SUPPLEMENTARY INFORMATION The SCAR/WAVE complex … · Peptides were first separated by reverse-phase chromatography using a fused silica microcapillary column (75 μm ID, 20 cm)

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2014.24

NATURE PLANTS | www.nature.com/natureplants 1

The SCAR/WAVE complex polarises PAN receptors and promotes division asymmetry in maize

SUPPLEMENTARY MATERIALS AND METHODS

Transgenic maize lines transformed with fluorescent protein constructs

Stable transgenic lines expressing translational fusions to fluorescent proteins were all generated as part of the maize cell genomics project; 1,2 (http://maize.jcvi.org/cellgenomics/index.php). PAN2-YFP 3, PAN1-YFP, YFP-ROP2 4, YFP-ABD2-YFP 1,5, PDI-YFP 6, and PIN1-YFP 7 plants were described previously.

BRK1-CFP made by fusing maize codon-optimized cerulean variant of CFP in C-terminal of BRK1 gene using the MultiSite Gateway method (Invitogen). The native 2721 bp promoter and genomic coding sequence of BRK1 was amplified with primers BRK1_3GWp1 and BRK1_3GWp4 and the 2259 bp native terminator of BRK1 was amplified with primers BRK1_3GWp3 and BRK1_3GWp2 and they were cloned into MultiSite Gateway donor vectors, respectively. The resulting two entry vectors were then recombined into the binary vector pAM1006 (a derivative of pTF101.1 carrying the Gateway Cassette) with the entry vector containing cerulean yielding BRK1-CFP.

RAB11D-YFP was generated by a triple-template PCR method as described previously 1,2. The 5’ native genomic sequence of RAB11D gene was amplified with primers RAB11D-P1 and RAB11D-P2. The 3’ native genomic sequence of RAB11D gene was amplified with primers RAB11D-P3 and RAB11D-P4.

Determination of polarization relative to GMC length

Calculation of the average GMC length in Figure 5 was calculated as follows. GMC lengths were measured in ImageJ, binned in 0.3 µM increments, and the percent of adjacent SMCs with polarized BRK1-CFP, PAN2-YFP, PAN1-YFP, ABD2-YFP-ABD2 or nuclei was calculated for each bin. The average GMC length when 70% of adjacent SMCs exhibited polarized distribution of each marker is reported in Figure 5. All markers reach 100% polarization except YFP-ROP2, which only reaches a maximum of 71% polarization. Therefore, The cell size at which 71%*70%=50% polarization is indicated for YFP-ROP2.

Co-Immunoprecipitation

Co-immunoprecipitation experiments were performed by extracting membrane proteins as described before 8 with minor modifications. 10-14 day old plants were used to isolate the basal 0.5-2.5 cm of unexpanded leaves 4-6. The leaf bases were ground in liquid nitrogen. For western blotting experiments, ~0.5 grams (3-5 plants) of tissue was used and for mass spectrometry 1.5 grams (8-10 plants) were used. 1 ml of Extraction Buffer (50mM Tris, pH 7.5, 150 mM NaCl, 5mM EGTA, 5mM EDTA, 0.3% -mercaptoethanol, 1% Sigma Plant Protease Inhibitor) per 0.25 g of tissue was added to frozen tissue on ice and the mixture was homogenized for 10s using a Omnitip homogenizer. Extracts prepared for mass spectrometry experiments were supplemented with phosphatase inhibitors (1 µM calyculin A, 25 mM Sodium Fluoride 50 mM Sodium Pyrophosphate,). All subsequent steps were 4°C. Extracts were pelleted twice at 13 000xg. The supernatant was then transferred and pelleted at 110,000xg for 45 min. The pellet was resuspended in solubilization buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% NP-40, 10% glycerol, 0.05% Sodium deoxycholate), sonicated 3x15s and left rotating 1hour. Mouse anti-GFP beads (Miltenyi) were added and the extracts were rotated for an additional 30 minutes. Miltenyi µ columns were equilibrated using solubilization buffer. The extracts were applied to the columns, then washed 4x with WB1 (50 mM Tris, 150 mM NaCl, 1% NP-40, 0.05% sodium deoxycholate), 2X with WB2 (20 mM Tris-Cl, 150 mM NaCl, 0.1% NP40, 0.05% sodium deoxycholate) and 2X with 20 mM Tris-Cl, pH 7.5. For western blotting, proteins were eluted with 50 µl hot elution buffer. For mass spectrometry, proteins were eluted with 100 mM Sodium carbonate and then immediately neutralized with 1 µl 1M MES, 1 µL 10 % Formic Acid, and 12.5 µl of 50% Formic Acid/250 mM Ammonium bicarbonate. The pH was checked with pH paper and adjusted with 10% Formic Acid until it was between 7 and 8. Eluted proteins were immediately digested with trypsin.

http://dx.doi.org/10.1038/nplants.2014.24

2 NATURE PLANTS | www.nature.com/natureplants

SUPPLEMENTARY INFORMATION DOI: 10.1038/NPLANTS.2014.24The SCAR/WAVE complex polarises PAN receptors

and promotes division asymmetry in maize Tryptic Digestions and Mass Spectrometry

After neutralization, 1 µl of 500 ng/µl trypsin (Promega) was added to each vial and incubated at 37°C for 8 hours. Reactions were stopped by adding 5 µl of 10% formic acid and dried in a vacuum concentrator. The pellet was resuspended in 0.1% formic acid, and desalted with in-house prepared C18 stage-tips using a previously described protocol and dried in a vacuum centrifuge 9. Samples were resuspended in 5% formic acid, 5% ACN and analyzed in triplicate by LC-MS/MS using a Q-Exactive mass spectrometer (Thermo Scientific, San Jose, CA) with the following conditions.

