Supplemental Materials and Methods

Fungal culture

Colletotrichum gloeosporioides S9275 (Cg) was provided by Shigenobu Yoshida (National

Institute for Agro-Environmental Sciences, Japan). The C. orbiculare wild-type strain

104-T (MAFF240422) was a stock culture of the Laboratory of Plant Pathology, Graduated

School of Agriculture, Kyoto University. Cg was grown on 2.5% (w/v) potato dextrose

agar medium (PDA; Difco, Detroit, MI, USA) and placed at 24°C in a cycle of 16 h of

black light and 8 h of dark. Colletotrichum orbiculare was maintained on 3.9% (w/v) PDA

at 24°C in the dark. Conidia of C. gloeosporioides and C. orbiculare were obtained by

gentle pipetting of grown cultures and centrifugation for purification.

Plant lines, growth, and inoculation

The sid2-2 (eds16-1) and npr1-3 mutants were provided by Volker Lipka

(Georg-August-University, Germany). The coi1-21 and ein2-1 mutants were obtained from

the Arabidopsis Biological Resource Center. The GFP-h transgenic plants were provided by

Ikuko Hara-Nishimura (Kyoto University, Japan). Plants were sown on rockwool, treated at

4°C in the dark for 2 days, and grown at 25°C with 16 h of illumination per day in nutrient medium. For microscopic observation, conidial suspension (~5 × 105 conidia per ml) was

dropped on cotyledons of 7~14-day-old seedlings. The conidial suspension of Cg was

inoculated with or without 0.1% Glc. Colletotrichum orbiculare was inoculated without Glc. For the flg22 treatment, 2 µM flg22 solution was spotted on cotyledons on PDF–GFP

plants. Inoculated plants then were placed in a growth chamber at 25°C with a cycle of 16 h

of light and 8 h of dark, and maintained at 100% relative humidity. For plant transformation,

the vectors were transformed into Agrobacterium tumefaciens (strain GV3101), and

Arabidopsis plants were transformed using the floral-dip method using the transformed

Agrobacterium strains (Clough and Bent, 1998). Transgenic plants were selected by

kanamycin. After 2 weeks, transformants were transplanted to soil and allowed to set seeds.

Mutants and T-DNA insertion lines

Homozygous mutant plants of the transfer (T)-DNA insertion mutant (coi1-21 SALK lines)

were identified by PCR using corresponding gene-specific primers, forward primer 5ʹ′-TGGACCATATAAATTCATGCAGTC-3ʹ′ and reverse primer

5ʹ′-CTGCAGTGTGTAACGATGCTC-3ʹ′, and the T-DNA insertion-specific primer

5ʹ′-GCGTGGACCGCTTGCTGCAACT-3ʹ′. PCR was performed with two paired primers:

(i) forward primer and reverse primer, and (ii) LBb1 and reverse primer. The amplification

of PCR products by primer pair (i) represents the wild-type or heterozygous lines, and the

amplification of PCR products by primer pair (ii) represents homozygous or heterozygous

lines. The npr1-3 and ein2-1 mutations were checked by corresponding derived

cleaved-amplified polymorphic sequence (dCAPS) primers designed by using the dCAPS

Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html): 5ʹ′-GGCCGACTATGTGTAGAAATACGATAT-3ʹ′ and

5ʹ′-CCATTGCAGCTTGTGCTTCCGTTGG-3ʹ′ for npr1-3 and

5ʹ′-GGATACTACGTCTGTTACTAGC-3ʹ′ and 5ʹ′-GTCTTCCTTAAGACTACTAACTC-3ʹ′

for ein2-1. Each type of PCR product (wild-type or mutant) was cleaved with the

corresponding enzyme (EcoRV for npr1-3, XhoI for ein2-1). The sid2-2 mutation was also

checked by the corresponding specific primers, 5ʹ′-TGCAGCTTCAATGCTTCATTTCTTG-3ʹ′ and

5ʹ′-TTACAAGAGAGACAACATTGCTTTC-3ʹ′.

Quantitative reverse transcription-PCR analysis

Total RNA was isolated from three sets of eight cotyledons collected from four different

plants using the Qiagen RNeasy Plant Mini Kit and were treated with DNase (Promega

RQ1 RNase-free DNase) to remove DNA contamination. A TaKaRa PrimeScriptTM RT

reagent kit was used to obtain cDNA (TaKaRa Bio Inc., Shiga, Japan). The PCR products

were amplified with the TAKARA SYBR Premix Extaq and Thermal cycler Dice Real time

system TP800. The expression of Actin2 (At3g18780) was used as a control for normalizing

the amount of cDNA. The primers used for detection of the PDF1.2a–GFP transcript were forward primer 5ʹ′-TCCAGGAGCGCACCATCTTCTT-3ʹ′ and the reverse primer

5ʹ′-TTGTACTCCAGCTTGTGCCCCA-3ʹ′. The primers for detection of Actin2 transcript

were forward primer 5ʹ′-ACCTTGCTGGACGTGACCTTACTGAT-3ʹ′ and reverse primer

5ʹ′-GTTGTCTCGTGGATTCCAGCAGCTT-3ʹ′.

