Supplementary Information - media.nature.com · glaucoma cases and 3,266 controls from Italy, the USA, Mexico, Russia, Greece, South Africa, Pakistan, and India. The number of individuals

Supplementary Information

Aung T, Ozaki M, Lee MC, Schlötzer-Schrehardt U, Thorleifsson G, Mizoguchi T, Igo RP Jr., Haripriya A, Williams

SE, Astakhov YS, Orr AC, Burdon KP, Nakano S, Mori K, Abu-Amero K, Hauser M, and others.

Genetic association study of exfoliation syndrome identifies a protective rare variant at LOXL1 and five new

susceptibility loci

Supplementary Figure 1

Genome-wide significant allele reversal observed for the classical LOXL1 common variants rs3825942

and rs1048661. The effect of the rs3825942-A (p.153Asp) allele is significantly reversed in Black

Africans (Nigeria and South Africa), whereas the effect of the rs1048661-T (p.141Leu) allele is

significantly reversed in Eastern Asia (Vietnam, Japan, Korea, and Beijing).

Nature Genetics: doi:10.1038/ng.3875


Distribution of exfoliation syndrome (XFS) cases and controls.

(Upper panel) Cases and controls are drawn from six continents around the world. The contribution from countries

for the stages of analysis are appended, with numbers of cases and controls shown per-country. For countries

contributing samples for both discovery and replication stages, the numbers in parenthesis reflect numbers

contributed for the replication stage.

(Lower panel) Genetic ancestry analysis for the GWAS discovery case-control series where individual level data is

available for calculation. The first two principal components of genetic stratification are projected with XFS cases on

the left and controls on the right. Samples are color-coded as shown in the legend.



Distribution of XFS cases and controls in the GWAS discovery collection. XFS cases and normal controls are projected onto the top 2

principal components of genetic stratification, with cases on the left and controls on the right.



Analysis of non-synonymous variant burden from the LOXL1 resequencing exercise.

a) LOXL1 non-synonymous mutations detected after sequencing 2,827 XFS and glaucoma cases and 3,014

controls from Japan. Mutations are labelled as ‘DAMAGING’ if they were predicted to be damaging or deleterious

by all five protein prediction soft wares (SIFT, Polyphen2-HumDiv, LRT score, MutationTaster, and Condel).

Otherwise, they are labelled as ‘TOLERATED’.

The number of individuals carrying a particular mutation is given in parenthesis next to the annotation.


b) LOXL1 non-synonymous mutations predicted to be deleterious by all five protein prediction softwares (SIFT,

Polyphen2-HumDiv, LRT score, MutationTaster, and Condel) from Japan. A total of 2,827 XFS and glaucoma

cases and 3,014 controls were tested.



c) LOXL1 non-synonymous mutations detected after sequencing 2,743 XFS and glaucoma cases and 3,266

controls from Italy, the USA, Mexico, Russia, Greece, South Africa, Pakistan, and India.

Mutations are labelled as ‘DAMAGING’ if they were predicted to be damaging or deleterious by all five protein

prediction soft wares (SIFT, Polyphen2-HumDiv, LRT score, MutationTaster, and Condel). Otherwise, they are

labelled as ‘TOLERATED’.



d) Deleterious ‘strict’ mutations (predicted to be damaging or deleterious by all five protein prediction softwares;

SIFT, Polyphen2-HumDiv, LRT score, MutationTaster, and Condel) detected after sequencing 2,743 XFS and

glaucoma cases and 3,266 controls from Italy, the USA, Mexico, Russia, Greece, South Africa, Pakistan, and India.




Principal component analysis for Japanese XFS cases and normal controls where the protective LOXL1

p.Y407F mutation was found. Carriers of the rare p.407F allele did not stratify along the top two axes of

genetic stratification.

The lower panel shows association analysis between LOXL1 p.Y407F and exfoliation syndrome in 3,061

Japanese cases and 2,968 controls with genome-wide genotyping data. Association results are

presented as an unadjusted genotype-based test using Fisher’s exact test, as well as in various logistic

regression frameworks (unadjusted, adjusted for the top principal component, adjusted for the top five

principal components, and adjusted for the top ten principal components). The observations suggest that

the association between LOXL1 p.Y407F and exfoliation syndrome is unlikely to be confounded by

cryptic population stratification.

Variant Amino acid substitution

Genotype count XFScases

Genotype count controls Test OR 1/OR P-value

rs201011613 (A>T) p.Y407F 0/1/3060 0/35/2933 Genotype test (Fisher's exact) 0.028 35.7 3.1 x 10-10

Logistic regression (likelihood ratio test), unadjusted 0.02739 36.5 9 x 10-11

Logistic regression (likelihood ratio test) PC1 0.02738 36.5 8.97 x 10-11

Logistic regression (likelihood ratio test) PC1-PC5 0.02717 36.8 8.14 x 10-11

Logistic regression (likelihood ratio test) PC1-PC10 0.02716 36.8 8.15 x 10-11

The likelihood ratio test performed within a logistic regression framework has been previously

described1,2.



Secretion assays and Western blot analysis assessing the effect of LOXL1 variant haplotypes.

(a) Secretion of LOXL1 according to variant haplotypes by HLECs. Data represent mean ± s.e.m. of six

independent experiments, N.S., not significant.

(b) Protein blots of HLEC lysates that were nucleofected with 1μg empty pCI-puro vector (V), or relevant

C-term HA-tagged pCI-puro-LOXL1-(G-A-T), -(G-A-A), -(T-G-A) or –(G-G-A) haplotype with an

increasing dosage of 0.5, 1, and 1.5μg to mediate transient overexpression of the respective variants.

GAPDH was applied as an internal loading control for each sample, and V cell lysate was used to

demonstrate the specificity of LOXL1 overexpression effects. We tested for effects on elastin, collagen

IV, and fibronectin.

a)

b)



Cumulative average of impedance values (as a surrogate for cellular adhesion strength) measured over

35 hours post nucleofection of HLECs overexpressing LOXL1 p.Y407F in all possible haplotypic

backgrounds for p.R141L and p.G153D. Data represent mean ± s.e.m. of seven independent

experiments. N.S., not significant; **P<0.0001.



Manhattan plot for the GWAS discovery stage comprising 9,035 XFS cases and 17,008 controls. The

corresponding quantile-quantile plot is inset. In this GWAS discovery stage, SNP markers at the known

LOXL1 locus as well as the newly identified POMP locus (P = 2.97 x 10-10) have significant associations.

There appears to be a significant excess of small P-values at the tail end of the quantile-quantile

distribution, suggesting that more XFS susceptibility loci remains to be found. Double genomic control

corrections were applied for all association statistics comprising this plot.


Supplementary figure 9

Forest plots for the five newly identified XFS susceptibility loci. Squares represent the estimated odds

ratios (ORs) per-copy of the risk allele for each country collection. The area of the square is scaled in

proportion to the variance of the estimate, and the horizontal lines representing the 95 percent

confidence intervals. The diamonds, accompanied by P-values, represent the summary estimates for the

GWAS discovery, overall replication, as well as meta-analysis of all data.




Regional association plots for the five newly identified genome-wide significant loci. These plots

comprise directly genotyped SNPs as well as SNPs which were imputed at high quality (impute

information score ≥0.95, with allele dosages used for the imputed data association analyses [SNPTEST

software] in order to average across imputation uncertainty).The vertical axis of the left denote –Log10

association P-values, whereas the vertical axis on the right denote the recombination rate. The horizontal

axis show genomic location on hg19 build. The dashed vertical lines show the ± 150,000 base-pair

interval spanning the index SNPs for each locus. Most of the proxy SNPs showing r2 ≥ 0.5 with the index

SNP are located within this ± 150,000 base-pair interval, except for the chromosome 6 locus located

within the broad MHC region which is well known for long range, complex patterns of LD.

a) AGPAT1 rs3130283 locus on chromosome 6


b) TMEM136 rs11827818 locus on chromosome 11

c) POMP rs7329408 locus on chromosome 13


d) RBMS3 rs12490863 locus on chromosome 3

e) rs10072088 near SEMA6A locus on chromosome 5



A sample of genotyping cluster plots for the sentinel SNP markers mapping to the five genome-wide

significant loci. All five SNP markers rs7329408 (FLT1-POMP-SLC46A3 on chromosome 13),

rs11827818 (TMEM136-ARHGEF12 on chromosome 11), rs3130283 (AGPAT1 on chromosome 6),

rs12490863 (RBMS3 on chromosome 6), and rs10072088 (near SEMA6A on chromosome 5) show

clearly distinct genotyping clusters for the baseline homozygous, heterozygous carrier, and homozygous

variant alleles with no ambiguity.



Long non-coding RNA mapping to the chromosome 13 locus where FLT1, POMP, and SLC46A3 are

located. The index SNP (rs7329408) maps precisely onto the long non-coding RNA. The output is from

the UCSC genome browser, on hg19 build.



Expression of POMP, FLT1, SLC46A3, TMEM136, ARHGEF12, and AGPAT1 in ocular tissues of normal

human donors as determined by real-time PCR technology. The expression levels were normalized

relative to GAPDH and the results are expressed as mean (2 -ΔCT / 1,000) ± SD (n=4). CO, cornea; TM,

trabecular meshwork; IR, iris; LE, lens; CB, ciliary body; RE, retina; CH, choroid; LC, lamina cribrosa;

ON, optic nerve.


Supplementary Figure 14 Genotype-correlated expression of POMP, FLT1, SLC46A3, TMEM136, ARHGEF12, and AGPAT1 in iris

tissue, ciliary body, and retina of donors with and without XFS (n=60) as determined by real-time PCR

technology. The expression levels were normalized relative to GAPDH and the results are expressed as

mean (2 -ΔCT / 1,000) ± SD; rs7329408: G/G (n = 33), G/A (n = 24), A/A (n = 3); rs11827818: A/A (n =

38), A/G (n = 19), G/G (n = 3); rs3130283: C/C (n=42), C/A (n=15), A/A (n=3). The expression levels did

not display any significant differences between genotype groups but showed a trend for reduced

expression of POMP in risk A allele carriers.



Expression of POMP, FLT1, SLC46A3, TMEM136, ARHGEF12, and AGPAT1 in iris tissue, ciliary body,

and retina of normal human donor eyes (control) and donor eyes with XFS, as determined by real-time

PCR technology. The mRNA expression levels were normalized relative to GAPDH and the results are

expressed as mean (2 -ΔCT / 1,000) ± SD (n = 21 for each group). In eyes from XFS patients,

expression levels of POMP were reduced by 28% and 36% in iris and ciliary body, and expression levels

of TMEM136 were significantly reduced by 41% and 33% in both anterior segment tissues, respectively,

when compared against control eyes. In contrast, tissue expression levels of all other genes did not

display significant differences between groups; * P <0.005, **P<10-4.


Supplementary Figure 16: Full length Western blot gel for POMP

Western blot - POMP Iris, Fig. 3G (main text) Western blot - ß-actin Iris, Fig. 3G (main text)

Western blot - POMP Ciliary body, Fig. 3G (main text) Western blot - ß-actin Ciliary body, Fig. 3G (main text)

Western blot - POMP Iris, Suppl. Fig. 19 Western blot - ß-actin Iris, Suppl. Fig. 19

Western blot - POMP Ciliary body, Suppl. Fig. 19 Western blot - ß-actin Ciliary body, Suppl. Fig. 19

-70 kD -55 kD

-35 kD

-70 kD -55 kD

-70 kD -55 kD

-35 kD

-70 kD -55 kD

-35 kD

-70 kD -55 kD

-70 kD -55 kD

-70 kD

-55 kD

-70 kD

-55 kD

-35 kD

POMP

POMP

POMP

POMP


Supplementary Figure 17: Full length Western blot gel for TMEM136

Western blot - TMEM Iris, Fig. 4G (main text) Western blot - ß-actin Iris, Fig. 4G (main text)

Western blot - TMEM Ciliary body, Fig. 4G (main text) Western blot - ß-actin Ciliary body, Fig. 4G (main text)

-70 kD -55 kD

-35 kD -25 kD TMEM136

-70 kD -55 kD

-35 kD -25 kD

TMEM136

-70 kD

-55 kD

-70 kD

-55 kD


Western blot - TMEM Iris, Suppl. Fig. 20 Western blot - ß-actin Iris, Suppl. Fig. 20

Western blot - TMEM Ciliary body, Suppl. Fig. 20 Western blot - ß-actin Ciliary body, Suppl. Fig.20

-70 kD -55 kD

-35 kD -25 kD

-70 kD -55 kD

-35 kD -25 kD

TMEM136

TMEM136

-70 kD

-55 kD

-70 kD

-55 kD



Replication experiments testing for TMEM136, POMP and LOXL1 expression in eye tissues.

a) Replication experiments for the expression of TMEM136, POMP and LOXL1 protein in ocular tissues

of control donor eyes and XFS donor eyes as determined by immunohistochemistry.