Peptides were first separated by reverse-phase chromatography using a fused silica microcapillary column (75 μm ID, 20 cm) packed with C18 reverse-phase resin (ReproSil-Pur 120 C18-AQ, 1.9 μm, Dr. Maisch Gmbh) using an in-line nano-flow EASY-nLC 1000 UHPLC (Thermo Scientific). Peptides were eluted over a 100 minute 2-25% ACN gradient, followed by a 45 minute 25-60% ACN gradient, a 5 minute 60-95% ACN gradient, a 5 minute 95%- 0% gradient, with a final 5 minute isocratic step at 0% ACN for a total run time of 120 minutes at a flow rate of 250 nl min-1. MS/MS data were collected in a data-dependent fashion using a top 10 method with a full MS mass range from 400-1800 m/z, 70,000 resolution, and an AGC target of 3 e6. MS2 scans were triggered when an ion intensity threshold of 1.7 e3 was reached. Peptides were fragmented using a normalized collision energy setting of 25. A dynamic exclusion time of 20 seconds was used and the peptide match setting was disabled. Singly charged ions, charge states above 8 and unassigned charge states were excluded. The resultant RAW files were converted into mzXML format using the ReAdW program. The SEQUEST search algorithm (version 28) was used to search MS/MS spectra against a concatenated target-decoy database comprised of forward and reversed sequences derived from the version 2 of the maize genome (5a.59 working gene set). The search parameters used are as follows: 50 ppm precursor ion tolerance and 0.01 Da fragment ion tolerance; up to two missed cleavages were allowed; dynamic modifications of 15.99491 Da on methionine (oxidation). Peptide matches were filtered to a peptide false discovery rate of 0.51% and a protein false discovery rate of 2.35% using the linear discriminant analysis 10. Peptides were assembled into proteins using maximum parsimony and only unique and razor peptides were retained for subsequent analysis.

Determination of CompPass Score threshold

The WD-score for the Co-IP/MS data was calculated in Excel 11,12 using the CompPASS tutorial as a guide (http://falcon.hms.harvard.edu/ipmsmsdbs/cgi-bin/tutorial.cgi). Proteins likely to be an artifact of carryover from previous runs were removed from analysis. Carryover was defined as proteins that had 0 SPC in one of the two biological replicates for a given IP, >18 SPC in the other biological replicate, and >200SPC in the MS experiment immediately preceding the biological replicate with >18 SPC. The order of MS runs was altered between biological replicates (with the exception of the first run always as the non-transgenic control). To determine the cutoff WD-score at which interactors are considered high confidence, simulated, randomized MS runs based on the original data were created in Python and WD-scores were calculated for the simulated runs. In the randomized runs, 5% of the values fell above a WD-score of 3.30, which was used as a threshold cutoff. Proteins that had a WD-score greater than the 3.30 threshold as well as a WD-score greater than the non-transgenic control for the same protein were considered high confidence interactors.


Supplemental Table 1. Primer sequences used in this study.

Primer Sequence

BRK3_cDNA_F1 ATGGCCCATGTTTCGTTCAAAAGC

BRK3_cDNA_R1 CTATCTGTACGATAGAGGGCCAG

BRK3_SEQ1 TGGAACGGTGCTGTTTATGA

BRK3_SEQ2 TAAAGGACGCTTCTCGCATT

BRK3_SEQ3 GTCTATCATGGGTGGGTTGG

BRK3_SEQ4 GCACTGGCTGTCAATCTTGA

BRK3_SEQ5 GCAAAAGGAAGCTGATCTGG

BRK3_SEQ6 AGCCCAAGAATTGGAGAGGT

pJET1.2F CGACTCACTATAGGGAGAGCGGC

pJET1.2R AAGAACATCGATTTTCCATGGCAG

BRK3_GenF1 CTGCTGAACATGTGTATGAATAG

BRK3_GenR1 GACGCCGTGTGGATCTGG

BRK3_GenF2 GTAACCGACAGCGTGCCTG

BRK3_GenR2 GAGCAAGTGCAATAAGTCACC

BRK3_GenF3 TGCCCTGAACTAACCATTGTC

BRK3_GenR3 CAGGCTAGAGTGTGCTCAGC

BRK3_GenF4 CAAAGGTATGCATCGGAGACC

BRK3_GenR4 GCTCAATGCCACATCAAGTGC

BRK3_GenF5 GAGGTGTCTTAGGTGTCTTAG

BRK3_GenR5 GAGAAAACACGATGCATGTGC

BRK3_GenF6 GTAAAGATTCACCAAACTAGATTCC

BRK3_GenR6 GTGTGGTTCTGGTCATGTATC

BRK3_GenF7 CATATTGAGGGAAGCACCTTAG

BRK3_GenR7 AAGTTGTAGGAAAATTAGGTCTATC

BRK3_GenF8 GCACCATATTCTGTTGCTTGTTG

BRK3_GenR8 CCATTGACACATAGGATACC

BRK3_GenF9 GCTCTTGTTCTCTGTTATTGTGC

BRK3_GenR9 GCTAGTCATGTTGCCAAGCAC

BRK3_GenF10 AAGGCTTTGAACTGCCATTGAC



SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2014.24The SCAR/WAVE complex polarises PAN receptors

and promotes division asymmetry in maize Tryptic Digestions and Mass Spectrometry

After neutralization, 1 µl of 500 ng/µl trypsin (Promega) was added to each vial and incubated at 37°C for 8 hours. Reactions were stopped by adding 5 µl of 10% formic acid and dried in a vacuum concentrator. The pellet was resuspended in 0.1% formic acid, and desalted with in-house prepared C18 stage-tips using a previously described protocol and dried in a vacuum centrifuge 9. Samples were resuspended in 5% formic acid, 5% ACN and analyzed in triplicate by LC-MS/MS using a Q-Exactive mass spectrometer (Thermo Scientific, San Jose, CA) with the following conditions.

