1

Supplemental Material

for

Solution Structure of Proinsulin. CONNECTING-DOMAIN FLEXIBILITY AND PROHORMONE PROCESSING

Yanwu Yang*, Qing-xin Hua, Jin Li>, Eri H. Shimizu>, Meredith H. Choquette>,

Robert B. Mackin>, and Michael A. Weiss*

Department of Biochemistry, Case Western Reserve University, Cleveland, OH 44106 >Department of Biomedical Sciences, Creighton University School of Medicine, Omaha, NE 68178

Table of Contents

Purpose of Supplement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .2 Supplemental Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .2 Supplemental References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 Figure S1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 Figure S2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 Figure S3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9 Figure S4 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .10 Figure S5 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .11 Figure S6 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .12 Figure S7 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .13 Table S1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14 Table S2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14 Table S3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 Table S4 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16 Table S5 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17 Table S6 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18 Table S7 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .19 Table S8 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .20

2

Purpose of Supplement

This Supplement describes methods in detail and contains 7 figures and 8 tables. Figures S1-S3 pertain to the expression of SPC3 (PC1/3) and the enzymatic cleavage assay. In Figure S4 is shown an overlay of 1H-15N HSQC spectra of DKP-insulin and DKP-proinsulin. Figure S5 illustrates triple-resonance-based sequential resonance assignment and in so doing demonstrates motional narrowing of C-domain resonances. In Figure S6 the solution structure of proinsulin is compared to the solution structure of DKP-insulin and classical crystal structures of insulin. Figure S7 provides a histogram summarizing results of SPC3 cleavage assay. In Tables S1 and S2 are given results of receptor-binding assays and guanidine denaturation assays, respectively. Tables S3 and S4 provide a summary of 13Cα and 13Cβ chemical shifts and SSP scores of DKP-proinsulin with comparison to that of free connecting peptide. In Table S5 are given 1H-15N heteronuclear NOE values (hetNOEs). Table S6 provides the statistics of experimental data and structure calculations of DKP-proinsulin. Table S7 provides a summary of structural comparison between insulin moiety of DKP-proinsulin versus insulin crystal structures and NMR solution structure of DKP-insulin. Table S8 provides results of PC1 cleavage assays.

Supplemental Methods Materials. Plasmid pFastBac1, Sf9 cells, High Five cells, Sf-900 II SFM cell culture medium, competent DH10Bac, DH5α, TOP10 E. coli, pre-cast polyacrylamide gels, MOPS running buffer, the pCR-Blunt vector and additional components of the Bac-to-Bac baculovirus expression system were obtained from Invitrogen or its subsidiaries (Carlsbad, CA). ExCell 405 cell-culture medium was obtained from JRH Biosciences (Lenexa, KS). PCR reagents, Pfu DNA polymerase, and QuikChange mutagenesis kit were obtained from Stratagene (La Jolla, CA), and restriction enzymes from New England Biolabs (Beverly, MA). QIAprep spin miniprep, QIAquick gel extraction and Qiagen large-construct kits were each obtained from Qiagen (Valencia, CA). Ready-to-Go T4 DNA ligase was procured from Amersham Biosciences (Piscataway, NJ), and the plasmid pBAC-3, competent BL21(DE3) E.coli, BugBuster, and Benzonase from Novagen (Madison, WI). Fluorogenic substrate pyroglutamyl-arginyl-threonyl-lysyl-arginine-4-methylcoumaryl-7-amide (pQRTKR-mca) was obtained from Peptides International (Louisville, KY). Natural, unstained high and low range SDS-PAGE molecular weight standards were obtained from Bio-Rad Laboratories (Hercules, CA), and MetaPhor agarose from BioWhittaker Molecular Applications (Rockland, ME). Laboratory chemicals were obtained from Fisher Scientific (Pittsburgh, PA). NMR Resonance Assignment. The 1H-15N-HSQC fingerprint of DKP-proinsulin is similar to that of DKP-insulin but exhibits additional cross peaks at near random-coil frequencies and multiple small changes in pattern of non-random chemical shifts (Supplemental Fig. S4). Main-chain (1H, 13C, and 15N)-NMR assignments were obtained by combined use of through-bond correlation spectra (HNCACB and CBCA(CO)NH; Supplemental Fig. S5). Side chains were assigned by analysis of isotope-directed TOCSY spectra (C(CO)NH-TOCSY, H(CCO)NH-TOCSY, and HCCH-TOCSY); spin-system classification was consistent with main-chain assignments. Ambiguities in correlation spectra were overcome by analysis of nuclear Overhauser effects (NOEs) via 3D 15N-NOESY and 13C-NOESY spectra. Remaining unassigned NOE cross peaks were interpreted based on the well-characterized structure of DKP-insulin

