.A., Berge, G., Paulsen, B.S., and Maiga, A. (1999). An

ethnobotanical survey of herbal drugs of Gourma district, Mali. Pharmaceutical Biology 37,

80-91.

Duraipandiyan, V., Ayyanar, M., and Ignacimuthu, S. (2006). Antimicrobial activity of some

ethnomedicinal plants used by Paliyar tribe from Tamil Nadu, India. BMC complementary

and alternative medicine 6, 35.

91

Dusheiko, G., Schmilovitz‐Weiss, H., Brown, D., McOmish, F., Yap, P.L., Sherlock, S.,

McIntyre, N., and Simmonds, P. (1994). Hepatitis C virus genotypes: an investigation of

type‐specific differences in geographic origin and disease. Hepatology 19, 13-18.

Duvet, S., Cocquerel, L., Pillez, A., Cacan, R., Verbert, A., Moradpour, D., Wychowski, C.,

and Dubuisson, J. (1998). Hepatitis C virus glycoprotein complex localization in the

endoplasmic reticulum involves a determinant for retention and not retrieval. Journal of

Biological Chemistry 273, 32088-32095.

Foy, E., Li, K., Sumpter, R., Loo, Y.-M., Johnson, C.L., Wang, C., Fish, P.M., Yoneyama,

M., Fujita, T., and Lemon, S.M. (2005). Control of antiviral defenses through hepatitis C

virus disruption of retinoic acid-inducible gene-I signaling. Proceedings of the National

Academy of Sciences of the United States of America 102, 2986-2991.

Fretz, C., Jeannel, D., Stuyver, L., Herve, V., Lunel, F., Boudifa, A., Mathiot, C., and

Fournel, J. (1995). HCV infection in a rural population of the Central African Republic

(CAR): evidence for three additional subtypes of genotype 4. Journal of medical virology 47,

435-437.

Ge, D., Fellay, J., Thompson, A.J., Simon, J.S., Shianna, K.V., Urban, T.J., Heinzen, E.L.,

Qiu, P., Bertelsen, A.H., and Muir, A.J. (2009). Genetic variation in IL28B predicts hepatitis

C treatment-induced viral clearance. Nature 461, 399-401.

Ghany, M.G., Nelson, D.R., Strader, D.B., Thomas, D.L., and Seeff, L.B. (2011). An update

on treatment of genotype 1 chronic hepatitis C virus infection: 2011 practice guideline by the

American Association for the Study of Liver Diseases. Hepatology 54, 1433-1444.

Gowri, S.S., and Vasantha, K. (2010). Phytochemical screening and antibacterial activity of

Syzygium cumini (L.)(Myrtaceae) leaves extracts. Int J Pharm Tech Res 2, 1569-1573.

Grossmann, M.E., Mizuno, N.K., Schuster, T., and Cleary, M.P. (2010). Punicic acid is an ω-

5 fatty acid capable of inhibiting breast cancer proliferation. International journal of

oncology 36, 421.

Gu, M., and Rice, C.M. (2013). Structures of hepatitis C virus nonstructural proteins required

for replicase assembly and function. Current opinion in virology.

Gupta, M., Shaw, B., and Mukherjee, A. (2010). A new glycosidic flavonoid from Jwarhar

mahakashay (antipyretic) Ayurvedic preparation. International journal of Ayurveda research

1, 106.

Haq, I., and Rehman, M. (1990). Medicinal plants of upper Swat (NWFP) Pakistan. Hamdard

Med 33, 51-68.

Hassan, B.A.R. (2012). Medicinal Plants (Importance and Uses). Pharmaceutica Analytica

Acta.

Hissar, S.S., Goyal, A., Kumar, M., Pandey, C., Suneetha, P., Sood, A., Midha, V., Sakhuja,

P., Malhotra, V., and Sarin, S.K. (2006). Hepatitis C virus genotype 3 predominates in North

92

and Central India and is associated with significant histopathologic liver disease. Journal of

medical virology 78, 452-458.