Peptides were first separated by reverse-phase chromatography using a fused silica microcapillary column (75 μm ID, 20 cm) packed with C18 reverse-phase resin (ReproSil-Pur 120 C18-AQ, 1.9 μm, Dr. Maisch Gmbh) using an in-line nano-flow EASY-nLC 1000 UHPLC (Thermo Scientific). Peptides were eluted over a 100 minute 2-25% ACN gradient, followed by a 45 minute 25-60% ACN gradient, a 5 minute 60-95% ACN gradient, a 5 minute 95%- 0% gradient, with a final 5 minute isocratic step at 0% ACN for a total run time of 120 minutes at a flow rate of 250 nl min-1. MS/MS data were collected in a data-dependent fashion using a top 10 method with a full MS mass range from 400-1800 m/z, 70,000 resolution, and an AGC target of 3 e6. MS2 scans were triggered when an ion intensity threshold of 1.7 e3 was reached. Peptides were fragmented using a normalized collision energy setting of 25. A dynamic exclusion time of 20 seconds was used and the peptide match setting was disabled. Singly charged ions, charge states above 8 and unassigned charge states were excluded. The resultant RAW files were converted into mzXML format using the ReAdW program. The SEQUEST search algorithm (version 28) was used to search MS/MS spectra against a concatenated target-decoy database comprised of forward and reversed sequences derived from the version 2 of the maize genome (5a.59 working gene set). The search parameters used are as follows: 50 ppm precursor ion tolerance and 0.01 Da fragment ion tolerance; up to two missed cleavages were allowed; dynamic modifications of 15.99491 Da on methionine (oxidation). Peptide matches were filtered to a peptide false discovery rate of 0.51% and a protein false discovery rate of 2.35% using the linear discriminant analysis 10. Peptides were assembled into proteins using maximum parsimony and only unique and razor peptides were retained for subsequent analysis.

Determination of CompPass Score threshold

The WD-score for the Co-IP/MS data was calculated in Excel 11,12 using the CompPASS tutorial as a guide (http://falcon.hms.harvard.edu/ipmsmsdbs/cgi-bin/tutorial.cgi). Proteins likely to be an artifact of carryover from previous runs were removed from analysis. Carryover was defined as proteins that had 0 SPC in one of the two biological replicates for a given IP, >18 SPC in the other biological replicate, and >200SPC in the MS experiment immediately preceding the biological replicate with >18 SPC. The order of MS runs was altered between biological replicates (with the exception of the first run always as the non-transgenic control). To determine the cutoff WD-score at which interactors are considered high confidence, simulated, randomized MS runs based on the original data were created in Python and WD-scores were calculated for the simulated runs. In the randomized runs, 5% of the values fell above a WD-score of 3.30, which was used as a threshold cutoff. Proteins that had a WD-score greater than the 3.30 threshold as well as a WD-score greater than the non-transgenic control for the same protein were considered high confidence interactors.


Supplemental Table 1. Primer sequences used in this study.

Primer Sequence

BRK3_cDNA_F1 ATGGCCCATGTTTCGTTCAAAAGC

BRK3_cDNA_R1 CTATCTGTACGATAGAGGGCCAG

BRK3_SEQ1 TGGAACGGTGCTGTTTATGA

BRK3_SEQ2 TAAAGGACGCTTCTCGCATT

BRK3_SEQ3 GTCTATCATGGGTGGGTTGG

BRK3_SEQ4 GCACTGGCTGTCAATCTTGA

BRK3_SEQ5 GCAAAAGGAAGCTGATCTGG

BRK3_SEQ6 AGCCCAAGAATTGGAGAGGT

pJET1.2F CGACTCACTATAGGGAGAGCGGC

pJET1.2R AAGAACATCGATTTTCCATGGCAG

BRK3_GenF1 CTGCTGAACATGTGTATGAATAG

BRK3_GenR1 GACGCCGTGTGGATCTGG

BRK3_GenF2 GTAACCGACAGCGTGCCTG

BRK3_GenR2 GAGCAAGTGCAATAAGTCACC

BRK3_GenF3 TGCCCTGAACTAACCATTGTC

BRK3_GenR3 CAGGCTAGAGTGTGCTCAGC

BRK3_GenF4 CAAAGGTATGCATCGGAGACC

BRK3_GenR4 GCTCAATGCCACATCAAGTGC

BRK3_GenF5 GAGGTGTCTTAGGTGTCTTAG

BRK3_GenR5 GAGAAAACACGATGCATGTGC

BRK3_GenF6 GTAAAGATTCACCAAACTAGATTCC

BRK3_GenR6 GTGTGGTTCTGGTCATGTATC

BRK3_GenF7 CATATTGAGGGAAGCACCTTAG

BRK3_GenR7 AAGTTGTAGGAAAATTAGGTCTATC

BRK3_GenF8 GCACCATATTCTGTTGCTTGTTG

BRK3_GenR8 CCATTGACACATAGGATACC

BRK3_GenF9 GCTCTTGTTCTCTGTTATTGTGC

BRK3_GenR9 GCTAGTCATGTTGCCAAGCAC

BRK3_GenF10 AAGGCTTTGAACTGCCATTGAC




and promotes division asymmetry in maize

BRK3_GenR10 AACAAGGACACTATCCATCAGC

BRK3_GenF11 TGCCATGCATATCCTTGTCTG

BRK3_GenR11 GTTGGACACCATGAATGCAGC

BRK3_GenF12 ATTGAGAAAGGTTGCGAGCAG

BRK3_GenR12 TCGGTTCTGCATCTGCCTTG

BRK3_GenF13 ACATCGTCCCGAAGCTGAC

BRK3_GenR13 AGTTTTTAGTTCAGAGCGAGTTTG BRK1_3GWp1 GGGGACAAGTTTGTACAAAAAAGCAGGCTgtttgcgccactcttttctc