(i) Immunofluorescence labelling of POMP (red), TMEM136 (green) and LOXL1 (magenta) in non-XFS

control eye tissues shows significantly stronger immunopositivity in trabecular meshwork (TM) and

Schlemm’s canal endothelium (SC) compared to XFS eye tissues. Scale 30um.

(ii) Marked reduction in POMP, TMEM136 and LOXL1 immunofluorescence was observed in XFS donor

eyes compared to the non-XFS control eyes in ciliary epithelia. LOXL1-positive exfoliation material

(arrows) near the ciliary epithelia colocalized with both POMP and TMEM136. Scale 30um. NPCE: non-

pigmented ciliary epithelium. PCE: pigmented ciliary epithelium



b) Replication experiments for the expression of TMEM136, POMP and LOXL1 protein in iris tissue of

control donor eyes and XFS donor eyes determined by immunohistochemistry.

(i) Immunofluorescence labelling of POMP (red), TMEM136 (green) and LOXL1 (magenta) in non-XFS

control eye tissues shows a significantly stronger immunopositivity in iris stroma (IS) and iris anterior

border cell layer (ABC) when compared to XFS eye tissues. In contrast, there was no difference in

immunopositivity for TMEM136, POMP, and LOXL1 when the pigmented iris epithelium (PIE) of XFS

eyes and control eyes were compared. LOXL1-positive exfoliation material (arrows) near the iris was

found to colocalize with both POMP and TMEM136. Scale 90um.

(ii) LOXL1 was found to be expressed at negligible levels in iris capillaries of XFS eyes while clear

positive expression was observed in the iris capilaries of control eyes. We observed reduced staining of

POMP and TMEM136 in the iris capilaries of XFS eyes compared to control eyes. Scale 15um.



Supplementary Figure 19 Expression of POMP protein in ocular tissues of human donor eyes and donor eyes with XFS, as determined by immunohistochemistry and Western blotting. Immunofluorescence labeling of normal eye tissues shows punctate POMP immunopositivity (green fluorescence) in cells of iris stroma, particularly individual stromal cells (arrows) (A), ciliary processes (B), retinal layers (C), trabecular meshwork (D), ciliary epithelium (E), and blood vessels and cells (arrow) of the iris stroma (F). Reduced POMP protein expression levels are seen in iris (A‘), ciliary body (B‘), trabecular meshwork (D‘), ciliary epithelium (E‘) and iris blood vessels (F‘), but not in retinal tissues (C‘) of XFS eyes. Reduced POMP protein expression levels are confirmed in iris (G) and ciliary body tissues (H) of XFS eyes compared to age-matched controls by Western blot analysis (n=3). (BV blood vessel, CE ciliary epithelium, GCL retinal ganglion cell layer, INL inner nuclear layer, IPE iris pigment epithelium, ONL outer nuclear layer, SC Schlemm‘s canal, ST stroma; DAPI nuclear counterstain in blue; original magnification x100 in A,B,C,D and x250 in E,F).



Supplementary Figure 20 Expression of TMEM136 protein in ocular tissues of human donor eyes and donor eyes with XFS, as determined by immunohistochemistry and Western blotting. Immunofluorescence labeling of normal eye tissues shows cytoplasmic TMEM136 immunopositivity (green fluorescence) in cells of iris stroma, particularly in blood vessel endothelia (arrows) (A), ciliary processes (B), retinal layers and blood vessels (C), trabecular meshwork and Schlemm‘s canal wall (D), ciliary epithelium (E), and blood vessel endothelia of the iris (F). Reduced TMEM136 protein expression levels are seen in iris (A‘), ciliary body (B‘), trabecular meshwork (D‘), ciliary epithelium (E‘) and iris blood vessels (F‘), but not in retinal tissues (C‘) of XFS eyes; exfoliation material deposits on ocular surfaces are marked by arrows in B‘ and E‘. Reduced TMEM136 protein expression levels are confirmed in iris (G) and ciliary body tissues (H) of XFS eyes compared to age-matched controls by Western blot analysis (n=3). (BV blood vessel, CE ciliary epithelium, GCL retinal ganglion cell layer, INL inner nuclear layer, IPE iris pigment epithelium, ONL outer nuclear layer, SC Schlemm‘s canal, ST stroma; DAPI nuclear Counterstain in blue; original magnification x100 in A,B,C,D and x250 in E,F).




Genomic map spanning the sequenced LOXL1 locus (from hg19/b37; chr15:74,200,000 to 74:260,000).

The genetic maps are shown for i) South Asians, ii) Europeans, iii) East Asians, and iv) South Africans.

The panels from top to bottom show the following: Summarized scores from the publicly available

RegulomeDB database. We used this database (Boyle AP et al., Genome Research 2012, 22:1790-

1797) to search for regulatory elements in non-coding regions of the human genome. RegulomeDB

scores range from 1 to 6, with 1 having the most data supporting the presence of regulatory elements

(e.g. eQTL + transcription factor / DNAse peak) and 6 having no supporting data. The panel for

recombination rate is shown below the RegulomeDB panel. This is followed by three panels showing

ENCODE elements (The ENCODE Project Consortium. Nature 2012; 489:57-74) within the locus. Below

the ENCODE panels, we show the genomic location of LOXL1 and LOXL1-AS1. The lowermost panel

shows pair-wise linkage disequilibrium (LD) measurements between genetic polymorphisms detected

from the LOXL1 deep sequencing effort. The measure of LD is shown in the accompanying color key.

The two classical LOXL1 alleles rs1048661 and rs3825942 are also marked.

i) South Asians


ii) Europeans

iii) East Asians


iv) South Africans



Quantile-quantile plots for the GWAS discovery stage. The genomic inflation factor (λgc) as included in

Supplementary Table 2.



Regional association analysis of the LOXL1 locus on chromosome 15. SNP markers from the GWAS

discovery meta-analysis comprising 9,035 XFS cases and 17,008 controls from 25 individual case-

control strata are plotted by genomic location (horizontal axis), statistical significance (vertical axis, left

hand side), and I2 index for heterogeneity (shaded scale on right hand vertical axis, from 0% - 100%). I2

= 0% denotes no inter-collection heterogeneity, and I2 > 75% denote very high heterogeneity. The vast

majority of significant SNP markers at this locus show I2 > 75%, as all of them show allele reversal

depending on ethnic group (see example in Supplementary Figure 1).


Supplementary Table 1

Case-control series per-country site for the complete resequencing study on LOXL1 and CACNA1A.

Collection N Cases N Controls

Japan 2827 3013

Italy 454 267

South Africa 95 250

Greece 355 1075

India 648 263

Pakistan 383 186

Mexico 116 205

Russia 476 859

USA 212 161

Grand total 5566 6279

The initial 2,827 cases and 3,013 controls from Japan which underwent re-sequencing were enrolled from

December 2007 to January 2015. To replicate the significant association seen at LOXL1 p.Y407F, a total of 1,082

exfoliation syndrome cases and 2,325 controls from Japan were enrolled. These samples were collected between

February 2015 and December 2016 and did not undergo deep sequencing of the entire LOXL1 locus.



Case-control series per-country site for the world-wide GWAS partnership study on exfoliation syndrome.

Discovery GWAS

Collection Latitude band Geographical region N

cases N

controls λgc

Singapore 0° - 10° East Asia 112 591 1

Nigeria 0° - 10° West Africa 33 26 1

Thailand 10° - 20° East Asia 88 270 1

Guatemala 10° - 20° Central America 29 40 1

Saudi Arabia 20° - 30° Greater Middle East 306 170 1.022

Mexico 20° - 30° Central America 127 224 1.023

Japan GWAS 30° - 40° East Asia 3061 2968 1.02

USA GWAS 40° - 50° North America 1124 4894 1.013

Turkey 30° - 40° Greater Middle East 352 210 1.022

Pakistan 30° - 40° South Asia 297 618 1.035

Greece 30° - 40° Southern Europe 249 623 1.01

Morocco 30° - 40° North Africa 173 132 1.019

Korea 30° - 40° East Asia 146 535 1.014

Argentina 30° - 40° South America 137 149 1.022

Iran 30° - 40° Greater Middle East 132 163 1.021

South Africa 30° - 40° South Africa 109 269 1.027

China (Beijing) 30° - 40° East Asia 103 2049 1

Georgia 30° - 40° Eastern Europe 83 103 1.013

Austria 40° - 50° Central Western Europe 325 452 1.032

Germany GWAS 50° - 60° Central Western Europe 755 1243 1

Russia St Petersburg GWAS 50° - 60° Eastern Europe 387 674 1.008

Canada 40° - 50° North America 341 247 1.023

Poland 50° - 60° Central Western Europe 276 165 1.01

Russia Republic of Bashkortostan 50° - 60° Eastern Europe 124 116 1.025

Finland 60° - 70° Northern Europe 166 77 1.026

Discovery GWAS meta-analysis 9035 17008 1.07


Replication collections

Collection Latitude band Ethno-geographical classification

N cases

N controls

Vietnam 10° - 20° East Asia 90 2018

India 10° - 20° South Asia 936 2962

Australia 20° - 30° Central Western Europe 462 2466

USA replication 40° - 50° North America 191 1301

Japan replication 30° - 40° East Asia 400 880

Georgia 30° - 40° Eastern Europe 36 55

Switzerland 40° - 50° Central Western Europe 38 41

Peru 0° - 10° South America 44 88

Italy 40° - 50° Southern Europe 474 1511

Spain 40° - 50° Southern Europe 259 1066

China (Xinjiang) 40° - 50° Central Asia 50 50

Romania 40° - 50° Eastern Europe 86 103

France 40° - 50° Central Western Europe 23 42

Germany replication 50° - 60° Central Western Europe 741 1325

Denmark 50° - 60° Northern Europe 59 59

Canada replication 40° - 50° North America 136 747

Russia St Petersburg replication 50° - 60° Eastern Europe 214 400

Iceland 60° - 70° Northern Europe 564 78153

Total all replication collections 4803 93267

Total all samples in study 13838 110275



Association results for the two well-known LOXL1 common amino acid substitutions showing the reversal

in genetic effect (allele flip) in red for comparison. E.g. rs3825942-A is strongly associated with increased

risk of XFS (OR = 8.1) in South Africa, but associated with decreased risk of XFS elsewhere. Similarly,

rs1048661-T is associated with increased risk of XFS (OR = 14.6) in Japan, but associated with

decreased risk of XFS elsewhere.

