Supplementary Materials for

ATRX loss promotes tumor growth and impairs nonhomologous end

joining DNA repair in glioma

Carl Koschmann, Anda-Alexandra Calinescu, Felipe J. Nunez, Alan Mackay,

Janet Fazal-Salom, Daniel Thomas, Flor Mendez, Neha Kamran, Marta Dzaman,

Lakshman Mulpuri, Johnathon Krasinkiewicz, Robert Doherty, Rosemary Lemons,

Jacqueline A. Brosnan-Cashman, Youping Li, Soyeon Roh, Lili Zhao, Henry Appelman,

David Ferguson, Vera Gorbunova, Alan Meeker, Chris Jones, Pedro R. Lowenstein,

Maria G. Castro*

*Corresponding author. E-mail: mariacas@med.umich.edu

Published 2 March 2016, Sci. Transl. Med. 8, 328ra28 (2016)

DOI: 10.1126/scitranslmed.aac8228

The PDF file includes:

Materials and Methods

Fig. S1. SB-responsive shATRX plasmids are cloned to explore the impact of

ATRX on GBM development.

Fig. S2. Cells cotransfected with shp53, shATRX, and NRAS plasmids are

characterized at 15 days after injection.

Fig. S3. SB-mediated transfected cells are distinct from ependymal cells in mice.

Fig. S4. Characterization of p53/NRAS/shATRX mice 7 days after injection

shows tumor cells expressing GFAP and Nestin.

Fig. S5. p53/NRAS/shATRX mice at 21 days after injection show tumor cells

expressing OLIG2 and Nestin.

Fig. S6. Moribund p53/NRAS/shATRX mice show tumor cells expressing

OLIG2, Nestin, and pERK.

Fig. S7. p53/NRAS/shATRX mice show loss of GFAP expression by 15 days

after injection.

Fig. S8. ATRX mutations do not cluster in SNF2/helicase domain in human

glioma.

Fig. S9. Primary GBM cell cultures are generated from SB-induced mouse

tumors.

Fig. S10. Telomere length measured by qPCR is not different in tumors with or

without ATRX.

www.sciencetranslationalmedicine.org/cgi/content/full/8/328/328ra28/DC1

Fig. S11. ALT was assessed by c-circle assay with DNA from mouse tumors and

neurospheres.

Fig. S12. Cells transfected with shATRX plasmid show reduction in NHEJ by

flow cytometry.

Fig. S13. NHEJ pathway is characterized by IHC.

Fig. S14. HR pathway is characterized by IHC.

Fig. S15. Mismatch repair pathway is characterized by IHC.

Fig. S16. SB mouse tumor growth (without radiation treatment) is characterized

by luminescence.

Fig. S17. Tumors with ATRX loss show reduction in pDNA-PKcs before and

after radiation treatment.

Fig. S18. Mouse tumors with ATRX loss show increased expression of γH2A.X

in vitro and in vivo.

Fig. S19. Detailed schematic shows proposed impact of ATRX loss on GBM

progression.

Table S1. Animal models of glioma all have RTK-RAS-PI3K alterations.

Table S2. Mice injected with p53/NRAS/shATRX have faster-growing tumors.

Table S3. MSI rate is increased in p53/NRAS/shATRX tumors.

Table S4. IDH1 and TP53 mutations do not alter SNV rate calculated by two-way

ANOVA model.

Table S5. Telomere qPCR average telomere length ratio worksheet and standard

curve show similar results in all experimental groups.

Table S6. Immunofluorescence analysis shows reduced pDNA-PKcs expression

in ATRX-deficient mouse GBM.

Table S7. Antibodies used for tissue analysis are summarized in table form.

Materials and Methods:

Study Design

To study the impact of ATRX loss on GBM formation in an animal model, we injected

Sleeping Beauty plasmids encoding shp53 and NRAS (with or without shATRX) into the

ventricles of neonatal mice. All experiments with mouse GBM tissue used these two

experimental conditions, and sample size and any data inclusion/exclusion were defined

individually for each experiment. Replication number varied between experiments and is

presented in the figure legends. Our studies were not randomized with the exception of

subsequent litters of mice bearing tumors being selected (entire litters) for treatment or non-

treatment with whole brain radiation. We performed blinding for qualitative

immunohistochemistry scoring of ALT and GBM neurosphere chromosome counting. Human

glioma mutation assessment was performed using publically-available matched tumor/non-tumor

genome sequencing datasets, all of which were accessed through the European Genome-

phenome Archive (EGA) and additional pediatric high-grade glioma samples, which have been

deposited (C. Jones, EGA accession number (EGAS00001001436). Both brainstem and non-

brainstem glioma samples were included. We excluded samples with extreme hyper-mutation,

which is associated with germline mutation in known DNA-damage repair pathway genes.

Development of a Sleeping Beauty transposase-responsive shATRX plasmid

Plasmids encoding (1) SB transposase and luciferase (pT2C-LucPGK-SB100X,

henceforth referred to as SB/Luc), (2) a short-hairpin against p53 (pT2-shp53-GFP4, henceforth

referred to as shp53), and (3) an over-expressed version of NRAS (pT2CAG-NRASV12,

henceforth referred to as NRAS) were generously provided by Dr. John Ohlfest (University of

Minnesota, deceased) (10, 11).