BRK1_3GWp4 GGGGACAACTTTGTATAGAAAAGTTGGGTGgttgaagacggaagggttgg

BRK1_3GWp3 GGGGACAACTTTGTATAATAAAGTTGAGtaggaatcgcgggtttatatgt

BRK1_3GWp2 GGGGACCACTTTGTACAAGAAAGCTGGGTAagctcccacaaagacgctaa

RAB11D-P1 GCTCGATCCACCTAGGCTgcgcatgttcgtcttcgaccaaaggta

RAB11D-P2 CACAGCTCCACCTCCACCTCCAGGCCGGCCttcctgcgccggacctgggacgaggac

RAB11D-P3 TGCTGGTGCTGCTGCGGCCGCTGGGGCCatcccgaagagcaagtgctgcagttcc

RAB11D P4 CGTAGCGAGACCACAGGAtcagtcagcatgggaaagtgccagttg


REFERENCES

1 Mohanty, A. et al. Advancing Cell Biology and Functional Genomics in Maize Using Fluorescent Protein-Tagged Lines. Plant Physiol. 149, 601-605, doi:10.1104/pp.108.130146 (2009).

2 Mohanty, A., Yang, Y., Luo, A., Sylvester, A. W. & Jackson, D. in Methods in Molecular Biology Vol. 526 1-19 (Humana Press, 2009).

3 Zhang, X. et al. Identification of PAN2 by Quantitative Proteomics as a Leucine-Rich Repeat-Receptor-Like Kinase Acting Upstream of PAN1 to Polarize Cell Division in Maize. Plant Cell 24, 4577-4589, doi:10.1105/tpc.112.104125 (2012).

4 Humphries, J. A. et al. ROP GTPases Act with the Receptor-Like Protein PAN1 to Polarize Asymmetric Cell Division in Maize. Plant Cell 23, 2273-2284, doi:10.1105/tpc.111.085597 (2011).

5 Sutimantanapi, D., Pater, D. & Smith, L. G. Divergent roles for maize PAN1 and PAN2 receptor-like proteins in cytokinesis and cell morphogenesis. Plant Physiol. 164, 1905-1917, doi:10.1104/pp.113.232660 (2014).

6 Kirienko, D. R., Luo, A. & Sylvester, A. W. Reliable transient transformation of intact maize leaf cells for functional genomics and experimental study. Plant Physiol. 159, 1309-1318, doi:10.1104/pp.112.199737 (2012).

7 Gallavotti, A., Yang, Y., Schmidt, R. J. & Jackson, D. The Relationship between Auxin Transport and Maize Branching. Plant Physiol. 147, 1913-1923 (2008).

8 Cartwright, H. N., Humphries, J. A. & Smith, L. G. PAN1: A Receptor-Like Protein That Promotes Polarization of an Asymmetric Cell Division in Maize. Science 323, 649-651, doi:10.1126/science.1161686 (2009).

9 Rappsilber, J., Ishihama, Y. & Mann, M. Stop and Go Extraction Tips for Matrix-Assisted Laser Desorption/Ionization, Nanoelectrospray, and LC/MS Sample Pretreatment in Proteomics. Analytical Chemistry 75, 663-670, doi:10.1021/ac026117i (2002).

10 Huttlin, E. L. et al. A Tissue-Specific Atlas of Mouse Protein Phosphorylation and Expression. Cell 143, 1174-1189 (2010).

11 Sarraf, S. A. et al. Landscape of the PARKIN-dependent ubiquitylome in response to mitochondrial depolarization. Nature 496, 372-376, doi:10.1038/nature12043 (2013).

12 Sowa, M. E., Bennett, E. J., Gygi, S. P. & Harper, J. W. Defining the human deubiquitinating enzyme interaction landscape. Cell 138, 389-403, doi:10.1016/j.cell.2009.04.042 (2009).





BRK3_GenR10 AACAAGGACACTATCCATCAGC

BRK3_GenF11 TGCCATGCATATCCTTGTCTG

BRK3_GenR11 GTTGGACACCATGAATGCAGC

BRK3_GenF12 ATTGAGAAAGGTTGCGAGCAG

BRK3_GenR12 TCGGTTCTGCATCTGCCTTG

BRK3_GenF13 ACATCGTCCCGAAGCTGAC

BRK3_GenR13 AGTTTTTAGTTCAGAGCGAGTTTG BRK1_3GWp1 GGGGACAAGTTTGTACAAAAAAGCAGGCTgtttgcgccactcttttctc

BRK1_3GWp4 GGGGACAACTTTGTATAGAAAAGTTGGGTGgttgaagacggaagggttgg

BRK1_3GWp3 GGGGACAACTTTGTATAATAAAGTTGAGtaggaatcgcgggtttatatgt

BRK1_3GWp2 GGGGACCACTTTGTACAAGAAAGCTGGGTAagctcccacaaagacgctaa

RAB11D-P1 GCTCGATCCACCTAGGCTgcgcatgttcgtcttcgaccaaaggta

RAB11D-P2 CACAGCTCCACCTCCACCTCCAGGCCGGCCttcctgcgccggacctgggacgaggac

RAB11D-P3 TGCTGGTGCTGCTGCGGCCGCTGGGGCCatcccgaagagcaagtgctgcagttcc

RAB11D P4 CGTAGCGAGACCACAGGAtcagtcagcatgggaaagtgccagttg


REFERENCES

1 Mohanty, A. et al. Advancing Cell Biology and Functional Genomics in Maize Using Fluorescent Protein-Tagged Lines. Plant Physiol. 149, 601-605, doi:10.1104/pp.108.130146 (2009).

2 Mohanty, A., Yang, Y., Luo, A., Sylvester, A. W. & Jackson, D. in Methods in Molecular Biology Vol. 526 1-19 (Humana Press, 2009).

