Supplemental Figure S1. Comparisson of our microarray data ...oru.diva-portal.org/smash/get/diva2:578724/ATTACHMENT02.pdf · 15 At5g23730 RUP 2 0,943 16 At1g06000 UGT89C1 0,953 17

Supplemental Figure S1. Comparisson of our microarray data with previous studies using venn diagrams.

log2FC values in red denotes oposite trend in expression.

A. Overlap between genes regulated by solar UV A+B in Ler with UV-B regulated genes

in wild-type plants (Brown et al., 2005 and Favory et al., 2009)

Ler UV AB Genes regulated by solar UV A+B in Ler after 12 h

Col UVB 6h↓ Genes with decreased expression in Col, UV-B 1.5 µmol m-2 s-1 for 6 h (Favory et al., 2009)

Col UVB 6h↑ Genes with increased expression in Col, UV-B 1.5 µmol m-2 s-1 for 6 h (Favory et al., 2009)

Ler UVB Genes induced in Ler, UV-B 3 µmol m-2 s-1 for 4 h (Brown et al., 2005)

A1. Ler UV AB vs Col UVB 6h↑ Symbol log2FC in our study

1 At5g07990 TT7 3,388

2 At4g04840 MSRB6 2,091

3 At1g65560 F5I14.9 1,551

4 At1g54570 T22H22.2 1,623

5 At5g48880 PKT2 1,733

6 At2g37040 PAL1 1,678

7 At1g06690 F12K11.2 1,080

8 At3g19170 PREP1 0,873

9 At1g36160 ACC1 1,233

10 At3g53260 PAL2 1,412

11 At1g48850 EMB1144 0,792

12 At5g51040 K3K7.22 0,770

13 At1g10522 … 0,831

14 At1g48570 T1N15.19 0,740

15 At1g73990 SPPA 1,101

16 At4g32770 VTE1 0,663

17 At1g12050 F12F1.8 0,710

18 At3g49320 F2K15.180 0,685

19 At3g57180 F15A17.240 0,636

20 At5g48470 MJE7.11 0,745

A2. Ler UV AB vs Col UVB 6h↑ vs Ler UVB

1 At5g62210 MMI9.4 2,212

2 At3g22840 ELIP1 1,678

3 At5g13930 CHS 1,412

4 At4g31870 GPX7 1,519

5 At4g14690 ELIP2 2,952

6 At5g60540 PDX2 1,286

7 At1g78570 RHM1 1,225

8 At5g08640 FLS1 1,470

9 At5g05270 K18I23.7 1,446

10 At3g55120 CHI 1,566

11 At5g17050 UGT78D2 0,999

12 At5g02270 ABCI20 0,900

13 At3g51240 F3H 1,952

14 At5g24850 CRY3 0,851

15 At5g23730 RUP 2 0,943

16 At1g06000 UGT89C1 0,953

17 At5g56090 COX15 0,863

18 At3g16530 MDC8.19 -1,490

19 At4g37760 SQE3 0,635

A3. Ler UV AB vs Ler UVB

1 At5g42800 DFR 1,197

2 At2g18690 MSF3.7 -1,375

3 At1g56060 T6H22.17 -1,660

4 At5g27420 CNI1 -1,412

5 At2g29350 SAG13 -0,844

6 At3g14620 CYP72A8 -1,009

7 At3g55980 SZF1 -1,016

8 At2g38470 WRKY33 -1,420

9 At2g02010 GAD4 -0,705

10 At4g27280 M4I22.90 -1,608

11 At2g18680 MSF3.6 -1,142

B. Overlap between candidate UVR8 regulated genes under solar UV A+B with

UVR8 regulated genes under UV-B (Brown et al., 2005)

uvr8-2 UVAB UVR8 regulated genes by solar UV A+B 12 h

UVR8 UV-B UVR8 regulated genes, UV-B 3 µmol m-2 s-1 for 4 h (Brown et al., 2005)

1 At5g24120 SIG5 1,222

2 At5g02270 ABCI20 0,643

3 At3g56290 F18O21.250 0,694

4 At5g42800 DFR -1,697

5 At1g78510 SPS 0,803

6 At3g17800 MEB5.2 0,922

C. Overlap between candidate UVR8 regulated genes under solar UV A+B with

UVR8 regulated genes under UV-B (Favory et al., 2009)


UVR8 1 h Genes not induced in uvr8-6 after 1 h UV-B (1.5 µmol m-2 s-1)



C1. uvr8-2 UVAB vs UVR8 1 h

1 At5g19240 T24G5.140 -1,107

2 At3g17800 MEB5.2 0,922

3 At1g28480 GRX480 -0,844

4 At3g05800 AIF1 0,741

C2. uvr8-2 UVAB vs UVR8 6 h

1 At4g30650 F17I23.10 -0,662

2 At1g69730 T6C23.7 -0,692

3 At5g01600 FER1 1,308

4 At3g56090 FER3 0,652

C3. uvr8-2 UVAB vs UVR8 1 h vs UVR8 6 h

1 At5g24120 SIG5 1,222

2 At5g18470 T28N17.6 -1,099

3 At1g78510 SPS 0,803

4 At1g19180 JAZ1 -0,795

5 At4g26530 M3E9.40 0,708

6 At3g56290 F18O21.250 0,694

7 At5g02270 ABCI20 0,643

8 At1g67070 PMI2 0,756

D. Overlap between wild type and uvr8-2 gene lists under UV A+B 12 h with

COP1 regulated genes under UV-B and white light (Oravecz et al., 2006)


COP1 UVB COP1 regulated genes under UVB

COP1 WL COP1 regulated genes under white light


D1. uvr8 UV AB vs COP1 UVB

1 At1g28480 GRX480 -0,844

2 At1g78510 SPS 0,803

3 At1g67070 PMI2 0,756

D2. uvr8 UV AB vs COP1 WL

1 At3g28220 T19D11.1 -1,463

2 At5g19240 T24G5.140 -1,107

3 At1g19180 JAZ1 -0,795

D3. uvr8 UV AB vs COP1 UVB vs COP1 WL

1 At5g24120 SIG5 1,222

2 At3g17800 MEB5.2 0,922

3 At3g56290 F18O21.250 0,694

4 At5g01520 F7A740 0,949

D4. Ler UV AB vs COP1 UVB

1 At4g14690 ELIP2 2,952

2 At3g55980 SZF1 -1,016

3 At4g24570 DIC2 -1,619

4 At4g31870 GPX7 1,519

5 At5g17050 UGT78D2 0,999

6 At5g24850 CRY3 0,851

7 At5g62210 MMI9.4 2,212

8 At5g23730 RUP 2 0,943

9 At5g05270 K18I23.7 1,446

10 At5g60540 PDX2 1,286

11 At5g56090 COX15 0,863

12 At3g53260 PAL2 1,412

13 At1g65560 F5I14.9 1,551

14 At5g08640 FLS1 1,470

15 At3g55120 CHI 1,566

16 At4g32770 VTE1 0,663

17 At1g73990 SPPA 1,101

18 At1g06000 UGT89C1 0,953

19 At2g37040 PAL1 1,678

20 At5g13930 CHS 1,412

21 At1g06690 F12K11.2 1,080

D5. Ler UV AB vs COP1 WL

1 At4g37760 SQE3 0,635

D6. Ler UV AB vs COP1 UVB vs COP1 WL

1 At3g22840 ELIP1 1,678

2 At3g51240 F3H 1,952

D7. Ler UV AB vs COP1 UVB vs uvr8 UV AB

1 At5g02270 ABCI20 0,900

E. Overlap between wild type and uvr8-2 gene lists under UV A+B 12 h with

blue light regulated genes (Kleine et al., 2007)



Blue light Blue light regulated genes, 3 h (200 µmol photons m-2 s-1)

E1. Ler UV AB vs Blue light

1 At3g22840 ELIP1 1,678

2 At3g51240 F3H 1,952

3 At5g62210 MMI9.4 2,212

4 At5g23730 RUP 2 0,943

5 At5g17050 UGT78D2 0,999

6 At5g05270 K18I23.7 1,446

7 At4g37760 SQE3 0,635

8 At5g08640 FLS1 1,470

9 At5g07990 TT7 3,388

10 At1g65560 F5I14.9 1,551

11 At4g04840 MSRB6 2,091

12 At4g32770 VTE1 0,663

13 At5g13930 CHS 1,412

14 At4g24570 DIC2 -1,619

15 At1g56060 T6H22.17 -1,660

16 At1g78570 RHM1 1,225

17 At3g14620 CYP72A8 -1,009

18 At3g11930 MEC18.3 0,816

19 At1g13650 F21F23.9 0,819

20 At1g19960 T20H2.25 -0,813

21 At5g48880 PKT2 1,733

22 At4g31870 GPX7 1,519

23 At2g37040 PAL1 1,678

24 At4g14690 ELIP2 2,952

25 At5g60540 PDX2 1,286

26 At1g06690 F12K11.2 1,080

27 At3g55120 CHI 1,566

28 At5g24850 CRY3 0,851

29 At1g06000 UGT89C1 0,953

30 At3g53260 PAL2 1,412

E2. uvr8 UV AB vs Blue light

1 At1g56650 PAP1 -1,484

2 At5g24120 SIG5 1,222

3 At3g56290 F18O21.250 0,694

4 At3g05800 AIF1 0,741

5 At1g78510 SPS 0,803

6 At3g29590 AT5MAT -1,397

7 At3g17800 MEB5.2 0,922

8 At5g01600 FER1 1,308

9 At4g30650 F17I23.10 -0,662

10 At3g56090 FER3 0,652

11 At5g54060 UF3GT -1,529

12 At5g47370 HAT2 -2,976

13 At1g31550 T8E3.19 -0,970

14 At2g14560 LURP1 -0,868

15 At1g19670 CLH1 -1,505

16 At2g28400 T1B3.8 -1,076

17 At1g16850 F6I1.15 -0,848

E3. Ler UV AB vs uvr8 UV AB vs Blue light

1 At5g02270 ABCI20

2 At5g42800 DFR

F. Overlap between wild type and uvr8-2 gene lists under UV A+B 12 h with high

light regulated genes (Kleine et al., 2007)