3

[Hua, 1996 #26; Yang, 2009 #15842], yielding essentially complete resonance assignment (Supplementary Tables S3 and S4). SPC3 (PC1/3) Plasmid Construction. The polh-gp64-hSPC3/pFastBac1 plasmid was constructed in three steps. (i) Polymerase chain reaction (PCR) was used to generate a DNA fragment successively consisting of approximately 110 bp of the polyhedrin promoter region, 66 bp encoding the baculovirus gp64 signal sequence, a 9 bp linker containing an NcoI recognition site and 39 bp of the human SPC3 (PC1/3) coding region beginning at the "pro-" domain of the SPC3 cDNA. This fragment was generated by using 5' primer 5'-GCTACGTATACTCCGGAATATTAATAG ATCATGGAGATAATTAAAATGATAACC-3' and 3' primer 5'-GCGGATCCCGGGGATCTC CGCTGCCCATTCATTGACAAATTGCCTTTTGACCATGGCCGCAAAGGCAGAATGC-3' with the pBAC-3 plasmid as template. The resulting fragment was ligated into pCR-Blunt (Invitrogen), then cut out using SnaBI and BamHI. This fragment was ligated into pFastBac1 to form polh/pFastBac1. (ii) The above polh/pFastBac1 plasmid was cut 3' of the insertion site using the restriction enzymes KpnI and HindIII. The human SPC3 coding sequence was removed from plasmid pIP82 (obtained from the American Type Culture Collection (deposited by Dr. W.J.M. van de Ven, University of Leuven) and ligated into polh/pFastBac1 to form polh-hSPC3/pFastBac1. (iii) This plasmid was cut with SmaI, gel purified and re-ligated to remove extraneous DNA 5' of the SPC3 (PC1/3) coding sequence. The resulting plasmid is called polh-gp64-hSPC3/pFastBac1, and the fidelity of its construction was verified by DNA sequence analysis. The final cDNA and amino acid sequence of the altered portion of the expression cassette (from 5' of the polh promoter into the beginning of the SPC3 pro-region) is shown in Supplemental Figure S1. Expression and Purification of SPC3 (PC1/3). The polh-gp64-hSPC3/pFastBac1 plasmid was used to generate and titer recombinant baculovirus according to the manufacturer's instructions; four 200 ml cultures of High Five cells were infected at a multiplicity of infection of 3. Following 48-hour incubation, the cell culture medium was harvested, and proteins precipitated using polyethylene glycol. Following re-suspension, the sample was applied to a 1.0 x 10 cm column of SP Sepharose HP equilibrated in 30 mM NaAc/HAc (pH 5.2) at 4 °C. The column was washed with starting buffer and then developed using a linear gradient from 0-200 mM NaCl in 80 min at a flow rate of 0.4 ml/min. Enzyme activity was determined using a fluorogenic substrate assay; fractions containing significant activity were pooled. The sample was brought to pH 6.0 by adding 0.15 volumes of 100 mM bis-Tris/HCl (pH 6.6), and the salt concentration was reduced by adding 3 volumes of cold, deionized water. The sample was applied to a 0.5 x 5 cm Mono Q column equilibrated in 20 mM bis-Tris/HCl (pH 6.0) and washed with starting buffer at 4 °C. The column was developed using a linear gradient from 0-250 mM NaCl in 25 min at a flow rate of 0.4 ml/min. Fractions were tested for enzyme activity, and samples with relatively high fluorogenic activity divided into 50 or 100 µl aliquots, quick-frozen in liquid nitrogen and stored at -80 °C. Samples were analyzed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE); proteins were visualized using Coomassie blue staining (see Supplemental Fig. S2). Analysis of SPC3. N-terminal protein sequencing and MALDI-TOF analysis of purified SPC3 (PC1/3) were performed at the University of Nebraska Medical Center Protein Structure Core Facility. Protein sequencing was done using Edman degradation on an Applied Biosystems Procise 491 sequenator; MALDI-TOF analysis was performed using an Applied Biosystems Voyager DE PRO mass spectrometer.