Hoareau, L., and DaSilva, E.J. (1999). Medicinal plants: a re-emerging health aid. Electr J

Biotechnol 2, http://www.ejb.org/content/vol2/issue2/full2.

Hsieh, C.-C., Fang, H.-L., and Lina, W.-C. (2008). Inhibitory effect of Solanum

nigrum on thioacetamide-induced liver fibrosis in mice. Journal of Ethnopharmacology

119, 117-121.

Hsu, M., Zhang, J., Flint, M., Logvinoff, C., Cheng-Mayer, C., Rice, C.M., and McKeating,

J.A. (2003). Hepatitis C virus glycoproteins mediate pH-dependent cell entry of pseudotyped

retroviral particles. Proc Natl Acad Sci U S A 100, 7271-7276.

Huang, H.-C., Syu, K.-Y., and Lin, J.-K. (2010). Chemical composition of Solanum nigrum

linn extract and induction of autophagy by leaf water extract and its major flavonoids in

AU565 breast cancer cells. Journal of agricultural and food chemistry 58, 8699-8708.

Hudson, J. (1989). Plant photosensitizers with antiviral properties. Antiviral research 12, 55-

74.

Hudson, J., Lopez-Bazzocchi, I., and Towers, G. (1991). Antiviral activities of hypericin.

Antiviral research 15, 101-112.

Hussain, A., Sasidharan, S., Ahmed, T., Ahmed, M., and Sharma, C. (2009). Clove

(Syzygium aromaticum) extract potentiates gemcitabine cytotoxic effect on human cervical

cancer cell line. Int J Cancer Res 5, 95-104.

Idrees, M., Lal, A., Naseem, M., and Khalid, M. (2008). High prevalence of hepatitis C virus

infection in the largest province of Pakistan. Journal of digestive diseases 9, 95-103.

Jassim, S.A., and Naji, M.A. (2003). Novel antiviral agents: a medicinal plant perspective. J

Appl Microbiol 95, 412-427.

Jatav, V.S., Singh, S.K., Khatri, P., and Sharma, A.K. (2011). Recent pharmacological trends

of Glycyrrhiza glabra Linn. Unani Res 1, 1-4.

Jauregui, H.O., Hayner, N.T., Driscoll, J.L., Williams-Holland, R., Lipsky, M.H., and

Galletti, P.M. (1981). Trypan blue dye uptake and lactate dehydrogenase in adult rat

hepatocytes—freshly isolated cells, cell suspensions, and primary monolayer cultures. In

vitro 17, 1100-1110.

Jazwinski, A.B., and Muir, A.J. (2011). Direct-acting antiviral medications for chronic

hepatitis C virus infection. Gastroenterology & hepatology 7, 154.

Ji, Y., Gao, S., Ji, C., and Zou, X. (2008). Induction of apoptosis in HepG 2

cells by solanine and Bcl-2 protein. Journal of Ethnopharmacology 115, 194-202.

http://www.ejb.org/content/vol2/issue2/full2

93

Joo, H.Y., Lim, K., and Lim, K.T. (2009). Phytoglycoprotein (150 kDa) isolated from

Solanum nigrum Linne has a preventive effect on dextran sodium sulfate‐induced colitis in

A/J mouse. Journal of Applied Toxicology 29, 207-213.

Kala, C.P. (2005). Ethnomedicinal botany of the Apatani in the Eastern Himalayan region of

India. Journal of ethnobiology and ethnomedicine 1, 1-8.

Kapusta, J., Modelska, A., Figlerowicz, M., Pniewski, T., Letellier, M., Lisowa, O., Yusibov,

V., Koprowski, H., Plucienniczak, A., and Legocki, A. (1999). A plant-derived edible

vaccine against hepatitis B virus. The FASEB journal 13, 1796-1799.

Khattak, J.Z.K., Anwar, Z., Aftab, S., Afzal, M., Islam, M., and Khan, A. Solenum nigrum as

Potent Therapy: A Review. British Journal of Pharmacology 3.

