Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Syngas-derived medium-chain-length PHA synthesis in engineered Rhodospirillum rubrum 1
Syngas-derived mcl-PHA synthesis in R. rubrum 2
Daniel Heinrich1, Matthias Raberg1, Philipp Fricke1, Shane T. Kenny2, Laura Morales-3
Gamez2, Ramesh P. Babu2,3, Kevin E. O’Connor2, and Alexander Steinbüchel1,4 4
5
1Daniel Heinrich, Matthias Raberg, Philipp Fricke, and Alexander Steinbüchel () 6
Institut für Molekulare Mikrobiologie und Biotechnologie, Westfälische Wilhelms-Universität, Münster, Germany 7
AS: [email protected], Tel: +49-251-8339821, Fax: +49 251 8338388 8
9
2Shane T. Kenny, Laura Morales-Gamez, Ramesh P. Babu, and Kevin E. O’Connor 10
Bioplastech Limited, Belfield Innovation Park, University College Dublin, Dublin, Ireland 11
12
3Ramesh P. Babu 13
CRANN and School of Physics, Trinity College Dublin, Dublin, Ireland 14
15
4Alexander Steinbüchel 16
Environmental Sciences Department, King Abdulaziz University, Jeddah, Saudi Arabia 17
18
Keywords: Carbon monoxide, Polyhydroxyalkanoates, PHAMCL, Polyhydroxyoctanoate, Polyhydroxydecanoate, 19
Pseudomonas putida, Rhodospirillum rubrum, Syngas. 20
1
AEM Accepted Manuscript Posted Online 12 August 2016Appl. Environ. Microbiol. doi:10.1128/AEM.01744-16Copyright © 2016, American Society for Microbiology. All Rights Reserved.
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
2
Abstract: 21
The purple non-sulfur alphaproteobacterium Rhodospirillum rubrum S1 was genetically 22
engineered to synthesize a heteropolymer of mainly 3-hydroxydecanoic acid and 3-23
hydroxyoctanoic acid [P(3HD-co-3HO)] from CO- and CO2-containing artificial syngas. For this, 24
genes from Pseudomonas putida KT2440 coding for a 3-hydroxyacyl-ACP thioesterase (phaG), a 25
medium-chain-length (MCL) fatty acid CoA-ligase (PP_0763) and a MCL PHA-synthase 26
(phaC1) were cloned and expressed under the control of the CO-inducible promoter PcooF from 27
R. rubrum S1 in a PHA-negative mutant of R. rubrum. P(3HD-co-3HO) was accumulated to up 28
to 7.1 % (wt/wt) of the cell dry weight by a recombinant mutant strain utilizing exclusively the 29
provided gaseous feedstock syngas. In addition to an increased synthesis of these medium chain-30
length PHAs (PHAMCL), enhanced gene expression through the PcooF promoter led also to an 31
increased molar fraction of 3HO in the synthesized copolymer when compared with the Plac 32
promoter, which regulated expression on the original vector. The recombinant strains were able 33
to partially degrade the polymer, and the deletion of phaZ2, which codes for a PHA-34
depolymerase most likely involved in intracellular PHA-degradation, did not reduce mobilization 35
of the accumulated polymer significantly. However, an amino acid exchange in the active site of 36
PhaZ2 led to a slight increase in PHAMCL accumulation. The accumulated polymer was isolated; 37
it exhibited an average molecular weight (Mw) of 124.3 kDa and a melting point of 49.6 °C. With 38
the metabolically engineered strains presented in this proof-of-principle study, we demonstrated 39
the synthesis of elastomeric second generation biopolymers from renewable feedstocks not 40
competing with human nutrition. 41
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
3
Importance 42
Polyhydroxyalkanoates (PHAs) are natural biodegradable polymers (biopolymers) showing 43
properties similar to commonly produced petroleum-based non-degradable polymers. The 44
utilization of cheap substrates for the microbial production of PHAs is crucial to lower the 45
production costs. Feedstock not competing with human nutrition is highly favorable. Syngas, a 46
mixture of carbon monoxide, carbon dioxide, and hydrogen can be obtained by pyrolysis of 47
organic waste and can be utilized for PHA-synthesis by several bacteria. Up to now, the 48
biosynthesis of PHAs from syngas has been limited to short-chain-length PHAs, which results in 49
a stiff and brittle material. In this study the syngas-utilizing bacterium Rhodospirillum rubrum 50
was genetically modified to synthesize a polymer, which consisted of medium-chain-length 51
constituents resulting in rubber-like material. This study reports the establishment of a microbial 52
synthesis of these so-called medium-chain-length PHAs from syngas and therefore potentially 53
extends the applications of syngas-derived PHAs. 54 on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
4
Introduction 55
Biodegradable and biocompatible Polyhydroxyalkanoates (PHAs) are naturally occurring 56
polyesters, which are synthesized by various bacteria. Depending on their composition PHAs 57