4

Generation of proinsulin expression plasmids. Construction and expression of DKP-insulin has previously been described (1). Expression plasmids encoding altered versions of proinsulin were created using either the QuikChange mutagenesis kit or by PCR amplification using oligonucleotides designed for use with the QuikChange mutagenesis protocol (Stratagene). Coding sequences were verified by DNA sequence analysis and the plasmids were transformed into competent BL21 (DE3) E. coli. Two deletion mutants were constructed as follows. (i) Plasmid des(33-36)-DKP-hPI/pET-9b was created by loop-out mutagenesis PCR using the complementary primers 5'-GACCCGCCGGCTGCAGGTGG-3' and 5'-CCACCTGCAGCCGG CGGGTC-3' with the DKP-hPI/pET-9b plasmid as template. PCR conditions were: initial denaturation at 95 ºC for 30 seconds, followed by 18 cycles of denaturation (95 ºC for 30 seconds), primer annealing (55ºC for 60 seconds), and DNA polymerization (68 ºC for 9.5 minutes). The last cycle was followed by a 10 minute polymerization at 68 ºC. The product of this reaction was used to transform DH5α E. coli, and colonies screened for the presence of the altered proinsulin coding sequence. The integrity of the des(33-36)-DKP-hPI insert was confirmed by DNA sequencing, and the plasmid was transformed into competent BL21(DE3) E.coli. (ii) To generate the plasmid des(38-62)-DKP-hPI/pET-9b, the plasmid DKP-hPI/pET-9b was cut using PstI, purified using agarose gel electrophoresis and re-ligated using Ready-to-Go T4 DNA ligase. The integrity of the coding region was confirmed by DNA sequencing, and the plasmid was transformed into competent BL21(DE3) E.coli. Expression, purification and analysis of altered DKP-hPI. BL21(DE3) E.coli containing the appropriate plasmid were grown in 1 liter of M9 media with kanamycin. Following growth to ~A600 0.7-0.8, protein expression was induced by the addition of isopropyl β-D-1-thiogalactopyranoside to a final concentration of 0.4 mM. The bacteria were harvested and proinsulin was reduced, re-folded, and purified as previously described (1). Variant proinsulins were each analyzed for folding efficiency and purity using reversed phase-high performance liquid chromatography (RP-HPLC). Samples were applied to a 0.2 x 15 cm Phenomenex Jupiter C4 column equilibrated in 30% B (A = 0.1% trifluoroacetic acid (TFA) in water; B = 0.1% TFA in 80% acetonitrile/20% water); and the column was developed using a linear gradient of 30% to 75% B in 30 minutes at a flow rate of 150 µl/min. The identity of each proinsulin variant was then verified using electrospray ionization-mass spectrometry (ESI-MS).

Fidelity of Proinsulin Disulfide Pairing. Disulfide bonding was confirmed by endoproteinase Glu-C digestion. Approximately 100 ng of endoproteinase Glu-C was added to 5 µg of each version of proinsulin and incubated overnight in 250 mM sodium phosphate (pH 7.8) at 25 ºC. The digested samples were fractionated by reverse-phase HPLC using a linear gradient of 10-70% B in 60 minutes, and the collected peptides were analyzed using ESI-MS as described (2). Proinsulin conversion assay. Purified recombinant human SPC3 (PC1/3) was quantified using the Bradford assay whereas wild-type and variant proinsulins were quantified using HPLC post-column UV absorbance at 210 nm (an integrated peak area of 1500 mAU*sec was determined to be approximately equal to 1 µg of proinsulin). The enzyme (250, 500 or 750 nM) was then incubated with either normal or variant proinsulin (50 µM) in a total volume of 50 µl of 100 mM bis-Tris/HCl (pH 6.0) containing 2 mM calcium chloride. Incubation was allowed to proceed for 15 minutes at 37º C, and the reactions stopped by the addition of reducing buffer. To facilitate quantitative analysis of SPC3 cleavage products, samples were reduced and unfolded under an argon atmosphere for 30 minutes at 50 ºC by addition of a buffer containing urea and dithiothreitol (DTT); the final buffer components are 600 mM Tris/HCl (pH 8.7), 6 M urea, 5

5

mM ethylenediamine-tetraacetic acid (EDTA), and 60 mM dithiothreitol (DTT) in a final volume of 200 µl. The reduced and unfolded samples were each carboxamidomethylated by addition of iodoacetamide to a final concentration of 100 mM, and alkylation was allowed to proceed for 7 minutes in the dark at room temperature. Each reaction was stopped by adding glacial acetic acid to a final concentration of 3.5 M. Finally, the samples were analyzed by reverse-phase HPLC using a linear gradient from 22.2-52.5% B over 40 minutes. In initial experiments ESI-MS was used to establish the identities of cleavage products. To enable quantitative analysis, the integrated area from respective HPLC post-column UV absorbance peaks was normalized by dividing the peak area by the number of peptide and amide bonds in the corresponding peptide (i.e., B chain-R-R = area/35; B/C polypeptide-K-R = area/72; A chain = area/28; C/A polypeptide = area/65; DKP-hPI = area/101). This calculation is based on the assumption that the majority of the absorbance at 210 nm is due to the presence of these bonds. The percent cleavage at each site was then determined as follows: percent B/C junction = (B chain-R-R / (B chain-R-R + B/C polypeptide-K-R + DKP-hPI)) * 100 whereas the percent C/A junction = (A chain / (A chain + C/A polypeptide + DKP-hPI)) * 100. Assay results presented represent averaged values calculated using data from either two, three, or four trials for each version of proinsulin (wild-type or variant). Design of the SPC3 cleavage assays was based on preliminary studies indicating the following. Using 250 nM SPC3, we observed that ca. 50% of BC sites were cleaved under conditions wherein only 12% of CA sites were cleaved. Cleavage was enhanced with increasing enzyme concentration. An enzyme concentration of 750 nM SPC3 catalyzed 76% BC cleavage and 30% CA cleavage. Deletion of C-domain residues 33-36 (flanking the CA dibasic site) blocked BC cleavage with partial interference of CA cleavage. By contrast, deletion of residues 38-62 (the central portion of the C domain) only slightly reduced SPC3 cleavage at either junction. Because these results suggested that the substrate sites p1’-p4’ modulate SPC3 cleavage of the BC junction, effects of single amino-acid deletions and substitutions were also investigated (Fig. S7 and Table S8). The findings demonstrate that enzyme recognition of disordered substrate positions p1’-p4’ is sequence selective as described in the main text. Thermodynamic Modeling. CD-detected guanidine denaturation data (222 nm) were fitted by non-linear least squares to a two-state model (Table S2) as described (3). In brief, CD data )(xθ , where x indicates the concentration of denaturant, were fitted by a nonlinear least-squares program according to