Kiran, B., Kudesia, R., Rani, M., and Pal, A. (2009). Reclaiming degraded land in India

through the cultivation of medicinal plants. Bot Res Int 2, 174-181.

Kitazato, K., Wang, Y., and Kobayashi, N. (2007). Viral infectious disease and natural

products with antiviral activity. Drug discoveries & therapeutics 1, 14.

Kolykhalov, A.A., Agapov, E.V., Blight, K.J., Mihalik, K., Feinstone, S.M., and Rice, C.M.

(1997). Transmission of hepatitis C by intrahepatic inoculation with transcribed RNA.

Science 277, 570-574.

Kolykhalov, A.A., Mihalik, K., Feinstone, S.M., and Rice, C.M. (2000). Hepatitis C virus-

encoded enzymatic activities and conserved RNA elements in the 3′ nontranslated region are

essential for virus replication in vivo. Journal of virology 74, 2046-2051.

Krieger, N., Lohmann, V., and Bartenschlager, R. (2001). Enhancement of hepatitis C virus

RNA replication by cell culture-adaptive mutations. Journal of virology 75, 4614-4624.

Kuiken, C., Yusim, K., Boykin, L., and Richardson, R. (2005). The Los Alamos hepatitis C

sequence database. Bioinformatics 21, 379-384.

Kumar, P., Jaiswal, P., Singh, V.K., Singh, D.K., and Singh, D. MEDICI AL,

THERAPEUTIC AD PHARMACOLOGICAL EFFECTS OF SYZYGIUM

AROMATICUM (LAU G).

Kumar, R.V., Venkatrajireddy, G., Bikshapathi, T., and Reddy, M.K. (2012). Antioxidant-the

maximum expressed activity among 63 medicinal plants. J Phyto Pharmacol 1, 1-13.

Lamarre, D., Anderson, P.C., Bailey, M., Beaulieu, P., Bolger, G., Bonneau, P., Bös, M.,

Cameron, D.R., Cartier, M., and Cordingley, M.G. (2003). An NS3 protease inhibitor with

antiviral effects in humans infected with hepatitis C virus. Nature 426, 186-189.

Lanford, R.E., Sureau, C., Jacob, J.R., White, R., and Fuerst, T.R. (1994). Demonstration of in Vitro Infection of Chimpanzee Hepatocytes with Hepatitis C Virus Using Strand-

Specific RT/PCR. Virology 202, 606-614.

94

Lee, K.-R., Kozukue, N., Han, J.-S., Park, J.-H., Chang, E.-y., Baek, E.-J., Chang, J.-S., and

Friedman, M. (2004). Glycoalkaloids and metabolites inhibit the growth of human colon

(HT29) and liver (HepG2) cancer cells. Journal of agricultural and food chemistry 52, 2832-

2839.

Leporatti, M.L., and Ghedira, K. (2009). Journal of Ethnobiology and Ethnomedicine.

Journal of ethnobiology and ethnomedicine 5, 31.

Leung, D., Abbenante, G., and Fairlie, D.P. (2000). Protease inhibitors: current status and

future prospects. Journal of medicinal chemistry 43, 305-341.

Li, H.-M., Tang, Y.-L., Zhang, Z.-H., Liu, C.-J., Li, H.-Z., Li, R.-T., and Xia, X.-S. (2012).

Compounds from Arnebia euchroma and their related anti-HCV and antibacterial activities.

Planta medica 78, 39-45.

Li, J., Li, Q., Feng, T., and Li, K. (2008). Aqueous extract of Solanum nigrum inhibit

growth of cervical carcinoma (U14) via modulating immune response of tumor bearing mice

and inducing apoptosis of tumor cells. Fitoterapia 79, 548-556.

Li, J., Li, Q.W., Gao, D.W., Han, Z.S., and Lu, W.Z. (2009). Antitumor and

immunomodulating effects of polysaccharides isolated from Solanum nigrum Linne.