Microscopy

To investigate infection behavior of C. gloeosporioides expressing red fluorescent protein

(RFP) on Arabidopsis, plants were mounted in water under a cover slip with the inoculated

surface facing the objective lens (Hiruma et al., 2010). The invasion ratio (%) was

calculated by the following numerical formula: (the number of conidia with formation of invasive hypha) / (the number of conidia) × 100. At least 100 conidia were observed in

each experiment ~14 h after inoculation. Each line was tested in three independent

experiments. For plasmolysis assay, the inoculated cotyledons were treated with 0.8 M

mannitol solution for 15 min. Detection of GFP and RFP fluorescence was performed using

an Olympus Fluoview FV500 confocal microscope (Olympus, http://www.olympus-global.com), with a 40× or 60× PlanApo (1.4 numerical aperture)

oil-immersion objective (Nikon, http://www.nikon.com). The samples were excited with

the argon laser for GFP and HeNe laser for RFP. We used a diachronic mirror DM488/543,

beam splitter SDM560, and emission filter BA505-525 for GFP or BA5601F for RFP

fluorescence detection.

Plasmid constructs

Supplemental Table S1 provides the sequence information for the primers used for plasmid

construction in this study. For the construction of pBIC–NP–PDF1.2a–GFP (to generate the NP–PDF–GFP plants), we first amplified the sequence containing the native 5ʹ′ regulatory

PDF1.2a sequence, which is directly upstream from the start codon of PDF1.2a, and the

entire PDF1.2a gene sequence (named NP–PDF1.2a sequence) using primers FSaPDF and

RPDF. The GFP sequence was also amplified with primers FPDF–GFP and RGFP.

NP–PDF1.2a fused to the GFP sequence was then amplified by mixing the two PCR

products using FSaPDF and RGFP, which produced the NP–PDF1.2a–GFP sequence. After

digestion with SalI and EcoRI, the NP–PDF1.2a–GFP sequence was ligated into pBICP35

(Mori et al., 1991), which resulted in pBIC–NP–PDF1.2a–GFP. To construct

pBIC35S–NP–PDF1.2a–GFP to generate the PDF–GFP plants, we amplified the

NP-PDF1.2a sequence using primers FBaPDF and RPDF. The GFP sequence was also

amplified using primers FPDF–GFP and RGFP. The NP–PDF1.2a–GFP sequence was then

amplified by mixing the two PCR products using FBaPDF and RGFP. After digestion with

BamHI and EcoRI, the NP–PDF1.2a–GFP sequence was ligated into pBICP35, which

resulted in pBIC35S–NP–PDF1.2a–GFP. To construct pBIC35S–NP–SP–GFP to generate the SP–GFP plants, we amplified the 5ʹ′ regulatory sequence and the sequence encoding the

signal peptide (SP) of PDF1.2a using primers FBaPDF and RSP (NP–SP sequence). We

also amplified the GFP sequence using primers FSP-GFP and RGFP. The NP–SP–GFP

sequence was then amplified by mixing the two PCR products using primers FBaPDF and

RGFP. After digestion with BamHI and EcoRI, the NP–SP–GFP sequence was ligated into

pBICP35, which resulted in pBIC35S–NP–SP–GFP. To construct pBIC35S–PR1–GFP,

pBIC35S–PR3–GFP, and pBIC35S–PR4–GFP, we amplified the entire PR1, PR3, and PR4

sequences using the paired primers FStPR1 and RPR1 (for PR1), FStPR3 and RPR3 (for

PR3), and FStPR4 and RPR4 (for PR4), respectively. We also amplified the GFP sequence

using the paired primers FPR1–GFP and RGFP (for PR1), FPR3–GFP and RGFP (for PR3),

and FPR4–GFP and RGFP (for PR4). The PR1–GFP, PR3–GFP, and PR4–GFP sequences

were then amplified by mixing the two PCR products using the paired primers FStPR1 and

RGFP (for PR1), FStPR3 and RGFP (for PR3), and FStPR4 and RGFP (for PR4). After

digestion with StuI and EcoRI, each fragment was ligated into pBICP35, which resulted in

pBIC35S–PR1–GFP, pBIC35S–PR3–GFP, and pBIC35S–PR4–GFP.