As I2 index for heterogeneity >95% (far exceeding the standard guideline of I2 > 75%), random effects

meta-analysis was performed.

rs3825942 p.G153D Effect Allele/ Other allele

Study weight (%)

Frequency in cases (%)

Frequency in controls (%)

OR P

Japan sequencing A/G 37.6 1.8 15.7 0.10 1.3 x 10-152

Greece A/G 13.9 5.4 19.6 0.23 2.8 x 10-19

Italy A/G 1.2 0.3 16.9 0.02 3 x 10-35

Russia A/G 8.8 3.2 13.8 0.20 2.7 x 10-15

USA A/G 2.8 1.9 15.2 0.11 1.1 x 10-11

Mexico A/G 1.9 2.1 19.4 0.091 4.7 x 10-10

South Africa sequencing A/G 8.5 85.3 41.8 8.1 1.5 x 10-24

India A/G 15.4 4.6 24.6 0.15 8 x 10-37

Pakistan A/G 9.9 5.0 22.6 0.18 2 x 10-19

Meta-analysis 100% Phet I2 OR P-meta

<1 x 10-10

97.1% 0.26 0.0039

rs1048661 p.R141L Effect Allele/ Other allele

Study weight (%)

Frequency in cases (%)

Frequency in controls (%)

OR P

Japan sequencing T/G 40.8 93.9 51.3 14.6 < 1 x 10-100

Greece T/G 12.1 18.2 28.7 0.55 3 x 10-8

Italy T/G 9.1 18.8 32.8 0.47 1.7 x 10-9

Russia T/G 11.7 19.2 23.9 0.76 0.011

USA T/G 4.4 16.0 31.1 0.42 1.2 x 10-6

Mexico T/G 3.5 19.1 29.1 0.58 0.0057

South Africa sequencing T/G 0.1 0.5 14.4 0.031 1.2 x 10-7

India T/G 11.4 24.5 35.6 0.59 1.4 x 10-6

Pakistan T/G 6.8 18.9 32.0 0.50 9.8 x 10-7

Meta-analysis 100% Phet I2 OR P-meta

<1 x 10-10

98.3% 0.93 0.25



Association results from deep re-sequencing for the previously reported LOXL1 promoter variant

rs16958477 A>C. Freq cases (%) and Freq controls (%) denote frequency of the effect allele in cases

and controls, respectively in terms of absolute percentages.

rs16958477 Effect Allele Freq cases (%) Freq controls (%) OR P

Japan sequencing C 1.9 9.7 0.18 1.8 x 10-44

European sequencing C 60.9 41.8 2.20 1.7 x 10-12

South Africa sequencing C 5.3 9.8 0.51 0.057

South Asia sequencing C 31.9 15.7 2.50 2 x 10-12



Association results from the LOXL1 deep sequencing experiment for the three common SNPs

reported by Hauser et al. (Human Molecular Genetics 2015; 24:6552-63)

The genome-wide significantly reversed allele in South Africans in shown in red. The r2 value in

parenthesis next to SNP reflect pairwise linkage disequilibrium measures against the classical

rs3825942 G>A (p.153Gly>Asp) polymorphism.

Meta-analysis

Association with XFS Heterogeneity estimate

SNP (r2) BP Country A1 F_A F_U A2 P OR P OR Phet I2

rs1550437 74221298 Japan T 0.04 0.37 C 2.22 x 10-257 0.07 (0.62)

Italy T 0.02 0.18 C 1.76 x 10-27 0.10

South Africa T 0.88 0.54 C 3.10 x 10-16 6.09

India T 0.23 0.38 C 3.60 x 10-11 0.48

Pakistan T 0.14 0.26 C 2.11 x 10-6 0.48 2 x 10-143 0.27 4.9 x 10-95 98.3%

Greece T 0.08 0.22 C 2.18 x 10-12 0.33

Russia T 0.08 0.17 C 6.01 x 10-10 0.40

USA T 0.06 0.17 C 1.75 x 10-6 0.31

Mexico T 0.19 0.26 C 0.035 0.66

rs6495085 74221313 Japan C 0.015 0.15 G 1.93 x 10-96 0.08 (0.99)

Italy C 0.003 0.17 G 2.98 x 10-35 0.02

South Africa C 0.853 0.42 G 3.70 x 10-24 7.92

India C 0.047 0.25 G 6.88 x 10-37 0.15

Pakistan C 0.054 0.23 G 2.82 x 10-18 0.19 6 x 10-100 0.21 1.9 x 10-66 97.6%

Greece C 0.046 0.20 G 7.32 x 10-17 0.19

Russia C 0.032 0.14 G 2.70 x 10-15 0.20

USA C 0.019 0.16 G 5.52 x 10-12 0.10

Mexico C 0.038 0.18 G 1.61 x 10-7 0.18

rs6495086 74221492 Japan T 0 0 C NA NA (0.59)

Italy T 0.002 0.06 C 2.41 x 10-12 0.03

South Africa T 0.526 0.29 C 6.85 x 10-9 2.72

India T 0.015 0.04 C 0.0009 0.36

Pakistan T 0.014 0.05 C 0.00063 0.29 0.0028 0.69 2.3 x 10-24 93.9%

Greece T 0.012 0.09 C 1.74 x 10-9 0.12

Russia T 0.009 0.05 C 2.90 x 10-6 0.19

USA T 0.009 0.08 C 9.09 x 10-7 0.11

Mexico T 0.004 0.04 C 0.0057 0.10



(please refer to web-based excel table)

Genome-wide significant (P<5 x 10-8) SNPs emerging from the LOXL1 deep sequencing effort

after fixed effects meta-analysis is performed. Random effects meta-analysis was also

performed for comparison. No genetic marker retained genome-wide significance on random

effects analysis, fully in keeping with the phenomenon of allele reversal at this locus. The I2

index for heterogeneity is presented, together with the P-value for heterogeneity across XFS

case-control collections which underwent deep sequencing for the LOXL1 locus.

The rightmost column (Pcond) denotes the association P-value after fully conditioning for the

common LOXL1 polymorphisms led by rs3825942 G>A (p.153Gly>Asp).



Details of all 63 amino acid substitutions (excluding the well-known rs3825942 G>A for

p.153Gly>Asp and rs1048661 T>G for p.141Leu>Arg) which were detected from the deep-

resequencing of LOXL1 in 5,566 exfoliation syndrome cases and 6,279 controls from 9

countries. The output from the five functional effect prediction algorithms SIFT, Polyphen2-

HumDiv, LRT, MutationTaster, and Condel are appended.



Burden of LOXL1 rare, deleterious non-synonymous variants which do not segregate with the

‘protective’ rs3825942-A allele. The overall burden test for all collections after accounting for

LOXL1 common variants led by rs3925942 is P < 1 x 10-5.

a) Burden of LOXL1 rare, deleterious non-synonymous variants which do not segregate with the minor

‘protective’ rs3825942-A allele in Japan (P-value after conditioning for LOXL1 rs3825942 = 0.0007)

Genetic variant Amino

acid allele count cases

allele count controls SIFT Polyphen2 LRT score MutationTaster Condel

chr15-74238766 A>T Y407F 0 2 DAMAGING

probably DAMAGING Deleterious disease_causing deleterious

chr15-74240187 A>G I516V 0 1 DAMAGING


chr15-74240217 G>A V526M 0 2 DAMAGING


chr15-74241806 G>A V537M 0 2 DAMAGING


chr15-74235297 T>A L402Q 0 1 DAMAGING


chr15-74241846 A>G N550S 0 1 DAMAGING


Total 0 9

b) Burden of LOXL1 rare, deleterious non-synonymous variants which do not segregate with the

‘protective’ rs3825942-A allele in the rest of the world. (P-value after conditioning for LOXL1 rs3825942

= 0.0006; stratified meta-analysis of conditional results per-strata).

Genetic variant amino

acid

Population

allele count in

cases

allele count in controls SIFT Polyphen2 LRT MutationTaster Condel

chr15-74240188 T>A I516N

Russia 0 2 DAMAGING probably DAMAGING Deleterious disease_causing deleterious

chr15-74240217 G>A V526M

South Africa 0 1 DAMAGING probably DAMAGING Deleterious disease_causing deleterious

chr15-74238808 G>A R421H

Greece 0 1 DAMAGING probably DAMAGING Deleterious disease_causing deleterious

chr15-74238820 G>A R425H


India 0 2 DAMAGING possibly DAMAGING Deleterious disease_causing deleterious

Italy 0 1 DAMAGING possibly DAMAGING Deleterious disease_causing deleterious

South Africa 0 1 DAMAGING possibly DAMAGING Deleterious disease_causing deleterious

chr15-74239442 G>A D462N


India 1 0 DAMAGING probably DAMAGING Deleterious disease_causing deleterious

Italy 1 0 DAMAGING probably DAMAGING Deleterious disease_causing deleterious

chr15-74241806 G>A V537M


Italy 0 2 DAMAGING probably DAMAGING Deleterious disease_causing deleterious

chr15-74235285 A>C E398A

India 4 5 DAMAGING probably DAMAGING Deleterious disease_causing deleterious

chr15-74239539 G>A R494H

Pakistan 0 1 DAMAGING probably DAMAGING Deleterious disease_causing deleterious

chr15-74239560 C>A T501N

USA 1 0 DAMAGING probably DAMAGING Deleterious disease_causing deleterious

Total

8 19



Non-synonymous rare-variant burden testing for the CACNA1A deep sequencing data. The

CACNA1A locus (from chr19:13,307,000bp to 13,745,000bp on Hg19/b37) was subjected to

deep resequencing to a mean depth of 60X. We did not observe significant differential rare

variant burden at this locus in either the XFS cases or the controls.

All non-synonymous

N

cases N

controls Allele burden

in cases Allele burden in

controls Freq

cases (%) Freq

controls (%) OR P

East Asia (Japanese) 2827 3013 318 311 5.6 5.2 1.1 0.27

Europeans 1613 2567 83 151 2.6 2.9 0.87 0.32

South Africa 95 250 9 13 4.7 2.6 1.86 0.15

South Asians 1031 449 90 25 4.4 2.8 1.6 0.04

Deleterious ‘strict’

N cases

N controls

Allele burden in cases

Allele burden in controls

Freq cases (%)

Freq controls (%) OR P

East Asia (Japanese) 2827 3013 5 11 0.1 0.2 0.48 0.17

Europeans 1613 2567 0 4 0.0 0.1 0 0.11

South Africa 95 250 0 0 0 0 - -

South Asians 1031 449 0 1 0.0 0.1 0 0.13



Study power (expressed in %) as a function of allele odds ratio and minor allele frequency.

Conditions surpassing 80% power are highlighted in yellow. The power calculations are

presented as follows:

a) GWAS discovery stage for 9,035 XFS cases and 17,008 controls at P < 1 x 10-4

for follow up in

additional replication collection.

Odds Ratio

Min

or

alle

le f

req

uen

cy

1.10 1.125 1.15 1.175 1.20 1.25 1.30

0.01 0.24% 0.52% 1.1% 2.1% 3.7% 10% 21.7%

0.05 6% 16.3% 33.9% 55.7% 75.7% 96.3% >99

0.10 24.8% 53.9% 80.8% 94.9% >99 >99 >99

0.15 46.7% 79.9% 96% >99 >99 >99 >99

0.20 64.1% 91.7% >99 >99 >99 >99 >99

0.25 75.7% 96.4% >99 >99 >99 >99 >99

0.30 82.9% 98.2% >99 >99 >99 >99 >99

0.35 87.1% 99% >99 >99 >99 >99 >99

0.40 89.4% >99 >99 >99 >99 >99 >99

0.45 90.5% >99 >99 >99 >99 >99 >99

0.50 90.7% >99 >99 >99 >99 >99 >99

b) GWAS discovery stage for 9,035 XFS cases and 17,008 controls at P < 5 x 10-8

.

Odds Ratio

Min

or

alle

le f

req

uen

cy

1.10 1.125 1.15 1.175 1.20 1.25 1.30

0.01 <0.01% <0.01% <0.01% 0.02% 0.04% 0.23% 0.95%

0.05 0.09% 0.55% 2.40% 7.80% 19.40% 59.10% 90.40%

0.10 1.20% 7.20% 24.50% 52.80% 79.50% 99% >99%

0.15 5% 23.50% 57% 86.10% 97.60% >99% >99%

0.20 11.50% 43.00% 79.80% 96.60% >99% >99% >99%

0.25 19.40% 59.40% 90.70% >99% >99% >99% >99%

0.30 27% 70.70% 95.40% >99% >99% >99% >99%

0.35 33.30% 78% 97.40% >99% >99% >99% >99%

0.40 37.80% 81.80% 98.20% >99% >99% >99% >99%

0.45 40.20% 83.70% 98.60% >99% >99% >99% >99%

0.50 40.60% 83.90% 98.60% >99% >99% >99% >99%


c) GWAS discovery + replication of 13,838 XFS cases and 110,275 controls at P < 5 x 10-8

.

Odds Ratio

Min

or

alle

le f

req

uen

cy

1.10 1.125 1.15 1.175 1.20 1.25 1.30

0.01 <0.01% 0.02% 0.09% 0.30% 0.90% 5.40% 19.70%

0.05 1.94% 10.90% 34.50% 66.60% 89.50% >99% >99%

0.10 20.80% 62.80% 92.80% >99% >99% >99% >99%

0.15 51.80% 91.70% >99% >99% >99% >99% >99%

0.20 75.12% 98.50% >99% >99% >99% >99% >99%

0.25 87.60% >99% >99% >99% >99% >99% >99%

0.30 93.40% >99% >99% >99% >99% >99% >99%

0.35 96.10% >99% >99% >99% >99% >99% >99%

0.40 97.30% >99% >99% >99% >99% >99% >99%

0.45 97.80% >99% >99% >99% >99% >99% >99%

0.50 97.80% >99% >99% >99% >99% >99% >99%



Ethno-geographical stratified analysis for the five new genome-wide significant loci.