Phytotherapy Research 23, 1524-1530.

Li, S.-y., Chen, C., Zhang, H.-q., Guo, H.-y., Wang, H., Wang, L., Zhang, X., Hua, S.-n., Yu,

J., and Xiao, P.-g. (2005). Identification of natural compounds with antiviral activities against

SARS-associated coronavirus. Antiviral research 67, 18-23.

Locarnini, S.A., and Bartholomeusz, A. (2002). Advances in hepatitis C: What is coming in

the next 5 years? Journal of gastroenterology and hepatology 17, 442-447.

Manns, M.P., McHutchison, J.G., Gordon, S.C., Rustgi, V.K., Shiffman, M., Reindollar, R.,

Goodman, Z.D., Koury, K., Ling, M.-H., and Albrecht, J.K. (2001). Peginterferon alfa-2b

plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic

hepatitis C: a randomised trial. The Lancet 358, 958-965.

Marya, B., Dattani, K.H., Patel, D.D., Patel, P.D., Patel, D., Suthar, M.P., Patel, V.P., and

Bothara, S.B. (2011). In vitro cytotoxicity evaluation of aqueous fruit and leaf extracts of

Grewia asiatica using MTT assay. Scholars Research Library Der Pharma Chemica 3, 282-

287.

McHutchison, J.G., Lawitz, E.J., Shiffman, M.L., Muir, A.J., Galler, G.W., McCone, J.,

Nyberg, L.M., Lee, W.M., Ghalib, R.H., and Schiff, E.R. (2009). Peginterferon alfa-2b or

alfa-2a with ribavirin for treatment of hepatitis C infection. New England Journal of

Medicine 361, 580-593.

Mercer, D.F., Schiller, D.E., Elliott, J.F., Douglas, D.N., Hao, C., Rinfret, A., Addison, W.R.,

Fischer, K.P., Churchill, T.A., and Lakey, J.R. (2001). Hepatitis C virus replication in mice

with chimeric human livers. Nature medicine 7, 927-933.

95

Meuleman, P., Libbrecht, L., De Vos, R., de Hemptinne, B., Gevaert, K., Vandekerckhove,

J., Roskams, T., and Leroux‐Roels, G. (2005). Morphological and biochemical

characterization of a human liver in a uPA‐SCID mouse chimera. Hepatology 41, 847-856.

Meylan, E., Curran, J., Hofmann, K., Moradpour, D., Binder, M., Bartenschlager, R., and

Tschopp, J. (2005). Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted

by hepatitis C virus. Nature 437, 1167-1172.

Mohanty, S., and Cock, I.E. (2012). The chemotherapeutic potential of Terminalia

ferdinandiana: Phytochemistry and bioactivity. Pharmacognosy reviews 6, 29.

Moradpour, D., Brass, V., and Penin, F. (2005). Function follows form: The structure of the

N‐terminal domain of HCV NS5A. Hepatology 42, 732-735.

Morgan, K. (1994). Medicine of the gods: Basic principles of Ayurvedic medicine (Charles

T. Banford Company).

Morikawa, K., Lange, C., Gouttenoire, J., Meylan, E., Brass, V., Penin, F., and Moradpour,

D. (2011). Nonstructural protein 3‐4A: the Swiss army knife of hepatitis C virus. Journal of

viral hepatitis 18, 305-315.

Moshi, M.J., Otieno, D.F., Mbabazi, P.K., and Weisheit, A. (2009). Journal of Ethnobiology

and Ethnomedicine. Journal of ethnobiology and ethnomedicine 5, 24.

Mosmann, T. (1983a). Rapid colorimetric assay for cellular growth and survival: application

to proliferation and cytotoxicity assays. Journal of immunological methods 65, 55-63.

Mosmann, T. (1983b). Rapid colorimetric assay for cellular growth and survival: application

to proliferation and cytotoxicity assays. J Immunol Methods 65, 55-63.