Microprojectile bombardment

A microprojectile bombardment assay was performed using a PDS1000 helium particle gun

(Bio-Rad, Richmond, CA, USA) following the conditions described in Tamai and Meshi

(2001) and Kaido et al. (2011). Three mg of gold particles were coated with 5 µg of

plasmid DNA ptd/MEB2 (Yamada et al., 2013). ptd/MEB2 carries Pro-35S:tdTom-MEB2,

which encode fusion proteins of tdTomato (tdTOM) (Shaner et al., 2004) with MEB2.

Eight-day-old seedlings of PDF–GFP plants were bombarded, then incubated at 24 °C for 1

day. Detection of GFP and tdTOM fluorescence was performed using an Olympus

Fluoview FV500 confocal microscope (Olympus). The samples were excited with the argon

laser for GFP and HeNe laser for tdTOM. We used a diachronic mirror DM488/543, beam

splitter SDM560, and emission filter BA505-525 for GFP or BA5601F for tdTOM

fluorescence detection.

Accession numbers

The GenBank accession numbers for the genes used in this study are shown in parentheses:

EDR1 (At1g08720), PDF1.2a (At5g44420), PR1 (At2g14610), PR3 (At3g12500), PR4

(At3g04720), SID2 (At1g74710), NPR1 (At1g64280), EIN2 (At5g03280), COI1

(At2g39940), ACTIN2 (At3g18780).

Supplemental References

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated

transformation of Arabidopsis thaliana. Plant J 16: 735-743 Hiruma K, Onozawa-Komori M, Takahashi F, Asakura M, Bednarek P, Okuno T,

Schulze-Lefert P, Takano Y (2010) Entry mode-dependent function of an indole glucosinolate pathway in Arabidopsis for nonhost resistance against anthracnose pathogens. Plant Cell 22: 2429-2443

Kaido M, Funatsu N, Tsuno Y, Mise K, Okuno T. (2011) Viral cell-to-cell movement requires

formation of cortical punctate structures containing Red clover necrotic mosaic virus

movement protein. Virology 413:205–215 Mori M, Mise K, Kobayashi K, Okuno T, Furusawa I (1991) Infectivity of plasmids containing

brome mosaic virus cDNA linked to the cauliflower mosaic virus 35S RNA promoter. J Gen Virol 72 ( Pt 2): 243-246

Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY (2004)

Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma

sp. red fluorescent protein. Nat Biotechnol 22: 1567–1572

Tamai A, Meshi T (2001) Tobamoviral movement protein transiently expressed in a single

epidermal cell functions beyond multiple plasmodesmata and spreads multicellularly in an

infection-coupled manner. Mol Plant-Microbe Interact 14: 126–134. Yamada K, Nagano AJ, Nishina M, Hara-Nishimura I, Nishimura M (2013) Identification of

two novel endoplasmic reticulum body-specific integral membrane proteins. Plant Physiol

161: 108–12

Legends to Supplemental Figures

Supplemental Figure S1.

Quantitative reverse transcription-PCR analysis of the expression level of the

PDF1.2a–GFP fusion gene in generated transgenic lines. Expression of the PDF1.2a–GFP

gene was induced 9 h after Cg inoculation with Glc in the transgenic Arabidopsis line

designated NP–PDF–GFP expressing PDF1.2a–GFP under the putative PDF1.2a native

promoter; this is shown in comparison with before inoculation (0 h). The expression level

of the PDF1.2a–GFP gene was much higher in PDF–GFP plants than in NP–PDF–GFP

plants. The PDF1.2a–GFP gene was highly expressed in PDF–GFP plants before Cg

inoculation. The mean and standard deviation were calculated from three independent

experiments.

Supplemental Figure S2.

Partial recovery of nonhost resistance against Cg in the edr1 mutant after expression of

PDF1.2a–GFP. Nonhost resistance against Cg was partially recovered in the PDF–GFP

plants carrying the edr1 mutation compared with the original edr1 mutant. Cg with Glc was

inoculated on the tested plants. At 14 hpi, the invasion ratio was examined. At least 100

conidia were observed in each experiment. The mean and standard deviation were

calculated from three independent experiments.

Supplemental Figure S3.

Location of the fluorescence signal of GFP having HDEL in ER bodies even when ESPER

is activated. Cg with Glc was inoculated on cotyledons of the GFP-h plants expressing GFP

with an ER-retention signal (HDEL). As a control, Glc was also administered. At 16 hpi, fluorescence was detected in ER bodies in each treatment. Bar = 50 µm.

Supplemental Figure S4.