RTmxG

RTmxGBA

oOH

oOH

eex

)(

)(

2

2

1)(

−∆−

−∆−

+

+=

θθθ

where x is the concentration of guanidine hydrochloride and where Aθ and Bθ are baseline values in the native and unfolded states. These baselines were approximated by pre- and post-transition lines xmx A

OHAA += 2)( θθ and xmx B

OHBB += 2)( θθ . Fitting the original CD data and

baselines simultaneously circumvents artifacts associated with linear plots of DG as a function of denaturant according to xmx o+∆=∆ o

OHo

2G)(G (for reviews see (3,4)).

Protocol for NMR Structure Determination and Analysis. Initial structures were calculated by employing only unambiguous NOEs; calculations were iteratively performed on further NOE analysis. NOEs were classified as strong, medium, weak, or very weak, with respective inter-proton distance restraints of 1.8-2.7 Å (1.8-2.9 Å for NOEs involving NH protons), 1.8-3.3 Å (1.8-3.5 Å for NOEs involving NH protons), and 1.8-5.0 Å and 1.8-6.0 Å

6

(5,6). Restraints on main-chain φ and ψ torsion angles were generated using TALOS (7), in which minimum error ranges were set to ± 20 (φ) and ± 30 (ψ) from the average predicted value (8,9). The structure of proinsulin was calculated based on 939 NOE distance restraints, including 166 long-range restraints. Ramachandran plots were calculated to assess final structures using PROCHECK (10). Models were visualized using InsightII, molmol and grasp software (11); 20 NMR models were analyzed in relation to a collection of 18 crystallographic T-state protomers extracted from T6 and T3Rf

3 zinc hexamers (12-16) and the T2 dimer (17,18). Supplemental References 1. Mackin, R. B., and Choquette, M. H. (2003) Protein Expr. Purif. 27, 210-219 2. Mackin, R. B. (1999) Protein Expr. Purif. 15, 308-313 3. Sosnick, T. R., Fang, X., and Shelton, V. M. (2000) Methods Enzymol. 317, 393-409 4. Pace, C. N., and Shaw, K. L. (2000) Proteins Suppl 4, 1-7 5. Williamson, M. P., Havel, T. F., and Wuthrich, K. (1985) J. Mol. Biol. 182, 295-315 6. Clore, G. M., Brunger, A. T., Karplus, M., and Gronenborn, A. M. (1986) J. Mol. Biol.

191, 523-551 7. Cornilescu, G., Delaglio, F., and Bax, A. (1999) J. Biomol. NMR 13, 289-302 8. Caffrey, M., Cai, M. L., Kaufman, J., Stahl, S. J., Wingfield, P. T., Covell, D. G.,

Gronenborn, A. M., and Clore, G. M. (1998) EMBO J. 17, 4572-4584 9. Cai, M. L., Huang, Y., Ghirlando, R., Wilson, K. L., Craigie, R., and Clore, G. M. (2001)

EMBO J. 20, 4399-4407 10. Laskowski, R. A., Macarthur, M. W., Moss, D. S., and Thornton, J. M. (1993) J. Appl.

Crystallogr. 26, 283-291 11. Koradi, R., Billeter, M., and Wuthrich, K. (1996) J. Mol. Graph. 14, 51-55, 29-32 12. Blundell, T. L., Cutfield, J. F., Cutfield, S. M., Dodson, E. J., Dodson, G. G., Hodgkin,

D. C., Mercola, D. A., and Vijayan, M. (1971) Nature 231, 506-511 13. Bentley, G., Dodson, G., and Lewitova, A. (1978) J. Mol. Biol. 126, 871-875 14. Baker, E. N., Blundell, T. L., Cutfield, J. F., Cutfield, S. M., Dodson, E. J., Dodson, G.

