Suppression of RecJ Exonuclease Mutants of coli by ... · recB2l recC22 sbcA23 red77 helD104 uwD517,,,srjD7 recB21 recC22 sbcA23 recJ77 helD104 uwD517,,mjD7 recB21 recC.22 sbcA23

Copyight 6 1995 by the Genetics Society of America

Suppression of RecJ Exonuclease Mutants of Escherichia coli by Alterations in DNA Helicases I1 (uvrD) and IV (heZD)

Susan T. Lovett and Vincent A. Sutera, Jr.

Department of Biology and Rosenstiel Basic Medical Sciences Center, Brandeis University, Waltham, Massachusetts 02254- 91 10 Manuscript received June 16, 1994

Accepted for publication January 23, 1995

ABSTRACT The recj gene encodes a single-strand DNA-specific exonuclease involved in homologous recombina-

tion. We have isolated a pseudorevertant strain in which recjmutant phenotypes were alleviated. Suppres- sion of recjwas due to at least three mutations, two of which we have identified as alterations in DNA helicase genes. A recessive amber mutation, “uwD517,,,” at codon 503 of the gene encoding helicase I1 was sufficient to suppress recj partially. The uwD517,, mutation does not eliminate uwD function because it affects W surv iva l only weakly; moreover, a uvrD insertion mutation could not replace uwD517,, as a suppressor. However, suppression may result from differential loss of UWD function: mutation rate in a uwD517,, derivative was greatly elevated, equal to that in a uznD insertion mutant. The second cosuppressor mutation is an allele of the helD gene, encoding DNA helicase IV, and could be replaced by insertion mutations in helD. The identity of the third cosuppressor “srjD” is not known. Strains carrying the three cosuppressor mutations exhibited hyperrecombinational phenotypes including elevated excision of repeated sequences. To explain recjsuppression, we propose that loss of antirecombinational helicase activity by the suppressor mutations stabilizes recombinational intermediates formed . . ”

in the absence of re$

I N the bacterium Escherichia coli, two exonucleases participate in genetic recombination: the RecBCD and

RecJ nucleases (reviewed in WEST 1993) . Exonucleases may promote genetic exchange at several different steps. The RecA protein of E. coli, which pairs and trans- fers strands between homologous DNA molecules in vitro, requires that one of the DNA partners in the strand exchange reaction must be at least partially single-stranded ( CASSUTO et al. 1980; CUNNINGHAM et al. 1980). Therefore, proteins such as the RecBCD nuclease/helicase complex and the RecJ exonuclease could function presynaptically to create the single- stranded regions in duplex DNA, which RecA requires for strand invasion. In addition, single-strand DNA exonucleases such as RecJ may facilitate recombination after joint molecules have been formed. During the branch-migration phase of RecA strand-transfer in vitro, RecJ enhances the rate of strand-assimilation into heteroduplex, presumably by degrading a competitor strand for pairing (CORFWITE-BENNETT and LOVETT 1995). As a final postsynaptic step, exonucleases may be required to “trim” unpaired DNA before ligation.

This study focuses on the genetic function of the recJ gene of E. coli. The r e g gene encodes a 5 ’ to 3’ DNA exonuclease with a very strong preference for single- strand DNA ( LOVETI and KOLODNER 1989). Strains mutant in the recJgene are highly defective for recombina-

Corrapunding authm: Susan T. Lovett, Department of Biology and Rosenstiel Basic Medical Sciences Center, Brandeis University, Wal- tham, MA 022549110. E-mail: [email protected]

Genetics 140: 27-45 (May, 1995)

tion of duplicated genes carried on plasmids ( KOLODNER et al. 1985). The recJgene is also essential for the minor recBCD-independent pathways of recombination measured in conjugational and transductional crosses (Lo- VETT and CLARK 1984) . Mutations in recJare highly synergistic with those in recBW: recBC recJ mutants are extremely recombination deficient, UV sensitive and are partially inviable (LOVETT and CLARK 1984).

To investigate the role of RecJ in genetic recombination in vivo, we have isolated second-site suppressor mutations of various recJ mutations. We report here the isolation of a suppressor strain that carries at three mutations, which together suppress any allele of re$ One of these “srj” (for suppressor of ZecJ) mutations we show to be an allele of the UWD gene encoding DNA helicase I1 ( HICKSON et al. 1983), and a second cosuppressor mutation is an allele of the heZD gene, encoding DNA helicase IV (WOOD and MATSON 1989) . The existence of the third mutation, srjD, is implied by genetic analysis but its identity is yet unknown. The phenotypes of these mutants suggest that helicase I1 (and perhaps helicase IV) have antirecombinational properties and that recombination in the absence of RecJ may be especially prone to reversal by the action of these antirecombinational helicases.

MATERIALS AND METHODS

Bacterial strains and media: The majority of strains used in this study are derived from AB1157 and listed in Table 1. Strains were grown routinely in LB medium ( WIUETTS et al. 1969), with plate media containing 1.5% agar. Plate minimal

28 S. T. Lovett and V. A. Sutera

TABLE 1

Eschericia coli K-12 strains

Strain Genotype Derivation

AB1 157 and derivatives

uwD517,,sriD7

AB1157" AM207 JC7623 JC8679 JClO990 JC12123 JC12159 JC13015 JC13018 RDK1230 RDK1445 RDK1541 RDK1658 RDK1687 RDK1688 RDK1690 RDKl769 RDK1811

RDKl812

RDK1813

RDK1814

RDK1819

RDK2121

RDK2128

RDK2 144

SR1277 STL282 STL658 STL660

STL662

STL664

STL695 STL8 1 1 STL8 1 4

STL815

STL834 STL837 STL863 STL864 STL941

STL964 STL1028 STL1029

recR252: : Tn 10-9 recB21 recC22 sbcBl5 sbcC2Ol recB21 recC22 ~bcA.23~ re8332: : Tn' (PhiX') red284 : : Tn 10 recB21 recC22 sbcA23 lysA recB21 recC22 sbcA23 red284 : : Tn 10 recB.21 recC22 sbcA23 red77 srl-300: : Tn 10 red56 (supE+) serAl zgb224 : : Tn 10 recO1504: : Tn5 recB2l recC22 sbcA23 recO1504: :Tn5 recB2l recC22 sbcA23 recTl01: : Tn 10' recB21 recC22 sbcA23 red56 srl-300: : Tn 10 recB21 recC22 sbcA23 recQ61: : Tn3 recB2l recC22 sbcA23 aroA354 ompF: : Tn5 recB2l recC22 sbcA23 helD104 uvrD517,,mjD7 smAl

recB.21 recC22 sbcA23 helD104 uwD517,,mjD7 zgb

recB2l recC22 sbcA23 red77 helD104 uwD517,,,srjD7

recB21 recC22 sbcA23 recJ77 helD104 uwD517,,mjD7

recB21 recC.22 sbcA23 helD104 uwD517,,srjD7

recB21 recC22 sbcBl5 sbcC201 red2051 : :Tnl0-9

recJ2051 : : Tn 1 0-9

recB21 recC22 sbcA23 recJ2003: : Tn 10-9

uvrD254 : : Tn5 recB.21 recC22 sbcA23 re8332: :Tn3 recB2l recC22 sbcA23 recR252 : : Tn 10-9 recB2l recC22 sbcA23 red77 helDlO4 uwD517,,,srjD7

recB2l recC22 sbcA23 recJ77 helD104 uwD517,,,srjD7

recB21 recC22 sbcA23 red77 helD104 uvrD517,,mjD7

lacZ: : bla recB21 recC22 sbcA23 helDlO2 : : Tn 10-9 recB21 recC22 sbcA23 helD102::Tn10-9

recB21 recC22 sbcA23 helDl03: : Tn 10-9

recB.21 recC22 sbcA23 helDl01: : Tn 10-9 recB.21 recC22 sbcA23 helDlO3::Tnl0-9 recB21 recC22 sbcBl5 sbcC201 helDlO2: : Tn 10-9 helDlO2: : Tn 10-9 recB21 recC2.2 sbcA.23 helD104 uwD517,,srjD7

recB21 recC22 sbcA23 zcc-282: : Tn 1 W D 3 4 recB2l recC22 sbcA23 recJ.2051: : Tnl0-9 recB21 recC22 sbcA23 rec12051: : Tn10-9 helD104

zgb224::TnlO

224::TnIO

red56 srl-300: : Tn 10

re8332: : Tn3

recJ284 : : Tn 10

recTl01: : Tn 10

recR252: : Tn 10-9

recO1541: : Tn5

red284 : : Tn 10

recJ284 : : Tn 10

BACHMANN (1987) MAHDI and LLOYD (1989) HONI and CLARK (1973) GILLEN et al. (1981) BLANAR et al. (1984) LOVETT and CLARK (1984) LOVETT and CLARK (1984) LOVETT and CLARK (1984) LOVETT and CLARK (1984) R. KOLODNER R. KOLODNER KOLODNER et al. (1985) Km' transductant P1 RDK1541 X JC8679 Tc' transuctant P1 KF1053 X JC8679 Tc' W transductant P1 RDKl230 X JC8679 Ap' transductant P1 KD1996 X JC8679

Tc' Ser- transductant P1 RDK1445 X

Tc' Ser+ transductant P1 RDK1445 X

Tc' W transductant P1 RDK1230 X

Ap' transductant P1 JClO990 X STL1051"

Ser+ W transductant P1 JC12123 X

Km' Aps W pRDK161 transformant of

Km' Ser+ transductant P1 RDK2121 X

Km' Aps W pRDK163 transformant of

N. SARGENTINI Ap' transductant P1 JClO990 X JC8679 Km' transductant P1 AM207 X JC8679 Tc' transductant P1 KF'1053 X STL1051'

Km' transductant P1 AM207 X STLlO51'

Km' transductant P1 RDK1541 X STLlO51"

LOVETT et al. (1993) Km' Aps pSTL45 transformant of JC8679 Tc' transducant P1 JC12123 X STL811

Tc' transducant P1 JC12123 X STL837

Km' Aps pSTL42 transformant of JC8679 Km' Aps pSTL46 transformant of JC8679 Km' transductant P1 STL811 X JC7623 Km' transductant P1 STL811 X AB1157 Ser+ Tcs transductant P1 AB1157 X

Tc' Pyr- transductant P1 DC305 X JC8679 Km' transductant P1 RDK2128 X JC8679 Km' transductant P1 RDK2128 X STL1051"

d -

STL1051"

STLlO5 1

STL1051"

RDK1811"

JC7623

RDKl445

JC8679

RDK1812'

recJ Suppression 29

TABLE 1

Continued

Genotype Derivation

STLlO3l STL1036

STL1051 STL1066

STLll62 STL1163

STL1495 STL1496

STL1498

STL1499 STL1500 STL1523 STL1524

STL1526 STL1527 STL1543

STL1544

STL1548 STL1549 STL1550 STL1551

STLl609

STL1611 STL1613

STL1615

STLl617 STL1639 STL 1 640

STL1651

STL1661

STL1665

STL1672 STL1674 STL1681

STL1683

STL1685

STL1686

STL1688

recB2l recC22 sbcA23 helD102: : Tn10-9 recQ61: : Tn3 recB2l recC22 sbcA23 recJ2003: : Tn 10-9 helDlO4

recB21 recC22 sbcA23 recJ77 helD104 uwD517,,sr3D7 recB2l recC22 sbcA23 recJ77 helD104 uwD517,,srjD7

recB2l recC22 sbcA23 lacZ: : bla' tetA,,, recB2l recC22 sbcA23 helDI04 uwD517,,srjD7

recB2l recC22 sbcA23 metE3079: : TnlO recB2I recC22 sbcA23 helDl02: : Tn 10-9

recB21 recC22 sbcB15 sbcC201 helD102:: Tn10-9

helD102::Tn10-9 metE3079::TnlO recB21 recC22 sbcA23 uwD254: : Tn5 recB2l recC22 sbcA23 uwD254: : Tn5 recQ61: : Tn3 recB21 recC22 sbcA23 uurD254: : Tn5

uwD254 : : Tn5 recB21 recC22 sbcB15 sbcC201 uvrD254 : : Tn5 recB2I recC22 sbcBI5 sbcC2Ol uwD254: :Tn5

uwD254 : : Tn5 hlD102 : : Tn 10-9

recQ61: : Tn3 recB2I recC22 sbcBl5 sbcC201 recQ61: : Tn3 recQ61: : Tn3 uwD254 : : Tn5 recB2I recC22 sbcB15 sbcC201 recQ61: : Tn3

uvrD254: : Tn5 recB21 recC22 sbd23 uwD254: :Tn5

helD102::TnlO-9 recQ61::Tn3 helDlO2: : Tn I 0-9 recQ61: : Tn3 recB2l recC22 sbcBl5 sbcC201 helDl02: : Tn 10-9

recQ61: : Tn? recB2I recC22 sbcB15 sbcC201 helD102::Tnl09

recQ61: : Tn3 uwD254: : Tn5 uurD254::Tn5 helD102::Tnl0-9recQ61::Tn3 recB21 recC22 sbcA23 p y # : : Tn5 recB21 recC22 sbcA23 helD104

uwD517,,sr~D7pr#: : Tn5 recB2I recC22 sbcA23 i l~3164: : Tn 1 0-kan

metE3079: : Tn 10 recB21 recC22 sbcA23 helD104

recB2l recC22 sbcA23 uvrD517,,

recB2l recC22 sbcA23 uwD517,,recJ284::Tn10 recB21 recC22 sbcA23 helDl04 recJ284: : Tn 10 recB21 recC22 sbcA23 uwD517,,,,pyrF: : Tn5

recB21 recC22 sbcA23 uwD517,,zcc-282: : Tn IO

recB21 recC22 sbcA23 helD104 uwD517,,

recB21 recC22 sbcA23 helDl04 uwD5I 7,,

recB21 recC22 sbcA23 heLD104 uurD517,, srjD7

uwD517.,s@7

pyrD34 zcb222 : : Tn 10

lacZ: : blu+ tea,,,,

metE3079: : Tn 10

metE3079::TnlO

helD102::TnIQ9

helDlO2:: Tn10-9

pyrD34

re4284 : : Tn I O

recJ284 : : Tn 10

Ap' transductant P1 RDKl690 X STL811 Km' transductant P1 RDK2144 X STL1051'