Mukhtar, M., Arshad, M., Ahmad, M., Pomerantz, R.J., Wigdahl, B., and Parveen, Z. (2008).

Antiviral potentials of medicinal plants. Virus Research 131, 111-120.

Murphy, W.L., Andersen, J.M., and Ebelin, R.M. (2002). Assessment of geology as it

pertains to modeling uplift in jointed rock :

a basis for inclusion of uncertainty in flow models (Vicksburg, Miss., US Army Corps of

Engineers, Engineer Research and Development Center, Geotechnical and Structures

Laboratory, Information Technology Laboratory).

Nagamine, T., Hayakawa, K., Kusakabe, T., Takada, H., Nakazato, K., Hisanaga, E., and Iha,

M. (2009). Inhibitory effect of fucoidan on Huh7 hepatoma cells through downregulation of

CXCL12. Nutrition and cancer 61, 340-347.

Nascimento, G.G., Locatelli, J., Freitas, P.C., and Silva, G.L. (2000). Antibacterial activity of

plant extracts and phytochemicals on antibiotic-resistant bacteria. Brazilian Journal of

Microbiology 31, 247-256.

96

Ndjomou, J., Pybus, O.G., and Matz, B. (2003). Phylogenetic analysis of hepatitis C virus

isolates indicates a unique pattern of endemic infection in Cameroon. Journal of General

Virology 84, 2333-2341.

Newman, D.J., Cragg, G.M., and Snader, K.M. (2000). The influence of natural products

upon drug discovery. Natural product reports 17, 215-234.

Nisar, M.F., Ismail, S., Arshad, M., Majeed, A., and Arfan, M. (2011). Ethnomedicinal Flora

of District Mandi Bahaudin, Pakistan. Middle-East Journal of Scientific Research 9, 233-238.

Noppornpanth, S., Sablon, E., De Nys, K., Lien, T.X., Brouwer, J., Van Brussel, M., Smits,

S.L., Poovorawan, Y., Osterhaus, A.D., and Haagmans, B.L. (2006). Genotyping hepatitis C

viruses from Southeast Asia by a novel line probe assay that simultaneously detects core and

5′ untranslated regions. Journal of clinical microbiology 44, 3969-3974.

Nozaki, A., Morimoto, M., Kondo, M., Oshima, T., Numata, K., Fujisawa, S., Kaneko, T.,

Miyajima, E., Morita, S., and Mori, K. (2010). Hydroxyurea as an inhibitor of hepatitis C

virus RNA replication. Archives of virology 155, 601-605.

O'Neill, L.A., and Bowie, A.G. (2010). Sensing and signaling in antiviral innate immunity.

Current Biology 20, R328-R333.

Pak, E., Esrason, K.T., and Wu, V.H. (2004). Hepatotoxicity of herbal remedies: an emerging

dilemma. Progress in Transplantation 14, 91-96.

Pietschmann, T., Lohmann, V., Rutter, G., Kurpanek, K., and Bartenschlager, R. (2001).

Characterization of cell lines carrying self-replicating hepatitis C virus RNAs. Journal of

virology 75, 1252-1264.

Poonam, K., and Singh, G.S. (2009). Ethnobotanical study of medicinal plants used by the

Taungya community in Terai Arc Landscape, India. Journal of Ethnopharmacology 123, 167-

176.

Qureshi, R., Waheed, A., Arshad, M., and Umbreen, T. (2009). Medico-ethnobotanical

inventory of Tehsil Chakwal, Pakistan. Pak J Bot 41, 529-538.

Raney, K.D., Sharma, S.D., Moustafa, I.M., and Cameron, C.E. (2010). Hepatitis C virus

non-structural protein 3 (HCV NS3): a multifunctional antiviral target. Journal of Biological

Chemistry 285, 22725-22731.

Ravi, V., Saleem, T., Maiti, P., Gauthaman, K., and Ramamurthy, J. (2009). Phytochemical

and pharmacological evaluation of Solanum nigrum Linn. African Journal of Pharmacy and

Pharmacology 3, 454-457.