Association tests

Chromosome SNP

(effect/reference) Position Gene locus

Ethno-geographical sub-analysis

OR P-value

13 rs7329408 (A/G) 29166671 FLT1 - POMP

East Asia 1.11 0.0007

South Asia 1.16 0.006

Greater Middle East 1.24 0.045

Black Africans 0.94 0.7

Latin & South America 1.33 0.011

North America 1.2 0.0008

Eastern Europe 1.26 0.007

Central-Western Europe 1.18 0.001

Southern Europe 1.2 0.023

Northern Europe 1.35 9 x 10-5

11 rs11827818 (G/A) 120198728 TMEM136 East Asia 1.08 0.041

South Asia 1.32 3.6 x 10-7








Northern Europe 1.09 0.23

6 rs3130283 (A/C) 32138545 AGPAT1 East Asia 1.22 1.2 x 10-5










3 rs12490863 (A/G) 29907310 RBMS3 East Asia 1.11 0.005











5 rs10072088 (G/A) 116019417 SEMA6A East Asia 0.9 0.048












Association between the previously reported CACNA1A rs4926244 and susceptibility to

exfoliation syndrome.

Chromosome SNP

(effect/reference) Position

Gene locus

Stage OR P-value Phet I2 index

19 rs4926244 (G/A) 13374913 CACNA1A GWAS discovery 1.13 2.27 x 10-6 0.55 0.00%

Replication summary 1.13 7.5 x 10-6 0.73 0.00%

All data summary 1.13 1.67 x 10-10 0.66 0.00%


Association between POMP rs7329408 and exfoliation syndrome for each latitude band from 0°

- 10° to 60° - 70°. There is a trend effect of increasing odds ratio per-copy of the POMP

rs7329408 minor allele and increasing geographical latitude away from the equator (Ptrend =

0.003).

Latitude band Odds Ratio per-copy of the rs7329408-A allele

95% CI P-value

0° - 10° 1.01 0.77-1.32 0.96

10° - 20° 1.14 1.02 - 1.26 0.017

20° - 30° 1.16 0.99 - 1.35 0.058

30° - 40° 1.14 1.08 - 1.21 9.99 x 10-6

40° - 50° 1.19 1.10- 1.30 5.06 x 10-5

50° - 60° 1.23 1.11 - 1.36 1.06 x 10-4

60° - 70° 1.35 1.15 - 1.57 1.69 x 10-4




LD regions around each of the 7 genome-wide significant loci for exfoliation syndrome. The LD

analysis was performed for Asians, Europeans, and Black Africans separately. Each locus is

located on a different chromosome, and defined by their index SNPs, their proxies with pair-

wise r2 ≥0.5, with an additional ± 500,000 base pairs to include potentially longer range LD

missed by the r2 criterion.



Additional biological and functional annotations on genes mapping at or close to the 7 loci showing association with XFS surpassing genome-wide

significance. We annotate all genes spanning ± 150,000 base-pairs from the index SNP. There are 33 genes so annotated which lie near to the 7

loci.

Biological evidence Credible set

analysis Annotation for potential

function HaploReg annotations#

locus #id

XFS index risk SNP Gene

Locus name a) b) c) d) e) f) g) h) i) j) k) l) m) n) o)

1 rs3825942 LOXL1 LOXL1 8 9 5 7

1 (LOXL1 & POMP)

1 rs3825942 TBC1D21 LOXL1 8

11

1 rs3825942 STOML1 LOXL1 8

1 rs3825942 PML LOXL1 8

11

2 rs7329408 POMP POMP 8

3

1 (LOXL1 & POMP)

2 rs7329408 FLT1 POMP 8 12

2 rs7329408 SLC46A3 POMP 8

3 rs4926244 CACNA1A CACNA1A 8

4

1 (CACNA1A & AGPAT1)

3 rs4926244 STX10 CACNA1A 8

3 rs4926244 IER2 CACNA1A 8

3 rs4926244 TRMT1 CACNA1A 8

4 rs11827818 TMEM136 TMEM136 8

5 2,6 2,6,7

4 rs11827818 ARHGEF12 TMEM136 8

5 2,6 2,6,7

4 rs11827818 OAF TMEM136 8

4 rs11827818 POU2F3 TMEM136 8

5 rs3130283 AGPAT1 AGPAT1 8

4

1 (CACNA1A & AGPAT1)

5 rs3130283 PPT2 AGPAT1 8 15 10 4

5 rs3130283 C4A AGPAT1 8

5 rs3130283 C4B AGPAT1 8

5 rs3130283 CYP21A2 AGPAT1 8

5 rs3130283 TNXB AGPAT1 8

5 rs3130283 ATF6B AGPAT1 8

5 rs3130283 FKBPL AGPAT1 8

5 rs3130283 PRRT1 AGPAT1 8

5 rs3130283 EGFL8 AGPAT1 8

5 rs3130283 RNF5 AGPAT1

5 rs3130283 AGER AGPAT1 8


5 rs3130283 PBX2 AGPAT1 8

5 rs3130283 GPSM3 AGPAT1 8

5 rs3130283 NOTCH4 AGPAT1 8 16

5 rs3130283 C6Orf10 AGPAT1 8

6 rs10072088 SEMA6A SEMA6A 8

13, 14

1

7 rs12490863 RBMS3 RBMS3 8

# Haploreg annotations were performed using Haploreg v4.1 (Ward LD et al., Nucleic Acids Research 2012)3

a) expression in anterior segment tissues, b) Eye phenotype in knockout mouse, c) XFS risk missense variant, d) LD with cis-EQTL, e) Pubmed text mining, f) Pleiotropy with other forms of glaucoma, g) Molecular pathway analysis, performed between loci h) Nearest gene to XFS risk SNP, i) >/= 1 variant in credible set in the gene or within 50Kb of it, j) protein altering, k) exonic variant, l) promoter variant, m) promoter histone mark, n) enhancer histone mark, o) DNAse hypersensitivity site 1. http://www.ebi.ac.uk/intact/

4 2. Springelkamp H et al., 20155 3. Zenkel M et al., 20076 4. Westra et al., 20137 5. GTEX portal8 6. Gharahkhani et al., 20149 7. Wiggs et al., 201410 8. Eyebrowse Gateway (https://hpcwebapps.cit.nih.gov/eyebrowse/) and the ocular tissue database (https://genome.uiowa.edu/otdb/) 9. rs3829542 denotes LOXL1 p.G153D 10. rs3130283 is in strong LD with (r2>0.9) rs3134604, PPT2 p.C429W 11. Nakano M et al., 201411 12. Ambati BK et al., 200612 13. Matsuoka RL et al., 201113 14. Sun LO et al., 201314 15. Gupta P et al., 200315 16. James AC et al., 201416


http://www.ebi.ac.uk/intact/

https://hpcwebapps.cit.nih.gov/eyebrowse/

https://genome.uiowa.edu/otdb/


Primers used for Quantitative Real-Time PCR.

Gene Acc. No. Product Tan MgCl2 Sequence (5‘ - 3‘) AGPAT1 NM_006411 249 bp 64°C 3.0 mM GATCTTGCGTCTAATGCTGCTCC

TTCCGGTCGATGAAGATGACTCC ARHGEF12 NM_015313 186 bp 64°C 3.0 mM GGTCTTGATGACAGTGGAGAGCA

AGCAACCTCCTCATCTGTGGAAC

FLT1 NM_002019 248 bp 62°C 3.0 mM CTGATGGAAAACGCATAATCTGG

TCTCGTGTTCAAGGGAGTGGTAG

GAPDH NM_002046 194 bp 64°C 3.0 mM AAGGTCGGAGTCAACGGATTTGG ATGACAAGCTTCCCGTTCTCAGC

POMP NM_015932 191 bp 63°C 3.5 mM CAGCAGGTTCAGCGTCTTCCA CGGTTTCCATGAACAGCACAC SLC46A3 NM_181785 196 bp 64°C 3.5 mM CACGATGACAGGAATGGCTATGAC TGCAGTGACTCCTCCAAGTGTTTC TMEM136 NM_001198670 192 bp 63°C 3.0 mM TGGAGTCAAGGCTGGTCAGTAGG ACTTGAACACAGAAGGCGGAGGT Tan, annealing temperature; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.



Oligonucleotide primer pairs used to create the LOXL1 constructs for functional experiments.

Gene Comment Sequence

LOXL1 full-length cDNA encoding LOXL1 Fwd: GGT CAC CAT GGC TCT GGC CCG AGG CA

Rev: CGG AGA TCA GGA TTG GAC AAT TTT GCA G

LOXL1 oligos for adding in the EcoRI and SalI

restriction enzyme sites

Fwd: ATA GAA TTC GCC ACC ATG GCT CTG GCC

CGA GGC A

Rev: AGA GTC GAC TGC GGA TTG GAC AAT TTT

GCA GTT TGT TGC AGA A

LOXL1 Targeted base-pair substitution to

construct (G-G-A) haplotype

LOXL1-Arg141-Gly153-Tyr407

Fwd: CGG CAC GGG GGC TCC GCC TCC

Rev: GGA GGC GGA GCC CCC GTG CCG


construct (T-G-A) haplotype

LOXL1-Leu141-Gly153-Tyr407

Fwd: GGC ATG GCC CTG GCC CGC ACC

Rev: GGT GCG GGC CAG GGC CAT GCC


construct (G-A-T) haplotype

LOXL1-Arg141-Asp153-Phe407

Fwd: GCC AGC ACA GCC TTT GCC CCT GAG GCC

Rev: GGC CTC AGG GGC AAA GGC TGT GCT GGC


Supplementary note

Details for XFS case-control collections

The criteria for diagnosis of exfoliation syndrome (XFS) were harmonized and made uniform across all participating

countries and sites. The enrollment criteria for patients with exfoliation syndrome are the following:

a) Patients age ≥50 years old at time of recruitment that is consistent with well-documented clinical data17

.

b) Presence of exfoliation material visualized by slit lamp examination along the pupillary margin, anterior lens

surface, or other anterior segment structures of at least one eye17

.

Patients under the age of 50 will be excluded, as well as patients with neovascular glaucoma or uveitis.

All study protocols from all sites were approved and performed strictly according to the Tenets of the Declaration of

Helsinki.

GWAS discovery collections

For Singapore, the patients with XFS were of self-reported Chinese descent and enrolled at the Singapore National

Eye Center. The controls were drawn from the Singapore Chinese Eye Study, which has been described elsewhere

and were shown to not have exfoliation syndrome on slit lamp examination18

. Ethical approval was granted by the

SingHealth Centralised Institutional Review Board (IRB).

For Nigeria, all patients were recruited from four institutions in Nigeria. These institutions were the University

College Hospital Ibadan in the South of Nigeria and the Evangelical Church of West Africa (ECWA) Eye Hospital,

Kano in the North, Enugu State University of Science and Technology (ESUT) Teaching Hospital Parklane, Enugu

and The Eye Specialists Hospital, Enugu in the East of Nigeria. All patients and controls provided informed consent

and underwent a detailed ophthalmological examination. This included dilated slit-lamp examination, applanation

tonometry, gonioscopy and dilated fundus examination. All cases had exfoliation material in the anterior surface of

the lens. Controls had no exfoliation material in the eye, and no evidence of glaucoma or ocular hypertension.

Ethical approval for the study was granted by University of Ibadan/University College Hospital Institutional review

board, the Catholic Hospitals’ Ethical Committee and the ESUT Teaching Hospital Parklane Ethical Committee.

For Thailand, patients with XFS were enrolled at Department of Ophthalmology, Faculty of Medicine Siriraj

Hospital, Mahidol University, Bangkok, Thailand, at the Glaucoma Service, Department of Ophthalmology, Rajavithi

Hospital, Bangkok, Thailand, at Department of Ophthalmology, Faculty of Medicine, Chiang Mai University, Chiang

Mai, Thailand, and at Ramathibodi Hospital, Mahidol University, Bangkok, Thailand. Ethical approval was granted

by the Ethics committee, Rajavithi hospital, Bangkok, by the Siriraj Institutional Review Board, Faculty of Medicine

Siriraj Hospital, by the Ramathibodi Hospital Review Board, and by the Chiang Mai University Hospital in Chiang

Mai, Thailand.