To create the plasmid shATRX (pT2-shATRX53-GFP4), we selected a 97 base pair

sequence (HP_451453) from the candidate sequences for mouse ATRX using the RNAi codex

database (http://cancan.cshl.edu/cgi-bin/Codex/Codex.cgi). Two custom oligos were synthesized

(TOP Gene Technologies) onto a pAPG10 cloning vector with flanking cut sites XhoI and EcoRI

with the following 116 base pair design: (1) shATRX53: [CTCGAGAAGGTATAT-[ 97 base

pair HP_451453 sequence]-AATTC], and (2) shSCRAMBLE, with scramble generated from the

online siRNA Wizard (InvivoGen) based on shATRX53 sequence; scrambled sequenced

underlined:

[CTCGAGAAGGTATATTCGAGAAGGTATATTGCTGTTGACAGTGAGCGGCCGTGCTT

TATCCGTGACAATTAGTGAAGCCACAGATGTAGGCCTGAACACTGGTAATATCATGC

CTACTGCCTCGG- AATTC].

To clone into the shp53 plasmid (fig. S1), we used the QuikChange II Site-Directed

Mutagenesis Kit (Agilent) to remove the additional XhoI (position 4654 A>C) and EcoRI sites

(position 4285 A>C) outside of the shRNA region (position 1949 to 2291), generating

shp53mutated. The plasmids shp53mutated, pAPG10-shATRX53, and pAPG10-shSCRAMBLE

were digested with XhoI and EcoRI. Then, the shATRX53 and shATRX-SCRAMBLE

fragments (110 bp each) were inserted into separate shp53mutated backbones with removal of

the 110 bp shp53 sequence. The resultant shATRX and shSCRAMBLE plasmids were confirmed

by sequencing.

To confirm that all plasmids were being expressed by mouse cells at early time points, we

created plasmids that allow distinct fluorescent expression for each plasmid, including (1) pKT2-

NRAS-Katushka (henceforth referred to as NRAS-Katushka) and (2) pT2-shATRX-NO GFP

(henceforth referred to as shATRX-NO GFP) to follow ATRX status by immunostaining alone.

To create shATRX-NO GFP, unique sites ClaI and SfiI flanking the eGFP sequence were cut and

the resultant 816 bp GFP fragment was removed from the 6555 bp remaining plasmid.

Overhanging ends were blunt-ended and re-ligated and resultant shATRX-NO GFP plasmid was

confirmed by sequencing. Additionally, shSCRAMBLE-NO GFP was created in a similar

manner. To create NRAS-Katushka, custom oligos were synthesized (TOP Gene Technologies)

onto respective pAPG10 cloning vectors with flanking cut sites as listed below: (1) the sequence

of NRAS, as found in the pT2CAG-NRASV12 plasmid, with a c-terminal HA tag, and (2) an

IRES sequence followed by the cDNA for the fluorescent protein Katushka. The plasmids

pKT2CLP-AKT and pAG10-HA-NRAS were digested with XbaI and XhoI. Then, the HA-

NRAS fragment was inserted into the pKT2 backbone with removal of the AKT gene resulting

in the pKT2-NRAS plasmid. After this, the pKT2-NRAS plasmid and pAG10-IRES Katushka

were digested with XhoI and BsiWI, and the IRES-Katushka fragment was ligated in, resulting in

the NRAS-Katushka plasmid. Katushka expression was confirmed by transient transfection of

293T cells with the NRAS Katushka plasmid.

The choice of injection site and transfected cell population is central to the characteristics

of an endogenous mouse tumor model. As shown previously, transformation of the neural stem

cells of the SVZ induced by oncogenic DNA will drive them into a proliferative and invasive

state which overrides individual characteristics of cells in this area (10, 11). Generation of de

novo glioblastomas using the Sleeping Beauty transposon system represents a model system

designed to more closely mimic the etiology and pathology of the human disease, with the

concomitant heterogeneity seen in human GBM (15).

Animal studies, Sleeping Beauty injections, and in vivo imaging

Neonatal wild-type C57BL/6 and FVB mice (Jackson Laboratory) were used in all

experiments. All animal studies were conducted according to the guidelines approved by the

University Committee on Use and Care of Animals (UCUCA) at the University of Michigan.

Mice were injected according to previously described protocol (10). Briefly, plasmids were

mixed in equal ratio 1:1:1 or 1:1:1:1 (20 g plasmid per 40 l plasmid mixture) with In vivo-jet-

PEI (Polyplus Transfection) (2.8 l per 40 l plasmid mixture) and dextrose (5% total) and

maintained at room temperature for at least 15 minutes before injection. Mice were injected on

postnatal day 1. Anesthesia was performed by placing the mouse on ice for 2 minutes and then

on a neonatal stereotaxic stage cooled to 2-8°C to maintain anesthesia, as previously described

(11). Mice were injected in the lateral ventricle (1.5 mm AP, 0.7 mm lateral, and 1.5 mm deep

from lambda) with 0.75 l plasmid mixture (0.5 l/min): including (1) SB transposase/luciferase,

(2) NRAS, (3) shp53, with or without (4) shATRX. All data generated to explore the impact of

shATRX involved these two combinations (shp53/NRAS or shp53/NRAS/shATRX). Uptake of

plasmid DNA as well as development of intracranial tumors was monitored by bioluminescence.

For survival studies, animals were monitored daily for signs of morbidity, including

ataxia, impaired mobility, hunched posture, seizures, and scruffed fur. Animals displaying

symptoms of morbidity were anesthetized with an intra-peritoneal injection of 100 mg/kg of

ketamine and 10 mg/kg of xylazine, as previously described (11). After achieving deep

anesthesia, mice were intracardially perfused with Tyrode’s solution, followed by fixation with

4% paraformaldehyde (PFA) in phosphate buffered saline (PBS). Mouse brains were then

removed from the skulls and processed for histology.

To monitor plasmid uptake in neonatal pups, 30 µl of luciferin (30 mg/ml) was injected

subcutaneously into each pup 24-48 hours after plasmid injection. In vivo bioluminescence was

monitored with IVIS Spectrum (Perkin Elmer) imaging system. For the IVIS Spectrum, the

following settings were used: automatic exposure, large binning, and aperture f=1. Pups without

luminescence were euthanized by placing the neonatal mouse on ice for 2 minutes and then

performing decapitation, according to approved UCUCA protocol. To monitor tumor formation

and progression in adult mice, 100 µl luciferin solution was injected intra-peritoneally. For in

vivo imaging, adult mice were anesthetized with oxygen/isoflurane flow (1.5-2.5% isoflurane).

To score luminescence, we used Living Image Software Version 4.3.1 (Caliper Life Sciences).

Region of interest was defined as a circle over the head, and luminescence intensity was

measured using the calibrated units photons/s/cm2/sr. Multiple images were taken over a 25

minute period after injection and maximal intensity was reported.

Immunohistochemistry and telomere FISH (ALT assay)

Mouse brains were fixed in 4% PFA for 48 hours at 4°C and then transferred to 70%

ethanol, then processed and embedded in paraffin at the University of Michigan Microscopy &

Image Analysis Core Facility using a Leica ASP 300 paraffin tissue processor/Tissue-Tek

paraffin tissue embedding station. Tissue was sectioned with a rotary microtome (Leica) set to 5

μm in the z-direction.

Brains from early time points (7 and 15 days after injection) were flash frozen and

embedded for cryosection to maintain endogenous fluorescence. For cryo-sectioning, mice were

euthanized, and brains were removed without perfusion and immediately placed in OCT medium

(TissueTek). The blocks with embedded brains were then submerged in liquid nitrogen, and then

sectioned with a rotary cryotome (Leica) set to 12 μm in the z-direction. Cryo-section slides

were fixed for 5 minutes with 10% neutral-buffered formalin (Sigma).

Antigen retrieval and immunohistochemistry of paraffin-embedded brain tissue sections

was performed using antibodies and dilutions listed in table S7. Images were obtained using

brightfield/epifluorescence (Zeiss Axioplan2; Carl Zeiss MicroImaging) or laser scanning

confocal microscopy (Leica DMIRE2; Leica Microsystems) and analyzed with LSM5 software

(Carl Zeiss MicroImaging).

To confirm that all three plasmids were being expressed by individual cells, additional

plasmids were developed to isolate fluorescent markers (p53-GFP, NRAS-Katushka, and

shATRX-noGFP). Mice were injected with these three plasmids and sacrificed at 15 days after

injection. Immunohistochemistry was performed with primary antibody against ATRX, followed

by Alexa Fluor 405-conjugated secondary (blue). Therefore, endogenous red channel (594 nm)

fluorescence marked NRAS-Katushka plasmid expression, endogenous green channel (488 nm)

fluorescence marked shp53-GFP plasmid expression, and ATRX expression was marked by blue

(405 nm) fluorescence.

We performed the telomere FISH protocol to assess for ALT using PNA FISH Cy-3

labeled mammalian telomeric and centromeric probes (PNA Bio), as previously described (8), on

our paraffin-embedded brain and tumor tissue. In addition, we obtained eight samples of human

pancreatic neuro-endocrine tumors (PanNET) from the University of Michigan Pathology

Department to provide positive controls for ALT (~70% of PanNET tumors display ALT) (8).

Briefly, slides were deparaffinized, hydrated and steamed in citrate buffer, then dehydrated, dried

briefly, and hybridized with Cy3-labeled peptide nucleic acid (PNA) probe to telomere repeat

sequence (CCCTAACCCTAACCCTAA) ( PNA Bio, F1002) or centromere repeat sequence

(CCCTAACCCTAACCCTAA) (PNA Bio, F3002). After hybridization and washes, we

performed nuclear staining with DAPI. As previously described (8), ALT was scored by the

presence of ultra-bright telomere FISH foci (foci brighter than average cell signal). Calculated

total cell fluorescence (CTCF) and foci fluorescence was scored with Image J software to

measure area-integrated intensity minus background intensity. Tumors from each group: (1)

shp53/NRAS mouse GBM, (2) shp53/NRAS/shATRX mouse GBM, (3) non-tumor mouse

striatum, and (4) human PanNET were analyzed and scored for fluorescent signal.

Microsatellite instability analysis

For MSI assessment, GBMs (with or without ATRX) resected from moribund mice were

dissociated from normal tissue by microscopic visualization of GFP expression on an epi-

fluorescent microscope (Zeiss Axiovert 200; Carl Zeiss MicroImaging). Non-tumor striatum

and/or tail were isolated with a sterile scalpel. PCR was performed with published 5’-FAM-

labeled primers for known mouse and human sequences with coding repeats altered in cancers

with high microsatellite instability (22, 23), including (1) mBat26 (forward: 6-FAM-

CTGCGAGAAGGTACTCACCC; reverse: TCACCATCCATTGCACAGTT), (2) D7mit91

(forward: 6-FAM-TCTTGCTTGCATACACTCACG; reverse:

GAGACAAACCGCAGTCTCCT), (3) D1mit62 (forward: 6-FAM-

CCTGAGTTCAGTTATCAGCGC; reverse: GAGACCAGAAGAGCGTGTCC), and (4)

D6mit59 (forward: GCCATCCTTTGTAATAACAAACA; reverse: 6-FAM-

CGTCTGGGAAAACCTCAAAA). PCR was performed using previously published parameters

(22), and resultant DNA was submitted to University of Michigan DNA Sequencing Core for

fragment size analysis. Microsatellite sites were compared between tumors (with and without

shATRX) and control striatum/tail genomic DNA using the MSI Analysis Program GeneMarker

Software (SoftGenetics). Microsatellite instability was determined using log2 ratio plot of tumor

sample versus reference using standard software settings of MSI-High (+4), MSI-Low (2-4), or

MSI-Stable (<2) (24).

Human glioma mutation analysis

Human glioma mutation assessment and sequence alignment were performed using

publically-available matched tumor/non-tumor genome sequencing datasets, all of which were

accessed through the European Genome-phenome Archive (EGA), accession numbers

EGAS00001000192, EGAS00001000572, EGAS00001000575, EGAS00001000720, and

additional pediatric high-grade glioma samples (C. Jones, EGAS00001001436). Both brainstem

and non-brainstem glioma samples were included. We excluded samples with extreme hyper-

mutation, associated with germline mutation in known DNA-damage repair pathway genes.

Somatic variants were called in BWA alignments using GATK version 2 and annotated for

consequences with the Ensembl variant effect predictor. Copy number variations were assigned

using exon level log ratios of sequence coverage in tumor/normal pairs for all known genes. Log

ratios were segmented using circular binary segmentation in the DNA copy package in R version

3.1.3 and contiguous copy number aberrations were assigned using thresholds for gains/losses

and amplifications/deletions based upon the average genome wide median absolute deviation in

each dataset. For ATRX mutation locational analysis, data and images were extracted from

cBioPortal (5, 6).

Telomere length analysis by qPCR

Mouse telomere length was evaluated using previously designed mouse telomere and

single copy gene (36B4) primers for qPCR (28): Telomere-F

(CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT); Telomere-R

(GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT); 36B4-F

(ACTGGTCTAGGACCCGAGAAG); 36B4-R (TCAATGGTGCCTCTGGAGATT). Briefly,

tumor, non-tumor striatum, and tail DNA were isolated as above for MSI studies. For qPCR, 2

l of DNA (40 ng) was added in duplicate into adjacent wells of a 96-well plate. To each

reaction, we added 7 l SYBRGreen PCR Master Mix (Applied Biosystems), 1 l primer mix

(10 M forward primer, 10 M reverse primer), and 10 l PCR-grade water. An automated

thermocycler (ViiA 7, Applied Biosystems) was used with separate reaction conditions for

telomeric and 36B4 quantification as previously described (28). To serve as a reference for

standard curve calculation, a sample of mouse (FVB) DNA was serially diluted from 100 ng to

2.96 ng. Average threshold cycle (Ct) for each experimental sample was applied to the relevant

standard curve (telomere or 36B4) to calculate relative DNA concentration. The average of

these ratios (average telomere length ratio, or ATLR) was compared to FVB mouse tail DNA

telomere length for relative length calculation.

C-circle assay for ALT

C-circle assay for ALT was performed on tumor DNA and cell culture DNA as

previously described (29). Briefly, 400 ng of digested DNA from each sample was added to a

rolling circle amplification reaction in the presence or absence of Φ29 polymerase. Products

were blotted onto a nylon membrane and detected with a DIG-labeled telomere probe. Samples

were scored as positive when found to have qualitative change above background with addition

of Φ29 DNA polymerase, as previously described (29).

Homologous recombination (HR) and non-homologous end joining (NHEJ) assay

Reporter plasmids previously established to assess HR and NHEJ efficacy were used to

assess the effect of ATRX knockdown on sub-types of DNA damage repair (30). Hepa 1-6

(C57BL/6 mouse hepatoma) cells were used for maximal transfection efficacy. Plasmids

containing previously described NHEJ or HR reporter cassettes (30) were linearized by I-SceI

restriction enzymes and purified after gel electrophoresis. Cells were plated, in triplicate, in 12-

well plates and transfected at 24 hours with NHEJ or HR plasmids as well as mCherry harboring

plasmid to confirm transfection efficacy. Transfections were performed using JetPEI system

(Polyplus) with 2 g total DNA. Additionally, cells were transfected with either shATRX-no

GFP or shSCRAMBLE-no GFP. GFP expression demonstrated effective NHEJ or HR in cells

transfected with the respective reporter plasmids. Cells were imaged at 72 hours (48 hours after

transfection) for qualitative GFP expression. Cells were analyzed on the flow cytometer FACS

ARIA SORP (BD Biosciences) using a GFP versus mCherry fluorescent plot (30). Data were

analyzed with the FACSDiva software (BD Biosciences). DNA repair efficiency values were

expressed as percentage GFP positive normalized to control GFP positive. mCherry transfection

rate, used to confirm transfection efficiency, was equivalent in all experiments.