G., Hodgkin, D. M., Hubbard, R. E., Isaacs, N. W., and Reynolds, C. D. (1988) Philos. Trans. R. Soc. Lond. B Biol. Sci. 319, 369-456

15. Ciszak, E., and Smith, G. D. (1994) Biochemistry 33, 1512-1517 16. Whittingham, J. L., Chaudhuri, S., Dodson, E. J., Moody, P. C., and Dodson, G. G.

(1995) Biochemistry 34, 15553-15563 17. Dodson, E. J., Dodson, G. G., Lewitova, A., and Sabesan, M. (1978) J. Mol. Biol. 125,

387-396 18. Badger, J., Harris, M. R., Reynolds, C. D., Evans, A. C., Dodson, E. J., Dodson, G. G.,

and North, A. C. (1991) Acta Crystallogr. B Struct. Sci. 47, 127-136

7

SnaBI GACTCTAGCTATAGTTCTAGTGGTTGGCTACGTAT ACTCCGGAATATTAATAGATCATGGAGATAATTAA AATGATAACCATCTCGCAAATAAATAAGTATTTTA CTGTT TTCGTAACAGTTTTGTAATAAAAAAACCTA TAAAT ATG CCC ATG TTA AGC GCT M P M L S A ATT GTT TTA TAT GTG CTT TTG I V L Y V L L GCG GCG GCG GCG CAT TCT GCC A A A A H S A ↓ NcoI TTT GCG GCC ATG GTC AAA AGG F A A M V K R CAA TTT GTC AAT GAA TGG GCA Q F V N E W A SmaI GCG GAG ATC CCC GGG GGC CCG A E I P G G P GAA GCA GCC TCG GCC ATC GCC E A A S A I A Figure S1. DNA and amino acid sequence of SPC3 (PC1/3) expression plasmid. Region of the polh-gp64-hPC1/pFastBac1 plasmid as modified for the expression of human SPC3. The DNA sequence shown encodes the following regions: pFastBac1 plasmid sequence, the baculovirus polyhedrin promoter (indicated by a double underline), the baculovirus gp64 signal sequence, a novel three amino acid linker (circumscribed by an oval) that contains an NcoI restriction site (underlined italics) and the N-terminal portion of the human SPC3 (PC1/3) pro-region. The SnaBI and SmaI restriction sites used during the creation of the modified region are also indicated by underlined italics. The site where the signal peptide is believed to be cleaved is indicated by an arrow.

8

Figure S2. SDS-PAGE analysis of the purification of human SPC3 (PC1/3). Approximately 5 µg of purified recombinant enzyme was analyzed using a 10% acrylamide NuPAGE Bis-Tris gel and visualized by Coomassie blue staining.

9

800

600

400

200

050454035302520

800

600

400

200

050454035302520

Abso

rban

ce (m

AU -

210

nm)

A

B

A

B

C

C/A

B/C

PI

PI

800

600

400

200

050454035302520

C

B/C

PI

A

Time (min)

Figure S3. RP-HPLC analysis of DKP-hPI conversion. Samples of proinsulin were incubated either in the absence or presence of 750 nM SPC3 (PC1/3), reduced, derivatized using iodoacetamide, and analyzed by RP-HPLC. Panel A, control incubation of DKP-hPI without SPC3; panel B, incubation of DKP-hPI with PC1; panel C, incubation of des(33-36)DKP-hPI with SPC3. Peptide peaks are labeled as follows: A, A chain; C, C peptide extended with Lys-Arg; C/A, combined C peptide/A chain polypeptide; B, B-chain extended with Arg-Arg; B/C, combined B chain/C peptide polypeptide extended with Lys-Arg; PI, intact proinsulin.

10

Figure S4. Alignment of 2D 1H-15N HSQC spectra of DKP-proinsulin and DKP-insulin at pH 7.1. Cross-peaks of DKP-insulin are shown in red (labeled by residue number for main-chain amide groups); cross peaks of DKP-proinsulin, including its connecting peptide, are shown in black. Side-chain resonances in either fragment are not labeled. Main-chain cross peaks arising from the DKP-proinsulin are also unlabeled (black).

11

Figure S5. Isotope-directed NMR resonance assignment of polypeptide main chain. Strip plot from HNCACB 3D-NMR spectrum at 700 MHz illustrating connectivities between Cα and Cβ resonances in sequential residues in segment E33-G45 of C-domain and segment L78-Y84 of A-domain of DKP-proinsulin. This spectrum contains both intra- and inter-residue cross peaks in the fragment of C-domain and only shows intra-residue cross peaks in the fragment of A-domain, indicating motional narrowing of proinsulin C-domain. Spectra were obtained at pH 7.1 at 25 oC; the protein concentration was 0.3 mM.