MitoC' "revertant" of JC13018' Tc' Pyr- transductant P1 CY307 X STL1051"

Ap' transductant PI STL695 X JC8679 Ap' transductant P1 STL695 X STL941'

Tc' transductant P1 CAG18491 X JC8679 Tc' transductant P1 CAG18491 X STL811

Tc' transductant P1 CAG18491 X STL863

Tc' transductant PI CAG18491 X STL864 Km' transductant P1 SR1277 X JC8679 Ap' transductant P1 RDK1690 X STL1500 Met+ uv" transductant P1 SR1277 X

Km' transductant PI SR1277 X AB1157 Km' transductant P1 SR1277 X JC7623 Met+ uv" transductant P1 SR1277 X

Met' uv" transductant P1 SR1277 X

Ap' transductant P1 RDK1690 X AB1157 Ap' transductant P1 RDK1690 X JC7623 Ap' transductant P1 RDKl690 X STL1526 Ap' transductant P1 RDKl690 X STL1527

Ap' transductant PI STL1523 X STL1524f

Ap' transductant P1 RDKl690 X STL864 Ap' transductant P1 RDK1690 X STL863

Ap' transductant PI STL1523 X STL1543f

Ap' transductant P1 STL1523 X STL1544f Km' Ura- transductant P1 DB6507 X JC8679 Krd Ura- transductant P1 DB6507 X

Km' Tc' transductant P1 CAG18599 X

Pyr' Tcs transductant P1 STLlO5l X

Ilv' Met+ transductant P1 STL1051 X

Tc' transductant PI JC12123 X STL1665' Tc' transductant P1 JC12123 X STL1661" Km' Ura- transductant P1 DB6507 X

reTc' Pyr- transductant P1 DC305 X

Pyr' Tcs transductant P1 STLlO5l X

Tc' transductant P1 JC12123 X STL1685'

Tc' transductant P1 JC12123 X STL1051"

STL1496f

STL1498f

STL1499f

STL941

STL1495

STL964"

STL1651'

STL1665'

STL1665"

STL1683"


TABLE 1

Continued

Strain Genotype Derivation

STLl742 recB21 recC22 sbcA2? recQ61::Tn 3 recJ284::TnIO Tc' transductant P1 JC12123 X RDK1690 STLl743 recB21 ~recC22 sbcA23 uwD254::Tn5 recJ284::TnIO Tc' transductant P1 JC12123 X STL1500 STLl744 recB21 recC22 sbcA23 uwD254: : Tnt recQ61: : Tne Tc' transductant P1 JC12123 X STL1523

STLl745 recB21 recC22 sbcA23 uwD254: : Tn5 Tc' transductant P1 JC12123 X ST11524

STLl746 recB2l recC22 sbcA2? helD104 uwD517.,srjD7 sup,?? sup+ revertant of STL941" STLl749 recB2I recC22 sbcA2? recJ284:: TnlO sup,?? STL1751

sup+ revertant of JC13018

STLl766 recB21 recC22 sbcA2? helDlO4 uwD517,,s?JD7 sup' revertant of STL1688"

STL1789 recB21 recC22 sbcA2? helD102:: TnIO-9 recQ61::Tnjr Tc' transductant P1 JC12123 X STL1609

STLl790 recB21 recC22 sbcA23 helD102:: TnIO-9 rec@l::Tn? Tc' transductant P1 JC12123 X STL1031

STL1854 recB21 recC22 sbcA2? uvrD254 : : Tn5 supE+ sup+ revertant of STL1500

recJ284::TnIO

helD102:: TnlO-9 recJ284::TnIO

recB2I recC22 sbcA23 sup,?? sup' revertant of JC8679

recJ284 : : Tn 10 sup,??

uvrD254::Tn5 recJ284::TnIO

reg284 : : Tn IO

Other strains CAG18491 mtE3079: : Tn IO C. GROSS CAG18557 fadAB?I 65: : Tn IO-kan c. GROSS CAG18599 ilv-3164 : : Tn 1 0-kan C. GROSS CY307 Hfr PO3 rcb222: :TnlOpyrD34 r e a l spoT1 mtBl B. BACHMANN DB6507 f y F : : Tn5 recAl? leuB6 A(@t+roA)62 thi-1 lacy1 J. HABER

ara-I4 xyl-5 mtl-1 qsL20 hsdS20 supE44 DC305 zcc-282::TnIO pyrD34 galK2 mal41 xyl-7 mtl-2 B. BACHMANN

rpsLl18 DPBlOl himD451: : Tn 10-9 A(1acjno)rpsL S. COHEN HMSl74 recA 1 riy hsdR JC158 KD1996 recQ61 ::Tn? ilv-145 tqC3 pro thi mtl-1 maMl ara-9 NAKAYAMA et al. (1984)

KF'1053" Hfr PO45 recB2l recC22 sbc-I1 I : : Tn5 FOUTES et al. (1983)

"55 lacAU169 araD ompF: : Tn5 M. SWANEN

a Genotype of AB1157 and derived strains, unless otherwise indicated, includes F-A - thi-1 hzsG4 A(@tproA)62 axE2 thr-I leuB6

'JC86% and its derivates are rat+. Originally described by FOUTES et al. (1983) as "recElO1 ::TnlO", this mutation is an insertion in the linked recTgene (R. D.

KOLODNER, personal communication). Km' Aro- transductant of STLlO51 with P1 grown on RDKl768. RDKl768 was a Km' transductant produced from SY503

(gal aroA?54 supE strain obtained from M. SWANEN) with P1 donor "55. 'ThehelDIO4 mutation was originally assigned the designation "srjB2"; uvrD517,,, was designated "srjC6." The identity and

map position of srjD is not known but its existence is inferred by the genetic characterization described in the text. f Because both uvrD254: :Tn5 and helD102: :TnlO-9confer Km', the presence of the helD allele was confirmed by transductional

backcross into recipient DC305, showing cotransduction of Km', Tcs and Pyr' phenotypes. The presence of the uvrD allele is inferred by U V phenotype of these strains.

R. KOLODNER Hfr PO1 thi-1 serA6 rel4l lacZ22 CLARK (1963)

gal= lac-114 rpsL ton pol412

recTlO1: : Tn IO thr-300 ilv-318

kd K51 Dl ara-14 lacy1 galK2 xyl-5 mtl-1 tsx-?3 supE44 rpsL?l rac-.

medium consisted of 56/2 salts ( WILLETTS et ai. 1969) supplemented with 0.2% glucose, 1 pg/ml thiamine and 50 pg/ml of the appropriate required amino acids. Uracil or thymine, when required, were added to 50 pg/ml. Streptomycin (Sm) , tetracycline (Tc) , kanamycin ( K m ) and rifampin (Rif) were used at concentrations of 100,15,30 and 100 pg/ml, respectively. Strains carrying re&: : Tn?, recQ: :Tn? or lac : : bla+ tet- A,, were selected on media containing 30 pg/ml ampicillin (Ap) ; selection for plasmids conferring Ap resistance employed media containing 100 pg/ml ampicillin. For selection of suppressor mutants, LB plates containing Mitomycin C (Sigma) at 2 pg/ml were employed. P1 phage were grown in plate lysates on LCTG medium, LB plates containing 2 mM CaC12, 50 pg/ml thymine, 0.2% glucose and 1.2% agar (top

agar contained only 0.7% agar). P1 transductions were performed as in WILLE~TS et d. 1969. Reversion of supE44 was selected by plating of AJC1929 (N7 N53 cZ26) and AJC1930 ( h80 N7 N53 cZ26) on appropriate strains. Survivors of phage infection were then screened for plating of A1929, A1930, AcZ26 and Avir to identify the sup' derivatives.

Plasmids: Restriction enzymes and T4 DNA ligase were purchased from New England Biolabs, Inc. A 5.4kb BamHI fragment contained the helDgene was cloned into the BamHI site of plasmid pBS Ks- (Stratagene, Inc.) from A DNA prepared from phage 223 of the Kohara "miniset" library (KO- HARA et al. 1987), producing plasmid pSTL3O. The orientation of the fragment is such that the helD gene is not transcribed by the lac promoter on this plasmid. Plasmid

recJ Suppression 31

pSTL34 is the PstI BamHI helD+ fragment cloned into vector pT7-6 (TABOR 1990). Plasmids pSTL35 is an EcoRI deletion of pSTL34, which has the Cterminal portion of helD deleted from the unique EcoRI site within helD to the EcoRI site of the vector polylinker. Plasmids containing the u d region from PCR-amplified chromosomal DNA from JC8679 ( u d ’ ) or STL1051 (uvrD51 70,,,) were cloned into low-copy vector pWSK29 ( WANG and KUSHNER 1991). PCR primers were: 5’

CTGAAGATGG. Amplification was performed with Tag polymerase (Promega) and the supplied buffer supplemented with 2.5 mM MgC12 for 25 cycles of 95” 1 min, 50” 1 min and 72” 2 min. The PCR product was purified by glass-bead extraction ( USBioclean from US Biochemicals) from agarose gels, cleaved with XbuI and BglII and ligated into vector pWSK29 cut with XbaI and BamHI. Two uwD+ (pSTL101, pSTL102) and three ud517,, (pSTL103, pSTL104, pSTL105) plasmid isolates were saved. No differences in subsequent complementation analysis were observed among the independent uwD+ or uvrD517,, isolates although only data for pSTLlOl and pSTL105 are shown. All five of these plasmids exhibited complementation of the W sensitivity conferred by the uwD254::Tn5mutation when transformed into STL1526.

Isolation of TnIO-9 (element “9” of WAY et al. 1988) insertion mutants of plasmids are discussed briefly here and in more detail below. Plasmids pRDKl61 and pRDK163 are Tnl09insertion mutants ( recJ2051 and recJ2003, respectively) of pJC763 ( LOVEIT and CLARK 1985). Plasmids pSTL42, pSTL45 and pSTL46 are Tn109insertion mutants (helD101, helD102 and helD103, respectively) of pSTL30. Plasmid DNA was purified by the alkaline-SDS method ( BIRNBOIM and DOLY 1979) as modified by (AUSUBEL et al. 1989). Lambda phage DNA was prepared as described ( SILHAW et al. 1984). We used the TSS method ( CHUNG et al. 1989) or electroporation (DOWER et al. 1988) for introducing plasmid DNA into strains.

Recombination and UV-survival assays: Patch tests for conjugational recombination proficiency and W sensitivity (CLARK and MARGULIES 1965) were used to score rec mutations in strain constructions and in mapping experiments. Recombination in Hfr crosses and UV survival were quantified as described in LOVETT et al. ( 1988) from, in most cases, LB cultures grown to mid-log stage (OD590 = 0.4). Selections and duration of the matings are indicated in the tables in the text. For the experiment using the strains carrying various RecF pathway mutations, nonaerated ( “standing”) overnight cultures were tested. Serial dilutions were performed in 56/ 2 buffer and plated on appropriate selective media. Note that in matings with rec mutants, extended transfer can result in expression of the rec+ allele in the recipient and complementation of the mutant phenotype, producing a false baseline level of recombination. Apparent recombination values can also be depressed by defects in viability or failure to initiate conjugation. Because recmutants of E. coli show a concomitant defect in W repair, we therefore always determine the W- survival phenotype of mutant strains to compare with their conjugational recombination capacity.