CRY1 High light regulated genes CRY1 dependent


uvr8 UV AB UVR8 regulated genes by solar UV A+B 12 h

HY5 High light regulated genes HY5 dependent

F1. Ler UV AB vs CRY1 vs HY5

1 At4g14690 ELIP2 2,952

2 At4g31870 GPX7 1,519

3 At5g60540 PDX2 1,286

4 At5g24850 CRY3 0,851

5 At5g56090 COX15 0,863

6 At1g06000 UGT89C1 0,953

7 At2g37040 PAL1 1,678

8 At3g55120 CHI 1,566

9 At5g48880 PKT2 1,733

F2. Ler UV AB vs CRY1

1 At3g22840 ELIP1 1,678

2 At5g62210 MMI9.4 2,212

3 At5g08640 FLS1 1,470

4 At3g51240 F3H 1,952

F3. uvr82 UV AB vs HY5

1 At2g28400 T1B3.8 -1,076

2 At1g16850 F6I1.15 -0,848

3 At3g56400 WRKY70 -0,700

F4. uvr82 UV AB vs CRY1

1 At1g78510 SPS 0,803

2 At1g56650 PAP1 -1,484

F4. Ler UV AB vs uvr82 UV AB vs CRY1

1 At5g02270 ABCI20 0,900

Supplemental Figure S2. (A) Pictures of wild-type (Ler) and uvr8-2 plants

germinated and grown for three weeks outdoors under the UV treatments. Scale

bars = 1 cm. (B) Average number of flowering plants per pot.

Ler

uvr8-2

UV A+BUV AUV 0 A

B

0

1

2

3

4

5

6

UV 0 UV A UV A+B

Ler

uvr8-2

pN

um

be

r o

f la

nts

(λ)

(

−

−

)

Supplemental Figure S3. Spectral irradiance (W m-2 nm-1) under the UV treatments measured with a spectroradiometer Maya2000 Pro during a sunny day at noon.

Supplemental Table S1. Genes regualted by UV in wild-type Ler after 12 hLog2FC(log2 fold change)P (P-value adjusted for multiple testing)

No Gene symbol AGI No log2FC P Description1 MMI9.4 At5g62210 2,212 0,001 Embryo-specific protein 3, (ATS3)2 TT7 At5g07990 3,388 0,001 Required for flavonoid 3' hydroxylase activity3 MSRB6 At4g04840 2,091 0,001 Methionine sulfoxide reductase domain4 ELIP1 At3g22840 1,678 0,003 Encodes an early light-inducible protein5 F5I14.9 At1g65560 1,551 0,004 Zinc-binding dehydrogenase family protein6 T22H22.2 At1g54570 1,623 0,004 Esterase/lipase/thioesterase family protein7 CHS At5g13930 1,412 0,005 Encodes chalcone synthase (CHS)8 LDOX At4g22880 1,383 0,005 Encodes leucoanthocyanidin dioxygenase9 PKT2 At5g48880 1,733 0,005 Peroxisomal 3-keto-acyl-CoA thiolase 2 precursor10 GPX7 At4g31870 1,519 0,005 Encodes glutathione peroxidase11 PAL1 At2g37040 1,678 0,005 Encodes phenylalanine ammonia-lyase12 GSTF2 At4g02520 -1,711 0,008 Glutathione transferase, phi class of GSTs13 ELIP2 At4g14690 2,952 0,008 Encodes an early light-induced protein14 DFR At5g42800 1,197 0,008 Encodes dihydroflavonol reductase15 DIC2 At4g24570 -1,619 0,008 Mitochondrial dicarboxylate carriers (DIC)16 F14P13.5 At3g10350 1,115 0,008 Anion-transporting ATPase family protein17 PDX2 At5g60540 1,286 0,008 Involved in vitamin B6 biosynthesis18 F12K11.2 At1g06690 1,080 0,008 NAD(P)-linked oxidoreductase superfamily protein19 MSF3.7 At2g18690 -1,375 0,011 Unknown protein20 RHM1 At1g78570 1,225 0,013 Involved in the biosynthesis of rhamnose21 FLS1 At5g08640 1,470 0,021 Encodes a flavonol synthase 22 PCR2 At1g14870 -0,940 0,022 Encodes plant cadmium resistance 2 (PCR2)23 K18I23.7 At5g05270 1,446 0,023 chalcone-flavanone isomerase family protein24 CHI At3g55120 1,566 0,023 Catalyzes conversion of chalcones into flavanones25 UGT78D2 At5g17050 0,999 0,024 Encodes a anthocyanidin 3-O-glucosyltransferase 26 ABCI20 At5g02270 0,900 0,024 ATP-BINDING CASSETTE I20 (ABCI20)27 PREP1 At3g19170 0,873 0,025 Zinc metalloprotease pitrilysin subfamily A28 T6H22.17 At1g56060 -1,660 0,025 Unknown protein29 CNI1 At5g27420 -1,412 0,025 Encodes CNI1 (Carbon/Nitrogen Insensitive1)30 F3H At3g51240 1,952 0,025 Encodes flavanone 3-hydroxylase 31 ACC1 At1g36160 1,233 0,025 Encodes acetyl-CoA carboxylase32 F7H19.50 At4g22870 0,882 0,025 oxygenase superfamily protein33 PAL2 At3g53260 1,412 0,026 Encodes phenylalanine ammonia-lyase34 MPK3 At3g45640 -1,145 0,029 Response to UV-B and oxidative stress 35 … At5g26690 -1,177 0,029 Heavy-metal-associated domain-containing protein36 SAG13 At2g29350 -0,844 0,029 Senescence-associated gene SAG13 37 EMB1144 At1g48850 0,792 0,029 Embryo defective 1144 (EMB1144)38 CYP72A8 At3g14620 -1,009 0,029 Putative cytochrome P45039 K3K7.22 At5g51040 0,770 0,032 Unknown protein40 ARL At2g44080 -1,163 0,032 Cell expansion, brassinosteroid signaling pathway41 SZF1 At3g55980 -1,016 0,032 Salt inducible finger 1, transcription factor activity42 ERD13 At2g30870 -0,965 0,032 Early dehydration-induced gene43 PRB1 At2g14580 -2,009 0,029 Ethlylene, jasmonic acid and salycilic acid stimulus44 T20H2.25 At1g19960 -0,813 0,034 Unknown protein45 CRY3 At5g24850 0,851 0,034 Cryptochrome 346 … At1g10522 0,831 0,035 Unknown protein47 ALD1 At2g13810 -1,488 0,037 AGD2-Like defense response protein 1 (ALD1) 48 FAMT At3g44860 -0,792 0,037 farnesoic acid carboxyl-O-methyltransferase49 F1E22.7 At1g65690 -0,913 0,037 Late embryogenesis abundant (LEA) 50 F21F23.9 At1g13650 0,819 0,037 Unknown protein51 PCR1 At1g14880 -0,875 0,037 Plant Cadmium resistance 1 (PCR1)52 F3N23.11 At1g72910 -0,706 0,037 Defense response, signal transduction53 T9J22.6 At2g26390 -0,712 0,037 Serine protease inhibitor (SERPIN) family protein54 F18O19.11 At2g43780 0,726 0,037 Unknown protein55 T1N15.19 At1g48570 0,740 0,037 Zinc finger (Ran-binding) family protein56 MYM9.4 At3g23700 0,868 0,037 Nucleic acid-binding proteins superfamily57 SPPA At1g73990 1,101 0,039 Encodes a putative protease SppA (SppA).58 ISA3 At4g09020 -0,948 0,039 Encodes an isoamylase-like protein59 WRKY33 At2g38470 -1,420 0,043 Member of the plant WRKY transcription factor family60 F13O11.3 At1g64710 -0,962 0,045 GroES-like zinc-binding dehydrogenase family protein61 F24M12.370 At3g51330 -0,822 0,045 Eukaryotic aspartyl protease family protein62 RUP 2 At5g23730 0,943 0,045 Transducin/WD40 repeat-like superfamily protein63 RD22 At5g25610 -0,850 0,045 Responsive to dehydration mediated by ABA64 GRP-3 At2g05520 -0,688 0,045 Encodes a glycine-rich protein 65 PR1 At2g14610 -1,898 0,045 Pathogenesis related gene66 GAD4 At2g02010 -0,705 0,045 Glutamate decarboxylase 4 (GAD4)67 VTE1 At4g32770 0,663 0,045 Tocopherol cyclase 68 GSTF8 At2g47730 -0,651 0,045 Encodes glutathione transferase 69 CSLG2 At4g24000 -1,605 0,045 Encodes a protein similar to cellulose synthase70 T16L1.250 At4g33760 0,644 0,045 tRNA synthetase class II (D, K and N) family protein 71 UGT89C1 At1g06000 0,953 0,045 Encodes a flavonol-7-O-rhamnosyltransferase 72 COX15 At5g56090 0,863 0,045 Cytochrome C Oxidase 1573 F12F1.8 At1g12050 0,710 0,045 Fumarylacetoacetase putative