12

Figure S6. Structural comparison of proinsulin with crystal and NMR structure of insulin. (A) Best-fit superimposition of the crystal structure of insulin (PDB accession code 1RWE) and ensemble of insulin moieties of proinsulin (20 NMR-derived models). The crystal structure is shown in cyan; and the NMR structure in red for the A-chain; and in blue for the B-chain; disulfide bonds are shown in yellow. (B) Comparison of crystal structure and DKP-proinsulin for selected residues in major hydrophobic core. (C) Best-fit superimposition of the NMR structure of DKP-insulin (PDB accession code 2jmn) and ensemble of the insulin moieties of proinsulin. The solution structure of DKP-insulin is shown in purple. (D) Comparison of NMR structure of DKP-insulin and DKP-proinsulin for selected residues in the major hydrophobic core. In panels A and C are also shown the three disulfide bridges (top to bottom): cystines A7-B7, A6-A11, and A10-B19.

13

100

80

60

40

20

0

% c

leav

age

Glicentin substitution

100

80

60

40

20

0

% c

leav

age

Alanine scan

74

90

21 1812

74

91

0

79

46

P1' P2' P3' P4'DKP

P1' P2' P3' P4'DKP

A

B

Figure S7. Graphical representation of altered substrate cleavage. The solid dark bars in each panel represent the cleavage efficiency of SPC3 (PC1/3) acting upon the DKP-hPI substrate. (A) White bars represent the ability of SPC3 to cleave individual alanine scan mutants (P1' = E33A-; P2' = A34E-; P3' = E35A- and P4' = D36A-DKP-hPI). (B) Gray bars represent the cleavage of the progressively replaced glicentin substitution mutants (P1' = E33H-; P2' = E33H/A34S-; P3' = E33H/A34S/E35Q- and P4' = E33H/A34S/E35Q/D36G-DKP-hPI). Note that the alanine-scan mutants represent individual amino acid changes, while the glicentin-substitution mutants represent cumulative amino acid alterations.

14

Table S1. Receptor-Binding Studies

analogue human IR (isoform A) human IR (isoform B) Kd (nM) Relative Aff. Kd (nM) Relative Aff. insulin 0.034±0.002 (8) 100% 0.047±0.003 (8) 100% DKP-insulin 0.014±0.0003 (3) 237 0.020±0.001 (3) 235 proinsulin 1.10±0.061 (3) 3.1 2.60±0.252 (3) 1.8 DKP-proinsulin 0.133±0.005 (3) 23.7 0.221±0.005 (3) 23.5 IR indicates insulin receptor (isoform A or B). Numbers in parentheses indicate number of replicates. DKP indicates substitutions at positions B10, B28, and B29 that block self-assembly. Table S2. Guanidine Denaturation Studies at 4 oC and pH 7.4

analogue ∆Gu (kcal/mole) Cmid (M) m (kcal/mol/M)

human insulin 4.4 ± 0.1 5.3 ± 0.1 0.84 ± 0.01

DKP-insulin 4.9 ± 0.04 5.8 ± 0.1 0.84 ± 0.01

human proinsulin 4.0 ± 0.1 4.6 ± 0.1 0.87 ± 0.01

DKP-proinsulin 4.9 ± 0.1 5.4 ± 0.1 0.90 ± 0.02

15

Table S3. 13C chemical shifts of DKP-proinsulin (insulin moiety) and SSP scores based on the chemical shifts. Cα

Cβ

SSP

Cα

Cβ

SSP

A1Gly 45.12 - B1Phe 58.36 41.02 0.11 A2Ile 62.23 38.55 0.29 B2Val 62.00 32.81 -0.15 A3Val 62.68 31.67 0.16 B3Asn 53.70 38.22 -0.14 A4Glu 57.79 31.02 0.16 B4Gln 54.61 31.37 -0.20 A5Gln 55.71 31.09 0.09 B5His 57.74 29.25 -0.26 A6Cys - 38.69 - B6Leu 53.67 44.93 -0.10 A7Cys - 39.17 - B7Cys 53.94 - - A8Thr 63.76 68.59 0.11 B8Gly 47.50 0.73 A9Ser 56.42 64.55 0.11 B9Ser 61.67 62.57 1.15 A10Ile 60.72 3867 -0.15 B10Asp 57.40 39.94 1.10 A11Cys - - - B11Leu 57.50 40.36 1.09 A12Ser 56.59 65.68 0.47 B12Val 66.75 31.64 1.00 A13Leu 58.49 41.21 0.61 B13Glu 59.40 29.50 0.99 A14Tyr 60.01 37.71 0.70 B14Ala 55.57 19.12 1.01 A15Gln 58.73 29.32 0.88 B15Leu 57.63 40.21 0.99 A16Leu 58.02 42.09 0.81 B16Tyr 61.78 38.06 0.91 A17Glu 58.23 29.41 0.77 B17Leu 57.65 42.16 0.96 A18Asn 54.97 38.94 0.80 B18Val 65.52 32.80 0.92 A19Tyr 59.12 38.11 0.79 B19Cys 54.22 36.40 - A20Cys 53.44 35.65 - B20Gly 46.74 0.61 A21Asn 55.61 39.22 0.22 B21Glu 57.84 29.30 0.49 B22Arg 58.03 31.13 0.10 B23Gly 44.90 -0.17 B24Phe 55.83 41.62 -0.36 B25Phe 56.84 40.00 -0.61 B26Tyr 58.45 39.76 -0.59 B27Thr 60.94 70.14 -0.39 B28Lys 54.59 32.71 - B29Pro 63.27 32.24 -0.01 B30Thr 62.04 70.18 0.13

