22
Biološki aspekti sudskomedicinske genetike

sudskomedicinske genetike · Sekvenciranje DNK Hibridizacija DNK Preparativne tehnike Centrifugiranje Elektroforeza. PCR amplifikacija Elektroforeza Upoređivanje Zaključivanje Korišćenje

  • Upload
    others

  • View
    13

  • Download
    1

Embed Size (px)

Citation preview

  • Biološki aspekti sudskomedicinske

    genetike

  • Malo bazične biologije

    ◼ Telo je izgrađeno od ćelija

    ◼ U našem telu ima 30x1012 ćelija.

    ◼ Najviše je crvenih krvnih zrnaca (25x1012)

    2,5 x 1013

    2,5 kg

    1,4x1012

    13 kg

    3,3x1012

    10 kg 20 kg

    crvena krvna zrnca trombociti masne ćelije drugo mišići

  • DNK se nalazi u hromozomima

    ◼obmotana oko proteina i višestruko uvijena

  • DNK je smeštena u hromozomima

    1013 ćelija7 pikograma DNK po ćeliji

  • DNK je sastavljena od nukleotida

  • DNK je dvolančani molekul

    ◼ lanci su “polarni” : imaju 3’ i 5’ kraj

    ◼ naspram 3’ kraja jednoglanca je 5’ kraj drugog

    ◼ lanci sadrže “komplementarne” nukleotide:

    – naspram A je T

    – naspram G je C

  • Dve vrste hemijskih veza u DNK

    ◼ Fosfodiesterke veze – između susednih nukleotida

    ◼ Vodonične veze– između naspramnih

    (komplementarnih) nukleotida

  • Pod dejstvom temperature DNK se “topi”- DENATURACIJA

    ◼ dolazi do raskidanja veza između naspramnih nukleotida

    ◼ nastaju jednolančani molekuli

  • Raskidanje fosfodiestarskih veza

    U jednom lancu: nema veze

    U oba lanca: FRAGMENTACIJA

    Na više mesta: DEGRADACIJA

  • DNK je negativno naelektrisana

    ravnomerno, duž čitave dužine oba lanca

  • DNK polimerizacija je:

    usmerena u 5’ → 3’ smeru

    semikonzervativnau novosintetisanom molekulu jedan lanac je stari, a jedan novi.

  • Malo bazične genetike

    ✓DNK nasleđujemo po pola od svakog roditelja

    ✓Naša DNK je identična u svim tkivima

    ✓DNK se ne menja tokom života(ni nakon smrti)

  • Svi smo genetički jedinstveni

    ◼ Humani genom je dugačak 3.2 milijarde nukleotida

    ◼ 99.9% DNK je identična među ljudima

    ◼ Malo matematike0.1% od 3 mldrd ≈ nekoliko miliona nukleotida

  • Osnovna genetička terminologija

    ◼ Genski marker ≈ genki lokus ≈ gen

    – Tačno određeni deo molekula DNK na hromozomu

    ◼ Aleli

    – Različite varijante gena koje mogu postojati

    ◼ DNK profil

    – Kombinacija alela u nizu gena kod neke osobe

  • DNK: polimorfizmi

    Polimorfizam sekvence

    adenin

    timin

    guanin

    citozin

  • DNK polimorfizmi: nastavak

    UzastopnoPonovljene Sekvence2-7 bp=STR10-100=VNTRPolimorfizam broja ponovaka

  • Short Tandem Repeat (STR) Markeri

    TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACAGGTGGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATATCATTGAAAGACAAAACAGAGATGGATGATAGATACATGCTTACAGATGCACAC

    = 12 GATA ponovaka (“12” oznaka alela)

    short tandem repeat

    7 repeats

    8 repeats

    9 repeats

    10 repeats

    11 repeats

    12 repeats

    13 repeats

    Broj ponovaka može da varira između ljudi ali ne i unutar jedne osobe

    An accordion-like DNA sequence that occurs between genes

  • Malo genetike

    ◼ U sudskomedicinskoj genetici se analizira 15-25 gena

    ◼ Isti geni kod različitih ljudi postoje u različitim varijantama- belezima (alelima)

    ◼ Svaki od petnaestak gena postoji u po desetak varijanti

    ◼ Svaki gen postoji u po dve kopije (od majkei od oca).

  • Savremene metode u molekularnoj genetici

  • Koraci u veštačenju biološkog materijala

    Krim. tehnika

    • Uočavanje, dokumentovanje, fiksiranje

    • Izuzimanje, pakovanje i dostavljanje

    Analiza

    • Izolovanje DNK, umnožavanje gena

    • Genotipizacija (utvrđivanje DNK profila)

    Veštačenje

    • Upoređivanje DNK profila

    • Biostatistička analiza i interpretacija

  • Podela tehnikaAnalitičke tehnike

    Izolovanje DNK

    Umnožavanje DNK

    Enzimska digestija DNK

    Rekombinovanje DNK

    Kloniranje DNK

    Sekvenciranje DNK

    Hibridizacija DNK

    Preparativne tehnike

    Centrifugiranje

    Elektroforeza

  • PCR amplifikacija

    Elektroforeza

    Upoređivanje

    Zaključivanje

    Korišćenje forenzički validiranih hemikalija

    Utvrđivanje dužine amplifikovanih fragmenata

    Imenovanje alela

    Sa referentnim uzorkom ili

    bazom

    Frekvencionistički i probabilistički pristup

    Genotipizacija

    Izolacija DNK

    Dobijanje velike količine čiste DNK

    Osnovni koraci u

    savremenoj

    DNK analizi