3 Zhang, X. et al. Identification of PAN2 by Quantitative Proteomics as a Leucine-Rich Repeat-Receptor-Like Kinase Acting Upstream of PAN1 to Polarize Cell Division in Maize. Plant Cell 24, 4577-4589, doi:10.1105/tpc.112.104125 (2012).

4 Humphries, J. A. et al. ROP GTPases Act with the Receptor-Like Protein PAN1 to Polarize Asymmetric Cell Division in Maize. Plant Cell 23, 2273-2284, doi:10.1105/tpc.111.085597 (2011).

5 Sutimantanapi, D., Pater, D. & Smith, L. G. Divergent roles for maize PAN1 and PAN2 receptor-like proteins in cytokinesis and cell morphogenesis. Plant Physiol. 164, 1905-1917, doi:10.1104/pp.113.232660 (2014).

6 Kirienko, D. R., Luo, A. & Sylvester, A. W. Reliable transient transformation of intact maize leaf cells for functional genomics and experimental study. Plant Physiol. 159, 1309-1318, doi:10.1104/pp.112.199737 (2012).

7 Gallavotti, A., Yang, Y., Schmidt, R. J. & Jackson, D. The Relationship between Auxin Transport and Maize Branching. Plant Physiol. 147, 1913-1923 (2008).

8 Cartwright, H. N., Humphries, J. A. & Smith, L. G. PAN1: A Receptor-Like Protein That Promotes Polarization of an Asymmetric Cell Division in Maize. Science 323, 649-651, doi:10.1126/science.1161686 (2009).

9 Rappsilber, J., Ishihama, Y. & Mann, M. Stop and Go Extraction Tips for Matrix-Assisted Laser Desorption/Ionization, Nanoelectrospray, and LC/MS Sample Pretreatment in Proteomics. Analytical Chemistry 75, 663-670, doi:10.1021/ac026117i (2002).

10 Huttlin, E. L. et al. A Tissue-Specific Atlas of Mouse Protein Phosphorylation and Expression. Cell 143, 1174-1189 (2010).

11 Sarraf, S. A. et al. Landscape of the PARKIN-dependent ubiquitylome in response to mitochondrial depolarization. Nature 496, 372-376, doi:10.1038/nature12043 (2013).

12 Sowa, M. E., Bennett, E. J., Gygi, S. P. & Harper, J. W. Defining the human deubiquitinating enzyme interaction landscape. Cell 138, 389-403, doi:10.1016/j.cell.2009.04.042 (2009).





Supplemental Figure 1. Maize stomatal development. Immature maize leaves exhibit a developmental gradient with the earliest developmental stages at the leaf base and the most advanced toward the tip. (i,ii) Stomatal complex formation is initiated by a transverse asymmetric division forming a GMC and an interstomatal cell; the GMC is flanked on both sides by SMCs. (iii) SMC nuclei polarize towards the GMC and (iv) the SMC divides (v) to form a subsidiary cell and a pavement cell. (vi) The GMC divides symmetrically to form a guard cell pair.


Supplemental Figure 2. Exon structure and confirmed mutations in Brk3. The brk3-1 mutation was previously mapped to Chromosome 10S. In Maize Genome Release 5c this region includes genes GRMZM5G886363 and GRMZM2G180150. Comparing the sequence of these two genes and nearby genomic sequence to NAP1 from Arabidopsis thaliana (AT2G35110) and Oryza sativa (Os08G0544500) suggested that this region likely encodes a maize ortholog of NAP1 that was incorrectly annotated. A putative ZmNAP1 cDNA of 4450 bp and 23 exons (blue arrows) and a coding sequence of 4209 bp (grey arrow) was predicted. Primers BRK3_F1 (starting at the start codon) and BRK3_R1 (ending at the stop codon) were used to amplify the full coding sequence from cDNA generated from total RNA using an oligo dT primer. The resulting fragment was cloned into pJET and sequenced to confirm our predicted model (Genebank ID KM603488). Sequencing of PCR products amplified with primers listed in Supplemental Table 1 from genomic DNA of brk3-1, -2 and -3 mutants identified a deleterious mutation in each genetic background (red markers above) as follows: a G to A change in brk3-1 in a splice acceptor site in the intron immediately before exon 21; a G to A change in brk3-2 in a splice acceptor site immediately before exon 5; and a G to T change in brk3-3 that changes a Glu codon to a stop codon. Together, these data confirm that Brk3 encodes ZmNAP1.





Supplemental Figure 1. Maize stomatal development. Immature maize leaves exhibit a developmental gradient with the earliest developmental stages at the leaf base and the most advanced toward the tip. (i,ii) Stomatal complex formation is initiated by a transverse asymmetric division forming a GMC and an interstomatal cell; the GMC is flanked on both sides by SMCs. (iii) SMC nuclei polarize towards the GMC and (iv) the SMC divides (v) to form a subsidiary cell and a pavement cell. (vi) The GMC divides symmetrically to form a guard cell pair.


Supplemental Figure 2. Exon structure and confirmed mutations in Brk3. The brk3-1 mutation was previously mapped to Chromosome 10S. In Maize Genome Release 5c this region includes genes GRMZM5G886363 and GRMZM2G180150. Comparing the sequence of these two genes and nearby genomic sequence to NAP1 from Arabidopsis thaliana (AT2G35110) and Oryza sativa (Os08G0544500) suggested that this region likely encodes a maize ortholog of NAP1 that was incorrectly annotated. A putative ZmNAP1 cDNA of 4450 bp and 23 exons (blue arrows) and a coding sequence of 4209 bp (grey arrow) was predicted. Primers BRK3_F1 (starting at the start codon) and BRK3_R1 (ending at the stop codon) were used to amplify the full coding sequence from cDNA generated from total RNA using an oligo dT primer. The resulting fragment was cloned into pJET and sequenced to confirm our predicted model (Genebank ID KM603488). Sequencing of PCR products amplified with primers listed in Supplemental Table 1 from genomic DNA of brk3-1, -2 and -3 mutants identified a deleterious mutation in each genetic background (red markers above) as follows: a G to A change in brk3-1 in a splice acceptor site in the intron immediately before exon 21; a G to A change in brk3-2 in a splice acceptor site immediately before exon 5; and a G to T change in brk3-3 that changes a Glu codon to a stop codon. Together, these data confirm that Brk3 encodes ZmNAP1.