For Vietnam, patients with XFS were consented at the Vietnam National Institute of Ophthalmology in Hanoi, using

protocols for eye diseases which has been previously described19

. The hospital Institutional Review Board gave

ethical approval the study. Controls were obtained from a large collection of unrelated cord blood donors, which has

also been well-described to be matched to the general Vietnamese population with little evidence of population

stratification1,20,21

. The use of cord bloods, which reflect controls drawn from the general population, has been well

described previously for eye and other diseases. As the prevalence and incidence of XFS in Vietnam is estimated

to be less than 5%, we note here that consistent with previous results by others and us, the number of false-

negatives in the cord blood controls are unlikely to result in significant loss of statistical power to detect true positive

genetic associations1,19-21

.

For Mexico, patients with XFS and normal controls were enrolled from the Conde de Valenciana Institute of

Ophthalmology in Mexico City, as previously described18,22

. All exfoliation syndrome patients and controls

underwent detailed ophthalmological examinations, including slit-lamp biomicroscopic assessment, applanation


tonometry, gonioscopy, dilated inspection of the lens, and funduscopy, as previously described. Written informed

consent was obtained from all participants, the study protocol was approved by the Hospital ethics committee.

For Saudi Arabia, all patients with XFS and normal controls were of Saudi Arabian descent as self-reporting and

medical record shows. Patients were recruited from the ophthalmology clinic at the King Abdulaziz University

Hospital, King Saud University, Riyadh, Saudi Arabia, as well as King Khaled Eye Specialist Hospital, Riyadh. All

participants provided written informed consent and underwent a standardized detailed ophthalmic examination,

which included measurement of intraocular pressure (IOP) by applanation, slit lamp biomicroscopy, gonioscopy,

and dilated pupil examination of the lens and fundus. Saudi Arabian subjects with normal anterior segment and

optic nerve examination, an IOP of less than 18 mmHg and without clinical signs of exfoliation were recruited as

control subjects. The study was approved by College of Medicine IRB committee, King Saud University, and the

IRB of the King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia.

For Argentina, patients with XFS were recruited from two institutions in Buenos Aires (Organizacion Medica de

Investigacion and Fundacion para el Estudio del Glaucoma), and 1 in Tucuman (Centro Oftalmologico Lischinsky).

All patients and controls provided informed consent. All subjects underwent a detailed ophthalmological

examination. This included best-corrected visual acuity, dilated slit-lamp examination, applanation tonometry,

gonioscopy and dilated fundus examination. All cases had exfoliation material in the anterior surface of the lens.

Controls had no exfoliation material in the eye, and no evidence of glaucoma or ocular hypertension. Ethical

approval for the study was granted by ¨Comite de Etica en Investigacion Clinica¨ (CEIC), Buenos Aires, Argentina.

For Greece, patients with XFS were identified from the Thessaloniki Eye Study, which is a comprehensive

prevalence-based study of eye diseases in Thessaloniki, Greece23

. Ethical approval for the Thessaloniki Eye Study

was granted by the Aristotle University Medical School Ethics Committee. The Thessaloniki Eye Study was co-

funded by the European Union (European Social Fund) and Greek national funds under the Act "Aristia" of the

Operational Program "Education and Lifelong Learning".

For China (Beijing), patients with XFS and unaffected controls were of Han Chinese descent as self-reporting and

medical record shows. They came from Beijing or nearby areas, representing a northern Chinese group. All

patients and control subjects were recruited from the Eye Center of Beijing Tongren Hospital (Beijing, China). The

diagnostic criterion for exfoliation syndrome is the existence of exfoliation material on the anterior lens capsule with

dilation of the pupils or on the pupil margin in either eye. Patients with intraocular pressure (IOP) of less than 21

mmHg and no clinical evidence of glaucomatous optic neuropathy were classified as XFS. Cases with other causes

for secondary glaucoma, such as uveitis, pigment dispersion syndrome, and iridocorneal endothelial syndrome,

were excluded. Controls were individuals randomly selected from a population-based healthy entity in which 6830

people were recruited in a previous, comprehensive, ophthalmic, epidemiologic study in a county in north China

near Beijing24

. The controls were enrolled by the following criteria: (1) having no signs of XFS or XFG, (2) no

glaucomatous changes on optic disc, (3) normal visual field and intraocular pressure, (4) no family history of

glaucoma, and (5) no other eye diseases except mild refractive errors. As exfoliation syndrome is a late-onset

disorder and rarely develops before the age of 50 years, only individuals aged 50 years or above were included into

this study as controls. They received comprehensive ophthalmic examinations, including visual acuity testing and

refraction, Goldmann applanation tonometry, gonioscopy, slit lamp biomicroscopy in mydriasis, fundus examination,

and automated static perimetry (Humphrey Visual Field Analyzer; Carl Zeiss Ophthalmic Systems, Inc. Humphrey

Division, Dublin, CA). Peripheral venous blood was obtained from each subject. The research protocol was

approved by the ethics committee for human research of Beijing Tongren Hospital, Capital Medical University in

Beijing, China. Informed consent was obtained from all participants after explaining the objective and nature of the

study.

For Korea, patients with XFS were enrolled from the Yeungnam University College of Medicine, Daegu, South

Korea and from Department of Ophthalmology, Seoul National University College of Medicine, Seoul, South Korea.

Controls were enrolled from the same hospitals as the cases, and were free from eye diseases, and has been

previously described25

.

For Turkey, patients with XFS and controls were enrolled at the Department of Ophthalmology, Eskisehir

Osmangazi University, Meselik, Eskisehir, Turkey. Ethical approval for the study was granted by Eskişehir

Osmangazi University Rectorship and project number was PR-10-03-19-52. Patients with XFS and controls were


also enrolled from the Department of Ophthalmology, Hacettepe University School of Medicine, Ankara, as well as

Cerrahpasa Medical Faculty Ophthalmology Department. Informed consent was obtained from all participants. The

study was approved by the IRB board of the Medical School of Hacettepe University (HEK11/56) as well as the

Istanbul University Cerrahpasa Faculty of Medicine.

For Iran, patients with XFS and unaffected controls were of Iranian descent based on their medical records.

Patients were recruited from the ophthalmology clinic at Labbafinejad Medical Center affiliated to Shahid Beheshti

University of Medical Sciences, Tehran, Iran. All participants underwent a detailed ophthalmic examination

including intraocular pressure (IOP) measurement using Goldmann applanation tonometry, slit lamp biomicroscopy,

gonioscopy, and examination of the lens and fundus after pupillary dilation. Subjects with normal anterior segment

and optic nerve with IOP less than 21 mmHg with no sign of exfoliation were recruited as control subjects. Prior to

enrollment, all patients were informed about the goals and procedures involved in the study and written informed

consent was obtained from all participants.

For Japan, patients with XFS and hospital matched controls were enrolled from 19 clinical sites throughout Japan:

1. Kyoto University 2. Kyoto Prefectural University of Medicine, 3. Sensho-kai Eye Institute in Kyoto, 4. Inouye Eye Hospital in Tokyo, 5. Asahikawa Medical University from Hokkaido, 6. Ohashi Eye Center from Hokkaido, 7. Department of Ophthalmology, Faculty of Medical Science, University of Fukui, 8. Hiroshima University, 9. Yotsuya Shirato Eye Clinic in Tokyo, 10. Nagahama City, 11. Department of Ophthalmology and Visual Science, Kanazawa University Graduate School of Medical Science, 12. Hayashi Eye Hospital in Fukuoka, 13. Mizoguchi Eye Hospital in Nagasaki, 14. Department of Ophthalmology, Oita University Faculty of Medicine, 15. Ideta Eye Hospital in Kumamoto, 16. Shinjo Eye Clinic in Miyazaki, 17. Department of Ophthalmology, Faculty of Medicine, University of Miyazaki 18. Miyata Eye Hospital in Miyazaki, 19. Ozaki Eye Hospital in Miyazaki. Each participating hospital (with the exception of Miyata Eye Hospital) also enrolled matching healthy, elderly

controls (aged ≥ 60 years) without Exfoliation syndrome, macular degeneration, primary closed angle glaucoma,

and primary open angle glaucoma. The relevant Institutional Review Board of each Hospital reviewed and provided

ethical approval for this study.

For Morocco, patients with XFS and controls were enrolled from the Clinique Specialisee d’Ophthalmologie,

Mohammedia, Morocco. All controls and patients underwent an ophthalmic examination. None of the controls had

evidence of exfoliation syndrome, nor other ophthalmic diseases. Ethical approval was granted by the ethical

Comittee of the Clinique Specialisee d’Ophthalmologie and of the Laboratoire d'analyse médicales, Mohammedia,

Morocco.

For Pakistan, patients with XFS and controls were recruited from Al-Shifa Eye Trust Hospital (Pakistan Institute of

Ophthalmology), Rawalpindi, Pakistan. The patients and controls provided written informed consent and were of

Pakistani origin, belonging to the Northern part of the country. Age-matched controls were recruited in the study

after conducting their complete clinical examination. No changes of the fundus, or any other ocular symptoms or a

positive history was observed in any of the sampled individual. In addition, to rule out any ocular anomaly, the

controls also underwent applanation tonometery, slit lamp examination to exclude exfoliative deposits, CDR

measurement and visual field assessment. All controls had normal visual fields, IOPs (≤ 20 mmHg) and CDRs

(≤0.2). This study was approved by the COMSATS Institute of Information Technology, Islamabad, Department of

Biosciences, Ethics Review Board and Ethical Committee of Al-Shifa Eye Trust Hospital (Pakistan Institute of

Ophthalmology), Rawalpindi.

For South Africa, patients with XFS and unaffected controls were of self-reported South African Black descent and

recruited from the St. John Eye Hospital, Soweto, Johannesburg, South Africa and the East London Hospital


Complex (Eastern Cape, South Africa), as previously described. The home language of participants and that of

their parents and grandparents was used to establish their ethnic affiliation. All participants underwent a

standardized detailed ophthalmic examination, which included measurement of intraocular pressure (IOP) by

applanation, slit lamp biomicroscopy, gonioscopy, and dilated pupil examination of the lens and fundus. Southern

African subjects with normal anterior segment and optic nerve examination, an IOP of less than 18 mmHg and

without clinical signs of exfoliation were recruited as control subjects. The research protocol was approved by the

University of the Witwatersrand Human Research Ethics Committee (Johannesburg, South Africa; protocol number

M080817). The Stellenbosch University Faculty of Medicine & Health Sciences Health Research Ethics Committee

also gave approval for this study (N08/08/208). Southern African black participants with clinically diagnosed XFG or

POAG and unaffected southern African control subjects were recruited from the St. John Eye Hospital in Soweto,

Johannesburg, South Africa. Written informed consent was obtained from all participants. The home language of

participants and that of their parents and grandparents was used to establish their ethnic affiliation.

For Georgia, patients with XFS and unaffected controls were of self-reported Georgian descent. They were

recruited in “Chichua Medical Center Mzera” LLC in Tbilisi, Georgia. The Study was approved by Ethical Committee

of David Tvildiani Medical University. Patients over age 50 with clinical evidence of XFS were involved in the study.

Controls were mostly patients undergoing cataract surgery over age 60 with no evidence of exfoliation material on

pupillary margin, lens capsule or other anterior segment structures.

For the United States of America, 1,124 patients with XFS were recruited from the Glaucoma service of the

Massaachusetts Eye and Ear Infirmary (Harvard), Duke University School of Medicine Ophthalmology Department,

the Glaucoma service of the Mayo Clinic, the Ophthalmology department from the University of Iowa School of

Medicine, the Bascom Palmer Eye Institute (University of Miami), and the Nurses’ Health Study (NHS) and Health

Professionals Follow-up Study (HPFS). Controls (4,894) were all previously genotyped samples from the NHS and

HPFS. The control subjects are representative of the United States population26

. The study was approved by the

Massachusetts Eye and Ear Infirmary institutional review board and all subjects signed consent forms approved by

the local IRB prior to enrolling in the study. All cases and controls were self-reported Caucasians with European

ancestry. All XFS cases were over the age of 50 and have documentation of characteristic ocular exfoliation

material at the pupil margin or surface of the ocular lens, either though clinical exam or medical records. Controls

were also older than age 50 and have no evidence of XFS by clinical exam or medical records. Clinical

examination (for both cases and controls) included measurement of visual acuity and intraocular pressure, slit lamp

biomicroscopy, and fundoscopy. Cases also had visual field assessment primarily using the Humphrey automated

visual fields. Individuals were excluded if other types of glaucoma (pigment dispersion, steroid-induced, uveitis)

were evident on exam. All cases provided blood samples for DNA extraction. Cases were genotyped using the

Omni Express + Exome platform. Controls had previously had DNA collected and were genotyped using the Omni

Express platform.