74 K20I9.8 At3g16850 -0,659 0,046 Pectin lyase-like superfamily protein75 ACYB-2 At4g25570 0,798 0,047 Encodes cytochrome b56176 MDC8.19 At3g16530 -1,490 0,048 Lectin like protein 77 MSN2.11 At5g66720 0,649 0,048 Protein phosphatase 2C family protein78 PME41 At4g02330 -0,780 0,048 Brassinosteroid stimulus, response to cold79 T31J12.3 At1g09310 -0,765 0,048 Unknown protein80 SQE3 At4g37760 0,635 0,049 Squalene epoxidase 3 (SQE3)81 F2K15.180 At3g49320 0,685 0,049 Metal-dependent protein hydrolase82 MEC18.3 At3g11930 0,816 0,049 Adenine nucleotide alpha hydrolases-like protein83 M4I22.90 At4g27280 -1,608 0,050 Calcium-binding EF-hand family protein84 NADP-ME2 At5g11670 -0,813 0,049 Encodes NADP-MALIC enzyme 2 85 MHJ24.1 At5g64170 -0,636 0,050 Dentin sialophosphoprotein-related86 GLX2-5 At2g31350 -0,620 0,050 Encodes a mitochondrial glyoxalase 2 87 MSF3.6 At2g18680 -1,142 0,050 Unknown protein88 TOM5 At5g08040 0,616 0,050 Mitochondrial import receptor subunit TOM5 homolog89 BG3 At3g57240 -1,388 0,050 Encodes a member of glycosyl hydrolase family 1790 MNB8.3 At5g52970 0,643 0,050 Thylakoid lumen 15.0 kDa protein91 F15A17.240 At5g03210 -0,870 0,050 Unknown protein92 F15A17.240 At3g57180 0,636 0,050 Brassinazole Insensitive Pale Green 293 T20F21.27 At2g35710 -0,912 0,053 Nucleotide-diphospho-sugar transferase94 MJE7.11 At5g48470 0,745 0,050 Unknown protein95 MZN24.8 At3g21940 0,633 0,050 Receptor protein kinase-related96 SEX4 At5g46230 -0,660 0,050 Protein phosphatase

Supplemental Table S2. Genes regualted by UV in uvr8-2 after 12hLogFC(log2 fold change)P (P-value adjusted for multiple testing)

No Gene symbol AGI No logFC P Description1 CLH1 At1g19670 -1,505 0,02 Chlorophyll degradation2 T19D11.1 At3g28220 -1,463 0,02 TRAF-like family protein3 LDOX At4g22880 -1,700 0,02 Encodes leucoanthocyanidin dioxygenase4 T1B3.8 At2g28400 -1,076 0,02 Protein of unknown function5 WAK1 At1g21250 -1,016 0,02 Cell wall-associated kinase, involved in signaling and SA stimulus6 SIG5 At5g24120 1,222 0,02 Sigma factor, response to blue, red and far red light 7 DFR At5g42800 -1,697 0,02 Encodes dihydroflavonol reductase8 T24G5.140 At5g19240 -1,107 0,02 Glycoprotein membrane precursor GPI-anchored9 F12E4.80 At5g03350 -1,322 0,02 Legume lectin family protein10 AOS At5g42650 -1,059 0,02 p450 CYP74 gene family that functions as an allene oxide synthase11 T28N17.6 At5g18470 -1,099 0,02 Curculin-like (mannose-binding) lectin family protein12 ANNAT1 At1g35720 -0,997 0,02 Encodes a member of the annexin gene family, response to stress 13 ATR4 At4g31500 -0,965 0,02 Involved in the biosynthetic pathway of glucosinolates14 ANK At5g54610 -1,228 0,03 Belongs to the ankyrin repeat protein family, response to SA stimulus15 XPL1 At3g18000 0,844 0,03 N-methyltransferase-like protein, lipid biosynthesis and reproduction 16 RLK At2g37710 -0,943 0,03 Receptor lectin kinase, phosphorilation, response to SA stimulus17 MEB5.2 At3g17800 0,922 0,03 Response to UV-B18 T1P17.80 At4g12490 -0,918 0,03 defence response to fungus19 GRX480 At1g28480 -0,844 0,04 Glutaredoxin family, involved in SA/JA signaling pathways20 AT5MAT At3g29590 -1,397 0,04 anthocyanidin 5-O-glucoside-6"-O-malonyltransferase 21 LHT7 At4g35180 -0,832 0,04 Lys/His transporter 7 22 MXO21.9 At3g29240 -0,813 0,04 Protein of unknown function23 T6J4.20 At1g13470 -0,964 0,04 Protein of unknown function24 SPS At1g78510 0,803 0,04 Solanesyl diphosphate synthase activity25 FAMT At3g44860 -0,873 0,04 Encodes farnesoic acid carboxyl-O-methyltransferase26 F7H19.50 At4g22870 -1,388 0,04 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase protein27 F4L23.31 At2g45180 0,941 0,04 Bifunctional inhibitor/lipid-transfer protein28 F14D7.1 At1g35710 -1,127 0,04 Protein kinase family protein with leucine-rich repeat domain29 LURP1 At2g14560 -0,868 0,04 Response to Hyaloperonospora parasitica30 T22A6.310 At4g24480 3,502 0,04 Protein kinase 31 GRP19 At5g07550 3,452 0,04 Glycine rich protein 19, lipid storage and sexual reproduction32 F12K8.24 At1g22410 -0,721 0,05 Class-II DAHP synthetase family protein33 AOC1 At3g25760 -0,776 0,05 Encodes allene oxide cyclase, jasmonic acid biosynthesis34 AGP21 At1g55330 1,021 0,05 Encodes a putative arabinogalactan-protein (AGP21)35 JAZ1 At1g19180 -0,795 0,05 Jasmonate-Zim-Domain protein 1, involved in defence response36 M3E9.40 At4g26530 0,708 0,05 Aldolase superfamily protein37 AOC3 At3g25780 -0,997 0,05 Involved in jasmonic acid biosynthesis38 PPa5 At4g01480 -0,777 0,05 Encodes a protein that might have inorganic pyrophosphatase activity39 XBAT34 At4g14365 -0,990 0,05 Zinc ion binding protein40 T16B24.15 At2g39210 -0,768 0,05 Major facilitator superfamily protein41 UF3GT At5g54060 -1,529 0,05 UDP-glucose:flavonoid 3-o-glucosyltransferase42 T8E3.19 At1g31550 -0,970 0,05 GDSL-like Lipase/Acylhydrolase superfamily protein43 F21A20.190 At5g27480 -3,179 0,05 transposable element gene44 HAT2 At5g47370 -2,976 0,05 Auxin mediated signaling pathway45 DL4760C At4g17450 2,927 0,05 Transposable element gene46 ERD13 At2g30870 -0,697 0,05 Early dehydration-induced gene , response to water deprivation47 SYR1 At3g11820 -0,780 0,05 Defence response, JA mediating signaling pathway48 T3K9.5 At2g41180 -0,882 0,05 Protein of unknown function49 SIB1 At3g56710 -0,856 0,05 SIGMA FACTOR BINDING PROTEIN 1 (SIB1)50 F15K19.1, At2g10940 0,783 0,05 Bifunctional inhibitor/lipid-transfer protein51 F6I1.15 At1g16850 -0,848 0,05 Response to salt stress52 T3K9.14 At2g41090 -0,765 0,05 Calcium-binding EF-hand family protein53 F21M11.2 At1g04040 0,872 0,05 HAD superfamily54 DL4760C At4g17450 2,927 0,05 transposable element gene55 F6H5.8 At3g32220 2,788 0,06 Gypsy-like retrotransposon family 56 HPL1 At4g15440 -1,085 0,06 HYDROPEROXIDE LYASE 1 (HPL1), response to wounding57 AIF1 At3g05800 0,741 0,06 Brassinosteroid mediated signaling pathway58 MES5 At5g10300 -0,746 0,06 METHYL ESTERASE 5 (MES5)59 PAP1 At1g56650 -1,484 0,06 PRODUCTION OF ANTHOCYANIN PIGMENT 1 (PAP1)60 WRKY70 At3g56400 -0,700 0,06 WRKY DNA-BINDING PROTEIN 70 (WRKY70), defence response61 F18O21.250 At3g56290 0,694 0,06 Protein of unknown function62 F7A740 At5g01520 0,949 0,06 RING/U-box superfamily protein involved in zinc ion binding63 T24G5.150 At5g19250 -0,630 0,06 Protein of unknown function64 F17I23.10 At4g30650 -0,662 0,06 Low temperature and salt responsive protein, defence response65 ABCI20 At5g02270 0,643 0,06 ATP-BINDING CASSETTE I20 (ABCI20)66 At5g26690 -0,833 0,06 Heavy metal transport/detoxification superfamily protein67 MKK4 At1g51660 -0,636 0,06 Mitogen-activated map kinase, defence response68 SOT17 At1g18590 -0,615 0,06 SULFOTRANSFERASE 17, glucosinolate core structure biosynthesis69 F6N7.24 At5g52750 -0,836 0,06 Heavy metal transport/detoxification superfamily protein

70 T6C23.7 At1g69730 -0,692 0,06 Wall-associated kinase family protein71 T32A17.160 At4g08850 -0,830 0,06 Leucine-rich repeat receptor-like protein kinase family protein72 F28O16.9 At1g76720 0,652 0,06 eukaryotic translation initiation factor 2 (eIF-2) family protein73 F6H5.8 At3g32220 2,788 0,06 transposable element gene74 F12F1.28 At1g11880 2,457 0,07 GPI anchor biosynthetic process, lipid biosynthetic processes75 LCR27 At4g29300 2,393 0,07 Protein of unknown function76 F1M20.12 At1g74440 -0,642 0,07 Protein of unknown function77 AGP31 At1g28290 0,935 0,07 ARABINOGALACTAN PROTEIN 31, response to JA stimulus78 FER1 At5g01600 1,308 0,07 FERRETIN 1 (FER1), response to ROS79 FER3 At3g56090 0,652 0,07 FERRITIN 3 (FER3), response to ROS80 UCP5 At2g22500 -0,660 0,07 Uncoupling protein 581 IGMT5 At1g76790 -0,906 0,07 INDOLE GLUCOSINOLATE O-METHYLTRANSFERASE 5 (IGMT5)82 JR1 At3g16470 -0,758 0,07 JASMONATE RESPONSIVE 1 (JR1), response to abiotic stress83 PMI2 At1g67070 0,756 0,07 L-ascorbic acid biosynthesis84 BTS At3g18290 -0,631 0,07 E3 ligase protein with metal ion binding and DNA binding domains85 PRXCB At3g49120 -0,674 0,07 PEROXIDASE CB, defence response to bacteria and fungus86 ATPCB At3g49120 -0,674 0,07 Defence response to bacterium and fungus87 OPR3 At2g06050 -0,799 0,07 Jasmonic acid biosynthesis process88 T7N9.9 At1g27030 -0,749 0,07 Protein of unknown function89 ATPLC1 At5g58670 -0,657 0,07 Stress response, ABA mediated signaling pathway

Supplemental Table S3. Detailed information on experiments represented in the Bayesian cluster (Fig. 1)

Experiment Annotation Treatment UV-BBE Reference

Col-0 MeJA 6 h EATMX-13 50 µM methyl jasmonate 1

Col-0 MeJA 30 min EATMX-13 50 µM methyl jasmonate 1

Col-0 MeJA 2 h EATMX-13 50 µM methyl jasmonate 1

Col-0 ABA 30 min NASCARRAYS-176 10 µM abscisic acid 30 min 7

Col-0 ABA 1 h NASCARRAYS-176 10 µM abscisic acid 1 h 7

cop1-4 305 nm 15 min E-MEXP-557 Broadband UVB (305 nm cut-off) 0.12 Wm2 2

WS 305 nm 6 h E-MEXP-550 Broadband UVB (305 nm cut-off) 0.12 Wm2 3


uvr8-6 305 nm 1 h E-MEXP-1957 Narrowband UVB (305 nm cut-off) 1.5 µmol m-2 s-1 4

Col-0 unfiltered UV lamps 15 min NASCARRAYS-137 Broadband UVB 15 min 1.18 Wm2 NA

uvr8-6 305 nm 6h E-MEXP-1957 Narrowband UVB (305 nm cut-off) 1.5 µmol m-2 s-1 4

Col-0 SA 24 h GSE14961 2mM salicylic acid 24 h NA

Col-0 Ethylene 4 h GSE14247 Ethylene gas 10 ppm 5

Col-0 BTH 8 h NASCARRAYS-392 60 µM BTH 8 h NA

WS unfiltered UV lamps 6 h E-MEXP-550 Broadband UVB (unfiltered) 1.18 Wm2 3

Col-0 unfiltered UV lamps 15 min harvested 3 h NASCARRAYS-144 Broadband UVB 15 min 1.18 Wm2 6


Ler 305 nm 15 min E-MEXP-557 Narrowband UVB (305 nm cut-off) 0.12 Wm2 2

Col-0 305 nm 15 min E-MEXP-557 Narrowband UVB (305 nm cut-off) 0.12 Wm2 2


Col-0 305 nm 1 h E-MEXP-1957 Narrowband UVB (305 nm cut-off) 1.5 µmol m-2 s-1 4

Col-0 305 nm 6 h E-MEXP-1957 Narrowband UVB (305 nm cut-off) 1.5 µmol m-2 s-1 4

hy5 305 nm 15 min E-MEXP-557 Broadband UVB (305 nm cut-off) 0.12 Wm2 2

WS unfiltered UV lamps 1 h E-MEXP-550 Broadband UVB (unfiltered) 1.18 Wm2 3



Col-0 unfiltered UV lamps 15 min harvested 30 min NASCARRAYS-144 Broadband UVB 15 min 1.18 Wm2 6

Col-0 ABA 3 h NASCARRAYS-176 10 µM abscisic acid 3 h 7

Col-0 SA 3 h NASCARRAYS-192 10 µM salicylic acid 3 h NA



Reference

Pauwels et al (2008) Proc Natl Acad Sci USA 105: 1380-1385 1

Oravecz et al (2006) Plant Cell 18: 1975–1990 2

Ulm et al (2004) Proc Natl Acad Sci USA 101: 1397–1402 3

Favory et al (2009) EMBO J 28: 591–601 4

Qiao et al (2009) Genes Dev 23: 512-21 5

Kilian et al (2007) Plant J 50 :347-363 6

Goda et al (2008) Plant J 55: 526-542 7

Non available NA

Supplemental Table S4. Detailed information on genes represented in the Bayesian cluster (Fig. 1).

Genes shown in Fig. 1 as they appear from left to right. The fold change induction in wild-type and uvr8-2