Reed, K., and Rice, C. (2000). Overview of hepatitis C virus genome structure, polyprotein

processing, and protein properties. In The Hepatitis C Viruses (Springer), pp. 55-84.

Sahranavard, S., Naghibi, F., Mosaddegh, M., Esmaeili, S., Sarkhail, P., Taghvaei, M., and

Ghafari, S. (2009). Cytotoxic activities of selected medicinal plants from Iran and

97

phytochemical evaluation of the most potent extract. Research in pharmaceutical sciences 4,

133.

Saleem, T.M., Chetty, C.M., Ramkanth, S., Rajan, V., Kumar, K.M., and Gauthaman, K.

(2010). Hepatoprotective herbs—a review. International Journal of Research in

Pharmaceutical Sciences 1, 1-5.

Sánchez–Tapias, J.M., Diago, M., Escartín, P., Enríquez, J., Romero–Gómez, M., Bárcena,

R., Crespo, J., Andrade, R., Martínez–Bauer, E., and Pérez, R. (2006). Peginterferon-alfa2a

plus ribavirin for 48 versus 72 weeks in patients with detectable hepatitis C virus RNA at

week 4 of treatment. Gastroenterology 131, 451-460.

Sarrazin, C., and Zeuzem, S. (2010). Resistance to direct antiviral agents in patients with

hepatitis C virus infection. Gastroenterology 138, 447-462.

Saxena, S. (2005). Glycyrrhiza glabra: medicine over the millennium. Nat Prod Rad 4, 358-

367.

Sharma, Y., Singh, H., and Mehra, B. (2004). Hepatoprotective effect of few Ayurvedic

herbs in patients receiving antituberculus treatment. Indian Journal of Traditional Knowledge

3, 391-396.

Shepard, C.W., Finelli, L., and Alter, M.J. (2005). Global epidemiology of hepatitis C virus

infection. The Lancet infectious diseases 5, 558-567.

Sikdar, M., and Dutta, U. (2008). Traditional phytotherapy among the Nath people of Assam.

Ethno Med 2, 39-45.

Sikder, M.A.A., Kaisar, M.A., Rahman, M.S., Hasan, C.M., Al-Rehaily, A.J., and Rashid,

M.A. (2012). Secondary Metabolites from Seed Extracts of Syzygium Cumini (L.). Journal

of Physical Science 23, 83-87.

Simmonds, P. (2004). Genetic diversity and evolution of hepatitis C virus–15 years on.

Journal of General Virology 85, 3173-3188.

Singh, B., Gupta, V., Bansal, P., Singh, R., and Kumar, D. (2010). Pharmacological potential

of plant used as aphrodisiacs. International Journal of Pharmaceutical Sciences Review and

Research 5, 104-113.

Sivaperumal, R., Ramya, S., Ravi, A.V., Rajasekaran, C., and Jayakumararaj, R. (2010).

Ethnopharmacological studies on the medicinal plants used by tribal inhabitants of Kottur

Hills, Dharmapuri, Tamilnadu, India. Environ We Int J Sci Technol 5, 57-64.

Smith, D.B., Pathirana, S., Davidson, F., Lawlor, E., Power, J., Yap, P.L., and Simmonds, P.

(1997). The origin of hepatitis C virus genotypes. Journal of General Virology 78, 321-328.

Son, Y.-O., Kim, J., Lim, J.-C., Chung, Y., Chung, G.-H., and Lee, J.-C. (2003). Ripe fruits

of Solanum nigrum L. inhibits cell growth and induces apoptosis in MCF-7 cells.

Food and chemical toxicology 41, 1421-1428.

98

Steinmann, E., Penin, F., Kallis, S., Patel, A.H., Bartenschlager, R., and Pietschmann, T.

(2007). Hepatitis C virus p7 protein is crucial for assembly and release of infectious virions.

PLoS Pathog 3, e103.