For Austria, patients with XFS were consented as previously described27

at the Department of Ophthalmology,

Medical University Graz between May 2003 and March 2015 and gave written informed consent prior to enrolment.

The study was conducted in accordance with the National Gene Technology Act of Austria and the guidelines of the

local ethics committee. The control subjects are representative of the Austrian population, and have been

previously described28

.

For Poland, patients with XFS and unaffected controls were recruited from Department of Diagnostics and

Microsurgery of Glaucoma, Medical University, Lublin, Poland. All participants underwent detailed ophthalmic

examination, which included measurement of intraocular pressure (IOP) by Goldman applanation tonometry, slit

lamp examination, BCVA, dilated pupil examination of the lens and fundus. In fact majority of patients from the

exfoliation syndrome group had visual field testing. Matched Polish subjects with normal anterior segment and optic

nerve examination, an IOP of equal or less than 21 mmHg and without signs of exfoliation were recruited as control

subjects. Ethical approval for the study was granted by Ethical Commitee of Medical University, Lublin, Poland. KE

- 0254/159/2013.

For Germany (OmniExpress collection), patients with XFS was approved by the ethical review boards of the

Medical Faculty of the Universities of Erlangen-Nuremberg, Tuebingen, Wuerzburg (Germany). All were conducted

in accordance with the tenets of the declaration of Helsinki. All subjects gave informed consent before entering the

study. The healthy German subjects serving as controls were recruited from the same geographic regions as the

patients. Recruitment and clinical evaluation were performed as previously described. Additional German controls


were enrolled from the University of Tubingen. All subjects are healthy blood donors without having diseases. By

law, blood donors are checked routinely including laboratory and clinical examinations. The study was approved by

the ethical committee of the University Tübingen, Germany and all participant gave written informed consent to use

DNA for further investigations. Data of study subjects are anonymized. Informed consent for tissue donation used

for the expression analysis was obtained from the donors or their relatives, and the protocol of the study was

approved by the local Ethics Committee (No. 4218-CH) and adhered to the tenets of the Declaration of Helsinki for

experiments involving human tissues and samples.

For Canada, individuals of self-reported European descent with XFS were enrolled following informed consent from

within the Nova Scotia Health Authority (NSHA), Nova Scotia, Canada and each eye separately scored according

to a standardized 1–4 point clinical system previously described29

. Reference standards were obtained from the

DNA diagnostic laboratory serving the same population. Ocular examination was not carried out on members of this

general control group. Both studies were approved by the Research Ethics Board of the NSHA (protocols 1011873

and 1020512).

For Finland, the cases with XFS or XFG consisted of sporadic patients from Tammisaari municipality, Southern

Finland, and of 26 related patients from an extended family from Kökar Island, Southwestern Finnish archipelago,

collected by investigators of the Department of Ophthalmology, Helsinki University Hospital, Helsinki, all of Finnish

ancestry, as previously described30,31

. The controls consisted of unrelated individuals with no evidence of XFS or

other ocular disease and of patients with POAG from Tammisaari municipality (mean age, 86 years), as well as of

92 unaffected relatives from the extended family (mean age, 63 years), collected concurrently. The diagnoses are

based on a comprehensive ophthalmic examination, including both slit-lamp biomicroscopy and funduscopy, before

and after pupillary dilatation. XFS was recorded when a grayish central disc, with or without a peripheral band, on

the anterior lens capsule or fibrillary material on the pupillary ruff was detected. Pigment dispersion without such

signs was coded as XFS negative. The recorded age was the age when XFS was first observed or, if XFS was not

present, the age at the last examination. The study was approved by the institutional review board of the

Department of Ophthalmology, Helsinki University Hospital, Helsinki (#276/E9/07), and was conducted in

accordance with the Declaration of Helsinki. All participants gave written informed consent.

For Russia (Republic of Bashkortostan), patients with XFS and unaffected controls were enrolled from the population-based Ufa Eye and Medical Study performed at the Ufa Eye Research Institute (Ufa, Russia). Using a protocol described recently, all participants underwent a standardized detailed ophthalmic examination, including visual acuity assessment and refractometry, keratometry, tonometry, slit-lamp based biomicroscopy of the anterior and posterior segment of the eye, gonioscopy, automated static perimetry, examination of the lens and fundus in mydriasis, photography of the cornea, lens, optic disc and macula, and spectral-domain optical coherence tomography of the retina and optic nerve head. The study group included individuals with exfoliation. The diagnostic criterion for exfoliation syndrome is the existence of exfoliation material on the anterior surface of the lens and the pupillary margin. Individuals with a normal ophthalmological status including lack of signs of exfoliation, no evidence of glaucoma or ocular hypertension were recruited for the control group. Cases such as uveitis, pigment dispersion syndrome, and iridocorneal endothelial syndrome, were excluded. DNA was extracted from the peripheral whole blood for all participants. Prior to enrollment, all patients were informed about the goals of, and the procedures performed in, the study. Written informed consent was obtained from all participants. The Ethics Committee of the Academic Council of the Ufa Eye Research Institute approved the study according to the tenets of the Declaration of Helsinki.

For Russia (St Petersburg), patients with XFS and unaffected controls were enrolled from Department of

Ophthalmology at Pavlov First Saint Petersburg State Medical University, St. Petersburg Russia. All patients and

unaffected controls were of self-reported European descent. Controls were individuals of similar age as the patients

without any evidence of exfoliation deposits on intraocular tissues. All participants underwent detailed ophthalmic

examination including Goldmann tonometry, SAP, HRT, slit lamp biomicroscopy, gonioscopy, and dilated pupil

examination of the lens and fundus. Ethical approval was granted by the Ethical Committee of the St. Petersburg

Academic University RAS 03/14.


Replication collections

For Iceland, subjects with XFS were recruited from the Reykjavic Eye Study, as previously described32,33

. All

patients had maximum dilation of their pupils, with XFS specifically looked for and assessed. The controls were

general population controls from Iceland, and have been extensively described33-37

. Ethical approval was granted

by the National Bioethics Committee and the Iceland Data Protection Authority. All participating individuals provided

informed consent, with their samples de-identified.

For Australia, patients with XFS were ascertained through several ocular genetic studies being conducted in

Australia; the Blue Mountains Eye Study (BMES), The Australian and New Zealand Registry of Advanced

Glaucoma (ANZRAG), and The Glaucoma Inheritance Study in Tasmania (GIST). The BMES is a population based

cohort study of individuals aged over 49 years living in the Blue Mountains region, west of Sydney, Australia,

designed to investigate common ocular diseases. DNA was available from 59 XFS cases from this study. ANZRAG

aims to recruit patients from Australia and New Zealand with advanced glaucoma, and also recruits patients with

risk factors for severe secondary glaucoma such as XFS, regardless of glaucoma status. The registry provided 232

XFS cases for inclusion in this study. In all cases XFS was defined as the presence of characteristic deposits

visible on the lens capsule under slit lamp examination or a diagnosis of XFS recorded in the medical record prior

to cataract extraction. All cases were of European descent. The control cohort consisted of 2621 unaffected

participants of the Blue Mountains Eye Study. All controls were free of XFS by slit-lamp examination. DNA was

extracted from peripheral whole blood for all participants. Genotyping of the cases was performed Illumina

HumanCNV370 array or the Illumina Human 610 Quad Array at the Diamantina Institute, Brisbane, Australia. The

controls were genotyped on Illumina Human 610 Quad Array as part of the Wellcome Trust Case Control

Consortium 2 project. All individuals had >98% genotyping call rate. Following data cleaning, association analysis

was conducted using PLINK. This project was approved by the Western Sydney Area Health Service and the

Southern Adelaide Clinical Human Research Ethics Committees.

For Italy, the genetic study of patients with XFS and controls was approved by the ethical review boards of the

Medical Faculty of the hospital in Monfalcone-Gorizia (Italy) and that of the University Hospital in Siena (Italy). All

were conducted in accordance with the tenets of the declaration of Helsinki. All subjects gave informed consent.

For Germany (Affymetrix collection), the genetic study of XFS patients was approved by the ethical review boards

of the Medical Faculty of the Universities of Erlangen-Nuremberg, Tuebingen, Wuerzburg (Germany). All were

conducted in accordance with the tenets of the declaration of Helsinki. All subjects gave informed consent before

entering the study, in similar manner to the Germany-OmniExpress GWAS discovery collection.

For India, a total of 745 XFS case patients under the Aravind Exfoliation intra-ocular lens study with XFS as

diagnosed by ophthalmologists from four centres of Aravind eye hospitals in Tamilnadu, India were enrolled. A

further 141 XFS patients from Medical Research Foundation, Sankara Nethralaya, Chennai, India, and 50 XFS

patients from Narayana Nethralaya Eye Hospital, Bangalore were also enrolled. All cases patients were from clear

self-reported Southern Indian descent. A total of 627 normal control subjects of Southern Indian descent without

XFS, without uveitis, and without any evidence of secondary glaucoma, and no other ocular disease were also

recruited from the Aravind eye hospitals as well as a further 43 controls of Southern Indian descent without any eye

disease from Medical Research Foundation, Sankara Nethralaya, Chennai, India. A further 2,292 Southern Indians

who have undergone eye examinations and had no evidence of exfoliation syndrome or glaucoma were also

enrolled as controls. These individuals had genome-wide genotyping data and were confirmed by self-report and

genetic analysis to be of Southern Indian descent, and have been extensively described18-20

. Ethical approval was

granted by the Narayana Nethralaya Hospital Ethics Committee and Medical Research Foundation, Sankara

Nethralaya, The Institutional Review Board of Aravind Eye care System also reviewed and approved the Project.

For the United States of America replication collection, patients with XFS were enrolled from the New York Eye and

Ear Infirmary, the John A. Moran Eye Center at the University of Utah School of Medicine, the Hamilton Glaucoma

Center, Shiley Eye Institute, University of California, San Diego, as well as the Vanderbilt Eye Institute, Vanderbilt

University School of Medicine. The controls were representatively drawn from US individuals of European descent

and has been previously described18

.

For the Japan replication collection, similar to the discovery GWAS collection, the patients with XFS were enrolled

from 19 clinical sites throughout Japan:


1. Kyoto University 2. Kyoto Prefectural University of Medicine, 3. Sensho-kai Eye Institute in Kyoto, 4. Inouye Eye Hospital in Tokyo, 5. Asahikawa Medical University from Hokkaido, 6. Ohashi Eye Center from Hokkaido, 7. Department of Ophthalmology, Faculty of Medical Science, University of Fukui, 8. Hiroshima University, 9. Yotsuya Shirato Eye Clinic in Tokyo, 10. Nagahama City, 11. Department of Ophthalmology and Visual Science, Kanazawa University Graduate School of Medical Science, 12. Hayashi Eye Hospital in Fukuoka, 13. Mizoguchi Eye Hospital in Nagasaki, 14. Department of Ophthalmology, Oita University Faculty of Medicine, 15. Ideta Eye Hospital in Kumamoto, 16. Shinjo Eye Clinic in Miyazaki, 17. Department of Ophthalmology, Faculty of Medicine, University of Miyazaki 18. Miyata Eye Hospital in Miyazaki, 19. Ozaki Eye Hospital in Miyazaki. Each participating hospital (with the exception of Miyata Eye Hospital) also enrolled matching healthy, elderly

controls (aged ≥ 60 years) without Exfoliation syndrome, macular degeneration, primary closed angle glaucoma,

and primary open angle glaucoma. The relevant Institutional Review Board of each Hospital reviewed and provided

ethical approval for this study.

For the Georgia replication collection, patients with XFS and unaffected controls were of self-reported Georgian

descent. They were recruited in “Chichua Medical Center Mzera” LLC in Tbilisi, Georgia, similar to the Georgian

GWAS collection. The Study was approved by Ethical Committee of David Tvildiani Medical University. Patients

over age 50 with clinical evidence of XFS were involved in the study. Controls were mostly patients undergoing

cataract surgery over age 60 with no evidence of exfoliation material on pupillary margin, lens capsule or other

anterior segment structures.

For Switzerland, patients with XFS and unaffected controls were recruited from Clinique Generale-Beaulieu,

Geneva, Switzerland. Ethical approval for the study was granted by the relevant local Cantonal authority.