with the corresponding P value and the cluster they group are also given

Wild-type uvr8-2

No AGI code LogFc P LogFc P Cluster

1 At5g64170 -0,64 0,05 I

2 At5g62210 2,21 0,001 I

3 At5g60540 1,29 0,01 I

4 At5g54060 -1,53 0,05 I

5 At5g52970 0,64 0,05 I

6 At5g51040 0,77 0,03 I

7 At5g48880 1,73 0,01 I

8 At5g48470 0,74 0,05 I

9 At5g42800 1,20 0,01 -1,70 0,02 I

10 At5g42650 -1,06 0,02 I

11 At5g25610 -0,85 0,04 I

12 At5g24850 0,85 0,03 I

13 At5g23730 0,94 0,04 I

14 At5g19250 -0,63 0,06 I

15 At5g17050 1,00 0,02 I

16 At5g13930 1,41 0,005 I

17 At5g11670 -0,81 0,05 I

18 At5g08640 1,47 0,02 I

19 At5g08040 0,62 0,05 I

20 At5g07990 3,39 0,001 I

21 At5g07550 3,45 0,04 I

22 At5g05270 1,45 0,02 I

23 At5g03210 -0,87 0,05 I

24 At5g02270 0,90 0,02 0,64 0,06 I

25 At5g01600 1,31 0,07 I

26 At5g01520 0,95 0,06 I

27 At4g37760 0,63 0,05 I

28 At4g33760 0,64 0,04 I

29 At4g32770 0,66 0,04 I

30 At4g30650 -0,66 0,06 I

31 At4g26530 0,71 0,05 I

32 At4g25570 0,80 0,05 I

33 At4g24570 -1,62 0,01 I

34 At4g24480 3,50 0,04 I

35 At4g24000 -1,61 0,04 I

36 At4g15440 -1,08 0,06 I

37 At4g12490 -0,92 0,03 I

38 At4g09020 -0,95 0,04 I

39 At4g04840 2,09 0,001 I

40 At4g02330 -0,78 0,05 I

41 At4g01480 -0,78 0,05 I

42 At3g57180 0,64 0,05 I

43 At3g56290 0,69 0,06 I

44 At3g56090 0,65 0,07 I

45 At3g55120 1,57 0,02 I

46 At3g53260 1,41 0,03 I

47 At3g52180 -0,66 0,05 I

48 At3g51330 -0,82 0,04 I

49 At3g49320 0,68 0,05 I

50 At3g45640 -1,14 0,03 I

51 At3g32220 2,79 0,06 I

52 At3g29590 -1,40 0,04 I

53 At3g29240 -0,81 0,04 I

54 At3g23700 0,87 0,04 I

55 At3g19170 0,87 0,02 I

56 At3g18290 -0,63 0,07 I

57 At3g18000 0,84 0,03 I

58 At3g17800 0,92 0,03 I

59 At3g16850 -0,66 0,05 I

60 At3g16470 -0,76 0,07 I

61 At3g11930 0,82 0,05 I

62 At3g10350 1,11 0,01 I

63 At3g05800 0,74 0,06 I

64 At2g45180 0,94 0,04 I

65 At2g44080 -1,16 0,03 I

66 At2g43780 0,73 0,04 I

67 At2g41090 -0,77 0,05 I

68 At2g35710 -0,91 0,05 I

69 At2g31350 -0,62 0,05 I

70 At2g30870 -0,96 0,03 -0,70 0,05 I

71 At2g26390 -0,71 0,04 I

72 At2g14580 -2,01 0,03 I

73 At2g13810 -1,49 0,04 I

74 At2g10940 0,78 0,05 I

75 At2g05520 -0,69 0,04 I

76 At1g78570 1,23 0,01 I

77 At1g78510 0,80 0,04 I

78 At1g76790 -0,91 0,07 I

79 At1g74440 -0,64 0,07 I

80 At1g73990 1,10 0,04 I

81 At1g69730 -0,69 0,06 I

82 At1g67070 0,76 0,07 I

83 At1g64710 -0,96 0,04 I

84 At1g56650 -1,48 0,06 I

85 At1g55330 1,02 0,05 I

86 At1g54570 1,62 0,00 I

87 At1g48850 0,79 0,03 I

88 At1g48570 0,74 0,04 I

89 At1g36160 1,23 0,03 I

90 At1g35720 -1,00 0,02 I

91 At1g35710 -1,13 0,04 I

92 At1g31550 -0,97 0,05 I

93 At1g28290 0,93 0,07 I

94 At1g22410 -0,72 0,05 I

95 At1g19670 -1,51 0,02 I

96 At1g18590 -0,61 0,06 I

97 At1g16850 -0,85 0,05 I

98 At1g13650 0,82 0,04 I

99 At1g12050 0,71 0,05 I

100 At1g10522 0,83 0,04 I

101 At1g09310 -0,76 0,05 I

102 At1g06690 1,08 0,01 I

103 At1g04040 0,87 0,05 I

104 At1g06000 0,95 0,04 I

105 At5g56090 0,86 0,05 II

106 At5g54610 -1,23 0,03 II

107 At5g52750 -0,84 0,06 II

108 At5g27420 -1,41 0,02 II

109 At5g24120 1,22 0,02 II

110 At5g19240 -1,11 0,02 II

111 At5g18470 -1,10 0,02 II

112 At5g10300 -0,75 0,06 II

113 At5g03350 -1,32 0,02 II

114 At4g35180 -0,83 0,04 II

115 At4g31870 1,52 0,01 II

116 At4g31500 -0,96 0,02 II

117 At4g27280 -1,61 0,05 II

118 At4g14690 2,95 0,008 II

119 At4g14365 -0,99 0,05 II

120 At4g08850 -0,83 0,06 II

121 At3g57240 -1,39 0,05 II

122 At3g56710 -0,86 0,05 II

123 At3g56400 -0,70 0,06 II

124 At3g55980 -1,02 0,03 II

125 At3g51240 1,95 0,02 II

126 At3g28220 -1,46 0,02 II

127 At3g25780 -1,00 0,05 II

128 At3g22840 1,68 0,00 II

129 At3g16530 -1,49 0,05 II

130 At3g14620 -1,01 0,03 II

131 At3g11820 -0,78 0,05 II

132 At2g47730 -0,65 0,04 II

133 At2g41180 -0,88 0,05 II

134 At2g39210 -0,77 0,05 II

135 At2g38470 -1,42 0,04 II

136 At2g37710 -0,94 0,03 II

137 At2g37040 1,68 0,01 II

138 At2g29350 -0,84 0,03 II

139 At2g28400 -1,076 0,022 II

140 At2g22500 -0,660 0,070 II

141 At2g18690 -1,38 0,01 II

142 At2g18680 -1,14 0,05 II

143 At2g14610 -1,90 0,04 II

144 At2g14560 -0,868 0,043 II

145 At1g65690 -0,91 0,04 II

146 At1g65560 1,55 0,004 II

147 At1g56060 -1,66 0,02 II

148 At1g51660 -0,636 0,061 II

149 At1g28480 -0,84 0,04 II

150 At1g21250 -1,016 0,022 II

151 At1g19960 -0,81 0,03 -0,647 0,070 II

152 At1g13470 -0,964 0,039 II

153 At1g19180 -0,80 0,05 II

Supplemental Table S5. Summary of the ANOVA models used to estimate significant effects of the UV treatments,

genotype and the interaction UV treatment × genotype.

denDF (denominator degrees of freedom).