16

Table S4. 13C chemical shifts of DKP-proinsulin (C-domain) and SSP scores based on the chemical shifts*.

Cα DKP-proinsulin

C-domain

Cα Isolated

C-peptide

Cβ DKP-proinsulin

C-domain

Cβ Isolated

C-peptide

SSP DKP-proinsulin

C-domain

SSP Isolated

C-peptide C1Arg 56.08 30.71 -0. 09 C2Arg 56.28 30.82 -0.03 C3Glu 57.10 30.33 -0.02 C4Ala 52.90 52.84 19.35 19.19 0.00 -0.02 C5Glu 57.27 57.00 30.38 30.24 0.04 0.04 C6Asp 54.38 54.17 41.17 41.02 0.01 -0.01 C7Leu 55.54 55.22 42.21 42.26 0.06 0.03 C8Gln 55.72 55.63 29.28 29.22 0.04 0.00 C9Val 62.77 62.58 32.71 32.64 0.00 -0.04 C10Gly 45.32 45.13 -0.02 -0.06 C11Gln 55.79 55.69 29.62 29.59 0.00 -0.06 C12Val 62.40 62.34 32.91 32.91 -0.04 -0.08 C13Glu 56.69 56.32 30.33 30.27 -0.02 -0.06 C14Leu 55.19 55.31 42.46 42.33 0.02 -0.04 C15Gly 45.63 45.40 0.01 -0.08 C16Gly 45.35 45.05 0.07 -0.01 C17Gly 44.70 44.76 - - C18Pro 63.82 63.54 32.11 32.08 -0.01 -0.18 C19Gly 45.41 45.16 0.02 -0.15 C20Ala 52.97 52.77 19.34 19.34 0.04 -0.10 C21Gly 45.59 45.33 0.06 -0.21 C22Ser 58.69 58.27 64.08 63.86 0.07 -0.17 C23Leu 55.41 54.04 42.40 42.25 0.06 -0.26 C24Gln 53.68 55.62 28.98 29.01 - - C25Pro 63.41 63.16 32.10 32.13 0.07 -0.18 C26Leu 55.66 55.15 42.36 42.35 0.11 -0.07 C27Ala 52.71 52.24 19.30 19.30 0.18 -0.04 C28Leu 55.84 55.08 42.39 42.36 0.22 0.00 C29Glu 57.79 57.04 30.05 30.16 0.24 0.02 C30Gly 46.03 45.51 0.37 - C31Ser 59.41 58.57 63.89 63.78 0.28 0.12 C32Leu 56.52 55.30 42.11 42.18 0.13 0.07 C33Gln 56.34 56.70 30.34 29.46 0.10 0.06 C34Lye - 56.29 - 32.99 - 0.05 C35Arg 55.70 57.43 29.60 31.69 -0.10 0.00

*C-domain residues C1-C35 corresponds to residues 31-65 of human proinsulin.

17

Table S5. Backbone heteronuclear NOEs of DKP-proinsulin

NOEs NOEs NOEs

A1Gly 0.68 B1Phe C1Arg 0.48 A2Ile 0.60 B2Val C2Arg 0.42 A3Val 0.59 B3Asn 0.49 C3Glu 0.45 A4Glu B4Gln 0.67 C4Ala 0.44 A5Gln 0.56 B5His 0.71 C5Glu 0.40 A6Cys 0.65 B6Leu 0.79 C6Asp 0.32 A7Cys B7Cys 0.84 C7Leu 0.33 A8Thr B8Gly 0.61 C8Gln 0.38 A9Ser B9Ser 0.77 C9Val 0.31 A10Ile 0.69 B10Asp 0.82 C10Gly 0.22 A11Cys B11Leu 0.84 C11Gln 0.24 A12Ser 0.73 B12Val 0.76 C12Val 0.16 A13Leu 0.78 B13Glu 0.83 C13Glu 0.19 A14Tyr 0.74 B14Ala 0.85 C14Leu 0.27 A15Gln 0.78 B15Leu 0.81 C15Gly 0.11 A16Leu 0.74 B16Tyr 0.84 C16Gly 0.15 A17Glu 0.68 B17Leu 0.78 C17Gly -0.07 A18Asn 0.78 B18Val 0.83 C18Pro A19Tyr 0.77 B19Cys 0.75 C19Gly 0.08 A20Cys 0.77 B20Gly 0.80 C20Ala 0.14 A21Asn 0.80 B21Glu 0.67 C21Gly 0.05