For Peru, patients with XFS and unaffected controls were recruited from the Instituto de Glaucoma y Catarata,

Lima, Perú. Ethical approval for the study was granted by the Comité Institutional de Etica en Investigación de la

Universidad de San Martín de Porres-Clínica Cada Mujer, Lima, Perú (IRB00003251-FWA0015320).

For Spain, patients with XFS were recruited from the Instituto Oftalmológico Fernández-Vega, in Oviedo, Spain and

Department of Ophthalmology of the University Hospital of Salamanca, Salamanca, Spain. Complete ophthalmic

examinations were performed for both, patients and controls, as previously described38,39

. To increase statistical

power as well as to conduct sensitivity analysis, the control dataset was additionally enriched by additional controls

of ethnically matched Spanish individuals which has been previously described28

.

For China-Xinjiang, all XFS patients and unaffected controls were recruited from the first people's hospital of

Kashgar, Xinjiang, China. All subjects are Uighurs. All the participants signed the informed consent. All participants

underwent a standardized detailed ophthalmic examination, which included slit lamp biomicroscopy, gonioscopy,

dilated pupil examination of the lens and fundus and measurement of intraocular pressure (IOP). All patients have a

typical XFS substances exist in the lens capsules. For controls: no abnormal material gathered on the side of

anterior segment or the pupil, intraocular pressure is less than 22mmHg. We excluded samples with a history of

strong infrared contact, malignant tumor, autoimmune disease, hypertension, hepatitis, diabetes, cardiovascular

disease, neurological disease, and with a history of surgery. Ethical approval for this study was granted by the

ethical committee of the First Affiliated Hospital of Xinjiang Medical University, Urumchi.

For Romania, patients with XFS were recruited at the Department of Ophthalmology, Emergency University

Hospital, Bucharest. All included patients and controls underwent a complete ophthalmic examination. Controls had

no evidence for exfoliation syndrome, glaucoma or ocular hypertension. All patients and controls provided informed

consent; the ethical approval for the study was granted by the Ethics Committee of the Emergency University

Hospital, Bucharest, Romania.


For France, patients with XFS and controls were consented and enrolled at the Department of Ophthalmology,

University Hospital of Angers, France. The control subjects had a normal ocular health; moderate cataract was the

only acceptable eye condition at inclusion. All healthy controls underwent an ophthalmic evaluation including best-

corrected visual acuity (inclusion criteria: visual acuity ≥20/50) , intraocular pressure, pachymetry, slit-lamp

examination, fundoscopy, and high-definition optical coherence tomography (HD-OCT) using the Cirrus device

(Carl Zeiss Meditech, Dublin, CA) measuring the thickness of the peripapillary retinal nerve fiber layer. The study

protocol was approved by the University of Angers Ethical Review Committee (CPP Ouest 2—24/10/2013).

For Denmark, patients with XFS together with hospital-matched controls were eye examined and enrolled at the

Eye Clinic, Rigshospitalet – Glostrup, Glostrup. Denmark. Ethical approval for the study was granted by Regional

Committee E on Health Research, Capital Region, Protocol no. H-15010548

For Canada, individuals of self-reported European descent with manifest XFS were enrolled following informed

consent from within the Nova Scotia Health Authority (NSHA), Nova Scotia, Canada. Reference standards were

obtained from the DNA diagnostic laboratory serving the same population. Ocular examination was not carried out

on members of this general control group. Both studies were approved by the Research Ethics Board of the NSHA

(protocols 1011873 and 1020512), using clinical protocols identical to that used in the discovery GWAS collection.

For Russia (St Petersburg), patients with XFS and controls were enrolled from Department of Ophthalmology at

Pavlov First Saint Petersburg State Medical University, St. Petersburg Russia, as described for the GWAS

discovery cohort. Ethical approval was granted by the Ethical Committee of the St. Petersburg Academic University

RAS 03/14.

Non-synonymous burden tests at LOXL1.

Using previously described methods40

, we tested for the presence of a significant excess (or a significant deficit) in

XFS cases versus controls for rare, non-synonymous amino acid substitutions. The analysis was done by

aggregating together such variants with MAF <1% and comparing the counts in cases and controls.

Assessment of genetic stratification, inflation of test statistics, and initial GWAS primary

association analysis.

Principal component analysis (PCA) was performed on each case-control collection from each country separately

to exclude genetic outliers for that particular population (see Methods)41

. Assessment of genetic stratification using

PCA showed XFS cases and controls to be well matched, which was verified by minimal genomic inflation (1.00 ≤

λgc ≤ 1.035) for each of the countries participating in the GWAS discovery (Supplementary Table 2). Quantile-

quantile plots visualizing overall association statistics for each GWAS discovery collection also show minimal

dispersion of the genome-wide test statistics (Supplementary Figure 22). Association analyses performed

separately for each country, and adjusted for the top three principal components to further correct for residual

population stratification using logistic regression before meta-analysis were performed. Genomic inflation remained

low (λgc≤1.07) in the GWAS discovery meta-analysis, consistent with previous reports42-44

. We adjusted the

association statistics for genomic inflation during genome-wide analysis of each individual strata, and again during

meta-analysis (double gc correction45

; see Methods). Apart from verifying association at known genetic markers

mapping to LOXL1 and CACNA1A, the GWAS discovery meta-analysis confirmed the genetic effect reversal at

LOXL1 (with all associated SNPs displaying I2 index for heterogeneity >75%

46; Supplementary Figure 23).

Analysis of new loci by geographical latitude.

As XFS disease prevalence has been reported to differ according to geographical latitude, likely reflecting the

contribution of temperature, vitamin D or UV exposure in the disease process47,48

, we assessed the possibility of

gene-latitude interaction for the newly identified loci. Only rs7329408 located in the chromosome 13 locus that

includes FLT1-POMP-SLC46A3 showed a significant latitude gradient effect, with the genetic effect increasing from

OR per-allele = 1.10 in equatorial regions (latitude band 0° – 20°) to OR per-allele=1.35 for colder, sub-polar regions


(latitude band 60° – 70°; P for trend = 0.003, Supplementary Table 13). No other locus showed a significant

interaction with geographical latitude. The equatorial collections (N = 1,332 cases and N = 5,995 controls) had

>90% power to detect genetic effects with OR = 1.25, at MAF=10% at P = 0.05 should it exist, which is the case for

POMP rs7329408. Further study would be required to fully confirm this interactive effect.

Genotyping of replication stage collections

For replication, the XFS cases and controls from Australia were genotyped using the Illumina 1M Duo array. The

cases and controls for the German replication collection were genotyped using the Affymetrix 6.0 platform. To

harmonize the genotypes for the Australian and German replication collections, we imputed the GWAS data using

the 1000 Genomes haplotypes as a reference panel49

. The imputation and phasing of genotypes were carried out

using the IMPUTE2 software50,51

. (https://mathgen.stats.ox.ac.uk/impute/impute_v2.html) with a reference panel

constructed from cosmopolitan population haplotypes based on data obtained from 2535 individuals from 26

distinct populations around the world. This data is part of the 1000 Genomes project Phase 3 (Jun 2014) release,

as described elsewhere. To minimize the effect of imputation uncertainty, we only included imputed genotypes with

an information score of ≥0.95. Allele dosages were used for the imputed data association analyses with the

software SNPTEST. We also removed imputed SNPs with minor allele frequencies of less than 1 percent. We

further verified the accuracy of the imputation by performing direct genotyping on half of the cases and controls

from Australia and half of the cases and controls from the German replication collection at the seven loci

surpassing genome-wide significance. This exercise revealed an imputation concordance rate in excess of 99

percent, thus testifying to the robustness of our imputation. Direct genotyping using the Sequenom Mass-Array and

Applied Biosystems Taqman genotyping platforms was carried out for XFS cases and controls from Italy, Vietnam,

India, Germany (replication), USA (replication), Japan (replication), Spain, China-Xinjiang, Romania, France,

Denmark, Canada, Switzerland, Georgia, Peru, and Russia (St Petersburg) (Supplementary Table 2). The cases

and controls from DeCODE Genetics, Iceland were first genotyped with Illumina chip-arrays. A subset of these

samples then underwent whole genome sequencing, followed by long-range phasing into haplotypes and whole-

genome imputation into the chip-typed cases and controls as previously described36,37

. When verified by direct

genotyping, the accuracy of this approach surpasses 99%52,53

Statistical analysis for the replication stage

For the replication stage, chip-typed data on XFS cases and controls from Australia and Germany were harmonized

with global reference panels and imputed at high confidence (imputation information completeness must be >95%).

We used the Sequenom MassArray primer extension platform and Applied Biosystems Taqman real time PCR

genotyping to genotype the most significantly associated SNPs emerging from the GWAS discovery stage.

Sequenom and Taqman genotyping was performed for XFS case control collection from India, USA (replication),

Japan (replication), Italy, Vietnam, Spain, China-Xinjiang, Romania, France, Denmark, Canada, and Russia (St

Petersburg). In addition, we also used the Sequenom/Taqman genotyping systems to verify imputation accuracy for

half of the cases and half of the controls from Australia and Germany. Imputation accuracy was confirmed at >99%.

For the Iceland XFS case-control study, whole-genome sequencing followed by genome-wide imputation into

Illumina chip-typed GWAS datasets was conducted. For the Iceland study, SNPs at the seven genome-wide

significant locus were called at >99% genotyping completeness and information content. For each genome-wide

significant locus, we define the ‘sentinel’ SNP as the most significantly associated, directly genotyped SNP.

Nano luciferase secretion assay for LOXL1

LOXL1 was amplified and subcloned into pNLF1-C (Promega) which contained the NanoLuc (Nluc) gene, using the EcoRI restriction enzyme. The LOXL1-Arg141-Asp153-Tyr407 (G-A-A) haplotype was generated first, and the LOXL1-Arg141-Gly153-Tyr407 (G-G-A), LOXL1-Leu141-Gly153-Tyr407 (T-G-A), and LOXL1-Arg141-Asp153-Phe407 (G-A-T) haplotypes were subsequently created through site-directed mutagenesis. A total of 1ug of each construct was nucleofected (LONZA) into HLECs. 1ug of pNLF1-C plasmid was also nucleofected as a control for background Nluc activity. The assay was performed at 72 hours post nucleofection.


The nucleofected cells were plated in triplicates, in a 96-well plate at a seeding density of 30,000 cells per well. A sample of the spent media was taken to measure luminescence at 72h. The sample was diluted 1/10 with 1x PBS and an equal volume of nano-Glo (Promega) substrate was added. The luminescence was measured in a Tecan (infiniteM200) microplate reader. The wells were rinsed with 1x PBS with 1 volume of 1x PBS and 1 volume of nano-Glo substrate. Intracellular luminescence readings were used as controls for nucleofection efficiency. Relative Nluc activity was obtained as Relative Light Unit (RLU), and RLU of LOXL1-Arg141-Asp153-Tyr407 (G-A-A), LOXL1-Arg141-Gly153-Tyr407 (G-G-A) and LOXL1-Leu141-Gly153-Tyr407 (T-G-A) were presented as a percentage of the RLU of LOXL1-Arg141-Asp153-Phe407 (G-A-T) +/- standard deviation. Assays were performed independently six times.

Western blot analysis for HA-tagged LOXL1 haplotypes on elastin, fibronectin and collagen IV.

Titration of 0.5 μg, 1 μg and 1.5 μg amount of DNA from the different HA-tagged LOXL1 haplotypes LOXL1-

Arg141-Gly153-Tyr407 (G-G-A), LOXL1-Leu141-Gly153-Tyr407 (T-G-A), LOXL1-Arg141-Asp153-Tyr407 (G-A-A),

and LOXL1-Arg141-Asp153-Phe407 (G-A-T) were nucleofected in HLECs using program DS-137 and V4XC-

2032(SF) kit (Lonza, Basel, Switzerland) in a 4D Nucleofector System (Lonza Group Ltd). After a 10 minute

recovery period, cells were plated in complete media (Dulbecco’s modified Eagle’s medium supplemented with

20% fetal bovine serum (Sigma-Aldrich) and 2mM Glutamax (Invitrogen) and incubated at 37° C with 5% CO2).The

culture media was changed 24 hours post-nucleofection, and cells were harvested for immunobloting 72 hours

post-nucleofection. Nucleofected cells were lysed in lysis buffer containing 1M HEPES pH 7.6, 5M NaCl

,10%NP40,0.5M EDTA pH8,0.25M PMSF for western blotting.