A. Gene expression measured by qPCR in Ler and uvr8-2 after 12 h and 36 h outdoors (denDF=10).

CHS 12 h 36 h

Source DF F P DF F P

UV treatment 2 172.67011 0.0001 2 13.054 0.2684

Genotype 1 2.37137 0.1546 1 194.572 0.0192

UV treatment × Genotype 2 4.37365 0.0432 2 0.508 0.8539

TT7 12 h 36 h


UV treatment 2 444.3359 <.0001 2 1.1729722 0.3486

Genotype 1 0.0396 0.8463 1 0.4131218 0.5348


HY5 12 h 36 h


UV treatment 2 69.74710 <.0001 2 0.869357 0.4486

Genotype 1 59.72127 <.0001 1 1.474632 0.2525


COP1 12 h 36 h


UV treatment 2 0.7669407 0.4899 2 0.243269 0.7891

Genotype 1 1.2245187 0.2944 1 4.578354 0.0611


RUP2 12 h 36 h


UV treatment 2 101.24126 <.0001 2 8.129416 0.0080

Genotype 1 21.70823 0.0009 1 7.619618 0.0201


MEB5.2 12 h 36 h


UV treatment 2 64.14824 <.0001 2 2.445116 0.1366

Genotype 1 21.23567 0.0010 1 6.776489 0.0263


UVR8 12 h 36 h


UV treatment 2 2.826950 0.1064 2 0.8664652 0.4497

Genotype 1 1.575138 0.2380 1 1.0666859 0.3260


PDF1.2 12 h 36 h


UV treatment 2 1.572442 0.2548 2 0.443872 0.6536

Genotype 1 26.035006 0.0005 1 5.800154 0.0368


PAD3 12 h 36 h


UV treatment 2 14.253639 0.0012 2 3.0009916 0.0953

Genotype 1 9.400364 0.0119 1 1.4275832 0.2597


RCD1 12 h 36 h


UV treatment 2 2.045437 0.1800 2 0.04520444 0.9560

Genotype 1 4.851114 0.0522 1 0.00027605 0.9871


TAT3 12 h 36 h


UV treatment 2 23.57744 0.0002 2 1.089156 0.3733

Genotype 1 37.26773 0.0001 1 4.181907 0.0681


AOXI 12 h 36 h


UV treatment 2 2.0943858 0.1739 2 1.780232 0.2181

Genotype 1 1.3606367 0.2705 1 5.055030 0.0483


VSP1 12 h 36 h


UV treatment 2 3.957300 0.0542 2 0.347251 0.7148

Genotype 1 0.640493 0.4421 1 0.305930 0.5923


ATR4 12 h 36 h


UV treatment 2 24.01473 0.0002 2 4.861912 0.0335

Genotype 1 43.75311 0.0001 1 11.577140 0.0067


LOX 12 h 36 h


UV treatment 2 31.165994 0.0001 2 3.150325 0.0869

Genotype 1 19.480321 0.0013 1 3.069358 0.1103


AOC3 12 h 36 h


UV treatment 2 36.00602 <.0001 2 3.618573 0.0657

Genotype 1 15.22165 0.003 1 1.638847 0.2294


NCED3 12 h 36 h


UV treatment 2 3.651143 0.0645 2 0.9178747 0.4305

Genotype 1 0.408353 0.5372 1 0.2800938 0.6082


AOS 12 h 36 h


UV treatment 2 20.857260 0.0003 2 1.862785 0.2053

Genotype 1 13.066562 0.0047 1 3.264195 0.1009


PMI2 12 h 36 h


UV treatment 2 7.962940 0.0085 2 6.479813 0.0157

Genotype 1 12.462489 0.0054 1 3.553708 0.0888


AIF1 12 h 36 h


UV treatment 2 16.75070 0.0006 2 0.6875362 0.5251

Genotype 1 31.71697 0.0002 1 0.0684003 0.7990


SIG5 12 h 36 h


UV treatment 2 101.83965 <.0001 2 2.927703 0.0998

Genotype 1 122.27431 <.0001 1 5.332916 0.0436

UV treatment × Genotype 2 43.89081 <.0001 2 0.965454 0.4136

SPS 12 h 36 h


UV treatment 2 99.66862 <.0001 2 4.662555 0.0371

Genotype 1 52.16762 <.0001 1 10.761346 0.0083


CLH1 12 h 36 h


UV treatment 2 2.684271 0.1166 2 1.454934 0.2789

Genotype 1 22.149208 0.0008 1 3.846601 0.0783


At5g01520 12 h 36 h


UV treatment 2 251.61130 <.0001 2 5.696182 0.0223

Genotype 1 99.87390 <.0001 1 0.013494 0.9098


DFR 12 h 36 h


UV treatment 2 7.106523 0.0120 2 1.313898 0.3114

Genotype 1 22.274154 0.0008 1 4.309583 0.0646


STO 12 h 36 h


UV treatment 2 1.807759 0.2137 2 2.3272456 0.1480

Genotype 1 3.331994 0.0979 1 1.8656667 0.2019


GRX480 12 h 36 h


UV treatment 2 6.45797 0.0158 2 2.0846935 0.1751

Genotype 1 32.45098 0.0002 1 0.0073179 0.9335


B. Gene expression measured by qPCR in Ler and uvr8-2 after three weeks (denDF=8).

CHS

Source DF F P

UV treatment 2 0.705172 0.5223

Genotype 1 7.048953 0.0290

UV treatment × Genotype 2 0.165677 0.8502

HAT2

Source DF F P

UV treatment 2 19.19738 0.0009

Genotype 1 58.57053 0.0001


AOC3

Source DF F P

UV treatment 2 1.0097451 0.4064

Genotype 1 0.0730799 0.7937


RUP2

Source DF F P

UV treatment 2 72.54591 <.0001

Genotype 1 161.54599 <.0001


ATR4

Source DF F P

UV treatment 2 0.4836175 0.6335

Genotype 1 0.0402518 0.8460


HY5

Source DF F P

UV treatment 2 0.6946817 0.5270

Genotype 1 0.9297521 0.3632


LOX

Source DF F P

UV treatment 2 2.307673 0.1617

Genotype 1 1.425468 0.2667


TAT3

Source DF F P

UV treatment 2 0.9103042 0.4404

Genotype 1 0.9489398 0.3585


WRKY70

Source DF F P

UV treatment 2 1.112379 0.3748

Genotype 1 4.738432 0.0512


AOS

Source DF F P

UV treatment 2 1.4495494 0.2903

Genotype 1 0.4679975 0.5132


JAZ1

Source DF F P

UV treatment 2 1.053498 0.3925

Genotype 1 10.255788 0.0126


PR1

Source DF F P

UV treatment 2 0.1834873 0.8358

Genotype 1 1.3563665 0.2777


DFR

Source DF F P

UV treatment 2 0.071083 0.9320

Genotype 1 3.839792 0.0857


GRX480

Source DF F P

UV treatment 2 1.738338 0.2361

Genotype 1 12.543766 0.0076


PMI2

Source DF F P

UV treatment 2 0.453038 0.6510

Genotype 1 5.871699 0.0416


C. Accumulation of PDX1 measured by western blot in Ler and uvr8-2 after 12 h and 36 h (denDF=25).

12 h 36 h


UV treatment 2 20.876 <.0001 2 33.076 <.0001

Genotype 1 0.015 0.90 1 33.230 <.0001


D. Metabolites detected by UPLC-MS7MS in Ler and uvr8-2 after 12 h and 36 h (denDF=19).

Phe 12 h 36 h


UV treatment 2 3.8400 0.0398 2 1.71566 0.2053

Genotype 1 6.6619 0.0183 1 9.20459 0.0066


Q-3-N-7-Rha 12 h 36 h


UV treatment 2 18.95817 <.0001 2 45.59767 <.0001

Genotype 1 12.05807 0.0025 1 0.00116 0.9731


K-3-O-S-7-O-Glu 12 h 36 h


UV treatment 2 27.14600 <.0001 2 30.82153 <.0001

Genotype 1 44.83310 <.0001 1 0.14295 0.7094


K-NeoHes-3-R-7 12 h 36 h


UV treatment 2 1.4083 0.2690 2 2.71580 0.0905

Genotype 1 3.9648 0.0610 1 2.22179 0.1517


Chlorogenic acid 12 h 36 h


UV treatment 2 38.09202 <.0001 2 6.25680 0.0078

Genotype 1 15.63075 0.0009 1 1.98548 0.1742


Q-3-R-7-Rha 12 h 36 h


UV treatment 2 36.78064 <.0001 2 43.46911 <.0001

Genotype 1 3.79848 0.0662 1 2.99556 0.0989


K-3-S-Rha-7 12 h 36 h


UV treatment 2 0.34514 0.7125 2 2.96065 0.0748

Genotype 1 0.32094 0.5777 1 0.02211 0.8833


K-3-R 12 h 36 h


UV treatment 2 19.1814 <.0001 2 7.36691 0.0040

Genotype 1 4.3731 0.0502 1 0.81953 0.3761


Q-3-(O)-Rha 12 h 36 h


UV treatment 2 6.07237 0.0091 2 27.14106 <.0001

Genotype 1 0.18800 0.6695 1 0.58472 0.4534


IsoRha-3-O-G-7-O-Rha 12 h 36 h


UV treatment 2 1.08687 0.3584 2 14.11396 0.0002

Genotype 1 10.76918 0.0041 1 11.77962 0.0026


Q-3-Glu 12 h 36 h


UV treatment 2 42.44323 <.0001 2 152.4937 <.0001

Genotype 1 0.68743 0.4179 1 0.0093 0.9243

UV treatment × Genotype 2 0.02636 0.9740 2 18.4070 <.0001

K-R-3-Rha-7 12 h 36 h


UV treatment 2 1.63453 0.2213 2 7.5955 0.0035

Genotype 1 0.11850 0.7344 1 0.2442 0.6266


K-Rha-3-Rha-7 12 h 36 h


UV treatment 2 6.6916 0.0063 2 1.48005 0.2515

Genotype 1 13.3209 0.0017 1 3.28729 0.0849


K-3-O-Glu 12 h 36 h


UV treatment 2 18.9103 <.0001 2 7.83289 0.0031

Genotype 1 10.1016 0.0049 1 0.42455 0.5221


Quercetin 12 h 36 h


UV treatment 2 1.89637 0.1824 2 18.3129 <.0001

Genotype 1 1.75363 0.2040 1 3.9363 0.0611


Kaempferol 12 h 36 h


UV treatment 2 1.2688 0.3051 2 2.6233 0.0973

Genotype 1 2.8760 0.1071 1 0.8762 0.3604


Unidentified 12 h 36 h


UV treatment 2 75.90047 <.0001 2 75.90047 <.0001

Genotype 1 89.48351 <.0001 1 89.48351 <.0001

UV treatment × Genotype 2 95.07576 <.0001 2 95.07576 <.0001

Tyr 12 h 36 h


UV treatment 2 14.00537 0.0002 2 3.53442 0.0485

Genotype 1 6.83222 0.0171 1 9.49409 0.0059


Trp 12 h 36 h


UV treatment 2 0.51007 0.6084 2 6.02226 0.0090

Genotype 1 0.40881 0.5302 1 7.01633 0.0154


Kynurenic acid 12 h 36 h


UV treatment 2 5.77605 0.0110 2 2.239983 0.1325

Genotype 1 2.56312 0.1259 1 0.347514 0.5621


12-hydroxy jasmonic acid 12-hexose 12 h 36 h


UV treatment 2 4.12653 0.0335 2 12.18607 0.0003

Genotype 1 1.02588 0.3246 1 2.25228 0.1490


p -Coumaric acid 12 h 36 h


UV treatment 2 1.96780 0.1687 2 1.71208 0.2059

Genotype 1 5.84046 0.0265 1 2.45639 0.1327


Sinapic acid 12 h 36 h


UV treatment 2 0.89987 0.4233 2 4.4136 0.0258

Genotype 1 8.75732 0.0081 1 4.3017 0.0512


Ferulic acid hexose 12 h 36 h


UV treatment 2 3.99542 0.0356 2 9.3332 0.0014

Genotype 1 5.12293 0.0355 1 2.6787 0.1173


Camalexin 12 h 36 h


UV treatment 2 14.98064 0.0001 2 7.258467 0.0043

Genotype 1 5.32285 0.0325 1 1.915437 0.1816


E. Optical measurements in Ler and uvr8-2 after 50 h (denDF=13).

Chlorophyll (SPAD)

Source DF F P

UV treatment 2 1.246 0.3198

Genotype 1 21.312 0.0005


HCA (Dualex 315nm)

Source DF F P

UV treatment 2 159.544 <.0001

Genotype 1 36.246 <.0001


Flavonoids (Dualex 375nm)

Source DF F P

UV treatment 2 91.3896 <.0001

Genotype 1 68.5581 <.0001


E. Number of flowering plants counted after three weeks (denDF=16).

Source DF F P

UV treatment 2 4.29182 0.0322

Genotype 1 16.80043 <.001


Supplemental Table S6. Tests of significance of effects of the UV treatments on gene expression,

accumulation of PDX1 and metabolites, and optical measurements.

A1, A2, A3, and A4. P values for the comparisons between the UV treatments.

Contrasts amongst individual treatments were fitted within genotypes when the interaction UV Treatment x Genotype

was significant.