Supplemental Figure 3. BRK1-CFP and PAN1-YFP rescue brk1 and pan1 phenotypes, respectively. (a) A total of 65 plants from a cross of brk1/+; BRK1-CFP x brk1/brk1 were analyzed for % abnormal subsidiary cells, BASTA resistance/sensitivity, and pavement cell edge phenotype (presence of crenulations as seen in wild type, or absence as seen in brk1 mutants). Progeny of these crosses are expected to yield 50% brk1/+ (wild type) and 50% brk1/brk1 plants (phenotypically mutant in the absence of a functional transgene). Consistent with this expectation, about half the 31 BASTA-sensitive plants (BRK1-CFP-) analyzed had a wild type phenotype with <5% abnormal subsidiary cells and normal pavement cell crenulations (red dots) while the other half had a brk1 phenotype with >10% abnormal subsidiaries and no pavement cell crenulations (blue dots). In contrast, all 34 BASTA resistant plants (BRK1-CFP+) analyzed had <5% abnormal subsidiary cells and normal pavement cell crenulations, indicating that BRK1-CFP rescued both aspects of the brk1 mutant phenotype. (b) A total of 92 plants from two crosses of pan1/+;PAN1-YFP x pan1/pan1 were analyzed for percent abnormal subsidiary cells and BASTA resistance. Similar to (a), only BASTA sensitive plants (PAN1-YFP-) had abnormal subsidiary cell frequencies exceeding 12% indicating that the pan1 phenotype was largely rescued in BASTA-resistant (PAN1-YFP+) plants. In both (a) and (b), between 60-200 subsidiary cells were scored as normal or abnormal for each individual.


Supplemental Figure 4. BRK1-CFP does not co-localize with the ER marker PDI-YFP. Z-projections (a-c) of 26 planes or a single mid-plane (d&e) of the same cells co-expressing BRK1-CFP (a&d) or PDI-YFP (b&e). Panel c shows a merge of panels a (magenta, BRK1-CFP) and b (green, PDI-YFP). Although one SMC shows enrichment of PDI-YFP at the GMC interface (b&e, arrow), several others with polarized nuclei and BRK1-CFP patches do not. Several SMCs show localized accumulations of PDI-YFP that are not at the GMC interface (e, arrowheads) indicating that localized accumulation of PDI-YFP is not specific to the GMC-SMC interface. Young cells have a dense ER pattern, as shown in b. Panels a-e are at the same magnification. (f) Z-projection of PDI-YFP of mature, fully expanded leaf cells showing the typical “lacy” pattern of the ER and confirming that PDI-YFP is ER-localized.





Supplemental Figure 3. BRK1-CFP and PAN1-YFP rescue brk1 and pan1 phenotypes, respectively. (a) A total of 65 plants from a cross of brk1/+; BRK1-CFP x brk1/brk1 were analyzed for % abnormal subsidiary cells, BASTA resistance/sensitivity, and pavement cell edge phenotype (presence of crenulations as seen in wild type, or absence as seen in brk1 mutants). Progeny of these crosses are expected to yield 50% brk1/+ (wild type) and 50% brk1/brk1 plants (phenotypically mutant in the absence of a functional transgene). Consistent with this expectation, about half the 31 BASTA-sensitive plants (BRK1-CFP-) analyzed had a wild type phenotype with <5% abnormal subsidiary cells and normal pavement cell crenulations (red dots) while the other half had a brk1 phenotype with >10% abnormal subsidiaries and no pavement cell crenulations (blue dots). In contrast, all 34 BASTA resistant plants (BRK1-CFP+) analyzed had <5% abnormal subsidiary cells and normal pavement cell crenulations, indicating that BRK1-CFP rescued both aspects of the brk1 mutant phenotype. (b) A total of 92 plants from two crosses of pan1/+;PAN1-YFP x pan1/pan1 were analyzed for percent abnormal subsidiary cells and BASTA resistance. Similar to (a), only BASTA sensitive plants (PAN1-YFP-) had abnormal subsidiary cell frequencies exceeding 12% indicating that the pan1 phenotype was largely rescued in BASTA-resistant (PAN1-YFP+) plants. In both (a) and (b), between 60-200 subsidiary cells were scored as normal or abnormal for each individual.


Supplemental Figure 4. BRK1-CFP does not co-localize with the ER marker PDI-YFP. Z-projections (a-c) of 26 planes or a single mid-plane (d&e) of the same cells co-expressing BRK1-CFP (a&d) or PDI-YFP (b&e). Panel c shows a merge of panels a (magenta, BRK1-CFP) and b (green, PDI-YFP). Although one SMC shows enrichment of PDI-YFP at the GMC interface (b&e, arrow), several others with polarized nuclei and BRK1-CFP patches do not. Several SMCs show localized accumulations of PDI-YFP that are not at the GMC interface (e, arrowheads) indicating that localized accumulation of PDI-YFP is not specific to the GMC-SMC interface. Young cells have a dense ER pattern, as shown in b. Panels a-e are at the same magnification. (f) Z-projection of PDI-YFP of mature, fully expanded leaf cells showing the typical “lacy” pattern of the ER and confirming that PDI-YFP is ER-localized.