Cell extracts containing equal quantities of proteins, determined by the Bradford method, were separated by SDS-

PAGE (4%–20% acrylamide) and transferred to nitrocellulose membranes, 0.45 μm (Biorad). Membranes were

blocked in 5% Non-fat dry milk (Santa Cruz) with 10% Bovine Serum Albumin (Sigma) and 0.1% Tween-20 (Biorad)

in Phosphate-buffered saline for 1 hour before incubation with mouse antibody to HA (1:500 dilution; sc-7392;

Santa Cruz), mouse antibody to elastin (1:500 dilution; MAB2503; Millipore) mouse antibody to fibronectin (1:500

dilution; ab6328; Abcam), rabbit antibody to collagen IV (1:500 dilution; ab6586; Abcam) and rabbit antibody to

GAPDH (1:5000 dilution; sc-25778; Santa Cruz). All antibodies were diluted with the blocking buffer. Mouse or

Rabbit Horseradish peroxidase (HRP)-conjugated secondary antibodies (1:5000 dilution; Santa Cruz) were applied

to detect the bound primary antibodies, and signal was visualized with Luminata Forte Western HRP substrate

(Millipore).

Genotyping of human eye tissues

DNA samples obtained from ocular tissues and cells were genotyped by Sanger sequencing. Primers surrounding

SNPs rs7329408, rs11827818 and rs3130283 were designed using Primer3 software (http://frodo.wi.mit.edu/cgi-

bin/primer3/primer3_www.cgi/), supplied from Thermo Scientific (Schwerte, Germany), and are available on

request. Purified PCR fragments were sequenced using Big Dye Termination chemistry v.3.1 (Applied Biosystems,

ABI, Weiterstadt, Germany) on an automated capillary sequencer (ABI 3730 Genetic Analyzer). All sequences were

analysed using Sequencer 5.1 (Gencodes) software and compared with the respective reference SNP sequences

mapping to hg19.

Immuno-histochemistry of human eye tissues

Cryostat-cut sections of 4 µm thickness were fixed in cold acetone for 10 minutes, blocked with 10% normal goat

serum, and incubated with primary antibodies against POMP (HSPC014, clone EPR10177; Abcam, Cambridge),

TMEM136 (ab182495, Abcam), AGPAT1 (LS-C379231; LifeSpan BioSciences, Seattle, WA), and LOXL1 (B01P;

Abnova, Taipei, Taiwan) diluted in phosphate-buffered saline (PBS) overnight at 4°C. Antibody binding was

detected by Alexa 488- or Alexa-555-conjugated secondary antibodies (Molecular Probes, Eugene, OR) and

nuclear counterstaining was performed with DAPI (Sigma-Aldrich, St. Louis, Missouri). In negative control

experiments, the primary antibodies were replaced by PBS or equimolar concentrations of non-immune rabbit or

mouse IgG.


http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi/

http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi/

The replication experiments shown in Supplementary Figure 18 used an independently procured set of primary

antibodies against POMP (GTX82098, Genetex), TMEM136 (sc248885, Santa Cruz Biotechnology), AGPAT1 (LS-

C379231; LifeSpan BioSciences), and LOXL1 (Abnova, H00004016-B01P) diluted in phosphate-buffered saline

(PBS) overnight at 4°C.


Supplementary References

1. Dunstan, S.J. et al. Variation at HLA-DRB1 is associated with resistance to enteric fever. Nat Genet 46, 1333-6 (2014).

2. Raychaudhuri, S. et al. Five amino acids in three HLA proteins explain most of the association between MHC and seropositive rheumatoid arthritis. Nat Genet 44, 291-6 (2012).

3. Ward, L.D. & Kellis, M. HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res 40, D930-4 (2012).

4. Orchard, S. et al. The MIntAct project--IntAct as a common curation platform for 11 molecular interaction databases. Nucleic Acids Res 42, D358-63 (2014).

5. Springelkamp, H. et al. ARHGEF12 influences the risk of glaucoma by increasing intraocular pressure. Hum Mol Genet 24, 2689-99 (2015).

6. Zenkel, M., Kruse, F.E., Naumann, G.O. & Schlotzer-Schrehardt, U. Impaired cytoprotective mechanisms in eyes with pseudoexfoliation syndrome/glaucoma. Invest Ophthalmol Vis Sci 48, 5558-66 (2007).

7. Westra, H.J. et al. Systematic identification of trans eQTLs as putative drivers of known disease associations. Nat Genet 45, 1238-43 (2013).

8. Consortium, G.T. The Genotype-Tissue Expression (GTEx) project. Nat Genet 45, 580-5 (2013). 9. Gharahkhani, P. et al. Common variants near ABCA1, AFAP1 and GMDS confer risk of primary

open-angle glaucoma. Nat Genet 46, 1120-5 (2014). 10. Wiggs, J.L. & Pasquale, L.R. Expression and regulation of LOXL1 and elastin-related genes in eyes

with exfoliation syndrome. J Glaucoma 23, S62-3 (2014). 11. Nakano, M. et al. Novel common variants and susceptible haplotype for exfoliation glaucoma

specific to Asian population. Sci Rep 4, 5340 (2014). 12. Ambati, B.K. et al. Corneal avascularity is due to soluble VEGF receptor-1. Nature 443, 993-7

(2006). 13. Matsuoka, R.L. et al. Transmembrane semaphorin signalling controls laminar stratification in the

mammalian retina. Nature 470, 259-63 (2011). 14. Sun, L.O. et al. On and off retinal circuit assembly by divergent molecular mechanisms. Science

342, 1241974 (2013). 15. Gupta, P. et al. Disruption of PPT2 in mice causes an unusual lysosomal storage disorder with

neurovisceral features. Proc Natl Acad Sci U S A 100, 12325-30 (2003). 16. James, A.C. et al. Notch4 reveals a novel mechanism regulating Notch signal transduction.

Biochim Biophys Acta 1843, 1272-84 (2014). 17. Ritch, R. & Schlotzer-Schrehardt, U. Exfoliation syndrome. Surv Ophthalmol 45, 265-315 (2001). 18. Aung, T. et al. A common variant mapping to CACNA1A is associated with susceptibility to

exfoliation syndrome. Nat Genet 47, 387-92 (2015). 19. Khor, C.C. et al. Genome-wide association study identifies five new susceptibility loci for primary

angle closure glaucoma. Nat Genet 48, 556-62 (2016). 20. Vithana, E.N. et al. Genome-wide association analyses identify three new susceptibility loci for

primary angle closure glaucoma. Nat Genet 44, 1142-6 (2012). 21. Khor, C.C. et al. Genome-wide association study identifies susceptibility loci for dengue shock

syndrome at MICB and PLCE1. Nat Genet 43, 1139-41 (2011).


22. Jaimes, M., Rivera-Parra, D., Miranda-Duarte, A., Valdes, G. & Zenteno, J.C. Prevalence of high-risk alleles in the LOXL1 gene and its association with pseudoexfoliation syndrome and exfoliation glaucoma in a Latin American population. Ophthalmic Genet 33, 12-7 (2012).

23. Topouzis, F. et al. Prevalence of open-angle glaucoma in Greece: the Thessaloniki Eye Study. Am J Ophthalmol 144, 511-9 (2007).

24. Liang, Y.B. et al. Rationale, design, methodology, and baseline data of a population-based study in rural China: the Handan Eye Study. Ophthalmic Epidemiol 16, 115-27 (2009).

25. Cheng, C.Y. et al. New loci and coding variants confer risk for age-related macular degeneration in East Asians. Nat Commun 6, 6063 (2015).

26. Kang, J.H. et al. Contribution of the Nurses' Health Study to the Epidemiology of Cataract, Age-Related Macular Degeneration, and Glaucoma. Am J Public Health 106, 1684-9 (2016).

27. Mossbock, G. et al. Lysyl oxidase-like protein 1 (LOXL1) gene polymorphisms and exfoliation glaucoma in a Central European population. Mol Vis 14, 857-61 (2008).

28. Davila, S. et al. Genome-wide association study identifies variants in the CFH region associated with host susceptibility to meningococcal disease. Nat Genet 42, 772-6 (2010).

29. Orr, A.C. et al. Exfoliation syndrome: clinical and genetic features. Ophthalmic Genet 22, 171-85 (2001).

30. Lemmela, S. et al. Association of LOXL1 gene with Finnish exfoliation syndrome patients. J Hum Genet 54, 289-97 (2009).

31. Lemmela, S. et al. Genome-wide scan of exfoliation syndrome. Invest Ophthalmol Vis Sci 48, 4136-42 (2007).

32. Jonasson, F. et al. Prevalence of open-angle glaucoma in Iceland: Reykjavik Eye Study. Eye (Lond) 17, 747-53 (2003).

33. Thorleifsson, G. et al. Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma. Science 317, 1397-400 (2007).

34. Thorleifsson, G. et al. Common variants near CAV1 and CAV2 are associated with primary open-angle glaucoma. Nat Genet 42, 906-9 (2010).

35. Jonsson, T. et al. A mutation in APP protects against Alzheimer's disease and age-related cognitive decline. Nature 488, 96-9 (2012).

36. Steinberg, S. et al. Loss-of-function variants in ABCA7 confer risk of Alzheimer's disease. Nat Genet 47, 445-7 (2015).

37. Gudbjartsson, D.F. et al. Large-scale whole-genome sequencing of the Icelandic population. Nat Genet 47, 435-44 (2015).

38. Alvarez, L. et al. LOXL1 gene variants and their association with pseudoexfoliation glaucoma (XFG) in Spanish patients. BMC Med Genet 16, 72 (2015).

39. de Juan-Marcos, L. et al. Association of Lysyl Oxidase-Like 1 Gene Polymorphisms in Pseudoexfoliation Syndrome and Pseudoexfoliation Glaucoma in a Spanish Population. Ophthalmic Genet 37, 25-30 (2016).

40. Do, R. et al. Exome sequencing identifies rare LDLR and APOA5 alleles conferring risk for myocardial infarction. Nature 518, 102-6 (2015).

41. Price, A.L. et al. Principal components analysis corrects for stratification in genome-wide association studies. Nat Genet 38, 904-9 (2006).

42. Okada, Y. et al. Genetics of rheumatoid arthritis contributes to biology and drug discovery. Nature 506, 376-81 (2014).

43. Schizophrenia Working Group of the Psychiatric Genomics, C. Biological insights from 108 schizophrenia-associated genetic loci. Nature 511, 421-7 (2014).

44. Curtis, J. et al. Susceptibility to tuberculosis is associated with variants in the ASAP1 gene encoding a regulator of dendritic cell migration. Nat Genet 47, 523-7 (2015).


45. Kooner, J.S. et al. Genome-wide association study in individuals of South Asian ancestry identifies six new type 2 diabetes susceptibility loci. Nat Genet 43, 984-9 (2011).

46. International Parkinson Disease Genomics, C. et al. Imputation of sequence variants for identification of genetic risks for Parkinson's disease: a meta-analysis of genome-wide association studies. Lancet 377, 641-9 (2011).

47. Stein, J.D. et al. Geographic and climatic factors associated with exfoliation syndrome. Arch Ophthalmol 129, 1053-60 (2011).

48. Kang, J.H., Loomis, S., Wiggs, J.L., Stein, J.D. & Pasquale, L.R. Demographic and geographic features of exfoliation glaucoma in 2 United States-based prospective cohorts. Ophthalmology 119, 27-35 (2012).

49. Delaneau, O., Zagury, J.F. & Marchini, J. Improved whole-chromosome phasing for disease and population genetic studies. Nat Methods 10, 5-6 (2013).

50. van Rheenen, W. et al. Genome-wide association analyses identify new risk variants and the genetic architecture of amyotrophic lateral sclerosis. Nat Genet (2016).

51. Howie, B.N., Donnelly, P. & Marchini, J. A flexible and accurate genotype imputation method for the next generation of genome-wide association studies. PLoS Genet 5, e1000529 (2009).

52. Jonsson, T. et al. Variant of TREM2 associated with the risk of Alzheimer's disease. N Engl J Med 368, 107-16 (2013).

53. Holm, H. et al. A rare variant in MYH6 is associated with high risk of sick sinus syndrome. Nat Genet 43, 316-20 (2011).


Documents

Supplementary Information - media.nature.com · glaucoma cases and 3,266 controls from Italy, the USA, Mexico, Russia, Greece, South Africa, Pakistan, and India. The number of individuals