When ANOVA only showed significant main effects of the UV treatments and genotypes but not a significant interaction

contrasts between the UV treatments were fitted pooling the genotypes .

DF=degrees of freedom.

A1. Genes showing significant interaction UV treatment × genotype in Ler and uvr8-2 after 12 h (DF=10)

Wild-type UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B

HY5 < 0.001 0.085 0.002

MEB5.2 0.019 0.199 0.307

SPS < 0.001 0.002 0.036

RUP2 < 0.001 < 0.001 0.130

At5g01520 < 0.001 < 0.001 0.002

SIG5 < 0.001 0.256 < 0.001

CHS < 0.001 < 0.001 0.210

TT7 < 0.001 < 0.001 0.313

DFR < 0.001 < 0.001 0.34

uvr8-2 UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B

HY5 < 0.001 < 0.001 0.781

MEB5.2 < 0.001 < 0.001 0.329

SPS < 0.001 < 0.001 0.647

RUP2 < 0.001 < 0.001 0.035

At5g01520 < 0.001 < 0.001 0.173

SIG5 < 0.001 < 0.001 0.097

CHS < 0.001 < 0.001 0.849

TT7 < 0.001 < 0.001 0.313

DFR 0.99 0.36 0.36

A2. Genes where ANOVA only showed significant main effects of the UV treatments

and genotypes in Ler and uvr8-2 after 12 h (DF=10)

UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B

VSP1 0.515 0.125 0.040

AOS 0.720 0.0055 0.0030

RCD1 0.119 0.421 0.407

CLH1 0.622 0.284 0.132

ATR4 0.003 < 0.001 0.359

PDF1.2 0.213 0.305 0.036

AOC3 0.001 < 0.001 0.337

TAT3 0.008 0.002 0.465

LOX 0.001 < 0.001 0.453

PAD3 0.048 0.004 0.184

PMI2 0.05 0.41 0.22

AIF1 0.003 0.48 0.01

GRX480 0.07 0.06 0.95

A3. Genes showing significant interaction UV treatment × genotype in Ler and uvr8-2 after 36 h (DF=10)


VSP1 ns ns ns

SPS 0.695 0.622 0.167

RUP2 1.00 1.00 1.00

PMI2 0.809 0.809 0.797

AOS 0.999 0.999 0.999

ATR4 1.00 1.00 1.00


VSP1 ns ns ns

SPS 0.050 0.115 0.695

RUP2 0.005 0.005 1.00

PMI2 0.010 0.065 0.796

AOS 0.040 0.194 0.998

ATR4 0.015 0.035 1.000

A4. Genes where ANOVA only showed significant main effects of the UV treatments and genotypes

in Ler and uvr8-2 after 36 h (DF=10)


AOXI 0.410 0.972 0.392

SIG5 0.550 0.716 0.344

At5g01520 0.088 0.258 0.506

MEB5.2 0.528 0.226 0.080

CHS 0.552 0.180 0.429

PDF1.2 0.522 0.859 0.640

A5. Significance of simple effects of the genotype in models fit separately to each UV treatment

for genes showing significant interaction UV treatment x Genotype after 12 and 36 h outdoors (DF=2)

12 h gen. wihtin UV 0 gen. within UV A gen. within UV A+B

HY5 0.2954 0.0745 0.0176

MEB5.2 0.1201 0.0115 0.0223

SPS 0.1542 0.0248 0.0481

RUP2 0.1753 0.2543 0.0098

At5g01520 0.868 0.0250 0.0013

SIG5 0.8132 0.0281 0.0021

CHS 0.3998 0.2075 0.0944

TT7 0.0587 0.2032 0.0479

DFR 0.4543 0.1163 0.0038

36h gen. whithin UV 0 gen. within UV A gen. within UV A+B

VSP1 0.0453 0.2124 0.9425

SPS 0.8332 0.0168 0.0211

RUP2 0.0775 0.0459 0.1143

PMI2 0.3566 0.1296 0.0465

AOS 0.1573 0.0490 0.2502

ATR4 0.5624 0.0358 0.0289

B. PDX1 accumulation in Ler and uvr8-2 after 12 and 36 h outdoors (DF=25)

12 h UV 0 vs UV A UV 0 vs UV A+B UV A vs UV A+B

PDX1 < 0.001 < 0.001 0.64

36 h


PDX1 0.01 0.004 0.57


PDX1 < 0.001 < 0.001 0.01

C. Metabolites detected by UPLC-MS/MS in Ler and uvr8-2

C1. Metabolites showing significant interaction UV treatment × genotype after 12 h (DF=19)


Q-3-N-7-Rha < 0.001 < 0.001 0.18

K-3-O-S-7-O-Glu < 0.001 < 0.001 0.10

Chlorogenic acid 0.33 0.33 0.01

Q-3-R-7-Rha 0.05 < 0.001 0.02

Q-3-(O)-Rha 0.05 < 0.001 0.44

unidentified 0.99 < 0.001 < 0.001

Tyr 1.0 1.0 0.64

kynurenic acid 0.68 0.12 0.22


Q-3-N-7-Rha 0.78 0.29 0.78

K-3-O-S-7-O-Glu 0.95 0.95 0.95


Q-3-R-7-Rha 0.07 0.01 0.25

Q-3-(O)-Rha 1.0 1.0 1.0

unidentified 1.0 1.0 1.0

Tyr 0.49 1.0 1.0

kynurenic acid 0.03 0.3 0.22

C2. Metabolites where ANOVA only showed significant main effect of the UV treatments

and genotypes after 12 h (DF=19)


Phe 0.21 0.84 0.13

K-3-R 0.07 0.23 0.48

IsoRha-3-O-G-7-O-Rha 0.40 0.27 0.80

Q-3-Glu < 0.001 < 0.001 0.68

K-Rha-3-Rha-7 0.34 0.44 0.08

K-3-O-Glu 0.008 0.03 0.49

12-hydroxy jasmonic acid 12-hexose 0.005 0.49 0.01

Camalexin 0.12 0.006 0.15

12-hydroxy jasmonic acid 12-hexose

Treatment Genotype Mean se

UV 0 Ler 0.008 0,004

UV A Ler 0.019 0,01

UV A+B Ler 0.011 0,005

UV 0 uvr8 0.013 0,01

UV A uvr8 0.016 0,01

UV A+B uvr8 0.016 0,01

C3. Metabolites showing significant interaction UV treatment × genotype after 36 h (DF=19)


Phe 0.72 0.72 0.83

Q-3-Glu < 0.001 < 0.001 < 0.001

K-R-3-Rha-7 1.0 1.0 1.0

K-3-O-Glu 0.31 0.01 0.22

Quercetin < 0.001 < 0.001 < 0.001

Kaempferol 1.0 1.0 1.0

unidentified 1.0 < 0.001 < 0.001

Tyr 0.85 0.38 0.97

Trp 1.0 1.0 1.0


Phe 0.01 0.72 0.19

Q-3-Glu < 0.001 < 0.001 < 0.001

K-R-3-Rha-7 0.001 1.0 0.008

K-3-O-Glu 0.008 0.31 0.01

Quercetin < 0.001 < 0.001 < 0.001

Kaempferol 0.05 1.0 0.03

unidentified 1.0 1.0 1.0

Tyr 0.14 0.97 0.04

Trp 0.001 1.0 0.003

C4. Metabolites where ANOVA only indicated significant main effect of the UV treatments

and genotypes after 36 h (DF=19)


Q-3-N-7-Rha < 0.001 < 0.001 0.64

K-3-O-S-7-O-Glu < 0.001 < 0.001 0.66


Q-3-R-7-Rha < 0.001 < 0.001 0.33

K-3-R 0.07 0.03 0.71

Q-3-(O)-Rha < 0.001 < 0.001 0.79

IsoRha-3-O-G-7-O-Rha 0.01 0.01 0.39

Ferulic acid hexose 0.23 0.01 0.17

12-hydroxy jasmonic acid 12-hexose 0.01 0.09 0.44

12-hydroxy jasmonic acid 12-hexose


UV 0 Ler 0.011 0,005

UV A Ler 0.021 0,01

UV A+B Ler 0.018 0,008

UV 0 uvr8 0.014 0,01

UV A uvr8 0.032 0,01

UV A+B uvr8 0.018 0,01

IsoRha-3-O-G-7-O-Rha


UV 0 Ler 0,039 0,017

UV A Ler 0,110 0,049

UV A+B Ler 0,146 0,066

UV 0 uvr8 0,130 0,058

UV A uvr8 0,275 0,124

UV A+B uvr8 0,182 0,082

D. Optical measurements in Ler and uvr8-2 after 50 h outdoors (DF=13)


Dualex 375nm < 0.001 < 0.001 < 0.001

Dualex 315nm 0.65 0.005 0.04


Dualex 375nm < 0.001 < 0.001 0.87

Dualex 315nm 0.65 0.75 0.75


SPAD 0.64 0.63 0.48

SPAD averages

Wild-type uvr8-2

UV A+B 26.27 22.97

UV A 27.35 24.102

UV 0 27.033 22.57

E. Genes where ANOVA only showed significant main effects of the UV treatments and genotypes

in Ler and uvr8-2 after three weeks outdoors (DF=8)


HAT2 0.068 0.052 0.851

CHS 0.722 0.765 0.471

RUP2 0.011 < 0.001 0.007

WRKY70 0.85 0.71 0.87

JAZ1 0.81 0.94 0.73

PMI2 0.93 0.29 0.21

At1g28480 0.07 0.89 0.04

F. Number of flowering plants per pot counted after three weeks (DF=16)


Flowering plants 0.11 0.07 < 0.01

Supplemental Table S7. Metabolites identified in wild-type and uvr8-2 leaves by UPLC-MS. Retention times (RT) and detected masses (M+1) are shown.