Isolation of Tn2&9 insertion mutations: Transposition of the defective TnlO element carrying kanamycin resistance (“element 9” as described in WAY et al. 1988) into plasmid pJC763 and pSTL30 were performed as described (WAY et al, 1988) . Plasmids that carried the Tn109 element were selected from the population by subsequent retransformation into HMS174 conferring both Ap and Km resistance. The location and orientation of insertions were determined by restriction analysis of purified plasmid DNA. All the insertions isolated in the chromosomal helD region of plasmid pSTL30 had the same orientation of the transposon, with the kan gene transcribed in the opposite orientation to helD. Insertions in

CGGCGAGATCTTTACATGTTGG and 5 ’ GGCTCTAGATA-

recJgene of pJC763 included reg2003 and recJ2051 oriented with kun reading in the same direction as re$

Transformation of Tn2&9 mutations to the E. coli chromosome: Plasmid DNA carrying the recJ2003, recJ2051, helDlO1, helD102 and he1103::TnlO-9mutations was subjected to digestion with the restriction enzymes (EcoRI, PstI and Sun for the recJalleles; EcoRI SalI for the helD alleles). This cleaved DNA was transformed into strain JC7623 (recB21 recC22 sbcB15 sbcC201) or JC8679 ( recB21 recC22 sbcA23), selecting Km‘. The presence of the recJalleles was confirmed by the W and Rec phenotype of the resulting transformants, by transductional linkage of Km‘ with SerA+ in crosses into RDK1445 and by Southern blot analysis (AUSUBEL et al. 1989) using digoxygenin-labeled pJC763 probe (kit purchased from Boehringer Mannheim) . The presence of helD insertion in the appropriate location in the E. coli chromosome was confirmed similarly by Southern blot analysis with pSTL30 probe and by genetic linkage to pyrD in transductional crosses.

Sequence analysis: Various restriction fragments were cloned into M13 phage mp18 or mp19. DNA sequence was determined using Sequenase 2.0 (US Biochemical). The sequence of various TnlO-9 insertion sites was determined by cloning the B a d 1 SalI fragments of the recJ2051 and recJ2003 plasmid mutants into the M13 sequencing vector mp18 and the BamHI EcoRI fragment of the helD plasmid mutant (helDlOl and helD102) into mp18 vector. The universal -40 primer was used to obtain DNA sequence from the B a d 1 site of the TnlO-9elements into the adjoining DNA. To determine the location of recJ284::TnlO, the B a d 1 SaZI fragment from plasmid pJC760 (LOVETT and CLARK 1985) was cloned into mp19. A synthetic primer complementary to the end of TnlO (5 ’ GACAAGATGTGTATCTACC ) was used to obtain DNA sequence across the insertion site. The recJ77 allele was sequenced from PCR-amplified chromosomal DNA from strain RDK1789 (LOVETT et al. 1988) with Tag polymerase (Promega) . PCR primers were 5 ’ AGCAATGGCACACITGT- TCCG and 5’ TTAAGCCGTAACCGTCTTCGA. The PCR fragment was digested with EcoRI KpnI and cloned into M13 mp18 and mp19 for sequencing. Sequence was determined for two independent isolates.

The UWD locus was amplified from chromosomal DNA purified from JC8679 (uvrD+) or STL1051 (uvrD51 7am), cleaved with PstI and EcoRI and cloned into M13 vectors mp18 or mp19 with subsequent dideoxy sequencing as above. PCR primers were: 5 ’ AGTTGTGGCTT-MCAAGCCGC and 5 ’ TTCACCTGCTTCCAGTGCCGC and amplification was performed with Tag polymerase ( Promega) under the conditions described previously. Five clones derived from two independent PCR reactions for both uwD+ and uvrD517., template were sequenced to verify the presence of the uvrD517,, C to T transition at codon 503 of UvrD.

Excision and mutation assays: All excision and mutation rates were calculated by method of the median as described in LEA and COULSON 1949. The py#::Tn5mutation was introduced into appropriate strain backgrounds by P1 transduction from DB6507, selecting Km resistance on plates containing additional uracil (50 pg/ml) . Precise excision was determined by resuspending entire overnight colonies on LB+Ura medium into LB+Ura broth with subsequent overnight growth. Cultures were collected, washed twice in 56/2 buffer and plated on 56/2 minimal medium lacking Ura. The average number of cells in these cultures was determined for the cultures by serial dilution and plating on LB + Ura medium. The excision rate was calculated using the median number of Ura+ and the mean number of cells in the cultures (LEA and COULSON 1949).

Nearly precise excision of a Tn 10 derivative was assayed by introducing plasmid pHV857 ( D’ALENCON et al. 1994) into


appropriate strain background by transformation, selecting Km‘. Excision of the miniTnlMan element (marked with a Km-resistance gene and lacking the transposase) restores transcription of the bla gene and therefore Ap resistance to the cell. Similar to procedure above, the number of Ap‘ colonies was determined from independent cultures inoculated from entire colonies grown an additional 2 hr. The excision rate was calculated from the median number of Ap‘ colonies in the cultures and the mean number of Tc‘ (total) cells in the cultures (LEA and COULSON 1949).

A 787-bp tetA chromosomal duplication was transduced into several genetic backgrounds by P1 transduction selecting Ap‘. Excision of the repeat was measured by determining the median number of Tc‘ cells for several independent cultures inoculated from entire individual colonies as described previously LOVE^ et al. 1993).

Mutation to Rif rwas determined by inoculating 100-1000 cfu of an overnight culture in seven tubes. After overnight growth, samples from each independent culture were plated on LB i- rifampin, and total viable cells were determined by dilution with 56/2 buffer and plating on LB. Colonies were counted after overnight growth and the mutation rate was calculated from the median number of Rif colonies and the mean number of viable cells in the culture (LEA and Cou1.30~ 1949).

RESULTS

Isolation of a recfiuppressor strain: The recJ77 allele is a strong allele of recJ ( LOVETT and CLARK 1984). When present in recB21 recC22 sbcA23 genetic background, recJ77 causes an approximate 30-fold reduction in conjugational recombination frequencies, extreme sensitivity to W light and Mitomycin C (MitoC) and partial inviability. We selected spontaneous MitoC‘ derivatives and screened these for concomitant resistance to UV and elevated recombination frequencies in Hfr crosses. We obtained such “revertants” at frequencies of -5 X 10”’ for the recJ77strain. One such derivative, STL1051, exhibited partial alleviation of the recJmutant phenotype (Table 2 ) . A transductional backcross using P1 grown on STL1051 and a lysA recBC sbcA recipient JC12159 revealed that STL1051 still carries the recJ77 allele cotransducing with lysA:16 Rec- Ws among 86 Lys’ transductants. The suppressed phenotype must therefore be due to a second-site suppressor mutation, which we call srj (for “suppressor of ref’). In fact, as we show below, three loci are requiredfor the full suppressive effect. Two of the srj loci are alleles of the DNA helicase genes, helD and uvrD, but the identity of the third locus, srjD is not yet known.

Allele nonspecificity of suppression: Several insertion recJalleles were introduced by P1 transduction into the srj suppressor strain. Three insertion mutations, recJ284 : : T n 10, recJ2003 :Tn 1@9 and recJ2051: : T n 10-9, were suppressed to about the same extent as that seen for recJ77allele (Table 2) . The same was seen for other recJ alleles, recJ153 and recJ154 (data not shown). The locations of these recJ mutations were determined by DNA sequence analysis. The recJ77 allele is caused by a transition mutation GGT (Gly) to GAT (Asp) at codon 78 of the redgene. The recJ284 insertion is 434 nucleo-

tides downstream of the presumed start codon, whereas recJ2003 insertion is more N-terminal, 124 nucleotides downstream of the start. The recJ2051 insertion is quite C-terminal, 1252 nucleotides downstream of the start. The fact that all alleles of re$ including insertion mutations, can be suppressed in this genetic background suggests that suppression results from “bypass” of recJ function. We can not, however, rule out the possibility that truncated forms of RecJ protein from these insertion mutants retain partial activity and that the suppression enhances the effectiveness of the mutant proteins.

Mapping sr j loci-evidence for two cosuppressors: Various Hfr crosses were performed with STL1051 to map the suppressor loci. Inheritance of the srj+ allele from the donor should remove suppression and cause the strain to become Ws and Rec-. Inheritance pat- terns were complex with two different regions of the E. coli chromosome affecting suppression: one between gal and his (which we initially called srjB and will show is helD) and the second (which we initially called srjC and is, in fact, uvrD) near argE (data not shown).

P1 transductional crosses established a position for srjB at 22 min (Table 3) . Markers closest to srjB were inherited most poorly in these crosses (data not shown) -this may be due to dominance of srjB’ over srjB in the transductant, reversing the suppressive effect and lowering recombinational inheritance. Coinheri- tance between srjB and other markers was somewhat less than expected from the genetic map. This may be explained by the poor recovery of srj+ recombinants due to their reduced viability relative to srjB- transductants or possibly reestablishment of a srjB suppressor mutation in the transductants.

Other transductional crosses located mjCnear 86 min on the E. coli chromosome (Table 4) . Again, srj+ derivatives showed poor viability and may be underrepre- sented among the transductants. These mapping data reveal the location of two mutations, srjB and srjC, both required for suppression of recJin strain STL1051. The low frequency at which such suppressors were isolated is consistent with this hypothesis. We note that increased genetic instability conferred by one of the mutations (see below) may have facilitated the accumulation of the second cosuppressor mutation. Also, further analysis (see below) suggests yet another cosuppressor mutation (“srjD7”) is required to see the full suppressive effect.

Identification of hem, the gene for helicase IV, as wjB: Fragments corresponding to the 22 min region were cloned from the ordered Kohara lambda library (KOHARA et al. 1987) into plasmids and screened for complementation of the Srj phenotype in strain STL1051. One plasmid pSTL34, derived from phage 223, carried a 3.2-kb PstI BamHI fragment and was shown to convert STL1051 to W sensitivity comparable with nonsuppressed recJ strains (Figure 1 ) . This plasmid therefore carried the srjB’ allele, which, at least

recJ Suppression 33

TABLE 2

recj-allele specificity of srj-reJ suppression

Strain Genotype Relative W survival

RF" ( % I b JC8679 recB21 recC22 sbcA23 (1) 15 JC13018 recB21 recC22 sbcA23 recJ77 0.035 0.0053 STL1051" recB2l recC22 sbcA23 recJ77 helD104 uvrD517,, srjD7 0.24 0.37 JC13015 recB21 recC22 sbcA23 reg284 : : Tn 10 0.01 1 <0.0003 STLl688 recB2l recC22 sbcA23 recJ284: : Tn 10 helDlO4 uwD517.,,,srjD7 0.30 0.23 RDK2 144 recB21 recC22 sbcA23 recJ2003: : Tn 1 0-9 0.01 1 0.00041 STL1036 recB2l recC22 sbcA23 recJ2003: : Tnl0-9 helD104 uwD517,,,,srjD7 0.18 0.089 STL1028 recB2l recC22 sbcA23 recJ2051: : Tn 10-9 0.026 <0.0008 STL1029 recB2l recC22 sbcA23 recJ2051: : Tnl0-9 helD104 uvrD517,,srjD7 0.39 0.13

Recombination frequencies (RF) are expressed relative to that determined for JC8679 which ranged from 0.7 to 2%. Donor strain was JC158. Cultures were grown to mid-log phase. Matings were performed for 0.75 hr with selection for Thr+ Leu+ [Ser+ Smr]. All values are avrages of two to four determinations.

'At 20 J/m2. "As shown below in RESULTS, derivatives of this original srj isolate carry three cesuppressor mutations, helD104, uwD517,,

and q D 7 .

in high copy, reverses the suppression by the srjB mutation on the chromosome. An EcoRI deletion derivative of this plasmid, pSTL35, did not complement srjB in strain STLl051. The same Kohara lambda 223 fragment has been shown previously (WOOD and MATSON 1989) to carry the intact helD (helicase IV) gene, with the EcoRI site deletion removing the Gterminal region of the helD coding sequence. Our DNA sequence data (not shown) of this BamHI-EcoRI fragment also matched the published helD sequence. From our m a p ping and complementation data, we conclude that srjB is an allele of the helicase IV gene, helD. We designate

this allele as "helD104." The recessive nature of helD104mediated suppression is consistent with the loss or alteration of function of the heZD gene. No increase in W sensitivity was observed when the helD+ plasmid was introduced into a srj+ recJ77strain, JC13018; therefore the helD' plasmid does not reduce UV survival itself but merely counteracts the suppressive effect of helD104. A slight sensitization by the helD+ plasmid was observed in the recr mj'JC8679 strain, consistent with the notion that helicase IV may, in high copy, interfere somewhat with DNA repair.