Generation of Sleeping Beauty primary GBM cell cultures and karyotype analysis

Mouse GBM primary cell cultures were generated by harvesting tumors at the time of

euthanasia. Tumor was identified by GFP expression under epi-fluorescent microscope (Zeiss

Axiovert 200; Carl Zeiss MicroImaging) at time of resection. The tumor mass was dissociated

with non-enzymatic cell dissociation buffer (Gibco, 13151-014), filtered, and maintained in

neural stem-cell medium [DMEM/F12 with L-glutamine (Gibco, 11320-033), B-27 supplement

(Gibco 12587-010), N-2 supplement (Gibco 17502-048), penicillin-streptomycin (Cellgro 30-

001-CI), and Normocin (Invivogen). FGF and EGF (Shenandoah Biotech 100-26, 100-146)

supplementation was performed two times per week at 1 l (20 ng/L each) per 1 ml medium.

ATRX expression in primary cell cultures was assessed by (1) immunocytochemistry (1:250)

and Western blotting (1:200) with ATRX antibody (Santa Cruz, sc-15408) and (2) real-time

quantitative PCR (qPCR) with a primer set generated from Primer-BLAST for the mouse ATRX

gene (NC_000086.7): ATRX-F1 (GTCCGAGCCAAAAACATGAC) and ATRX-R1

(GTCATGAAGCTTCTGCACCA), and actin-F1 (TCCCTGGAGAAGAGCTACGA) and actin-

R1 (AGCACTGTGTTGGCGTACAG) as a control.

Karyotype analysis of mouse primary GBM cell cultures (with and without shATRX)

was performed by metaphase preparation with DAPI staining, as previously described (27).

Briefly, cells were fixed using KaryoMAX colcemid solution (Gibco 15210-040) at 20 l

colcemid (10 g/ml) per ml of medium at 37°C for 6 hours, then passaged, washed and

suspended in hypotonic (0.4%) KCl. After this, they were fixed by slow addition of ice cold

fixative (3:1 methanol:glacial acetic acid), pelleted, and re-suspended in 1 ml fixative. Cells

were then dropped onto slides from two feet, dried at room temperature for 10 minutes and

stained with DAPI. Images were taken with an epi-fluorescent microscope (Zeiss Axioplan2;

Carl Zeiss MicroImaging) and converted to gray scale. The chromosomes were then counted by

two independent blinded observers.

DNA-damaging treatment

For GBM primary cell culture treatment assays, cells were passaged and plated in a 96-

well plate at 25,000 cells/well in triplicate per condition. At 24 hours, cells were treated with

intervention or control and assessed for viability 72 hours later using the Cell Titer Glo Assay

(Promega). Chemotherapy was administered at a range of concentrations on the basis of

previously published data: temozolomide (Sigma) (0.3-1000 M) (32), doxorubicin (Sigma) (0.3

nM to 1M) (35), irinotecan (SN-38, Cayman Chemicals) (1 nm to 10 M) (33), topotecan

(Cayman Chemicals) (1 nm to 10 M) (33), and CCNU (Sigma) (0.3 M to 1 mM) (32). For

comparison of dose-response curves using DNA-damaging agents, a nonlinear regression curve

was fit [log (agent) vs. normalized response with variable slope], and a statistical comparison of

the logIC50 was performed using an F-test. Double-stranded DNA damage was assessed by

Western blot and immunofluorescence for H2A.X (Cell Signaling, 2577 and 2578, 1:1000

Western blot; 1:100 immunofluorescence).

GBM primary cell culture radiation and mouse whole brain radiation were performed in

the Experimental Irradiation Core of the University of Michigan Comprehensive Cancer Center

with a Phillips RT250 orthovoltage unit (Kimtron). Cells were treated with a single dose of

radiation (range of doses: 1-30 Gy). For mouse studies, whole brains were irradiated (1.5 cm x

1.5 cm), and the rest of the mouse was shielded. Mice received 6 Gy delivered at a dose rate of

approximately 1.3 Gy/min. For treatment studies (luminescent response), mice were treated with

6 Gy x 2 doses (24 hours apart) for a total dose of 12 Gy based on a previously published

schedule (34). Mice from each experimental group (p53/NRAS and p53/NRAS/shATRX) were

treated when tumors reached logarithmic growth phase (minimum 2 x 105 photons/sec via

bioluminescent imaging), and treatment groups had equivalent average luminescence at the time

of treatment. For immunostaining of mouse tumors after radiation, mice were treated with whole

brain radiation 6 Gy x 1 dose.

Statistical analysis

Kaplan-Meier survival curves were compared by the log-rank method. Two-sample t-

tests or Mann-Whitney tests were used to compare two experimental groups. Differences in MSI

rate were compared using a Chi-square test. For comparison of somatic variant and structural

variant rates associated with ATRX mutation alone in human datasets, comparisons were

performed using a Mann-Whitney test. ANOVA models were used to correlate (1) TP53 and

ATRX mutation status and (2) IDH1 and ATRX mutation status with the number of mutations (log

transformed) for the pediatric and adult integrated datasets. ANOVA models were used to

compare CTCF (log transformed) and ATLR across different experimental conditions.

For comparison of dose-response curves using DNA-damaging agents, a nonlinear

regression curve was fit [log (agent) vs. normalized response with variable slope] and then the

logIC50 was compared using an F-test. Statistical significance was defined as a two-sided P-

value <0.05. All analyses were conducted with GraphPad Prism software (version 6.01), SAS

(version 9.4, SAS Institute) or R (version 3.1.3).

Fig. S1. SB-responsive shATRX plasmids are cloned to explore the impact of ATRX on

GBM development.

Fig. S2. Cells cotransfected with shp53, shATRX, and NRAS plasmids are characterized at

15 days after injection.

To confirm that all three plasmids were being expressed by individual cells, additional plasmids

were developed to isolate the fluorescent markers (p53-GFP, NRAS-Katushka, and shATRX-

noGFP). Endogenous red channel (594 nm) expression marked NRAS-Katushka plasmid

expression, endogenous green channel (488 nm) expression marked shp53-GFP plasmid

expression, and ATRX expression (immunofluorescence) was marked by blue (405 nm), as an

indicator of shATRX plasmid expression. At 15 days after injection, distinct areas of

proliferative cells form over the border of the lateral ventricle (transfected cell population

denoted to the left of the white dotted line). Transfected cells (marked by asterisks and green

boxes in the bottom row) show NRAS (red) and p53 (green) plasmid expression, as well as low

ATRX expression (blue) reflecting transfection with shATRX plasmid, resulting in a yellow

color (top middle panel). Non-transfected cells further from the ventricle (red boxes at the

bottom) show no NRAS (red) or shp53 (green) plasmid expression but normal ATRX (blue)

expression.

Fig. S3. SB-mediated transfected cells are distinct from ependymal cells in mice.

Staining of transfected cells and tumor for myosin VIIa, a marker of ependymal cells, shows that

at 21 days after injection, GFP expression is seen in a proliferative cluster of cells (marked by

asterisks) that are distinct from ependymal cells (marked by arrows) that line the lateral ventricle.

Fig. S4. Characterization of p53/NRAS/shATRX mice 7 days after injection shows tumor

cells expressing GFAP and Nestin.

Transfected cells/tumors (marked by asterisks) were stained for markers associated with glial

tumors, including GFAP, OLIG2, and Nestin. At 7 days after injection, GFP expression was

seen in a diffuse peri-ventricular population that was Nestin positive, GFAP positive, and

occasionally OLIG2 positive.

Fig. S5. p53/NRAS/shATRX mice at 21 days after injection show tumor cells expressing

OLIG2 and Nestin.

Staining of transfected cells/tumors (marked by asterisks) for markers associated with glial

tumors, including GFAP, OLIG2, and Nestin. At 21 days after injection, GFP expression is seen

in a proliferative cluster of cells that are Nestin positive, OLIG2 positive, and GFAP negative.

Fig. S6. Moribund p53/NRAS/shATRX mice show tumor cells expressing OLIG2, Nestin,

and pERK.

Staining of transfected cells/tumors (marked by asterisks) for markers associated with glial

tumors, including GFAP, OLIG2, and Nestin. In this moribund mouse, GFP expression is seen

in a tumor that extends through right-sided striatum and cortex and is Nestin positive, OLIG2

positive, and GFAP negative. Additional immunostaining shows positivity for pERK1/2, which

is downstream of NRAS in the MAP kinase pathway and expressed in human GBM.

Fig. S7. p53/NRAS/shATRX mice show loss of GFAP expression by 15 days after injection.

Transfected cells/tumors (marked by asterisks) show GFAP expression at early time points only.

Fig S8. ATRX mutations do not cluster in SNF2/helicase domain in human glioma.

Location of ATRX mutations in samples of human glioma, in: (A) our integrated pediatric dataset

of high-grade glioma (HGG) samples, (B) adult GBM samples from TCGA, and (C) adult low-

grade glioma samples from TCGA. The SNF-2 domain, which encodes an ATPase and a DNA-

binding helicase motif, is denoted by the green region (N-terminus) and the red helicase region

(C-terminus). Previous analyses had shown clustering of pediatric HGG mutations near or

upstream of the helicase motif, but the above data do not support this. Red dots indicate

truncating mutations; green dots indicate missense mutations; black dots indicate in-frame

deletions; gray dots indicate other mutations and purple dots indicate multiple mutations at the

same site. Images obtained on cBioPortal.

Fig. S9. Primary GBM cell cultures are generated from SB-induced mouse tumors.

(A) Mouse GBM primary cell cultures were generated by harvesting tumors at the time of

euthanasia. (B) Analysis of ATRX expression in primary GBM cell cultures by

immunofluorescence and qPCR. Three independent primary cell cultures showed similar results.

Fig. S10. Telomere length measured by qPCR is not different in tumors with or without

ATRX.

(A) Standard curves were generated by qPCR with primers for mouse telomere and control

(36B4) gene using mouse striatum DNA. (B) Assessment of average tumor telomere length ratio

by qPCR (ratio to tail DNA telomere length) showed a similar distribution of tumor telomere

DNA lengths in each experimental group. Each point represents individual mouse tumor. Line

represents mean ± SEM; * P < 0.05 using unpaired Mann-Whitney test.

Fig. S11. ALT was assessed by c-circle assay with DNA from mouse tumors and

neurospheres.

Digested tumor DNA was added to a rolling circle amplification reaction in the presence (+) or

absence (-) of Φ29 DNA polymerase. Products were blotted onto a nylon membrane and

detected with a DIG-labeled telomere probe, with positive signal previously shown to be specific

for ALT (29). Positive results (change above background with addition of Φ29 DNA

polymerase) were seen in some of the ATRX-deficient samples (3/8). C-circles were not

detected in DNA extracted from normal mouse brains.

Fig. S12. Cells transfected with shATRX plasmid show reduction in NHEJ by flow

cytometry.

Hepa 1-6 cells were transfected with linearized reporters harboring a DNA-damaged GFP that is

restored by NHEJ or HR, in separate plasmids. Here, representative flow cytometry dot-plots

show the percentage of GFP-positive cells after transfection with shSCRAMBLE or shATRX,

after normalizing to the average percentage of GFP-positive cells in control cells. Additional co-

transfection with mCherry plasmid showed similar transfection efficacy in each sample.

Fig. S13. NHEJ pathway is characterized by IHC.

Illustration of multiple DNA damage repair pathway proteins in representative tumors from each

experimental group. Staining highlights reduced pDNA-PKcs and ATRX staining in

p53/NRAS/shATRX tumors.

Fig. S14. HR pathway is characterized by IHC.

HR damage repair pathway proteins (RAD51 and BRCA1) show no difference in expression in

tumors with or without ATRX.

Fig. S15. Mismatch repair pathway is characterized by IHC.

MMR damage repair pathway proteins (MSH6, MLH1, PMS2) show no difference in expression

in tumors with or without ATRX.

Fig. S16. SB mouse tumor growth (without radiation treatment) is characterized by

luminescence.

Among control animals that did not receive radiation, animals bearing tumors show no difference

in bioluminescence with or without ATRX.

Fig. S17. Tumors with ATRX loss show reduction in pDNA-PKcs before and after

radiation treatment.

Immunofluorescence staining for pDNA-PKcs, an integral member of the NHEJ pathway, shows

reduction in ATRX-deficient tumors at multiple time points (before and after whole brain

radiation). Dashed line represents border between tumor and normal brain.

Fig. S18. Mouse tumors with ATRX loss show increased expression of H2A.X in vitro and

in vivo.

(A) Assessment of H2A.X (marker of double-stranded DNA-damage) by Western blot in

primary mouse GBM cell cultures in vitro after exposure to doxorubicin; the experiment was

repeated in an additional set of primary cell cultures with similar results. Shp53/NRAS/shATRX

cells show increased H2A.X signal at 4 and 24 hours (red arrows) compared to shp53/NRAS

cells. Graphical result of Western blot quantification using ImageJ software is displayed to the

right and plotted as intensity signal from H2A.X/-tubulin. (B) Assessment of H2A.X in

mouse tumors in vivo by immunofluorescence after exposure to whole brain radiation. Tumors

(4 from each condition) were scored for H2A.X in multiple randomly chosen fields, and showed

an increase in the percentage of H2A.X staining (normalized for tumor size) at 4 and 24 hours

after irradiation. The immunofluorescence results are displayed graphically to the right; the y

axis indicates the percentage of cells positive for H2A.X.

Fig. S19. Detailed schematic shows proposed impact of ATRX loss on GBM progression.

In the above schematic, experimental results seen in ATRX-deficient mouse and human gliomas

are incorporated (reduced NHEJ, ALT, increased MSI, increased somatic mutations, and

increased sensitivity to dsDNA-damaging agents). We propose that a relative increase in HR

contributes to ALT, which is HR-driven. Other factors may contribute, including reduced

recruitment of inhibitors of ALT, such as tankyrase 1 (37), which reduces recombination at

telomeres. ATRX mutation is almost always seen with concurrent TP53 mutation and subsequent

loss of G1/S checkpoint (38).

Table S1. Animal models of glioma all have RTK-RAS-PI3K alterations.

p53/NRAS (n=5 mice)

p53/NRAS/shATRX (n=5 mice)

days after injection

tumor area

(µm2)

days after injection

tumor area

(µm2)

60 25.7 47 28.7 148 18.7 89 19.3 94 25.6 76 26.4

129 22.2 83 39.6 74 28.6 83 29.6

average growth rate 230 µm

2/day average

growth rate 379 µm2/day

Table S2. Mice injected with p53/NRAS/shATRX have faster-growing tumors.

Table S3. MSI rate is increased in p53/NRAS/shATRX tumors.

ATRX/ TP53 pediatric GBM adult GBM

Mean SD N Mean SD N ATRX wildtype TP53 wildtype 21.97 27.82 78 55.79 19.40 208 ATRX wildtype TP53 mutated 33.52 50.58 31 60.23 17.31 66 ATRX mutated TP53 wildtype 118.00 148.50 2 58.60 20.89 5 ATRX mutated TP53 mutated 50.27 74.06 22 65.36 45.56 11

ANOVA p value (significance of contribution to SNV rate) pediatric GBM adult GBM

ATRX mutation 0.027 0.074 TP53 mutation 0.42 0.10

ATRX/ IDH1

pediatric GBM adult GBM Mean SD N Mean SD N

ATRX wildtype IDH1 wildtype 25.61 36.36 106 56.87 19.04 272 ATRX wildtype IDH1 mutated 12.67 4.163 3 47.67 15.82 3 ATRX mutated IDH1 wildtype 57.78 80.82 23 88.8 55.35 5 ATRX mutated IDH1 mutated 13 0 1 53.5 24.21 10

ANOVA p value (significance of contribution to SNV rate) pediatric GBM adult GBM

ATRX mutation 0.0068 0.50 IDH1 mutation 0.19 0.14

Table S4. IDH1 and TP53 mutations do not alter SNV rate calculated by two-way ANOVA

model.

plasmids injected 36B4 (reporter)

average Ct log

DNA DNA (ng)

Telomere average Ct

log DNA

DNA (ng) telomere

DNA/36B4 DNA

Telomere length/

control tail DNA

C37A-tumor

shp53/NRAS /shATRX 25.9 1.5 31.0 22.8 1.6 39.4 1.3 1.2

C37B-tumor

shp53/NRAS /shATRX 27.3 1.0 10.9 25.7 0.7 5.5 0.5 0.5

C37C-tumor

shp53/NRAS /shATRX 25.5 1.6 39.7 23.0 1.5 32.7 0.8 0.8

C40D Tumor

shp53/NRAS /shATRX 22.0 2.7 532.7 18.1 2.9 844.0 1.6 1.5

C40E Tumor

shp53/NRAS /shATRX 22.4 2.6 383.3 18.6 2.8 622.6 1.6 1.5

C40F tumor shp53/NRAS /shATRX 22.5 2.6 356.5 19.7 2.5 291.4 0.8 0.7

C50B tumor

shp53/NRAS /shATRX 22.9 2.4 267.4 19.8 2.4 270.8 1.0 0.9

C50C tumor

shp53/NRAS /shATRX 21.9 2.8 573.0 18.1 2.9 834.9 1.5 1.3

C50D tumor

shp53/NRAS /shATRX 22.6 2.5 347.1 19.1 2.6 443.6 1.3 1.2

C50E tumor shp53/NRAS /shATRX 22.9 2.4 266.9 19.3 2.6 388.4 1.5 1.3

C48A Tumor

shp53/NRAS /shATRX 22.0 2.7 546.0 17.9 3.0 989.8 1.8 1.7

C39A tumor shp53/NRAS 29.0 0.5 3.2 26.5 0.5 3.3 1.0 0.9

C39B tumor shp53/NRAS 26.8 1.2 15.9 24.8 1.0 10.1 0.6 0.6

C39C tumor shp53/NRAS 23.8 2.2 146.2 20.0 2.4 248.2 1.7 1.6

C39E tumor shp53/NRAS 27.6 0.9 8.8 25.7 0.8 5.7 0.6 0.6

C51A Tumor shp53/NRAS 23.2 2.3 215.4 19.8 2.4 278.3 1.3 1.2

C51C Tumor shp53/NRAS 22.8 2.5 301.8 19.5 2.5 329.8 1.1 1.0

Table S5. Telomere qPCR average telomere length ratio worksheet and standard curve

show similar results in all experimental groups.

non-homologous end

joining pathway homologous

recombination base

excision repair

tumor plasmids radiation

status ATRX Ku70 Ku80 pDNA-

PKcs BRCA2 PARP1

p53/NRAS none ++++ + + ++++ + ++ p53/NRAS/shATRX none - - - - - +++

p53/NRAS 4 hours after +++ + ++ +++ - ++++ p53/NRAS/shATRX 4 hours after - - + - - ++++

p53/NRAS 30 days after ++++ - - +++ - ++++ p53/NRAS/shATRX 30 days after - - ++ - - ++++

Table S6. Immunofluorescence analysis shows reduced pDNA-PKcs expression in ATRX-

deficient mouse GBM.

Primary Antibodies Company Catalog Host Dilution

ATRX Santa Cruz sc-15408 rabbit 250

GFAP (astrocytes) Chemicon AB5804 rabbit 1000

Olig2 (oligodendrocyte progenitors) Millipore AB9610 rabbit 500

Nestin (neuronal/glial precursor cells) Novus NB100-1604 chicke

n 100

Anti-GFP Cell Signaling 600-101-215 goat 1000

phospho-DNAPKcs Assay Biotech A0909 rabbit 100

phosphoH2A.X Cell Signaling 2577 rabbit 100

Ku70 Assay Biotech A0449 rabbit 100

Ku80 Bioss USA bs-1358 rabbit 500

PARP1 Bioss USA bs-0769 rabbit 500

BRCA2 Bioss USA bs-1210 rabbit 500

Myosin VIIa Proteus 25-6790 rabbit 500

XRCC4 Bioss USA bs-8510R rabbit 200

Rad51 MyBioSource MBS8505653 rabbit 250

PMS2 Santa Cruz sc-618 rabbit 250

MLH1 AbCam ab92312 rabbit 250

MSH6 AbCam ab92471 rabbit 250

p44/42 MAPK (ERK1/2) Cell Signaling 4370 rabbit 100

Secondary Antibodies Company Catalog Host Dilution

Alexa Fluor 594 anti-rabbit Alexa A-11037 goat 1000

Alexa Fluor 488 anti-rabbit Alexa A-11034 goat 1000

Alexa Fluor 594 anti-chicken Alexa A-11042 goat 1000

Biotinylated anti-rabbit Dako E0432 goat 1000

Alexa Fluor 488 anti-goat Alexa A-11055 donkey 1000

Alexa Fluor 405 anti-rabbit Alexa A-175651 donkey 1000

Table S7. Antibodies used for tissue analysis are summarized in table form.