Supplemental Figure 5. BRK1-CFP is not associated with the cell periphery or enriched at GMC-SMC contact sites in brk3. Families segregating BRK1-CFP and brk3 were examined for BRK1-CFP expression. Only BASTA resistant plants were examined to ensure that all plants analyzed carried the BRK1-CFP construct. All SMCs (67/67) observed in three BASTA resistant, non-mutant siblings had BRK1-CFP patches at the GMC interface. Conversely, no SMCs (0/78) from four brk3 plants had BRK1-CFP patches nor any other detectable cell surface-associated signal and exhibited only a weak, diffuse cytoplasmic signal. All images shown at the same magnification; scale bar in (a) is 10 µm.






Supplemental Figure 5. BRK1-CFP is not associated with the cell periphery or enriched at GMC-SMC contact sites in brk3. Families segregating BRK1-CFP and brk3 were examined for BRK1-CFP expression. Only BASTA resistant plants were examined to ensure that all plants analyzed carried the BRK1-CFP construct. All SMCs (67/67) observed in three BASTA resistant, non-mutant siblings had BRK1-CFP patches at the GMC interface. Conversely, no SMCs (0/78) from four brk3 plants had BRK1-CFP patches nor any other detectable cell surface-associated signal and exhibited only a weak, diffuse cytoplasmic signal. All images shown at the same magnification; scale bar in (a) is 10 µm.






Supplemental Figure 7. BRK1 is not required for PAN1 localization to cell plates. In a-f, asterisks mark GMCs and arrowheads mark the edges of cell plates in adjacent SMCs at early (a,c,e) or late (b,d,f) stages of expansion. Top pair in each set of four images shows BRK1-CFP (a,b) or PAN1-YFP (c-f) in monochrome; bottom pair shows merge for the same image with BRK1-CFP or PAN1-YFP in magenta and YFP-tubulin-labeled microtubules in green to highlight the phragmoplast. As shown in a and b, BRK1-CFP is not localized to cell plates. Consistent with that finding, PAN1-YFP localization to both early and late cell plates of wild type (c,d) is unchanged in brk1 mutants (e,f). Note however the dramatic depletion of PAN1-YFP at GMC contact sites in brk1 mutants compared to wild type. Scale bar in f = 10 µm and applies to a-f. Quantitative analysis of PAN1-YFP signal intensity at GMC contact sites and cell plates was conducted for 30 brk1 mutant SMCs and 29 wild type SMCs (non-mutant brk1 siblings) sampled from multiple plants. This demonstrated that PAN1-YFP signal intensity at GMC contact sites dropped about 8-fold in brk1 mutants compared to wild type but signal intensity at cell plates was not reduced (g). Thus, the ratio of PAN1-YFP signal intensity at GMC contact sites relative to cell plates (“patch to plate ratio”) dropped from about 7.5 in wild type to nearly 1 in brk1 mutants (h). Error bars in g and h represent standard errors.


Supplemental Figure 8. brk and pan mutants have fewer YFP-ROP2 patches. SMCs in plants segregating YFP-ROP2 and pan or brk were analyzed for the presence/absence of ROP2 patches and nuclear polarization. (a) brk1/+ (wild type) plant with YFP-ROP2 patches and polarized nuclei in most SMCs (b). Homozygous brk1 (mutant) sibling with developing stomata at the same stage showing fewer YFP-ROP2 patches and polarized nuclei. (c) Quantification of the percent of SMCs with ROP patches and polarized nuclei. To ensure that cells compared were at similar developmental stages, only SMCs with a width-to-length ratio of 1 to 1.5 were analyzed. In all mutants, there was a decrease in the proportion of cells with a polarized nucleus and a ROP patch relative to its heterozygous sibling. This was accompanied by a corresponding increase in the number of plants with an unpolarized nucleus and no actin patch. Chi-squared tests comparing mutant plants to their respective heterozygous siblings results in p<0.001 in all 4 cases.





Supplemental Figure 7. BRK1 is not required for PAN1 localization to cell plates. In a-f, asterisks mark GMCs and arrowheads mark the edges of cell plates in adjacent SMCs at early (a,c,e) or late (b,d,f) stages of expansion. Top pair in each set of four images shows BRK1-CFP (a,b) or PAN1-YFP (c-f) in monochrome; bottom pair shows merge for the same image with BRK1-CFP or PAN1-YFP in magenta and YFP-tubulin-labeled microtubules in green to highlight the phragmoplast. As shown in a and b, BRK1-CFP is not localized to cell plates. Consistent with that finding, PAN1-YFP localization to both early and late cell plates of wild type (c,d) is unchanged in brk1 mutants (e,f). Note however the dramatic depletion of PAN1-YFP at GMC contact sites in brk1 mutants compared to wild type. Scale bar in f = 10 µm and applies to a-f. Quantitative analysis of PAN1-YFP signal intensity at GMC contact sites and cell plates was conducted for 30 brk1 mutant SMCs and 29 wild type SMCs (non-mutant brk1 siblings) sampled from multiple plants. This demonstrated that PAN1-YFP signal intensity at GMC contact sites dropped about 8-fold in brk1 mutants compared to wild type but signal intensity at cell plates was not reduced (g). Thus, the ratio of PAN1-YFP signal intensity at GMC contact sites relative to cell plates (“patch to plate ratio”) dropped from about 7.5 in wild type to nearly 1 in brk1 mutants (h). Error bars in g and h represent standard errors.