Insertion alleles of helD can act as srjB cosuppres-

TABLE 3

Transductional mapping of srjB (heD)

Marker Map No. of Genetic selected location (min) Donor Recipient srjB+/total distance (min) a

Cotransduction frequencies

aroA h i d : : Tn 10-9 ompF: : Tn5 zcb222 : : Tn 10 zcc-228: : Tn 10

20.2 JCl58 RDK1769 0/40 20.3 DPBlOl STL1051 0/62 20.9 "55 STL1051 8/300 21.2 CY307 STL1051 20/73 22.3 DC305 STL1051 4/33

>1.4 >1.5

1.4 0.7 1 .o

Transductant genotype Donor markers inheritedb No. of transductants

zcb222: : Tn 10 BrD+ s7jB2 zcb222: : Tn 10 BrD34 srjB2 zcb222 : : Tn 10 pyrD+ q'B+ zcb222 : : Tn 10 pyrD34 q'B+

Three-point cross

1/3 2/3 2/3 3/3

5 48 0

20

Three point cross consisted of donor CY307 zcb222: :TnlO (21.2 min) w D 3 4 (21.3 min) X recipient STL1051 srjB.2, selecting

Calculated genetic distance in minutes between the selected marker and srjB using the formula of (WU 1966). The srjB allele

'The number of donor markers inherited in the transduction. The rare class with inheritance of two of the three donor

TcR.

was scored by the W survival of the transductants.

markers, in this case zcb (pyrD+)srjB+, represents the quadruple exchange, suggesting the gene order zcb-pyrD-qB.


TABLE 4

Transductional mapping of SrjC (uvrD)

Map position No. of Genetic distance Marker selected (min) Donor strain q.c+/total (min)

ilv-3164 : : Tn 1 Okan uwD254Tn5 metE3079: : TnlO fadAB3165 : : Tn I M a n

Cotransduction frequencies with recipient strain STLlO5l s7jC6

84.9 85.8 86.3 87.0

CAG18599 SR1277 CAG18491 CAG18557

5/30 4/4

27/90 6/46

0.9

0.7 1 .o

Transductant genotype Donor markers inheritedb No. of transductants

Three-point cross

mtE3079: : Tn 10 ilv+ q 'C6 1/3 metE3079: : Tn 10 ilv-3164: 1 Tn 1 Okan mjC6 2/3 metE3079: : Tn 10 ilv+ q'C' 2/3 metE3079: : Tn IO ilv-3164 : : Tn 1 Okan srjC' 3/3

19 0 9 1

Three-point cross consisted of donor STL1651 meE3079::TnlO (86.3 min) ilv-3164::TnlOkan (84.9 min) X recipient STL1051 srjC6, selecting Tc'.

Calculated genetic distance in min between the selected marker and SrjC using the formula of (WU 1966). The q'C allele was scored in the transductants by W survival except for the UWD cross, where qC was scored by conjugational recombination phenotype.

bThe number of donor markers inherited in the transduction. The rare class with inheritance of two of the three donor markers, in this case metE3079 ilv-3164 ( q . C 6 ) , represents the quadruple exchange, suggesting the gene order d - q ' C i l v .

SOIS: Transposon insertion mutations were isolated strain STL1051. Three insertions ( helDlO1: : TnlO-9, throughout this cloned region, mapped by restriction helD102::TnlQ9, and helDlO3::TnlQ9) in the helD re- analysis and the resulting mutant plasmids screened gion abolished complementation (data not shown). Se- for complementation of the W-resistant phenotype in quence analysis of the helD102 allele determined the

A. JC13018 (s# d77)

1

0.1

.s 0.01 5 !! - CI c .- .E 0.001 cn

0.0001

o . o O o O 1 ~ 0 10

UV dose (J/IT?)

B. STL1051 (sfji3CD d77)

1

0.1

0.01

0.001

0.m1

0.00001

UV dose (J/IT?)

C. JC8679 (srf d+)

0.1 7

0.01 :

0.001 :

o.Ooo1:

o.oooo1 0 10

uv dose ( J / m 2 )

FIGURE 1. -Complementation of srj suppression by heZD plasmids. UV survival curves of various strains carrying vector plasmid pT7-6 (m) , helD+ plasmid pSTL34 (a), or AhelD plasmid pSTL35 (A). (A) Transformant strain JCl.3018 (recB21 recC22 sbcA23 recJ77) is shown; (B) STL1051 ( recB2l recC22 sbcA23 helD104 u d 5 1 7on S T - 7 recJ77) is shown; and (C) JC8679 ( recB21 recC22 sbcA23) is depicted. Data are averages of two independent determinations except the JC13018 transformants which were assayed once.

recJ Suppression 35

site of insertion as 683 nucleotides downstream of the ATG start codon as defined by WOOD and MATSON (1989). This disrupts the helD gene before “motif I,” a sequence shared by ATP- and GTP-binding proteins (WALKER et al. 1982) . The helDlUl allele is an insertion 22 nucleotides upstream of the helD start codon, as determined by sequence analysis, and the helD103 mutation is an insertion C-terminal in helD, at -1200 nucleotides within the 2.0-kb coding region, as determined by restriction mapping.

To establish if a suppressor effect could be seen from these insertion alleles of helD, we first recombined these helD transposon insertion alleles into the E. coli chromosome. One of these mutations, hAD102::Tn1@9, was then crossed into a srj-suppressed recJmutant strain as follows. The helD102: :Tnl@9 strain was used as the P1 donor in crosses with the prrD zcb: TnlU mj recJ mutant strain STL1066. All 36 of the PyrD + transductants (also all zcb+) , including 20 that had coinherited helD102:: TnlG9, retained the suppressed phenotype with regard to UV survival. This contrasts to similar crosses with heZD+ donors, which showed linkage of the nonsuppressing srjB+ allele with pyrD and zcb (Table 3) . Crosses with the two other helD insertion alleles similarly did not abolish suppression (data not shown), suggesting that helD insertion mutations can substitute for the original helD104 in recJ suppression.

Identification of an amber mutation in the DNA helicase I1 gene, uvrD517,,, as the second cosuppressor, srjC Genetic mapping described above indicated a map position for srjCvery close to the uurD gene, encoding DNA helicase 11. When an insertion mutation in uvrD was transduced into STL1051, only a few transductants were obtained- these were very poor growing and all had lost suppression of recJas judged by recombination tests. Therefore, if srjC is an alteration in the uurD gene, it is not a null mutation. PCR-amplified DNA from the uwD region from the srj-suppressed strain STL1051 was subjected to sequence analysis and revealed a transition mutation at codon 503 of the uurD coding sequence (FINCH and EMERSON 1984), chang- ing CAG (Gln) to TAG (Stop). This mutation, denoted “uurD517,,,” was not present in DNA from the paren- tal srj+ JC8679 strain. Because STL1051 carries supE44, a Gln-tRNA amber nonsense suppressor gene ( KOMINE et al. 1990), the uvrD517,, mutation may cause reduction, but not elimination, of uwD expression. In addition, because amber suppression is not complete, a truncated amber protein might have a dominant-nega- tive effect. This uvrD517,, mutation would remove two of the conserved regions among DNA helicase proteins (motifs V and VI of HODGMAN 1988) although two- thirds of the coding sequence would remain intact.

We therefore isolated amber-nonsuppressing revertants of several strains to determine the phenotypic consequence of the uvrD517,, mutation and whether suppression of recJ by this mutation required amber-

1

0.1

.o 0.01 ti c

2 .- P f 0.001

0.0001

0.00001

A. r e c ~ + strains B. -284 strains

0.00001 I

0 10

UV dose (J/m 2, UV dose (J/m 2,

FIGURE 2.-Effect of amber suppression on mj UV-survival phenotypes. Shown are UV survival curves of supE44 and supE’ derivatives in the recB2l recC22 sbcA23 genetic background: JC8679 supE44 ( 0 ) ; STL 1751 supE+ ( 0) ; STL941 heLD104 uwD517,, mjD7 supE44 ( + ) ; STL1746 helD104 uwD517,, srjD7 mpE+ ( 0 ) ; STL1688 heLD104 uwD517,, srjD7 recJ284::TnIO supE44 (A); STLl766 heLD104 uwD517,, mjD7 recJ284::TnIO supE+ ( A ) . Curves for JC13015 recJ284::TnIO supE44 (m) and STL1500 ud254::Tn5 supE44 (0) are included for comparison. Data represented are averages of two independent determinations.

suppression. When the amber suppressor was removed from uwD517,, helD104 srjD7 recs strain STL941, producing strain STLl746, a UV-sensitive and hypermutable phenotype emerged (Table 5, Figure 2 ) . Although the hypermutability in this strain was as extreme as the uurD254: : Tn5presumed null mutant and that reported for uurDA mutants (WASHBURN and KUSHNER 1991 ) , the UV sensitivity was not nearly as extreme. When the amber suppressor was removed from the uurD517,, helDl04 srjD 7 recJ284 : : T n 10 strain STLl688, giving STLl766, suppression of the recombination phenotype was similar to the supE44 derivative (Table 8) but the W survival was reduced ( Figure 2 ) . This additional UV sensitivity was similar to that conferred by the uwD517,, allele itself in ref sup’strains (see below) . Therefore, the uwD51 7am-alleviation of the need for recJin recombination does not require amber suppression nor is it apparently enhanced in the absence of amber suppression. However, optimal survival to W irradiation requires amber suppression of the uurD517,, mutation, presumably because this mutation interferes somewhat with the function of UvrD in excision repair (VAN HOUTEN 1990). The loss of the amber suppressor also exacerbates the hypermutable phenotype conferred by


TABLE 5

Conjugational recombination and mutator phenotypes of wpE44 and wpE+ derivatives of srj and control strains

Amber Mutation rated Strain Genotype (+recB2l recC22 sbcA23)" suppression? Relative RF" ( w ) X lo9

JC8679 srj' reg+ supE44 + (1) 1.5 STL1751 q" reg+ supE+ - 1.1 1.7 STL94 1 helD104 uvrD517,,srjD7 reg+ supE44 + 2.4 6.6 STLl746 helD104 uvrD517,,srjD7 reg+ supE+ - 1.6 160 JC13015 q'+ reg284 : : Tn 10 supE44 + 0.0047 nd STLl749 srj+ recJ284::TnlO supE+ - 0.0056 nd STL1688 helDlO4 uvrD517,,,,srjD 7 reg284 : : Tn 10 supE44 + 0.13 nd STLl766 helDlO4 uvrD517,, srjD 7 reg284 : : Tn 10 supE + - 0.13 nd STL1500 reg+ uwD254: : Tn5 supE44 + 1.2 nd STL1854 recJ+ uwD254: : Tn5 supE + - nd 160

nd, not determined. " JC8679 and all other derivatives in this table carry the mutations recB21 recC22 sbcA23. * AB1 157 and its derivatives carry the supE44 amber-suppressor mutation. Because uwD517,, is an amber nonsense mutation,

nonamber suppressing (sup+) derivatives of several strains were selected as described in MATERIALS AND METHODS and tested for their phenotypes.

Matings were performed for 0.5 hr. Recipients above and donor JC158 was grown with aeration to mid-log phase. Selections were for Thr+ Leu+ [Ser+ Sm"] for reg+ strains and Leu+ [Ser+TcrSmr] for recJ284::TnlO strains. Recombination frequencies (RF) are expressed relative to that determined for JC8679, which was 2-5% for these experiments. Data presented are averages of two to four determinations.

Mutation rate to rifamDin resistance was determined by the method of the median as described in MATERIALS AND METHODS for seven independent cultures.

uwD517,,, consistent with the loss of the known function of UvrD in methyldirected mismatch repair (MOD-

Both the uvrD+ and the u ~ r D 5 1 7 ~ ~ allele of uvrD were cloned from PCR-amplified chromosomal DNA from strains JC8679 and STL1051, respectively, into lowcopy number vector pWSK29. Two isolates of uwD+ and three of uvrD517,,-carrying plasmids were able to complement fully the UV sensitivity conferred by uwD: : Tn5 mutation in strain STL1526, indicating a functional uwD product is encoded by these plasmids in this strain background, which carries the amber suppressor supE44. Data for pSTLlOl and pSTL105 only are shown in Table 6 but the other plasmids behaved similarly in all subsequent analysis. The uvrD517,, plasmid consistently conferred less UV resistance than the uwD+ plasmid in the uwD: : T n 5 strain, indicating that the amber suppression of uvrD517,, in this background is not complete. Transformation of these plasmids into the nonamber suppressing ( sup') uwD517,, derivative STL1746 showed that its UV-sensitive phenotype is comple- mented by the uvrD+ but not by the uvrD517,, plasmid (Table 6 ) . This confirms that the UV-sensitive phenotype that emerged when the amber suppressor was removed is entirely due to an amber mutation in uvrD.

Determination of the dominance or recessiveness of the uwD517,, mutation with the lowcopy uwD plasmids proved to be problematic. When the uwD+ plasmid was transformed into the recJsuppressed strain STL1688, cell growth was so poor than suppression was difficult to assay. Plasmid transformants formed small colonies and plasmid deletion mutants quickly accumu-

RICH 1991).

lated during the growth of these transformants (data not shown). The uwD517,,-carrying plasmid, however, had no effect on viability (data not shown) or UV survival relative to pWSK29 vector controls (Table 6 ) . In the sup' derivative of STL1688, STLl766, the uwD+ plasmid was stable enough to allow us to determine that uwD' is dominant to uwD517,, for suppression of recJ (Table 6 ) . Viability and growth were clearly reduced in the uwD+ transformant and W survival at 5 J/m' was 30- to 1000-fold reduced relative to that seen for the uvrD517,, and vector plasmids. No reduction of viability or W survival by the uwD+ plasmid was observed in any rets strains, JC8679 (Table 6) or its sup' derivative STL1751 (data not shown). No detectable dominant suppression was conferred by the uwD517,, plasmid in srj+ recJ284::TnlO strain STL236 relative to transformants with pWSK29 vector. As before, the uvrD+ plasmid could not be stably maintained in these recJ- strains, indicating a selective inviability conferred by the uwD' plasmid in strains mutant for re$ Even though the uwD+ plasmid is present at only six to eight copies per cell (WANG and KUSHNER 1991) and con- tains the L e d repressor binding site, a modest increase in uvrD+ levels was apparently detrimental to recJmu- tant strains.

The data above suggest that the uwD517,, recJ- s u p pressor mutation is recessive and may therefore result in loss of some function of helicase 11. This loss may be selective in that the function of uwD in promoting survival after W irradiation is only slightly aEected but that involved in mutation avoidance is completely lost in nonamber suppressing strains. The observed reces

recJ Suppression 37

TABLE 6

Complementation by uvrD+ and uvrD517., lowcopy number plasmids

Strain Genotype

uv dose pWSK29 pSTLlOl pSTL105

(J/m‘) (vector) (uwD+) (uwD517J

UV survival, %, of strain carrying“

STL1526 uwD254::Tn5 supE44 20 0.00075 48 16 STLl746 recB21 recC22 sbcA23 helD104 uwD517,,srjD7 supE+ 40 0.045 4.0 0.050 JC8679 recB21 recC22 sbcA23 supE44 20 24 14 22 JCl3015 recB21 recC22 sbcA23 recJ284 : : Tn 10 supE44 5 0.0060 ns 0.010 STLl688 recB21 recC22 sbcA23 helDl04 uwD51 7a,,,srjD 7

STLl766 recB21 recC22 sbcA23 helDl04 uwD51 7 ~ r j D 7 recJ284 : : Tn 10 supE44 5 1.2 ns 0.94

recJ284 : : Tn 10 supE + 5 0.26 0.00025-0.010 0.36

ns, not stable. These transformants were too unstable to be assayed. “The various plasmids were transformed into the appropriate strains and assayed for UV survival at the indicated dose.

Selection for the plasmid was maintained throughout by growth in LB media containing ampicillin. Values are the average of two to three determinations except for STL1766 carrying pSTLlO1, where the values obtained in each of two experiments are shown. Unlike the other transformants, these values probably vary because of the instability of pSTLlOl in this genetic background.

sive character of suppression, however, is somewhat sur- prising because uwD517,, functions quite well in a genetic background that carries an amber suppressor mutation, supE44. The amber-suppressed uwD517,, protein should have the identical protein sequence to the wild-type UvrD+ protein and, one would imagine from our complementation results, uwD+ should be at least partially dominant to the uwD517,, allele. By plating of various phage derivatives carrying amber mutations, we confirmed that the original strain retains its amber suppressor (data not shown) . Perhaps a reduction of the level of uwD expression is sufficient for suppression. Protein labeling experiments suggest that expression of the full-length protein from uwD517,, plasmids is only -20-30% that of uwD+ plasmids in a supE44 strain background (data not shown) . Alterna- tively, the cell may have some means of selectively inhib- iting uwD function; the hypothetical srjD locus may exert such an effect.

Role of helD and uvrD in suppression: Strains were backcrossed to carry one or both of the helD104 and uwD517,, cosuppressor mutations in the recB recC sbcA genetic background by cotransduction of markers flanking the sites of both mutations (zccfirD for helD and ilv-met for UWD) . Two different isolates for each backcross were saved and behaved similarly in subsequent analysis, although data for only one isolate are shown. The recJ284: : Tn 10 mutation, previously shown to be suppressible, was introduced into each backcrossed derivative. Strains with the helDI04 mutation showed no substantial suppressive effect on the recJ284 mutation (Table 7) . However, we consistently saw a very small increase in recombination proficiency and the colonies formed by the helDl04 recJ284 strain are noticeably larger than those of the helD+ recJ284 control strain. In contrast, strains with uwD5I 7,, exhibited par-

tial suppression of recJ284 for UV survival and for recombination. Therefore, the helDl04 mutation does not by itself promote recJsuppression for UV survival but must facilitate the action of the uwD517,, mutation. The double backcrossed strain carrying both the helDl04 and uwD517,, mutations exhibited partial suppression of re$ as the strain carrying uvrD517,, alone. Our failure to achieve suppression comparable to the original isolate may be because another mutation, “mjD7,” is required for the complete suppressive effect.

To ascertain any phenotypes conferred by the cosup pressor mutations themselves, the recJ77 mutation was crossed out of the original STL1051 suppressor strain to produce helDI04 uwD517,, mP7? recr strain STL941. In addition, the helD104 and uwD517,, srjD+ backcrossed strains were examined for recombination or UV-survival phenotypes (Table 7 ) . The helD104 backcrossed strain behaved identically to the h lD+ control strain with respect to UV survival and conjugational recombination frequency. Strains carrying backcrossed uwD517,, were slightly more sensitive to UV irradiation and exhibited slightly lower transconjugant frequencies. These phenotypes were not observed for the helD104 uwD517,, srjD71 recr isolate (STL941) and confirms that the original suppressed strain carries a third mutation, srjD7, which modifies the UV and recombination phenotype conferred by uwD51 7,,. Our genetic analysis of the hypothetical srjDmutation is not yet complete.

Genetic instability associated with helDlO4 uvrD517,, srjD7 mutants The helD104 uwD517,, srjD7 recr strain STL941 exhibited higher levels of genetic instability as measured in several assays (Table 8) . First, deletion of a 787-bp internal direct repeat in the tetA gene carried on the E. coli chromosome was elevated - 100-fold in the helD104 uwD517,, s r - 7 mutant strain relative to the


TABLE 7

Conjugational recombination and W phenotypes of original suppressed strains and hem uvrD backcrossed derivatives

UV survival‘ Strain Genotype (+ recB21 recC22 sbcA23) Derivation” Relative R F 6 (%)

JC8679 STL941 STL1661 STL1665 STL1685 JC13015 STL1688 STL1674 STL1672 STL1686

red+ helD104 uwD517,,srjD7 red+ helDlO4 reg+ uwD517,,recJ+ helDlO4 uurD517,,recJ+ recJ284 : : Tn 10 helDlO4 uurD517,,,,srjD7 recJ.284 : 1 Tn 10 helDlO4 recJ284: : Tn 10 uurD517,,,,recJ284: : Tn 10 helDl04 uurD517,,recJ284: : Tn 10

from original isolate back-cross back-cross back-cross

from original isolate back-cross back-cross back-cross

(1) 3.2 1.3 0.63 0.82 0.0083 0.20 0.012 0.063 0.085

29 28 20 8.3 8.3 0.00068 0.16 0.00096 0.015 0.0095

a Strains STL941 and STL1688 are transductants of the original suppressor isolate and presumably carry other loci modifying suppression, including srjD7. Strains STL1661, STL1685, STL1674 and STL1686 were constructed by transductional backcross of helD region, selecting flanking markers pyrD and zcc; strains STL1665, STL1685, STL1672 and STL1686 were constructed by transductional back-cross of uwD region, selecting flanking markers metE and ilu. (See MATERIALS AND METHODS).

Matings were performed for 0.5 hr. Recipients above and donor JC158 was grown with aeration to mid-log phase. Selections were for Thr+ Leu’ [Ser’ Sm‘] for mcJ+ strains and Leu+ [Ser+ Tc‘ Sm‘] for recJ284:: TnlO strains. Recombination frequencies (RF) are expressed relative to that determined for JC8679 which was 1-3% for these experiments. Data presented are averages of two to four determinations.

UV survival was determined by plating to LB medium (LB + Tc for recJ284::TnlO strains) with and without exposure to 10 J/mz fluence. Data shown are the averages of two to four determinations.

control. Second, nearly precise excision of TnlO, presumably through 24bp direct repeats in ISlO (ROSS et al. 1979), was higher in the helD104 uwD517,, srjD7 mutant transformants by -10-fold. Third, the frequency of precise excision of the transposon Tn5 from chromc- soma1 prrF locus through the 9-bp direct repeats generated during the transposition process was elevated about fourfold in the helD104 uwD517,, s r 9 7 strain. At least for precise excision of Tn5, a 10-fold stimulation is seen in a backcrossed strain carrying the uwD517,, locus alone. Note as well that these derivatives all carry the supE44 amber suppressor mutation. These results show

that a number of recombinational events (including “il- legtimate” recombination involving very short DNA sequences as in the case of nearly precise and precise excision of transposons) occur at elevated rates in helD104 uwD517,, srjD7 mutant strains. This may mean that these suppressor mutations alter DNA metabolism in such a way that recombinational reactions are generally more favorable. We have not determined if hlD104 has any contribution to this phenotype, but it is interesting to note that helD maps very close to a locus affecting Tn5 precise excision, “uup” (HOPKINS et al. 1983).

The genetic nature of suppression: In the recB recC

TABLE 8

Enhanced deletion rates conferred by wj mutations

Excision rate

Background Genotype 787-bp tetA repeat“ Precise Tn5’ Imprecise Tn 10‘

JC8679 recB21 recC22 sbcA23 3.7 x 10-6 5.0 X 7.6 X

STL941 + helD104 uwD517,,srjD7 4.8 X 1 0 - ~ 2.0 x 5.4 X 1 0 - ~ STLl665 + uwD51 7,,,, nd 6.1 X nd

nd, not determined. All excision rates were calculated from the median for several independent cultures as described in LFA and COULSON (1949).

a Deletion was measured between 787-bp internal repeats of tetA carried on the E. coli chromosome by the number of Tc’ progeny. Derivatives STLl162 (derived from JC8679) and STL1163 (derived from STL941) were used; their construction is described in Table 1. Eighteen independent cultures were assayed. ’ Precise excision of Tn5 was measured for derivatives carrying pyrF: : Tn5 on the chromosome by reversion to prototrophy. Strains STL1639 (derived from JC8679), STL1640 (derived from STL941) and STL1681 (derived from STL1665) were used and are described in Table 1. Excision occurs presumably between the 9-bp flanking repeats generated during transposition. Five independent cultures were grown in LB + ura as described and selected for 4.’ revertants by plating on minimal medium lacking ura.

Imprecise excision of TnlO was measured using plasmid pHV857 (DIALENCON et al. 1994) where excision of miniTnl0-kart from the plasmid allows the expression of Ap resistance. The number of Ap‘ progeny in the Tc‘ population was determined for eight independent cultures. Excision most likely occurs between 24bp direct repeats in ISlO.