Sumpter, R., Loo, Y.-M., Foy, E., Li, K., Yoneyama, M., Fujita, T., Lemon, S.M., and Gale,

M. (2005). Regulating intracellular antiviral defense and permissiveness to hepatitis C virus

RNA replication through a cellular RNA helicase, RIG-I. Journal of virology 79, 2689-2699.

Tan, S.-L. (2006). Hepatitis C viruses: genomes and molecular biology (The Publisher).

Tellinghuisen, T.L., and Rice, C.M. (2002). Interaction between hepatitis C virus proteins

and host cell factors. Current opinion in microbiology 5, 419-427.

Tong, J., Wang, Y.-w., and Lu, Y.-a. (2012). New developments in small molecular

compounds for anti-hepatitis C virus (HCV) therapy. Journal of Zhejiang University

SCIENCE B 13, 56-82.

Trinks, J., Gadano, A., and Argibay, P. (2012). Evolving trends in the hepatitis C virus

molecular epidemiology studies: from the viral sequences to the human genome.

Epidemiology Research International 2012.

UD-DIN, A.M., DIN KHAN, Z.-U., Ahmad, M., AKRAM KASHMIRI, M., Yasmin, S., and

Mazhar, H. (2009). Chemotaxonomic significance of flavonoids in the Solanum nigrum

complex. Journal of the Chilean Chemical Society 54, 486-490.

Vega-Avila, E., Espejo-Serna, A., Alarcón-Aguilar, F., and Velasco-Lezama, R. (2009).

Cytotoxic activity of four Mexican medicinal plants. Paper presented at: Proceedings of the

Western Pharmacology Society.

Vermani, K., and Garg, S. (2002). Herbal medicines for sexually transmitted diseases and

AIDS. Journal of Ethnopharmacology 80, 49-66.

Vijayan, P., Raghu, C., Ashok, G., Dhanaraj, S., and Suresh, B. (2004). Antiviral activity of

medicinal plants of Nilgiris. Indian Journal of Medical Research 120, 24-29.

Wakita, T., Pietschmann, T., Kato, T., Date, T., Miyamoto, M., Zhao, Z., Murthy, K.,

Habermann, A., Kräusslich, H.-G., and Mizokami, M. (2005). Production of infectious

hepatitis C virus in tissue culture from a cloned viral genome. Nature medicine 11, 791-796.

Wang, H.-C., Wu, D.-H., Chang, Y.-C., Li, Y.-J., and Wang, C.-J. (2010). Solanum nigrum

Linn. water extract inhibits metastasis in mouse melanoma cells in vitro and in vivo. Journal

of agricultural and food chemistry 58, 11913-11923.

Wang, X., Zhang, A., and Sun, H. (2013). Recent Advances in Natural Products from Plants

for Treatment of Liver Diseases. European journal of medicinal chemistry.

Yan, F.M., Chen, A.S., Hao, F., Zhao, X.P., Gu, C.H., Zhao, L.B., Yang, D.L., and Hao, L.J.

(2000). Hepatitis C virus may infect extrahepatic tissues in patients with hepatitis C. World

Journal of Gastroenterology 6, 805-811.

99

Yanai, Y., Sanou, O., Kayano, T., Ariyasu, H., Yamamoto, K., Yamauchi, H., Ikegami, H.,

and Kurimoto, M. (2001). Analysis of the antiviral activities of natural IFN-α preparations

and their subtype compositions. Journal of Interferon & Cytokine Research 21, 835-841.

Yi, M., Villanueva, R.A., Thomas, D.L., Wakita, T., and Lemon, S.M. (2006). Production of

infectious genotype 1a hepatitis C virus (Hutchinson strain) in cultured human hepatoma

cells. Proceedings of the National Academy of Sciences of the United States of America 103,

2310-2315.

Zafar, R., and Ali, S. (1998). Cichorium intybus Linn. A review. Hamdard Med 41, 98-109.