Unlikely activation of ESPER when the pathogens try to enter through appressoria

pigmented with melanin. Each pathogen was inoculated on the PDF-GFP plant. At 16 hpi,

the fluorescence of PDF1.2a–GFP was investigated by confocal microscopy. Cg and C.

orbiculare (Co) were inoculated without Glc. In both inoculations, ESPER was not

detected, although the PDF1.2a–GFP signal occasionally exhibited focal accumulation underneath the melanized appressoria (represented by a white arrow). Bars = 50 µm.

0 h 9 h 0 h 9 h 0 h 9 hCol-0 NP-PDF-GFP PDF-GFP

Cg

Rel

ativ

e ge

ne e

xpre

ssio

n

Watanabe et al.Supplemental Fig. S1

100

10

1

0.1

0.01

Supplemental Figure S1.Quantitative reverse transcription-PCR analysis of the expression level of the PDF1.2a–GFP fusion gene in generated transgenic lines. Expression of the PDF1.2a–GFP gene was induced 9 h after Cg inoculation with Glc in the trans-genic Arabidopsis line designated NP–PDF–GFP expressing PDF1.2a–GFP under the putative PDF1.2a native promoter; this is shown in comparison with before inoculation (0 h). The expression level of the PDF1.2a–GFP gene was much higher in PDF–GFP plants than in NP–PDF–GFP plants. The PDF1.2a-GFP gene was highly expressed in PDF–GFP plants before Cg inoculation. The mean and standard deviation were calculated from three independent experiments.

Fung

al e

ntry

rate

(%)

Cg

with PDF-GFPedr1

Watanabe et al.Supplemental Fig. S2

edr1Col-0

30

25

20

15

10

5

0

Supplemental Figure S2.Partial recovery of nonhost resistance against Cg in the edr1 mutant after expres-sion of PDF1.2a–GFP. Nonhost resistance against Cg was partially recovered in the PDF–GFP plants carrying the edr1 mutation compared with the original edr1 mutant. Cg with Glc was inoculated on the tested plants. At 14 hpi, the invasion ratio was examined. At least 100 conidia were observed in each experiment. The mean and standard deviation were calculated from three independent experiments.

Cg with GlcGlc

Watanabe et al.Supplemental Fig. S3

Supplemental Figure S3.Location of the fluorescence signal of GFP having HDEL in ER bodies even when ESPER is activated. Cg with Glc was inoculated on cotyledons of the GFP-h plants expressing GFP with an ER-retention signal (HDEL). As a control, Glc was also administered. At 16 hpi, fluorescence was detected in ER bodies in each treat-ment. Bar = 50 μm.

Inoculation of Co Inoculation of Cg without Glc

Watanabe et al.Supplemental Fig. S4

Supplemental Figure S4.Unlikely activation of ESPER when the pathogens try to enter through appressoria pigmented with melanin. Each pathogen was inoculated on the PDF-GFP plant. At 16 hpi, the fluorescence of PDF1.2a–GFP was investigated by confocal micros-copy. Cg and C. orbiculare (Co) were inoculated without Glc. In both inocula-tions, ESPER was not detected, although the PDF1.2a–GFP signal occasionally exhibited focal accumulation underneath the melanized appressoria (represented by a white arrow). Bars = 50 μm.

Supplemental Table S1. The list of primers used for plasmid construction in this study

FSP-GFP GCGAGGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGAGG

RGFP

FPR3-GFPCCATACGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGAGGFPR1-GFP

RSP

RPR1GAAGGCCTAAGGAGATATAACAATGCCTCCACAAAAAGAAAACC

GAAGGCCTAAGGAGATATAACAATGAAGATCAGACTTAGC

FPR4-GFP CGCGTTGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGAGG

FStPR4RPR3

TCCACCTCCACCTCCCTCGCACAACTTCTGTGC

TCCACCTCCACCTCCGTATGGCTTCTCGTTCACATAATTCC

Primer name Sequence

FSaPDF ACGCGTCGACCGACGTTGGACTGTTTCATCATATCCCFBaPDFRPDF

CGGGATCCCGACGTTGGACTGTTTCATCTCCACCTCCACCTCCACATGGGACGTAACAGATAC

RPR4FPDF-GFP

GAAGGCCTAAGGAGATATAACAATGAATTTTACTGGCTATTCTC

GCTATTGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGAGG

CGGAATTCTTACTTGTACAGCTCGTCC

FStPR1

FStPR3TCCACCTCCACCTCCAATAGCAGCTTCGAGGAGGCCGTTAACG

TCCACCTCCACCTCCAACGCGATCAATGGCCGAAACAAGCCATGTGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGAGG