Supporting InformationCarmona et al. 10.1073/pnas.0903328106SI TextGeneration of the Ephrin-A3-Knockout Mice. The ephrin-A3-knockout mice were comissioned to the company Ozgene. Thetargeting vector included: (1) A 2.9 kb 5� homology arm gen-erated by PCR from 129/SvJ mouse genomic DNA; (2) a floxedenhanced yellow fluorescent protein (EYFP) cDNA generatedin the pEYFP-N1 vector (Clontech), which was PCR-amplifiedand inserted in frame with the initial ATG of ephrin-A3; (3) afrt-f lanked PGK-neo cassette to allow selection of the targetedgene; and (4) a 3.6-kb 3� homology arm generated by PCR from129/SvJ mouse genomic DNA (Fig. S2 a). The entire insert wasverified by sequencing. In this targeting scheme, the initialmethionine of ephrin-A3 drives EYFP expression in cells thatwould normally express ephrin-A3. The targeted DNA waselectroporated into B57BL/6 mouse ES cells and 3 ES cell clonesexhibited homologous recombination, as determined by using a5� and a 3� external probe on Southern blots of SpeI- andEcoRV-digested ES cell genomic DNA, respectively. Chimericmice were generated by blastocyst injection of targeted ES cellclones and germ line transmission was obtained. Animals weregenotyped by PCR using 3 primers: forward primer 1 to exon 1in ephrin-A3 (CGGGAGTGCGGGGCTCAGT), forwardprimer 2 to the EYFP cDNA (CCTCGGCGCGGGTCTTG-TAGTTGC), and reverse primer 3 to intron 1 of ephrin-A3(CCTCGGCGCGGGTCTTGTAGTTGC). Primers 1 and 3yield a product of 352 bp from the wild-type genomic DNA andprimers 2 and 3 yield a product of 468 bp from the targetedgenomic DNA. Mice were maintained on a C57BL/6 back-ground.

Antibodies. The anti-ephrin-A3 rabbit polyclonal antibody (Cat.# 36–7500), the anti-pan-ephrin-B mouse monoclonal antibody,and the GFAP antibody (Cat. # 13–0300) were from Zymed/Invitrogen. The 2 EphA4 antibodies used were from R&DSystems (goat polyclonal, Cat. # AF641) and Zymed/Invitrogen(mouse monoclonal, Cat. # 37–1600). Antibodies against syn-aptophysin (clone SVP-38, Cat. # S5768), syntaxin (Cat. #S1172), and �-actin (clone BM-75.2, Cat. # A5044) were fromSigma–Aldrich. Antibodies against VGLUT-1 (AB5905),PSD-95 (clone K28/43, Cat. # 05–494), GluR2/3 (AB1506),GLAST/EAAT1 (AB1782), GLT-1/EAAT1 (AB1783),EAAC1/EAAT1 (MAB1587), and the antibody anti-GFP usedto detect EYFP (MAB2510) were from Chemicon/Millipore.The anti-phosphotyrosine antibody (clone 4G10, Cat. # 05–321),anti-NR2A (Cat. # 06–313) and anti-NR2B (Cat. # 06–600)antibodies were from Upstate/Millipore. The anti-GAPDH an-tibody (Cat. No. 4300) was from Ambion. Alexa Fluor-conjugated secondary antibodies were from Invitrogen andhorseradish peroxidase-conjugated secondary antibodies werefrom Amersham Biosciences.

Immunofluorescence. Mice were perfused with 4% paraformal-dehide in PBS (PBS). The brains were postfixed in the samefixative overnight and cryoprotected in 30% sucrose beforefreezing. Free-floating frozen coronal sections (30-�m thick)were rinsed in PBS, blocked in PBS containing 0.2% gelatin,10% FBS (FBS), 0.2% lysine, 0.2% glycine, and 0.2% TritonX-100 for 1 h at room temperature and then incubated withprimary antibodies overnight at 4 °C in the same solution (butwith 5% FBS). The following dilutions of the antibodies wereused: ephrin-A3 (15 �g/mL), GFAP (1 �g/mL), VGLUT-1(1:5,000), PSD 95 (0.9 �g/mL), GLAST (1:2,500), GLT-1

(1:500), EAAC1 (1:800), and EphA4 (4 �g/mL for the goatantibody and 6 �g/mL for the mouse antibody). Sections werethen incubated for 1 h at room temperature with Alexa Fluor 488or Alexa Fluor 568-conjugated secondary antibodies (MolecularProbes/Invitrogen), mounted onto slides and coverslipped withProLong (Invitrogen). For double-labeling experiments, detec-tion of the 2 antigens was performed sequentially. High-magnification confocal images were taken with a 60� oil-immersion objective with 4� zoom using a Fluoview confocalsystem. Sections from wild-type and ephrin-A3-knockout micewere processed in parallel and the same parameters for imageacquisition were used for both groups of mice.

Measurement of Astrocyte Densities. GFAP-positive cells werecounted in the stratum radiatum of the CA1 region fromwild-type and ephrin-A3-knockout hippocampal sections corre-sponding to the dorsal hippocampus (between 1.82 and 2.06 mmposterior to the bregma). Ten to fifteen 100-�m2 squares werecounted for each of 2 wild-type and ephrin-A3-knockout mice.

Immunoblotting and Immunoprecipitation. Hippocampi were ho-mogenized in ice-cold Hepes buffer [50 mM Hepes pH 7.4, 150mM NaCl, 10% glycerol, 1% Triton-X-100, 1 mM EDTA with 1mM PMSF, 0.5 mM Na3VO4, 50 mM NaF, and other proteaseand phosphatase inhibitors (Sigma–Aldrich)]. The homogenateswere centrifuged at 20,000 � g for 10 min. Lysates wereseparated by 10% SDS/PAGE (10 �g per lane) and probed byimmunoblotting with the following primary antibodies: mouseanti-EphA4 (0.5 �g/mL); GFAP (1 �g/mL), GLT-1 (1:5,000),GLAST (1:4,000), ezrin (1:50), mouse anti-EAAC1 (1:1,000);pan-ephrin-B (2 �g/mL), GAPDH (0.4 �g/mL), EYFP (2.5�g/mL), syntaxin (0.1 �g/mL), synaptophysin (0.1 �g/mL),GluR2/3 (0.2 �g/mL), NR2A (0.5 �g/mL), NR2B (0.5 �g/mL),and �-actin (0.1 �g/mL). For GLT-1 and GLAST immunoblot-ing, the lysates were incubated at 56 °C for 10 min. For immu-noprecipitations, hippocampal lysates were incubated with 2�g/mL pan-ephrin-B or EphA4 antibody immobilized on Gam-maBind Plus Sepharose beads (GE Healthcare). Detection wasperformed with chemiluminescence methods (GE Healthcare).Immunoblot for GLT1, GLAST, and GFAP in hippocampalslices stimulated with Fc or EphA2 Fc was carried out similarly.Acute hippocampal slices were incubated with 10 �g/mL Fc orEphA2 Fc in oxygenated ACSF for 10 h at room temperature.3 independent experiments were performed and run in dupli-cate. Each experiment included 5 hippocampal sections percondition.

RT-PCR. One microgram of total RNA from each hippocampuswas reverse transcribed and amplified using the SuperScript IIIsystem (Invitrogen). The primers used for RT-PCR amplifica-tion were: (1) ephrin-A3 exon 1 forward, CGGGGCT-CAGTCGGGGG; (2) ephrin-A3 exon 2 reverse, CTCG-GAGAACTTGATGGGGCTGTG; (3) EYFP reverse,CCTCGGCGCGGGTCTTGTA; (4) ephrin-A3 exon 2 forward,GCAGCACGCCTCGCACAGC; (5) ephrin-A3 exon 5 reverseAAGGATGTAGGCCCCACAGCA.

Real-Time RT-PCR. One microgram of total RNA from each hip-pocampus was reverse transcribed and amplified using the Super-Script III system (Invitrogen), and 4 ng cDNA from this reactionwas analyzed in triplicate using SYBR GreenER qPCR (Invitro-gen) and the Mx3000P qPCR system (Stratagene). Two house-

Carmona et al. www.pnas.org/cgi/content/short/0903328106 1 of 12

keeping genes, GAPDH and cyclophylin, were used to normalizeeach sample for RNA content. Ephrin-A3 amplification (using 40ng cDNA) was used as a positive control for differences betweenwild-type and knockout mice, using the exon 2 forward and exon 5reverse primers mentioned above. All primer combinations weredesigned to exclude detection of genomic DNA. The primers usedwere: GLT-1 forward, CCAAGCTGATGGTGGAGTTC; GLT-1reverse, GTCCTTGATGGCGATGATCT; GLAST forward, GC-CCTCCGACCGTATAAAAT; GLAST reverse, GCCATTCCT-GTGACGAGACT; EAAC1 forward, CGCCGTGGTACTAG-GAATTG; EAAC1 reverse, CAAAATGACCAGCTTCAGCA;GAPDH forward, CCAGTATGACTCCACTCACG; GAPDH re-verse, GACTCCACGACATACTCAGC; cyclophylin forward,CACCGTGTTCTTCGACATC; cyclophylin reverse, ATTCTGT-GAAAGGAGGAACC. The primers used for GLT-1 amplify allmRNA splice variants known to be expressed in the rodent nervoussystem. The threshold cycle C(t) was determined for each sampleusing Stratagene software.

Diolistic Labeling and Morphological Quantification of DendriticSpines. For analysis of spines, pairs of wild-type and ephrin-A3-knockout littermates were perfused with 4% paraformaldehidein PBS. Hippocampal slices (�300 �m) were prepared, using themiddle third of the hippocampus. Gold particles (1-�m diame-ter; Bio-Rad) coated with DiI (Molecular Probes/Invitrogen)were fired into hippocampal slices at 80–100 psi using a HeliosGene Gun (Bio-Rad). DiI was allowed to diffuse for 20 h whileincubating the slices in paraformaldehyde.

Dendritic spines were imaged using a Fluoview confocalsystem at 60� magnification with 4� zoom, collecting z-opticalsections at 0.2-�m intervals. Three-dimensional reconstructionof dendritic spines was performed from confocal maximumprojections using a software package from Velocity Software.

Quantification of dendritic spine lengths and widths wasperformed using the National Institutes of Health ImageJ soft-ware, as described in ref. 1. Spines were defined as protrusionsfrom the dendritic stalk containing a rounded head region. Onlyspines with defined edges were included in the analysis. Thelength of individual spines was measured from the tip of thespine head to the interface with the dendritic stalk and the widthof the spine head was measured perpendicular to the length. Thelength of individual spine necks was measured from the interfaceof the spine head with the spine neck to the interface of the neckwith the dendrite. Spine shapes were classified as described byBourgin et al. (2). For measurements at 7 weeks, 4,194 spinesfrom 44 pyramidal neurons were measured using 3 wild-type orheterozygous controls and 2,857 spines from 31 pyramidalneurons using 3 ephrin-A3-knockout littermates. For measure-ments at 8 months, 827 spines from 13 pyramidal neurons weremeasured using 3 heterozygous controls and 1,074 spines from21 pyramidal neurons were measured using 3 ephrin-A3-knockout littermates. All of the mice used for the experimentswere males, except for 1 pair of 8-month-old females.

Analysis of dendritic spines in acute slices stimulated withephrin-A3 Fc was carried out similarly, except that the mice werekilled without perfusing, and the slices were incubated with 10�g/mL Fc or ephrin-A3 Fc in MEM with 25% horse serum for45 min at room temperature. For these experiments, 540 spinesfrom 5 pyramidal neurons were measured after Fc stimulationand 568 spines from 6 pyramidal neurons after ephrin-A3 Fcstimulation in slices from 2 wild-type mice, while 1,107 spinesfrom 6 pyramidal neurons were measured after Fc stimulationand 650 spines from 7 pyramidal neurons after ephrin-A3 Fcstimulation in slices from 2 ephrin-A3-knockout mice.

Behavioral Tests. For behavioral tests we used 3–6-month-oldmales. Nine mice per group were analyzed in the tests shown inFig. 6 A, C, and D and 8 mice per group were analyzed in the tests

shown in Fig. 6B and Fig. S8 and in a repeat of the fearconditioning test that is not shown but yielded essentiallyidentical results as shown in Fig. 6A. Mice were kept on a 12:12h reversed light–dark cycle, with light shifts at 6:00 and 18:00.Experiments were performed during the animals’ active phase.

Locomotor Activity and Rearing Behavior. Locomotor activity wasmeasured in polycarbonate cages (42 � 22 � 20 cm) placed intoframes (25.5 � 47 cm) mounted with 2 levels of photocell beamsat 2 and 7 cm above the bottom of the cage (San DiegoInstruments). These 2 sets of beams allowed recording of bothhorizontal (locomotion) and vertical (rearing) behavior. A thinlayer of bedding material was applied to the bottom of the cage.Mice were tested for 60 min.

Rotarod. Mice were placed on a rotating rod and the speed ofrotation was gradually increased (3 rpm). The speed at fall (rpm)was recorded for each mouse. During the 3 training sessions,mice were tested 6 times per day in 2 sets of 3, with 1 min betweenthe tests within a set and 1 h between sets. A week later, the micewere retested to examine retention of the motor learning de-veloped during the trials.

Visual Cliff. Mice were placed on a ledge between a ‘‘safe’’ sideand a side appearing as a cliff. If the animal sees the cliff, it willstep down onto the ‘‘safe side’’ (a horizontal checkered surface)in most trials. A blind animal will just as often step down ontothe ‘‘cliff’’ side (a vertical appearing surface) as the ‘‘safe side.’’

Light/Dark Tranfer Test. The apparatus is a rectangular box madeof Plexiglas divided by a partition into 2 environments. Onecompartment (14.5 � 27 � 26.5 cm) is dark (8–16 lux) and theother compartment (28.5 � 27 � 26.5 cm) is highly illuminated(400–600 lux) by a 60-W light source located above it. Thecompartments are connected by an opening (7.5 � 7.5 cm)located at floor level in the center of the partition. The timespent in the light compartment is used as a measure of anxiety-like behavior, that is, a greater amount of time in the lightcompartment is indicative of decreased anxiety-like behavior.Mice were placed in the dark compartment to start the 5-mintest.

Forced Swim Test. Mice were individually placed into the swimtank (15-cm deep) for 6 min. Time spent immobile (when noactivity is observed other than that required to keep the mouse’shead above the water) was recorded. An elevated time spentwithout moving suggests depressive-like behavior.

Object Placement Test. Object-place recognition involves hip-pocampus-dependent spatial learning and memory (3). Micewere allowed to explore an object placed in the test chamberduring 4 different 5 min trials, separated by 1-min intervals.Exploration of the object was scored from video recordings bya trained technician who was blind to genotype, and the timespent sniffing, touching, and looking at the object from adistance of no more than 2 cm was quantified. One minute afterthe last trial, the object was moved to a new location, and the timespent exploring the object in the new location was recorded for1 min. In the test shown in Fig. 5C, the mice were habituated tothe text chamber for 30 min before introducing the object.

Fear Conditioning. In this procedure, mice learn to associate anenvironment (context) and a neutral stimulus (conditionedstimulus, a tone) with an aversive foot shock stimulus. Testingthen occurs in the absence of the aversive stimulus. Conditionedanimals, when exposed to the conditioned stimuli, tend to refrainfrom all but respiratory movements by freezing. Freezing re-sponses can be triggered by exposure to either the context in

Carmona et al. www.pnas.org/cgi/content/short/0903328106 2 of 12

which the shock was received (context test) or the conditionedstimulus (conditioned stimulus test). Conditioning took place ina Freeze Monitor chamber (San Diego Instruments) housed ina sound-proofed box. The conditioning chamber (26 � 26 � 17cm) was made of Plexiglas with a speaker and light mounted on2 opposite walls. The chamber was installed with a shockablegrid floor. On day 1, mice were placed in the conditioningchamber for 5 min to habituate them to the apparatus. On day2, the mice were exposed to the context and conditioned stimulus(30 s, 3,000 Hz, 80 dB sound) in association with foot shock (0.70mA, 2 s, scrambled current). Specifically, a 5.5-min session wasrun in which the mice receive 2 shock exposures, both in the last2 s of a 30-s tone exposure. On day 3, contextual conditioning (asdetermined by freezing behavior) was measured in a 5-min testin the chamber where the mice were trained (context test). Onday 4, the mice were tested for cued conditioning (conditionedstimulus test). The mice were placed in a different context for 3min, after which they were exposed to the conditioned stimulus(tone) for 3 min. For this test, the chamber was disguised withnew walls (black opaque plastic creating a triangular-shapedcompartment in contrast to a clear plastic square compartment),a new floor (black opaque plastic in contrast to metal grid) anda different odor (drop of orange extract under the floor).Freezing behavior, that is, the absence of all voluntary move-ments except breathing, was measured in all sessions by avalidated computer-controlled recording of photocell beam in-terruptions. Freezing behavior in the context and cued tests(relative to the same context before shock and an altered contextbefore the tone, respectively) is indicative of the formation of anassociation between the particular stimulus (either the environ-

ment or the tone) and the shock; that is, that learning hasoccurred.

Barnes Maze Test. The Barnes maze test is a spatial learning andmemory test originally developed in rats, but also adapted formice. The Barnes maze used is an opaque Plexiglas disc 75 cmin diameter and elevated 58 cm above the floor by a tripod.Twenty holes, 5 cm in diameter, are located 5 cm from theperimeter, and a black Plexiglas escape box (19 � 8 � 7 cm) isplaced under 1 of the holes. Distinct spatial cues are located allaround the maze and are kept constant throughout the study. Onthe first day of testing, a training session was performed, whichconsisted of placing the mouse in the escape box and leaving itthere for 1 min. One minute later, the first session was started.At the beginning of each session, the mouse was placed in themiddle of the maze in a 10-cm high cylindrical black startchamber. After 10 s, the start chamber was removed, a buzzer (80dB) and a light (400 lux) were turned on, and the mouse was setfree to explore the maze. The session ended when the mouseentered the escape tunnel or after 3 min had elapsed. When themouse entered the escape tunnel, the buzzer was turned off, andthe mouse was allowed to remain in the dark for 1 min. Whena mouse did not enter the tunnel by itself, it was gently put in theescape box for 1 min. The tunnel was always located underneaththe same hole (stable within the spatial environment), which wasrandomly determined for each mouse. Mice were tested once aday for 12 days. Each session was videotaped and scored by anexperimenter blind to the genotype of the mouse. Measuresrecorded include the number of errors made per session, whichare defined as nose pokes and head deflections over any hole thatdid not have the tunnel beneath it.

1. Murai KK, Nguyen LN, Irie F, Yamaguchi Y, Pasquale EB (2003) Control of hippocampaldendritic spine morphology through ephrin-A3/EphA4 signaling. Nat Neurosci 6:153–160.

2. Bourgin C, Murai KK, Richter M, Pasquale EB (2007) The EphA4 receptor regulatesdendritic spine remodeling by affecting beta1-integrin signaling pathways. J Cell Biol178:1295–1307.

3. Dere E, Huston JP, De Souza Silva MA (2007) The pharmacology, neuroanatomy, andneurogenetics of one-trial object recognition in rodents. Neurosci Biobehav Rev31:673–704.

4. Lai KO, Ip FC, Ip NY (1999) Identification and characterization of splice variants ofephrin-A3 and ephrin-A5. FEBS Lett 458:265–269.

Carmona et al. www.pnas.org/cgi/content/short/0903328106 3 of 12

Fig. S1. Generation of ephrin-A3 knockout mice. (a) Genomic map of the wild-type ephrin-A3 locus and the targeted locus. The first exon (blue box, 1) wasmodified by homologous recombination in embryonic stem cells to replace the ephrin-A3-coding region with the cDNA encoding enhanced yellow fluorescentprotein (EYFP) inserted in frame with the initial ATG. The neomycin cassette (PGK neo) was also incorporated, to allow selection of the targeted gene. (b) Southernblot analysis of tail DNAs digested with EcoRV to screen the progeny of chimeras derived from targeted ES cells. The 3� probe shown in green in a was used todetect wild-type (24 kb) and knockout (6.5 kb) DNA fragments. The 5� probe shown in red in A was also used for Southern blot analysis of SpeI-digested genomicDNA to confirm correct targeting. (c) RT-PCR analysis of forebrain tissue confirms that the ephrin-A3 mutant mice lack ephrin-A3 mRNA, but express the EYFPmRNA fused to a portion of exon 1 of ephrin-A3. The primers used for amplification and the length of the expected products (in bp) are indicated in the box.A shorter and less abundant isoform is also detected in the wild-type mice with primers 4 � 5, presumably corresponding to that described in ref. 4. (d)Single-plane confocal images of the CA1 stratum radiatum show loss of ephrin-A3 immunoreactivity in the hippocampus of adult knockout mice. (Scale bar, 10�m.) (e) Immunoblot showing expression of EYFP in heterozygous and ephrin-A3-knockout mice. EGFP transfected cells were used as a positive control for theantibody, which recognizes both fluorescent proteins. EYFP protein was detectable by immunoblotting but was not expressed at sufficient levels to be detectableby fluorescence or by antibody immunostaining. (f) Fluorescence images of hippocampal sections from adult wild-type (�/�) and ephrin-A3-knockout mice (�/�)stained with DAPI (converted from blue to red using Adobe Photoshop). The overall lamination of hippocampal neurons appears normal in the ephrin-A3-knockout mice. (Scale bar, 100 �m.) (g) Representative examples of DiI-labeled CA1 pyramidal neurons from wild-type (�/�) and ephrin-A3-knockout (�/�) mice.(Scale bar, 75 �m.)

Carmona et al. www.pnas.org/cgi/content/short/0903328106 4 of 12

Fig. S2. Abnormal in vivo dendritic spine morphology in 8 months old ephrin-A3 knockout mice. (a) Three-dimensional reconstruction of biolistically labeleddendritic spines from CA1 pyramidal neurons of 8-month-old heterozygous (�/�) and ephrin-A3-knockout (�/�) mice. (b–e) Quantification of dendritic spineparameters. The ephrin-A3-knockout mice have similar spine density and width compared with control heterozygous mice, but their spines are significantlylonger and have longer spine necks (***, P � 0.001, KS and Student’s t test). (f) Ephrin-A3 knockout mice have more mushroom-shaped spines and fewer stubbyspines than control mice (*, P � 0.05, **, P � 0.01, one-way ANOVA with Bonferroni post hoc comparisons). Error bars, SEM. (Scale bar, 1 �m.)

Carmona et al. www.pnas.org/cgi/content/short/0903328106 5 of 12

Fig. S3. Normal EphA4 levels and expression pattern in ephrin-A3-knockout mice. (a) Immunoblot analysis shows similar EphA4 levels in wild-type andephrin-A3-null hippocampus. (b and c) Immunofluorescence labeling shows a similar EphA4 expression pattern in the wild-type and ephrin-A3-null hippocampus.(d) EphA4 immunoreactivity is lost in EphA4-knockout hippocampus. (e–j) Confocal images of the CA1 stratum radiatum from wild-type (�/�) and ephrin-A3-knockout (�/�) hippocampus double labeled for EphA4 (e and h) and PSD-95 (f and i). Similar EphA4-positive punctae (e and h) and colocalization with PSD-95(g and j) are observed in wild-type and ephrin-A3-knockout mice. [Scale bars, 100 �m (c and d) and 6 �m (j).]

Carmona et al. www.pnas.org/cgi/content/short/0903328106 6 of 12

Fig. S4. Stimulation with ephrin-A3 Fc causes similar EphA4 phosphorylation and spine retraction in wild-type and ephrin-A3-knockout mice. (a) Immuno-precipitation and immunoblot analysis show that the ephrin-A3 ligand induces a comparable increase in EphA4 phosphorylation in wild-type (�/�) andephrin-A3-knockout (�/�) hippocampus. The short exposure does not reveal the basal levels of EphA4 tyrosine phosphorylation. (b) Dendritic spine density andlength were similarly reduced by ephrin-A3 Fc stimulation in wild-type and ephrin-A3-knockout mice (**, P � 0.01; ***, P � 0.001 for Fc versus ephrin-A3 Fc byStudent’s t test for Fc versus ephrin-A3 Fc). Spine width was only slightly but significantly altered in the wild-type but not ephrin-A3-knockout mice afterephrin-A3 Fc treatment (*, P � 0.05). Error bars, SEM.

Carmona et al. www.pnas.org/cgi/content/short/0903328106 7 of 12

Fig. S5. Astrocyte density and morphology are not altered in the ephrin-A3-knockout mice. (a) Immunoblot analysis shows similar levels of GFAP expressionin wild-type, heterozygous, and ephrin-A3-null hippocampus. GAPDH levels demonstrate equal amounts of protein in the lanes. (b and c) Overview of GFAPimmunolabeling in adult wild-type (b) and ephrin-A3-null (c) hippocampal sections shows similar distribution of GFAP-positive astrocytes. (d) Quantificationshows similar astrocyte densities in the CA1 stratum radiatum of wild-type and ephrin-A3-knockout mice. (e and f) Confocal images illustrating astrocyticnetworks in the stratum radiatum of area CA1. The morphology of the cell bodies and main processes appears similar in wild-type and ephrin-A3-knockout mice.[Scale bars, 80 �m (c) and 20 �m (f).]

Carmona et al. www.pnas.org/cgi/content/short/0903328106 8 of 12

Fig. S6. The levels of presynaptic and postsynaptic components of glutamatergic synapses are similar in wild-type and ephrin-A3-null hippocampus. (a)Immunoblot analysis of the AMPA glutamate receptor subunits GluR2/3, NMDA glutamate receptor subunits NR2A and NR2B, and presynaptic proteins syntaxinand synaptophysin in wild-type (�/�) and ephrin-A3-knockout (�/�) mice. (b) Densitometric analysis, normalized to actin levels, indicates that the levels of thesesynaptic proteins are similar in wild-type and ephrin-A3-knockout mice. Error bars, SEM.

Carmona et al. www.pnas.org/cgi/content/short/0903328106 9 of 12

Fig. S7. Modest changes in GLT-1 and no alteration in GLAST levels in other brain regions of ephrin-A3-knockout mice. (a and c) High-magnification single planeconfocal images showing immunofluorescence labeling for GLT-1 (a) and GLAST (c) in different brain regions. (b and d) Quantification of average pixel intensities.A modest increase of GLT-1 is observed in the neocortex (*, P � 0.05 one-way ANOVA with Bonferroni post hoc comparisons). (e and f) Overview of ephrin-A3(e) and EphA4 (f) immunostaining in the adult forebrain. Expression of ephrin-A3 is significantly lower in the thalamus and hypothalamus compared with thehippocampus. EphA4 is preferentially expressed in the hippocampus, compared with all other brain regions examined. Hi, hippocampus; N, neocortex; S,striatum; T, thalamus; Hy, hypothalamus. [Scale bars, 30 �m (a and c) and 500 �m (e and f).]

Carmona et al. www.pnas.org/cgi/content/short/0903328106 10 of 12

Fig. S8. EphA4 and GLAST immunoreactivities in the hippocampus are segregated. Double-labeling for EphA4 (green) and GLAST (red) in hippocampal slicesfrom wild-type (�/�) and ephrin-A3-knockout (�/�) mice shows no overlap, indicating that EphA4 is not extensively localized on astrocytic processes in the adulthippocampus. (Scale bar, 6 �m.)

Carmona et al. www.pnas.org/cgi/content/short/0903328106 11 of 12

Fig. S9. Motor and visual performance and behavioral responses in ephrin-A3-knockout mice. (a and b) Locomotor activity (a) and rearing behavior (b) inwild-type and ephrin-A3-knockout mice. There is a trend toward increased locomotor activity and rearing in the ephrin-A3-knockout compared with wild-typemice, although the differences between the 2 groups do not reach significance (P � 0.114 in a and P � 0.054 in b, one-way ANOVA). (c) Rotarod test. After thecompletion of the 3 training sessions, there was a trend toward a decreased ability to remain on the rotating rod for the ephrin-A3-knockout mice (P � 0.053,one-way ANOVA), suggesting a slight decrease in maximal motor coordination ability. (d) In the visual cliff test, both the ephrin-A3-knockout and wild-type micestepped off the ledge onto the safe side of the platform �50% of the time, indicating normal visual ability (P � 0.13, Student’s t test). (e) The light/dark transfertest shows no abnormalities in the anxiety behavior of the ephrin-A3-knockout mice, since they spent the same amount of time as wild-type mice in the lightportion of the box (P � 0.93, Student’s t test). (f) Wild-type and ephrin-A3-knockout mice spent a similar amount of time not moving during the forced swimtest (P � 0.74, Student’s t test), indicating no significant differences in depressive behavior. Error bars, SEM.

Carmona et al. www.pnas.org/cgi/content/short/0903328106 12 of 12