Zeuzem, S., Andreone, P., Pol, S., Lawitz, E., Diago, M., Roberts, S., Focaccia, R.,

Younossi, Z., Foster, G.R., and Horban, A. (2011). Telaprevir for retreatment of HCV

infection. New England Journal of Medicine 364, 2417-2428.

Zia-Ul-Haq, M., Shahid, S.A., Muhammed, S., Qayum, M., Khan, I., and Ahmad, S. (2012).

Antimalarial, antiemetic and antidiabetic potential of Grewia asiatica L. leaves. J Med Plants

Res 6, 3213-3216.

Zia-Ul-Haq, M., Stanković, M.S., Rizwan, K., and Feo, V.D. (2013). Grewia asiatica L., a

food plant with multiple uses. Molecules 18, 2663-2682.

100

7. APPENDICES

APPENDIX-I

5x TBE Buffer

Trizma base 54g

Boric acid 27.5g

0.5M EDTA 20mL

Adjust volume to 1 liter with distilled water

6x DNA Loading Dye

Ficoll 20 %

EDTA 0.1M

SDS 1 %

Bromophenol blue 0.25 %

Xylene Cyanol 0.25 %

Protein Extraction Buffer (5mL)

Glycerol 0.5mL

0.5M EDTA 0.4mL (pH 7.5)

5M NaCl 0.15mL

1M TrisCl 0.05mL (pH 7.5)

NH4Cl 26.7mg

DTT 15mg

PMSF 2mM

101

Phosphate Buffered Saline (PBS)

CO 2

NaCl 8 g

KCl 0.2 g

KH2PO40.24 g

Na2HPO4 1.44 g .

Dissolve in 1 liter of distilled water; adjust pH to 7.4 and autoclaved.

1X Tris buffered saline tween 20 TBST

From stock 10X TBS make one liter 1X TB

10X TBS 100 m

dH2O 900 m

Twin 20 1 ml

Phosphate Buffered Saline-Tween 20 (PBST)

Tween-20 500 µL (0.05 %)

Dissolved in 1 liter of 1x PBS

12% separating gel

Water 2.8mL

Acrylamide (30%) 3.2mL

4xTris-SDS 2.5mL (pH8.8)

APS (10 %) 26.7µL

TEMED 5.3µL

102

4% stacking gel

Water 2.5mL

Acrylamide (30%) 0.533mL

4xTris-SDS 1mL (pH6.8)

APS (10 %) 31.5µL

TEMED 6.3µL

10% APS (ammonium per sulphate)

APS 0.1g

Water 1mL

30% Acrylamide

Acrylamide 29gm

Bisacrylamide 1g

dH2O

To make volume 100 ml

10% Sodium dodidyl sulphate SDS

SDS 10g

dH2O 90 ml

5% Skimmed Milk (Blocking Solution)

Skimmed Milk 0.5 g

TBST 10 ml

103

10x Running Buffer

Trizma base 30.05g

Glycine 142.5g

SDS 10g

Dissolve in 1 liter of distilled water

Transfer Buffer

Trizma base 3.032g

Glycine 14.416g

Methanol 200mL

Adjust volume upto 1 liter.

Coomassie Stain

Coomassie blue 2.5g

Methanol 455mL

Glacial acetic acid 91mL

Adjust volume to 1 liter with distilled water.

Coomassie Destain

Methanol 250mL

Glacial acetic acid 70mL

Adjust volume to 1 liter with distilled water.

distilled water.

104

APPENDIX-II

Publications:

Javed, T., Ashfaq, U. A., Riaz, S., Rehman, S., & Riazuddin, S.

(2011). In-vitro antiviral activity of Solanum nigrum against

Hepatitis C Virus. Virol J, 8, 26.

Ashfaq, U. A., Javed, T., Rehman, S., Nawaz, Z., & Riazuddin,

S. (2011). An overview of HCV molecular biology, replication

and immune responses. Virol J,8, 161.

Documents

STUDIES ON THERAPEUTIC POTENTIAL OF MEDICINAL PLANTS