B22Arg 0.73 C22Ser 0.22 B23Gly 0.75 C23Leu 0.20 B24Phe 0.75 C24Gln 0.26 B25Phe 0.77 C25Pro B26Tyr 0.70 C26Leu 0.40 B27Thr 0.60 C27Ala 0.37 B28Lys 0.59 C28Leu 0.45 B29Pro C29Glu 0.43 B30Thr 0.53 C30Gly 0.51 C31Ser 0.5 C32Leu 0.51 C33Gln 0.51 C34Lye 0.55 C35Arg 0.52

*C-domain residues C1-C35 corresponds to residues 31-65 of human proinsulin.

18

Table S6. Statistics of experimental data and structure calculations of proinsulin Parameter SA ensemble a Minimized

average Rmsd from experimental distance restraints (Å)

all (939) 0.025 ± 0.005 0.094

intraresidue, i=j (331) 0.023 ± 0.005 0.116

sequential, |i-j|=1 (264) 0.025 ± 0.006 0.043

medium range, 1<|i-j|<5 (178) 0.027 ± 0.006 0.050

long range, |i-j|≥5 (166) 0.026 ± 0.006 0.131

Rmsd from idealized covalent geometry

bonds (Å) 0.0040± 0.0009 0.0102

angles (°) 0.58 ± 0.13 0.928

impropers (°) 0.43 ± 0.10 5.00

EL-J (kcal/mol) b -237.5 ± 54.3 -

Ramachandran plot c

most favored regions (%) 85.8 86.5

additionally and generously allowed regions (%) 14.2 13.5

disallowed regions (%) 0.0 0.0

Coordinate precision of native insulin-like region d

rmsd of backbone atoms to the mean (Å) 0.24 ± 0.08

rmsd of all heavy atoms to the mean (Å) 0.89 ± 0.17

Coordinate precision of C-peptide region e

rmsd of backbone atoms to the mean (Å) 0.47 ± 0.16

rmsd of all heavy atoms to the mean (Å) 0.91 ± 0.26 a Mean ± standard error where applicable. b Lennard-Jones potential energy function, calculated with CHARMM19 (27) empirical

energy parameters. c Residues 1-28, 67- 85 and 56-62 for native insulin-like region and C-domain helix.

Glycine residues are not included. d Residues 2-28 and 67-85.

e Residues 56-62.

19

Table S7. Structural comparison: Insulin-like structure of proinsulin versus previous structuresa structure main-chain side-chain (Å) (Å) 1RWE T (T3R3) 0.95 1.54 2TCI T (T3R3) 0.95 1.71 2INS T (T6) 1.16 1.91 4INS (cubic) 1.19 1.99 1APH (cubic) 1.14 1.87 1BPH (cubic) 1.13 1.89 1CPH (cubic) 1.14 1.89 1DPH (cubic) 1.15 1.91 1BEN T (T3R3) 1.00 1.63 1MPJ T (T3R3) 0.98 1.78 1TRZ T (T3R3) 0.97 1.62 1TYL T (T3R3) 0.98 1.64 1TYM T (T3R3) 0.99 1.65 1ZNI T (T3R3) 0.97 1.75 1LPH T (T3R3) 1.00 1.71 3MTH T (T3R3) 0.96 1.76 1G7A T1 (T3R3) 0.98 1.77 T2 (T3R3) 1.02 1.64 average 1.04 (±0.09) 1.78 (±0.12) DKP-insulin 1.06 2.22 aStructures were pairwise aligned according to the main- chain atoms of residues B3-B28 and A2-A20.

20

Table S8. Effects of C-Domain Deletions and Sequence Modifications on SPC3 Cleavage P1’ to P4’ % BC cut % CA cut Set 1 – Large-scale deletions DKP-hPI EAED 76 30 Des (33-36) LQVG 0 27 Des (38-62) EAED 48 23 Set 2 – Single amino-acid deletions DKP-hPI EAED 71 25 Des (33) AEDL 15 19 Des (33-34) EDLQ 16 14 Des (33-35) DLQV 70 19 Des (33-36) LQVG 0 18 Set 3 – Alanine-scanning mutagenesis DKP-hPI EAED 74 33 E33A AAED 91 22 A34E EEED 0 15 E35A EAAD 79 30 D36A EAEA 46 27 Set 4 – Glicentin-substitution mutagenesis DKP-hPI EAED 74 29 E33H HAED 90 35 E33H/A34S HSED 21 18 E33H/A34S/E35Q HSQD 18 22 E33H/A34S/E35Q/D36G HSQG 12 23