39 recJ Suppression

TABLE 9

Conjugational recombination and W phenotypes of various rec m j strains

Relative uv sulvival Strain Genotype RF" (%I6

JC8679 recB21 recC22 sbCA.23 (1) 19 JC13018 recB21 recC2.2 sbcA23 recJ77 0.029 0.0038 STLl05 1 red321 recC2.2 sbcA23 recJ77 helDlO4 ud517.,SrJD7 0.13 0.42 RDK1687 red321 recC22 sbcA 23 recTl01: : Tn 10 0.083 0.98 STL660 red321 recC22 sbcA23 recJ77 helD104 uvrD517.,,,Srp7 recTl01:: TnlO 0.0081 0.0034 STL658 recB.21 recC22 sbd23 recR252 : : Tn 1 @9 0.061 0.039 STL662 red321 recC2.2 sbcA23 recJ77 helD104 uvrD517.,,,s7@7 recR252::Tn1@9 0.01 1 <0.0006 STL282 red321 recC22 sbcA23 recF332: :Tn3 0.041 0.027 RDK1814 recB21 recC2.2 sbd23 recJ77 helD104 uvrD517,,s7@7 recF332::Tn3 0.089 0.00035 RDK1658 red321 recC22 sbcA23 recO1504:: Tn5 0.01 5 0.043 STL664 recB21 recC22 sbcA23 recJ77 helD104 uvrD517.,sjD7 rec01504::Tn5 0.014 0.00020 RDKl688 recB.21 recC22 sbcA23 red56 0.0016 0.0001 RDK1813 red321 recC2.2 sbcA23 recJ77 helD104 uvrD517.,,,sjD7 red56 0.0024 <0.0003

Values shown are the averages of two or three determinations. a Matings were performed for 1 hr. Recipients were grown overnight in standing culture; donor JC158 was grown shaking to

mid-loa phase. Selections were for Thr+ Leu+ [Ser+ Smr]. Recombination frequencies (RF) are expressed relative to that determ-ined for JC8679 in parallel, which ranged from 3 to 4%.

bAt 20 J/m2.

sbd genetic background five genes, in addition to re& are known to be strongly required for recombination: r ed , re#, rec0, recR, re& and recT ( GILLEN et al. 1981 ; LLOYD et al. 1987; LUISI-DELUCA et al. 1989; MAHDI and LLOYD 1989; MORFUSON et al. 1989; HALL et al. 1993). Mutations in these genes were introduced into the original srj suppressor strain STL1051. The resulting derivatives were tested for conjugational recombination and UV survival in parallel to mj' reg' strains carrying the same mutations (Table 9 ) . Introduction of these rec mutations into STL1051 depressed recombination frequencies from 9- to 54fold and UV sensitivity was enhanced z100-fold at the 20 J/m2 dose. Therefore, re@ suppressed recombination required the same genes ( r e d , recT, re#, rec0 and recR) as that in normal srj' recJ' strains. No evidence for a suppressive effect was seen on insertion mutations in recT, re#, rec0 and recR; in fact, the phenotypes conferred by these mutations were more severe in the srjsuppressed recJ77strain than in the mj' reg+ background. In the srj-suppressed recJ77 background recT, re#, rec0, and recR mutations showed even stronger reduction of UV-repair capacity than in recJ' srj' control strains; recT, re#, and recR mutants showed stronger reduction of recombination proficiency as well. This result indicates that recflependent and recJindependent recombination may differ in their requirement for other recombination functions. The requirement for the recT, re#, rec0 and recR genes in recombination or DNA repair may be more stringent in the mjrecJ77strain. A recA56mutant showed no differ- ence in severity of phenotype whether in a recJ' mj' or recJ77 srj genetic background.

Unfortunately we were not able to test the requirement for the 5 ' dsDNA RecE exonuclease because of

the lack of suitable cotransducible selective markers to introduce mutations in our suppressed strain. The single-strand specific exonuclease, exonuclease VII, which attacks both 5 ' and 3 ' ends (CHASE and RICHARDSON 1974) was not required for recombination or UV survival in these recJsuppressed strains (data not shown) .

DISCUSSION

Potential roles for RecJ in genetic recombination: The RecJ exonuclease has strong specificity for single-stranded DNA and is required for recombination and UV repair in several genetic backgrounds which lack the RecBCD exonuclease (LOVEIT and CLARK 1984; LOVEI-T et al. 1988) . RecJ exonuclease may also participate in pathways of mismatch repair (COOPER et al. 1993) and UV damage repair (S. LOVEIT, unpub lished data) in RecBCD' strains. We have proposed that RecJ, like RecBCD, acts to produce single-stranded DNA intermediates, which are required for the RecA- mediated synapsis between homologous DNA molecules ( LOVETT and KOLODNER 1989) . RecBCD accom- plishes this role by its DNA helicase activity or its exonuclease on one strand of dsDNA ( K o w ~ ~ c z y ~ o w s ~ ~ et al. 1994). RecJ may accomplish this role by acting in concert with a DNA helicase: a 5 ' strand displaced by unwinding of a duplex is subject to RecJ digestion, leav- ing the 3' strand single stranded. The RecJ/DNA helicase combination, unlike RecBCD, would be able to extend a region of single-strand DNA at a gap or nick in a circular duplex molecule.

In addition to this presynaptic role, RecJ may also act on synaptic intermediates to favor extension of heteroduplex region. We have proposed that the degradation


of the complement of an invading strand into a single- strand gap may speed and stabilize the heteroduplex joint by removing a competitor strand for pairing. By examining coupled reactions between RecJ and the R e d strand transfer protein, we have shown that RecJ does in fact stimulate the rate of RecA-promoted branch migration (CORRETTE-BENNETT and LOVETT 1995). RecJ also allows R e d to overcome internal non- homology blocks of several hundred nucleotides to branch migration ( CORRETTE-BENNETT and LOVETT 1995).

RecJ-bypass suppression by mutations in DNA helicase genes: The isolation and characterization of genetic mutations that allow cells to overcome the requirement for RecJ nuclease may reveal important clues as to the important role of RecJ nuclease in recombination in vivo. We have isolated a strain with three mutant loci that lead to partial suppression of the recombination deficiency, W sensitivity and poor viability of recJmu- tants in the recBC sbcA genetic background. Every tested recJ allele was suppressed.

Genetic experiments have suggested that two of the srj suppressor loci are alterations in DNA helicase genes. The first mutation, “helD104, ” is probably a loss of function of DNA helicase IV and can be functionally replaced by several insertion alleles of the helD gene. The second mutation, “uwD517,,,” is an amber nonsense mutation causing a truncation in DNA helicase I1 at amino acid Gln503. The uwD517,, mutation can- not be functionally replaced by a insertion mutation in uwD. In the original isolate, uwD517,, is suppressed by the amber suppressor Gln-tRNA mutation supE44. When the supE44 mutation was removed, the strain retained the ability to suppress the requirement for recJ in recombination but some sensitivity to UV irradiation conferred by uwD517,, was revealed. In the supE+ derivative, the UV-sensitive phenotype conferred by uwD517,, was not as extreme as that conferred by the uwD254: : T n 5 (presumed null) mutation but its effect on spontaneous mutability was identical.

Strains carrying uwD517,, alone can achieve partial suppression of recJ. The function of helD104 in suppression is less clear. Presumably, because helD104back- crossed strains show no suppression, helD104 must enhance the suppressive action of uvrD51 Yam. However, by genetic backcrosses we were unable to gain evidence for this notion and the we suggest a third mutation, srjD, must be required for this cosuppressive effect. The presence of a third srjD mutation is also suggested by the fact that isolate STL941 (helD104 uwD517,, srjD7 recJ’) was less UV sensitive and more recombination- proficient than STL1685, a helD104 uwD517,, recJ+ backcrossed strain. Multiple suppressor mutations may have arisen because of strong selective pressure due to growth defects and may have been facilitated by the mutator phenotype conferred by these mutations. We

are presently investigating the genetic location and properties of the hypothetical srjD mutation.

Even in the presence of a functional recJ gene, the frequency of several recombinational events measured on the chromosome and on plasmids was elevated in helDlO4 uvrD517,, srjD7strains. These include deletion of a 787-bp repeat, precise excision of transposon Tn5 and “nearly precision” excision of TnlO. These latter two events must occur at very short regions of homology, 9 and 24 bp in length, respectively. The uwD517,, mutation, even in the presence of the supE44 amber suppressor, was sufficient to stimulate precise excision of Tn5. Mutations in uvrD increase the excision of transposons and recombination in a variety of assays ( ZEIG et al. 1978; ARTHUR and LLOYD 1980; HOWARD- FLANDERS and BARDWELL 1981; LUNDBLAD and KLECK- NER 1982,1985; LLOYD 1983; FEINSTEIN and Low 1986; RABSIGUIER et al. 1989) , suggesting that this DNA helicase has an antirecombinational activity in vivo. One of the normal functions of DNA helicase I1 in the cell may be to abort recombination events.

Recombination and UV survival were more strongly reduced by mutations in several recombination genes in the srj re+suppressed strain than in the srj’ recJ+ background. In particular, the recT, recFand recR genes were required more stringently for both UV survival and conjugational recombination; rec0 and r e 8 were more stringent for UV survival alone. These four genes facilitate DNA pairing interactions. RecT and RecO proteins are DNA “renaturases” ( HALL et al. 1993; HALL

and KOLODNER 1994; LUISI-DELUCA and KOLODNER 1994), that accelerate pairing of complementary single- strand DNA. RecO, RecR and possibly RecF facilitate the loading of the R e d strand-transfer protein on DNA ( UMEZU et al. 1993) . The greater stringency of the requirement for these gene products in the helD104 uwD517,, srjlhuppressed strain may indicate that DNA strand pairing that initiates recombination is not as ex- tensive and exhibits therefore greater demand for DNA pairing proteins.

Model for suppression-stabilization of the heteroduplex joint: The unwinding of DNA duplex by DNA helicases may both promote and discourage genetic recombination. For instance, the joint molecule recombination intermediate shown in Figure 3 can be destroyed by helicase action through the heteroduplex region. On the other hand, unwinding into the regions that flank the joint should stabilize the intermediate by allowing the heteroduplex region between the two in- teracting duplexes to be extended.

A plausible model for the suppression of recJ by uw517,, is that the anti-recombinational properties of helicase I1 have been selectively lost. The failure of uw517,, mutants to exhibit U V sensitivity characteristic of UWD null mutants suggests that the capacity for excision repair of DNA damage is not grossly affected. This may be because the C-terminal region of helicase I1

recJ Suppression 41

Branched heteroduplex joint molecule:

"" "" \

\ L"-

Helicase action

""_ ""_ -"" ""

\ \

\ - la L" DNA helicase DNA helicase

1 1 ""_ """"_ D =x"""

Anti-recombinational Recombinational helicase activity helicase activity

FIGURE 3.-Model for antirecombinational and recombinational activities of DNA helicase proteins. Heteroduplex branched intermediates formed during recombination can be dissoci- ated by helicase action into region of heteroduplex (at left) or can be extented by helicase action outward from heteroduplex (at right).

truncated by uvr517,, is required for anti-recombination but not for excision repair, possibly through interactions with other proteins. Or, the uvr517,, mutant helicase I1 may be impaired such that unwinding of the very short regions from the UvrABCdependent incision to thymine dimers is permitted although longer regions of unwinding associated with recombinational intermediates are not. An additional possibility is that the ~ ~ 5 1 7 , ~ mutation may affect utilization of some, but not all, substrates for helicase I1 unwinding. In vitro, high concentrations of helicase I1 permit unwinding of duplex linear or nicked DNA whereas at lower concentrations helicase I1 preferentially initiates at single- strand regions ( RUNYON and LOHMAN 1989). Finally, the uvr517,, mutation may result in complete loss of DNA helicase I1 activity; UvrD involvement with the excision repair pathway may not be through its DNA unwinding activity but some other property, such as an ability to interact with other proteins like DNA polymerase or UvrC.

Our finding that presumed null mutants of helicase IV can apparently act as cosuppressors may mean that helicase IV can also act in an antirecombinational capacity. Wild-type helicase IV may interfere with the effects of the truncated helicase I1 protein, perhaps because it can substitute for helicase I1 or can interact with wild-type helicase I1 directly. DNA helicase I1 forms heterodimers with the Rep helicase ( WONG et al. 1993) but possible dimerization with helicase IV is not known.

It has been recently demonstrated (KUSANO et al. 1994) that inactivation of the DNA helicase gene, recQ ( UMEZU et aZ. 1990) , can likewise partially alleviate the recombination deficiency and sensitivity to DNAdam- aging agents conferred by recJmutations, and we have

confirmed these observations (see APPENDIX). This sup ports the notion that DNA helicases can both promote and inhibit genetic recombination in various contexts. Whether the mechanisms of recQmediated suppression and UWD helDmediated suppression of recJare similar is not yet clear. Our genetic data (see APPENDIX) suggest that the two modes of suppression are not identical; the genetic dependence of recombination is different. These genetic results demonstrate that the interplay of various DNA helicases with each other and with various potential substrates may be complex. RecQ and helicases I1 and IV appear to exert distinct effects on UV repair and genetic recombination ( MATSON and KAI- SER-ROGERS 1990) although some redundancy is also evident ( see APPENDIX ) .

We suggest that an important role for RecJ in vivo is to stabilize synaptic heteroduplex joints. The RecJ exonuclease activity before or concomitant with strand invasion may serve to lengthen processively the region of heteroduplex. Such a role has been supported by our recent experiments with coupled RecA RecJ strand- transfer reactions ( CORRETTEBENNETT and LOVETT 1995). In the absence of RecJ, heteroduplex joints may be shorter, more unstable and subject to dissociation by DNA helicases. In vitro, helicase I1 reverses RecA- mediated pairing of homologous DNA and the early points of the strand-transfer reaction are especially sensitive to this inhibition ( MOREL et d . 1993) . This model is attractive because it would be consistent with the higher requirement for proteins that facilitate DNA pairing (such as RecT, RecF, RecR, etc. ) in our heZD104 uwD517,, srjDsuppressed recJ mutant strains. This model suggests that regions of heteroduplex DNA are shorter in recJ mutant strains; we have not tested this notion.

We are grateful for the support of A. J. CLARK and R. D. KOLODNER in whose laboratories the early phase of this work was performed. We also thank G. TIAN, Z. WANG and J. ROTHBERG for assistance in plasmid constructions. We are indebted to B. BACHMANN of the E. coli Genetic Stock Center, S. COHEN, C. GROSS, J. WER, N. SARGENTINI and M. SWANEN for providing mapping strains, to R. G. LLOYD for providing the recR mutant, to N. KLECKNER for A TnlO derivatives for mutagenesis, to A. J. CLARK for A JC1929 and JC1939, to S. D. EHRLICH for providing pHV857, to S. KUSHNER for pWSK29, and to A. ISHIHARA and Y. KOHARA for generous provision of the mini-set lambda library. This work was supported by US. Public Health Service grant GM43889 from the National Institute of General Medical Sciences.

LITERATURE CITED

ARTHUR, H. M., and R G. LLOM, 1980 Hyper-recombination in u d mutants of Escherichia coli K-12. Mol. Gen. Genet. 180: 185-191.

AUSUBEL, F. A., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1989 Shmt Protocols in Molecular Biology. Greene Publishing and Wiley-Interscience, NY.

BACHMANN, B. J., 1987 Derivations and genotypes of some mutant derivatives of Escherichia coli K-12, pp. 1190-1219 in Escherichia coli and Salmonella typhimunum: Cellular and Molecular Biology, edited by F. D. NEIDHARDT. American Society for Microbiology, Washington, DC.


BIRNBOIM, H. C., and J. DOLY, 1979 A rapid alkaline procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7: 1513-1523.

B“, M. A,, S. J. SANDLER, M.-E. ARMENGOD, L. W. REAM and A. J. CLARK, 1984 Molecular analysis of the recFgene of Escherichia coli. Proc. Natl. Acad. Sci. USA 81: 4622-4626.

CASSUTO, I., S. C. WEST, J. MURSALEM, L. CONLON and P. HOWARD- FLANDERS, 1980 Initiation of genetic recombination: h o m o b gous pairing between duplex DNA molecules promoted by recA protein. Proc. Natl. Acad. Sci. USA 77: 3962-3966.

CHASE, J. W., and C. C. RICHARDSON, 1974 Exonuclease VI1 of Esche- richi coli: mechanism of action. J. Biol. Chem. 249: 4553-4561.

CHUNG, C. T., S. L. NIEMELA and R. H. MILLER, 1989 One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. USA 86: 2172-2175.

A. J., 1963 Genetic analysis of a “double male” strain of Escherichia coli K-12. Genetics 48: 105-120.

CLARK, A. J., and A. D. MARGULIES, 1965 Isolation and characterization of recombinationdeficient mutants of Escherichia coli K-12. Proc. Natl. Acad. Sci. USA 53: 451-459.

COOPER, D. L., R. S. LAHUE and P. MODRICH, 1993 Methyldirected mismatch repair is bidirectional. J. Biol. Chem. 268: 11823- 11829.

CORRETTE-BENNE=, S. E., and S. T. LOW=, 1995 Enhancement of RecA strand transfer by the RecJ exonuclease of Escherichia coli. J. Biol. Chem. (in press).

CUNNINGHAM, R. P., C. DASGUFTA, T. SHIBATA and C. M. RADDING, 1980 Homologous pairing in genetic recombination: recA protein makes joint molecules of gapped circular DNA and closed circular DNA. Cell 20: 223-235.

D’ALENCON, E., M. PETRANOVIC, B. MICHEL, P. NOIROT, A. AUCOUTUR- IER et al., 1994 Copy-choice illegitimate DNA recombination revisited. EMBO J. 13: 2725-2734.

DOWER, W. J., J. F. MILLER and C. W. RAGSDALE, 1988 High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16: 6127-6145.

FEINSTEIN, S. I., and K. B. LOW, 1986 Hyper-recombining recipient strains in bacterial conjugation. Genetics 113: 13-33.

FINCH, P. W., and P. T. EMERSON, 1984 The nucleotide sequence of the uwD gene of E. coli. Nucleic Acids Res. 12: 5789-5799.

FOUTS, K. E., T. WASIE-GILBERT, D. K. WILLIS, A. J. CLARK and S. D. BARBOUR, 1983 Genetic analysis of transposon-induced mutation of the Rac prophage of Escherichia coli K-12 which affect expression and function of re&. J. Bacteriol. 156: 718-726.

GILLEN, J., D. K. WILLIS and A. J. CLARK, 1981 Genetic analysis of the RecE pathway of genetic recombination in Escherichia coli K- 12. J. Bacteriol. 145 521-532.

HALL, S. D., and R. KOLODNER, 1994 Homologous pairing and strand exchange promoted by the Escherichia coli RecE and RecT proteins. Proc. Natl. Acad. Sci. USA 91: 3205-3209.

%L, S. D., M. F. KANE and R. KOLODNER, 1993 Identification and characterization of the Escherichia coli RecT protein, a protein encoded by the re& region that promotes renaturation of homologous single-stranded DNA. J. Bacteriol. 175: 277-287.

HICKSON, I. D., H. M. ARTHUR, D. BRAMHILL and P. T. EMMERSON, 1983 The E. coli uwD gene product is DNA helicase 11. Mol. Gen. Genet. 190 265-270.

HODGMAN, T. C., 1988 A new superfamily of replicative proteins. Nature 333: 22-23.

HOPKINS, J. D., M. CLEMENTS and M. SWANEN, 1983 New class of mutations in Escherichia coli ( uup) that affect precise excison of insertion elements and bacteriophage Mu growth. J. Bacteriol.

HORII, Z. I., and A. J. CLARK, 1973 Genetic analysis of the RecF pathway of genetic recombination in Escherchia coli K12: isolation and characterization of mutants. J. Mol. Biol. 80: 327-344.

HowARDFLANDERs, P., and E. BARDWELL, 1981 Effects of wcB21, recFl43, and uvrD152 on recombination in lambda bacteriophage- prophage and Hfr by F- crosses. J. Bacteriol. 148: 739-743.

IRINO, N., K. NAKAVAMA and H. NAKAYAMA, 1986 The recQ gene of Escherichia coli K12: primary structure and evidence for SOS regulation. Mol. Gen. Genet. 205 298-304.

m u , E. A., and E. D. BELK, 1982 Induction of E. coli r e d protein via recBC and alternate pathways: quantitation by enzyme-linked immunosorbent assay (ELISA) . Mol. Gen. Genet. 185 275-282.

153: 384-389.

K O W , Y., K. AKIYAMA and K ISONO, 1987 The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 5 0

KOLODNER, R. D., R. A. RSHEL and M. HOWARD, 1985 Genetic recombination of bacterial plasmid DNA effect of RecF pathway mutations on plasmid recombination in Escherichia coli. J. Bacte- riol. 163 1060-1066.

KOMINE, Y., T. ADACHI, H. INOKUCHI and H. OZEKI, 1990 Genomic organization and physical mapping of the transfer RNA genes in Escherichia coli K12. J. Mol. Biol. 212 579-598.

K o w ~ ~ c z ~ x o w s ~ ~ , S. C., D. A. DIXON, A. K. EGGLESTON, S. D. LAUDER and W. M. REHRAUER, 1994 Biochemistry of homologous recombination in Escherichia coli. Microbiol. Rev. 5 8 538-602.

KUSANO, K., Y. SUNOHARA, N. TAKAHASHI, H. YOSHIKURA and I. KOBA- YMHI, 1994 DNA double-strand break repair: genetic determi- nants of flanking crossing-over. Proc. Natl. Acad. Sci. USA 91:

LEA, D. E., and C. A. COULSON, 1949 The distribution of the numbers of mutants in bacterial populations. J. Genetics 49: 264-285.

LLOYD, R. G., 1983 k d dependent recombination in uvrD strains of Escherichia coli. Mol. Gen. Genet. 189 157-161.

LLOYD, R. G., S. M. PICKSLEY and C. PRESCOIT, 1983 Inducible expression of a gene specific to the RecF pathway for recombination in Escherichia coli K12. Mol. Gen. Genet. 190: 162-167.

LLOM, R. G., C. BUCKMAN and F. E. BENSON, 1987 Genetic analysis of conjugation recombination in Escherichia coli K12 strains deficient in RecBCD enzyme. J. Gen. Microbiol. 133: 2531-2538.

LOVEIT, S. T., and A. J. CLARK, 1984 Genetic analysis of the recJ gene of Eschm‘chia coli K-12. J. Bacteriol. 157: 190-197.

LOWIT, S. T., and A. J. CLARK, 1985 Cloning of the Escherichia coli recJ chromosomal region and identification of its encoded proteins. J. Bacteriol. 162 280-285.

LOWTT, S. T., and R. D. KOLODNER, 1989 Identification and purification of a single-strand-specific exonuclease encoded by the recJ gene of Escherichia coli. Proc. Natl. Acad. Sci. USA86: 2627-2631.

LOW=, S. T., P. T. DWKIN, V. A. SUTERA, JR. and T. J. GLUCKMAN- PESKIND, 1993 A sister-strand exchange mechanism for red- independent deletion of repeated DNA sequences in Escherichia coli. Genetics 135: 631-642.

LOVEIT, S. T., C. A. LUISI-DELUCA and R. D. KOLODNER, 1988 The genetic dependence of recombination in re& mutants of Eschc richia coli. Genetics 120: 37-45.

LUISI-DELUCA, C. A,, and R. KOLODNER, 1994 Purification and characterization of the Escherichia coli K-12 RecO protein: renaturation of complementary single-stranded DNA molecules cata- lyzed by the RecO protein. J. Mol. Biol. 236: 124-138.

LUISI-DELUCA, C., S. T. LOWTT and R. D. KOLODNER, 1989 Genetic and physical analysis of plasmid recombination in recB recC sbcB and recB recC sbcA Escherichia coli K-12 mutants. Genetics 122 269-278.

LUNDBLAD, V., and N. KLECKNER, 1982 Mutants of Escherichia coli K12 which affect excision, pp. 245-258 in Molecular and Cellular Mechanisms of Mutagenesis, edited by J. F. LEMONTI and W. M. GENEROSO. Academic Press, New York.

LUNDBLAD, V., and N. KLECKNER, 1985 Mismatch repair mutants of Escherichia coli K12 enhance transposon excision. Genetics 109 3-19.

MAHDI, A. A,, and R. G. LLOYD, 1989 Identification of the recR locus of Escherichia coli K-12 and analysis of its role in recombination and repair. Mol. Gen. Genet. 216: 503-510.

MATSON, S. W., and K. A. KAISER-ROGERS, 1990 DNA helicases. Annu. Rev. Biochem. 59: 289-329.

MENDONCA, V. M., K. A. KAISER-ROGERS and S. W. MATSON, 1993 Double helicase I1 (uvrD) -helicase N ( hdD) deletion mutants are defective in the recombination pathways of Escherichia coli. J. Bacteriol. 175: 4641-4651.

MODRICH, P., 1991 Mechanisms and biological effects of mismatch repair. Annu. Rev. Genet. 25: 229-253.

MOREL, P., J. A. HENJA, S. D. EHRI.ICH and E. CASSUTO, 1993 Antipair- ing and strand transferase activities of E. coli helicase I1 ( UvrD) . Nucleic Acids Res. 1 4 3205-3209.

MORRISON, P. T., S. T. Lorn=, L. E. GILSON and R. KOLODNER, 1989 Molecular analysis of the Escherichia coli rec0 gene. J. Bacteriol. 171: 3641-3649.

NAKAYM, J., K. NAKAYAMA, R. NAKAYAMA, N. IRINO, Y. N m W el

495-508.

1173-1177.

recJ Suppression 43

al., 1984 Isolation and genetic characterization of a thymineless death-resistant mutant of Escherichia coli K12: identification of a new mutation ( recQl) that blocks the RecF recombination pathway. Mol. Gen. Genet. 195: 474-480.

RAYSSIGUIER, C., D. S. THALER and M. RADMAN, 1989 The barrier to recombination between Escherichia coli and salmoneua typhimurium is disrupted in mismatch-repair mutants. Nature 342 396-401.

Ross, D. G., J. SWAN and N. KLECKNER, 1979 Nearly precise excision: a new type of DNA alteration associated with the translocatable element TnlO. Cell 1 6 733-838.

RUNYON, G. T., and T. M. LOHMAN, 1989 Escherichia coli helicase I1 ( UvrD) protein can completely unwind fully duplex linear and nicked circular DNA. J. Biol. Chem. 264: 17502-17512.

SILHAVY, T. J., M. L. BERMAN and L. W. ENQUIST, 1984 Exphents with &e Fusions. Cold Spr. Harbor Laboratory Press, Cold Spring Harbor, Ny.

TABOR, S., 1990 Expression using the T7 RNA polymerase/promoter system, pp. 16.2.1-16.2.11 in Current Aotocols in Molecular Biology, edited by F. A. AUSUBEL, R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN, J. A. SMITH and IL STRUHL. Green Publishing and Wiley-Interscience, New York.

UMEZU, IC, IC NAKAYAMA and H. NAKAYAMA, 1990 Escherichia coli RecQ protein is a DNA helicase. Proc. Natl. Acad. Sci. USA 87:

UMEZU, R, N. W. CHI and R. D. KOLODNER, 1993 Biochemical inter- action of the Eschachia coli RecF, RecO, and RecR proteins with RecA protein and single-stranded DNA binding protein. Proc. Natl. Acad. Sci. USA 9 0 3875-3879.

VAN HOUTEN, B., 1990 Nucleotide excision repair in Escha'chia coli. Microbiol. Rev. 54: 18-51.

WALKER, J. E., M. SARASTE, M. J. RUNSWICK and N. J. GAY, 1982 Dis- tantly related sequences in the a- and p- subunits of ATP syn- thase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1: 945-951.

WANG, R. F., and S. R. KUSHNER, 1991 Construction of versatile low-

Escherichia coli. Gene 100: 195-199. copy vectors for cloning, sequencing and gene expression in

WASHBURN, B. IC, and S. R. KUSHNER, 1991 Construction and analysis of deletions in the structural gene ( u d ) for DNA helicase I1 of Escherichia coli. J. Bacteriol. 178: 2569-2575.

WAY, J. C., M. A. DAVIS, D. MORISATO, D. E. ROBERTS and N. KLECK- NER, 1988 New TnlO derivatives for transposon mutagenesis and for construction of lacZ operon fusions by transposition. Gene 32: 369-379.

WEST, S. C., 1993 The nucleases of genetic recombination, pp. 145- 170 in Nucleases, Ed. 2, edited by S. M. LINN, R. S. LLOYD and R. J. ROBERTS. Cold Spr. Harbor Laboratory Press, New York.

WILLE'ITS, N. S., A. J. CLARK and B. LOW, 1969 Genetic location of certain mutations conferring recombination deficiency in Esche- richia coli. J. Bacteriol. 97: 244-249.

WONG, I., M. AMARATUNGA and T. M. LOHMAN, 1993 Heterodimer formation between Escherichia coli Rep and UvrD proteins. J. Biol. Chem. 268: 20386-20391.

WOOD, E. R., and S. W. MATSON, 1989 The molecular cloning of the gene encoding the Escherichia coli 75kDa helicase and the determination of its nucleotide sequence and genetic map position. J. Biol. Chem. 264 8297-8303.

WU, T. T., 1966 A model for three-point analysis of random general transduction. Genetics 54: 405-410.

ZEIG, J., V. F. MAPLES and S. R. KUSHNER, 1978 Recombination levels of Escherichia coli K-12 mutants deficient in various replication, recombination, or repair genes. J. Bacteriol. 134: 958-966.

5363-5367.

Communicating editor: G. R. SMITH

APPENDIX

Effect of single and combined mutations in the DNA helicase genes, recQ uwD and helD, on genetic recombination and W survival and recJsuppression: Because of the apparent role of DNA helicase genes uwD and helD in suppression of re$ we examined the effect of insertion mutations in uwD, and helD in combination

with those in recQ which has previously been shown to affect recombination (NAKAYAMA et al. 1984). We tested conjugational inheritance by recombination and UV-survival capabilities in three different genetic backgrounds: reci, recBC sbcA, and recBC sbcB and results are shown in Table 10. In the rec+ genetic background, mutations in any or all of the DNA helicase genes had no effect on recombination frequencies. As expected, strains which carried a mutation in uvrD were sensitive to U V irradiation.

As in previous studies ( NAKAW et al. 1984; LUISI- DELUCA et al. 1989), a mutation in recQreduced conjugational inheritance by recombination somewhat in the recBC sbcA genetic background and more extremely in the recBC sbcBC genetic background. Mutations in recJ likewise decrease recombination in both recBC mutant genetic backgrounds with a greater effect in the recBC sbcB than the recBC sbcA strains (LOVETT and CLARK 1984). The helD insertion mutation itself, in recJ+ strains, conferred no detectable decrease in recombination frequencies observed after conjugation or for UV survival (Figure 4 ) in either ret+, recBC sbcB or recBC sbcA genetic backgrounds. Likewise, an insertion in uwD has little or no effect on conjugational recombination in any of these genetic backgrounds even in combination with h1D. This result contrasts with MENDONCA et al. ( 1993) who report a fivefold decrease of conjugational inheritance

TABLE 10

Conjugational recombination of helicase mutants in heD, uvrD and recQin three genetic backgrounds:

red3 recC sbd, red3 recC sbcB and rec'

Relative conjugational inheritance in genetic

background

Helicase genotype recBC sbcA recBC sbcBC rec+

helD102::Tn10-9 1.1 0.86 1.5 uvrD254: : Tn5 1.2 0.42 1.5 helD102::Tn10-9 uvrD254::Tn5 0.95 0.61 1.5 recQ61: : Tn3 0.23 0.020 0.87 recQ6l::Tn3 helD102::Tn10-9 0.12 0.032 1.4 recQ61: : Tn3 uwD254: : Tn5 0.13 0.027 1.5 recQ61: : Tn3 helDlO2: : Tn 10-9

uwD254: : Tn5 0.15 0.020 0.76

Isogenic helicase mutants in the three genetic backgrounds are described in Table 1 (strains STL811, STL1500, STL1524, RDKl690, STL1031, STL1523, STLl609 in recBC sbcA background; STL863, STL1527, STL1543, STL1613, STL1551, STL1615 in recBC sbcBC background; STL864, STL1526, STL1544, STL1548, STL1611, STL1550, STL1617 in rec+ background). Matings were performed for 0.5 hr. Selections were for Thr+ Leu+ [Ser+ Smr] with Hfr donor JC158. Inheritance frequencies are expressed relative to that determined for JC8679 (recBC sbcA), JC7623 (recBC sbcBC) or AB1 157 (rec') performed in parallel. Values are averages for at least two experiments. Recombination frequencies (recombinants/do- nor cells) for crosses with the Rec+ parent, JC8679, JC7623, or AB1157 ranged between 0.1 and 50%.


1 1

0.1 0.1

C

f 0.01 0.01 .t

.- e

.E 0.001 i?l

> 0.001

0.0001 0.0001

0.00001 0.00001 0.00001 -1 0 10 20 0 10 20 0 10 20

UV dose ( J / d ) uv dose (J/&) UV dose ( J / d )

1

0.1

0.01

0.001

0.0001

FIGURE 4.-Effects of various helicase mutations uwD254::Tn5, recQ61::Tn3 and he1D::TnlO-9 in combination on UV survival. Helicase mutation combinations in ret+ ( A ) , recBC sbcA ( B ) , and recBC sbcBC (C) genetic backgrounds include hP ( ~ ) , h ~ D ( A ) , r e c Q ( ( . ) , u w D ( A ) , h e l D r e c Q ( 4 ) , h e l D u w D ( O ) , r e c Q u v r D ( O ) , h e l D r e c Q u v r D ( O ) . D a t a s h o w n a r e t h e averages of two to three determinations. These strains are listed in Table 10 and their derivations are given in Table 1.

by helD mutations in recBC sbcA strains (although no effect on recBC sbcBC strains) and a synergistic effect on recombination by mutations in helD and UWD in the recBC sbcBC genetic background ( 100-fold reduction). Other of our conjugal crosses with Hfrs with differing origins of transfer including those that transfer the heZD region very late have failed to reveal any defect in conjugation recombination in heZD strains (data not shown). The explanation for this discrepancy is not known but may include allele differences, extragenic mutations or experimental differences.

The most striking effect seen in our analysis was the lesser effect of uvrD mutations on W survival in recBC sbcA or recBC sbcB genetic backgrounds as compared with the more extreme reduction of W survival in rec+ genetic background (Figure 4). This suppression of the UV sensitivity in the former genetic backgrounds is due to the action of re@: mutations in UWD and recQ were strongly synergistic in both recBC sbcA and recBC sbcB strains, reducing UV survival to the levels conferred by uvrD alone in the ret+ background. This background- specific synergism may be because recQ an DNAdam- age inducible gene ( IRINO et aZ. 1986), is expressed constitutively in recBC sbcA and recBC sbcBC strains; in

had little effect in recBC sbcA strains. These synergistic genetic effects illustrate a measure of overlapping function of these DNA helicases for W repair. Our analysis did not show evidence for overlapping function in genetic recombination.

The recJ284: :TnlOallele was introduced into the various combinations of helicase mutants in the recB recC

TABLE 11

Conjugational recombination of UV survival of helicase mutations in heD, uvrD and re@ in combination with

recJ in re& recC sbcA genetic background

uv red284 : : Tn 1 O+ RF (%I"

Genotype: recB2l red22 sbcA23 Relative survival

hel' helD102::TnI0-9 uvrD254: : Tn5 helD102::Tnl0-9 uwD254::Tn5 recQ61: : Tn3 recQ61: : Tn3 helDlO2: : Tn 10-9 ~ecQ61: : Tn3 uwD254: : Tn5 recQ61: : Tn3 helDlO2: : Tn 10-9

uwD254: : Tn5

0.020 0.035 0.024 0.029 0.15 0.018 0.19

0.034

0.0036 0.0018 0.0024 0.00091 0.047 0.014 0.0052

0.0048 recBC+ strains, levels of recQ expression may not be suf- Isogenic helicase mutants in the recBC sbcA genetic back-

expression of DNAdamage inducible genes have been STL814, STL1743, STL1745, STLl742, STLl790, STLl744, observed in recBC mutant strain backgrounds (MU STLl789. Matings were performed for 0.5 hr. Selections were and BELK 1982; LLOYD et al. 1983) . An additional muta- for Thr' Leu+ [Ser' Sm'] with Hfr donor JC158. Inheritance tion in helD also enhanced somewhat the sensitivity of frequencies are expressed relative to that determined for

JC8679 (recBC s b d ) performed in parallel, which was 1-4%.

tion in helD enhanced the UV sensitivity of UWD mu- two to three experiments. tants in the recBC sbcBCgenetic background slightly but "At 10 J/m2.

ficient to 'Ompensate for loss Of uvrD. Higher levels Of ground are described in Table 1. Swains include Jc1.3015,

recQmutants in these backgrounds' An muta- Both recombination and W survival values are averages for

recJ Suppression 45

sbd genetic background. Mutations in UWD and helD did not confer any suppression of recJphenotypic effects in tests of recombinational proficiency and UV survival (Table 11 ) . This supports our observations in the analysis of the uvrD heZD mjsuppressor mutations, that some residual function of UvrD is required for RecJ suppression. Our data confirmed the results of KUSANO et al. (1994) that inactivation of the recQ helicase partially suppresses the recombination deficiency and UV sensi-

tivity conferred by recJ mutations. This suppression is neither enhanced nor inhibited by introduction of mutations in UWD. However, suppression of recJ by re@ required a functional helD gene. This distinguishes the recQmode of suppression (helicase IV dependent) from the helD UWD srjD suppression (helicase IV independent) and suggests that, although both types of suppression involve DNA helicase genes, they are mecha- nistically distinct.

Documents

Suppression of RecJ Exonuclease Mutants of coli by ... · recB2l recC22 sbcA23 red77 helD104 uwD517,,,srjD7 recB21 recC22 sbcA23 recJ77 helD104 uwD517,,mjD7 recB21 recC.22 sbcA23