Supplemental Figure 8. brk and pan mutants have fewer YFP-ROP2 patches. SMCs in plants segregating YFP-ROP2 and pan or brk were analyzed for the presence/absence of ROP2 patches and nuclear polarization. (a) brk1/+ (wild type) plant with YFP-ROP2 patches and polarized nuclei in most SMCs (b). Homozygous brk1 (mutant) sibling with developing stomata at the same stage showing fewer YFP-ROP2 patches and polarized nuclei. (c) Quantification of the percent of SMCs with ROP patches and polarized nuclei. To ensure that cells compared were at similar developmental stages, only SMCs with a width-to-length ratio of 1 to 1.5 were analyzed. In all mutants, there was a decrease in the proportion of cells with a polarized nucleus and a ROP patch relative to its heterozygous sibling. This was accompanied by a corresponding increase in the number of plants with an unpolarized nucleus and no actin patch. Chi-squared tests comparing mutant plants to their respective heterozygous siblings results in p<0.001 in all 4 cases.





Supplemental Figure 9. SCAR complex members interact with ROP2 but not PAN2. Proteins solubilized from stomatal division zone membrane extracts of wild type, non-transgenic plants (B73) and plants expressing PAN2-YFP, BRK1-CFP or YFP-ROP2 in a B73 background were immunoprecipitated using -GFP. Immunoprecipitates were separated by SDS-PAGE and probed with -GFP, -PAN2 or -SRA1 antibodies. PAN2-YFP co-IP’s with endogenous PAN2, but not SRA1 in the same experiment. Reciprocally, BRK1-CFP co-IP’s with SRA1 but not PAN2 in the same experiment. YFP-ROP2 co-IP’s with SRA1 but not PAN2.


Supplemental Figure 10. Proposed ZmSra1 gene model and evidence that Brk2 encodes ZmSra1. Previous mapping of brk2 narrowed the causative mutation to a region on chromosome 1S5. This region includes 3 genes (GRMZM2G103599, GRMZM2G170567 and GRMZM2G113174) similar to parts of SRA1 from other organisms. We propose a new gene model which encompasses these three gene models. (a) Schematic of ~80 kb region encoding SRA1. The three genes currently annotated in the AGPv3 release of the maize genome are shown as grey arrows. The blue arrow spans the proposed coding sequence of ZmSra1 and the red boxes connected by a line show proposed exons. The proposed model results in a putative protein of 1299 amino acids, and about ~145 kDa. (b) Summary of % identity and similarity between the proposed full length maize SRA1 protein and orthologous proteins in three other plants determined via ClustalW alignment. (c) Western blot analysis of maize proteins probed with anti-SRA1. A polyclonal rabbit antibody was raised against the peptide KADPEQHSLHQETEEMR, which corresponds to amino acids 309-325 of GRMZM2G170567, or amino acids 539-555 of the proposed full length SRA1. On western blots of proteins extracted from wild type (B73 inbred) plants, this antibody labeled proteins of ~130 kDa and ~140-150 kDa. Proteins extracted from mutants homozygous for any of three brk2 mutant alleles of independent origin introgressed into B73 lacked the larger protein, suggesting that this is the Brk2 gene product. The size of the larger protein is consistent with the ~145 kDa predicted for full length SRA1 (and much larger than the ~60 kDa predicted by gene model GRMZM2G170567). Due to the large size and high GC content of the proposed gene, we have not successfully sequenced this region in brk2 mutant backgrounds. However, based on the evidence above, we suggest that Brk2 likely encodes the maize ortholog of SRA1 and our antibody recognizes SRA1.





Supplemental Figure 9. SCAR complex members interact with ROP2 but not PAN2. Proteins solubilized from stomatal division zone membrane extracts of wild type, non-transgenic plants (B73) and plants expressing PAN2-YFP, BRK1-CFP or YFP-ROP2 in a B73 background were immunoprecipitated using -GFP. Immunoprecipitates were separated by SDS-PAGE and probed with -GFP, -PAN2 or -SRA1 antibodies. PAN2-YFP co-IP’s with endogenous PAN2, but not SRA1 in the same experiment. Reciprocally, BRK1-CFP co-IP’s with SRA1 but not PAN2 in the same experiment. YFP-ROP2 co-IP’s with SRA1 but not PAN2.


Supplemental Figure 10. Proposed ZmSra1 gene model and evidence that Brk2 encodes ZmSra1. Previous mapping of brk2 narrowed the causative mutation to a region on chromosome 1S5. This region includes 3 genes (GRMZM2G103599, GRMZM2G170567 and GRMZM2G113174) similar to parts of SRA1 from other organisms. We propose a new gene model which encompasses these three gene models. (a) Schematic of ~80 kb region encoding SRA1. The three genes currently annotated in the AGPv3 release of the maize genome are shown as grey arrows. The blue arrow spans the proposed coding sequence of ZmSra1 and the red boxes connected by a line show proposed exons. The proposed model results in a putative protein of 1299 amino acids, and about ~145 kDa. (b) Summary of % identity and similarity between the proposed full length maize SRA1 protein and orthologous proteins in three other plants determined via ClustalW alignment. (c) Western blot analysis of maize proteins probed with anti-SRA1. A polyclonal rabbit antibody was raised against the peptide KADPEQHSLHQETEEMR, which corresponds to amino acids 309-325 of GRMZM2G170567, or amino acids 539-555 of the proposed full length SRA1. On western blots of proteins extracted from wild type (B73 inbred) plants, this antibody labeled proteins of ~130 kDa and ~140-150 kDa. Proteins extracted from mutants homozygous for any of three brk2 mutant alleles of independent origin introgressed into B73 lacked the larger protein, suggesting that this is the Brk2 gene product. The size of the larger protein is consistent with the ~145 kDa predicted for full length SRA1 (and much larger than the ~60 kDa predicted by gene model GRMZM2G170567). Due to the large size and high GC content of the proposed gene, we have not successfully sequenced this region in brk2 mutant backgrounds. However, based on the evidence above, we suggest that Brk2 likely encodes the maize ortholog of SRA1 and our antibody recognizes SRA1.


Documents

SUPPLEMENTARY INFORMATION The SCAR/WAVE complex … · Peptides were first separated by reverse-phase chromatography using a fused silica microcapillary column (75 μm ID, 20 cm)