No

Metabolite

Abreviation

Class

RT (Min)

[M+1]+ (m/z)

1 Tyrosine Tyr Amino acid 0.28 182

2 p-Coumaric acid Phenylpropanoid 0.29 165, 123

3 Phenylalanine Phe Amino acid 0.48 166

4 Tryptophan Trp Amino acid 0.72 205

5 kynurenic acid Tryptophan derivative 0.79 190

6 12-hydroxy jasmonic acid 12-hexose Jasmonate derivative 0.94 387

7 Unidentified 1.01 381, 365, 349

8 Quercetin-3-O-Neohesperidoside-7-Rhamnoside

Q-3-N-7-Rha Phenylpropanoid 1.12 757, 611, 449, 303

9 Kaempferol-3-O-Sophoroside-7-O-Glucoside K-3-O-S-7-O-Glu Phenylpropanoid 1.24 773 (+Na)

10 Kaempferol-3-O-Neohesperidoside-7-Rhamnoside

K-NeoHes-3-R-7 Phenylpropanoid 1.24 741, 595, 433, 287

11 5-Caffeoyl Quinic Acid Chlorogenic acid Phenylpropanoid 1.30 355, 193

12 Quercetin-3-O-Rutinoside-7-O-Rhamnoside Q-3-R-7-Rha Phenylpropanoid 1.37 757, 611, 449, 303

13 Kaempferol-3-O-Sophoroside-7-O-Rhamnoside K-3-S-Rha-7 Phenylpropanoid 1.40 757, 595, 433, 287

14 Kaempferol -3-O-Rutinoside K-3-R Phenylpropanoid 1.55 595, 433, 287

15 Quercetin-3-O-Rhamnoside Q-3-(O)-Rha Phenylpropanoid 1.57 449, 303

16 Isorhamnetin-3-O-glucoside-7-O-rhamnoside IsoRha-3-O-G-7-O-Rha

Phenylpropanoid 1.61 625, 479, 463, 317

17 Quercetin-3-Glucoside Q-3-Glu Phenylpropanoid 1.67 465, 303

18 Kaempferol-3-O-Rutinoside-7-O-Rhamnoside K-R-3-Rha-7 Phenylpropanoid 1.67 741, 595, 433, 287

19 Sinapic acid Phenylpropanoid 1.71 225

20 Kaempferol -3-Rhamnoside-7-Rhamnoside K-Rha-3-Rha-7 Phenylpropanoid 1.76 579, 433, 287

21 Kaempferol -3-Glucoside K-3-O-Glu Phenylpropanoid 1.90 471 (+Na), 449, 288

22 Quercetin Q Phenylpropanoid 1.92 303

23 Kaempferol K Phenylpropanoid 2.19 287

24 Ferulic acid hexose Phenylpropanoid 2.48 355

25 Camalexin Tryptophan derivative 2.86 201

Supplemental Table S8. Primers used in qPCR

Gene Annotation Forward Primer Reverse Primer Amplification efficiency

MEB5.2 At3g17800 CAAGCCGAGGGGACGGCAAC AGCACTAACTCCGCCCGCAA 1,94

SIG5 At5g24120 AGCTTAAGCATCAGGCCAGAGTTGA AGTGAGGCGGCTCAGTTCGG 2

SPS At1g78510 GCTCGGGAAGCCAGCAGGGA TTGGCTCCCTCTCCAGAGCGA 1,985

F7A7.40 At5g01520 TGCACGGTCACAGTCGTGCC TGCAATCTCGGCGCTACAAGTGT 2,03

AIF1 At3g05800 CGCTCGTGGTGCAACTCGGT CAGCTAATGCCGACGCCGGT 1,94

CLH1 At1g19670 GGGAACCGGACTCGGACCGA CCGCAGCCACGAAATGGGCT 2

AOC3 At3g25780 TGAAGGTGCGTACGGACAGGTT GGCGTAACCGCCGTTCCAGTA 2

AOS At5g42650 GGAGACTCCGACGGTGGGGAA ACGGCGACGTACCAACCTCAA 1,91

ATR4 At4g31500 AGGAGTGGACTTCAAGGGCCAAG CAAGATGCATGGCCGGGCAC 1,992

PMI2 At1g67070 CGGCAGTACCAGGTCCTTCGG CAGCCGGAACAAACAAAACATCTCC 1,981

RUP2 At5g23730 ATGGGCGCGTGATTCGCACG ACGCGCCGTTTCTCCACACAG 1,76

HY5 At5g11260 GAGGGAGGACACCGGCGGAG CCTCTCTCTTGCTTGCTGAGCTGA 2

CHS At5g13930 ATGTCGAGCGCGTGCGTTCT TCTCCTGTCGTGGCCACACCA 2

DFR At5g42800 ACCGGAGATGGTTTAACCGATGGT TGGGAGCATCGGTTCTCTCGC 2

TT7 At5g07990 AGCTGGAGGAGTTACGCCGGA ACGTTCGGAGCCAACCTTGGC 1,94

COP1 At2g32950 TCGCCTGTGGAAGCGAGACA TGCCTCTTCCTCTGCATCGTCCA 2

AOXI At4g12500 CTTAACGTGCAGTTGGGACA CCTAAGGGCAGTGCAGAGAC 1,86

PDF1.2 At5g44420 CCAAACATGGATCATGCAAC CACACGATTTAGCACCAAAGA 1,69

PAD3 At3g26830 GATGTTCCTGCGAAAACACA GTTTTGGATCACGACCCATC 1,69

VSP1 At5g24780 AATGGGCTGATTTGGTTGAG TGGATACAAGGGGACAATGC 1,839

LOX At1g72520 CTAGCCGTAGGAATCGCTGT TACACGTAACACCCGGTTCA 1,85

RCD1 At1g32230 GAGGTTCAGGAAGTGCAAACAGT AACAGAGTAGGAAATGGCATCCA 1,879

TAT3 At2g24850 ATGATCGTCATGCCATCTCC TGTGGACTTGTGGCATAGGA 1,841

UVR8 At5g63860 ATATGGCTGCCGACGAAGT CGCTTGACATCAGTTTGTGG 1,64

NCED3 At3g14440 AGCTCCTTACCTATGGCCAGT CGCTCTCTGGAACAAATTCATC 1,947

HAT2 At5g47370 CGAACCATCACCACAATCAC GCAAGGCTTCAAAATTCAGC 1,997

JAZ1 At1g19180 TGCGATCCAGCCAAAGCGTC TTGGTACGGCTTGAGGGTGGT 2

PR1 At2g14610 TGATCATGCATACACACGTACA CATCCTGCATATGATGCTCCT 1,720

WRKY70 At3g56400 TCATCATCAGGCCAGTTACG CACCTCCAAACACCATGAGA 2

GRX480 At1g28480 TTGGAGTGAATCCGGCGGTCCT CGTACCTCCGCCGCCTTGAAC 2

REFERENCE 1 At4g34270 GTGAAAACTGTTGGAGAGAAGCAA TCAACTGGATACCCTTTCGCA 1,91

REFERENCE 2 At4g33380 TTGAAAATTGGAGTACCGTACCAA TCCCTCGTATACATCTGGCCA 1,86

REFERENCE 3 At4g35510 ACTTCCTCCGCGTCTCCATT TTTATGTCCTGGCATTTCCAA 1,97

Supplemental Table S9. UVBE (kJ m-2 d-1) and PAR (MJ m-2 d-1) for the whole duration of the performance experiment. The minimum, (average) and maximum daily UVBE occurring during the experiment are given. Ambient (no filter) is not a treatment; these doses were included for comparative purposes.

Treatment GEN(G)

GEN(T)

FLAV

PG

PAR

UV 0 0.001(0.002)0.002 0.002(0.005)0.007 0.01(0.02)0.02 0.02(0.04)0.06 2.0(6.9)10

UV A 0.01(0.02)0.03 0.1(0.3)0.5 0.7(1.9)2.5 4.7(13.4)18.1 2.1(7.4)10.6

UVA+B 0.9(2.7)3.9 1.4(4.0)5.6 2.8(8.04)11.1 6.4(18.3)24.9 2.0(7.2)10.3

Ambient 1.1(3.2)4.7 1.7(4.86)6.8 3.4(9.6)13.2 7.6(21.7)29.6 2.4(8.3)11.9

Documents

Supplemental Figure S1. Comparisson of our microarray data ...oru.diva-portal.org/smash/get/diva2:578724/ATTACHMENT02.pdf · 15 At5g23730 RUP 2 0,943 16 At1g06000 UGT89C1 0,953 17