present different physical and mechanical properties that can resemble those of petrochemically 58
produced conventional plastics (1). PHAs are divided into those consisting of short-chain-length 59
(3-5 carbon atoms; PHASCL) and of medium-chain-length (6-14 carbon atoms; PHAMCL) 60
hydroxyalkanoic acids, with both showing significantly different properties and thereby also 61
being suitable for different applications. PHAMCL, which are mainly synthesized by 62
pseudomonads are elastomeric rubber-like polymers with a much lower melting point than the 63
more brittle and crystalline PHASCL (2). Due to these attributes, PHAMCL expand the range of 64
applications for PHAs to elastic materials, required in the food and pharmaceutical industry (3). 65
Generally, pseudomonads are able to synthesize PHAMCL from carbon sources that they can 66
convert to acetyl coenzyme A (acetyl-CoA), which is then subjected to fatty acid de novo 67
synthesis. This pathway is linked to PHA synthesis via the 3-hydroxyacyl acyl-carrier-protein 68
(ACP) thioesterase PhaG, which in combination with a fatty acid CoA-ligase transfers the 69
hydroxyacyl moiety from ACP to CoA (4, 5). Alternatively, readily available fatty acids that are 70
metabolized to 3-hydroxyacyl-CoA through β-oxidation can be converted to a substrate for the 71
PHA polymerase PhaC. Many recent studies have focused on the efficient production of PHAMCL 72
in wild type and recombinant microorganisms from abundant and cheap carbon sources, such as 73
carbohydrates (6), fatty acids (7), or even polyethylene and aromatic compounds (8, 9). 74
Although the currently decreasing oil price results in a competitive disadvantage for the 75
production of bioplastics in comparison to petrochemically produced plastics, the rising 76
awareness for the pollution of marine and terrestrial environments by non-degradable plastics and 77
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
5
the emerging problem of the occurrence of microplastics particles, leads to a growing demand for 78
degradable biopolymers, such as PHAs (10). Additionally, the possibility to utilize industrial 79
exhaust gases and such gases arising from gasification and pyrolysis of organic waste, referred to 80
as synthesis gas (syngas), could further promote environmentally friendly and cost-efficient 81
production processes for these so called second generation biopolymers (11). The synthesis of 82
PHAs from waste gases as CO and CO2, which in addition to N2 and H2 are the major 83
components of syngas, has gained increased attention over the last decade, as it is predicted to be 84
economically feasible without competing with human energy- or food supply (12, 13). However, 85
so far only PHASCL have been synthesized from these gaseous feedstocks, as there is no known 86
microorganism capable of synthesizing PHAMCL from syngas. 87
The purple non-sulfur alphaproteobacterium Rhodospirillum rubrum is able to utilize CO and 88
CO2 and has been a host- and model organism for several studies focusing on the synthesis of 89
PHASCL, from various feedstocks (14, 15, 16). Applying the water-gas-shift reaction, R. rubrum 90
oxidizes CO with H2O to CO2 and H2 employing a carbon monoxide dehydrogenase (CODH), 91
thereby gaining energy and carbon that is channeled into the Calvin cycle via ribulose 1,5 92
bisphosphate carboxylase (17). Moreover, recent investigations have shown that other 93
carboxylases, which are specifically active when acetate assimilation is required, play a major 94
role in CO2 fixation (16). These include carboxylases of the ethylmalonyl-CoA pathway, and a 95
ferredoxin-dependent pyruvate synthase (PFOR). The wild-type of R. rubrum naturally 96
synthesizes PHASCL with varying amounts of incorporated 3-hydroxyvalerate. The aim of this 97
study was to genetically modify R. rubrum S1 to synthesize PHAMCL from syngas-derived CO 98
and CO2. For this, three genes from Pseudomonas putida KT2440 coding for a 3-hydroxyacyl-99
ACP thioesterase (phaG; 4), a medium-chain-length (MCL) fatty acid CoA-ligase (PP_0763; 5) 100
and a PHA-Synthase (phaC1; 18) were chosen for overexpression in a ΔphaC1/ΔphaC2-mutant, 101
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
6
unable to synthesize PHASCL (Fig. 1). In order to evaluate syngas mediated gene overexpression, 102
the CO-inducible PcooF-promoter (19) was implemented. It was also investigated if cells of 103
R. rubrum would be able to degrade the synthesized PHAMCL and consequently, if a mutation of 104
the predicted intracellular PHA-depolymerase PhaZ2 gene (20) would increase polymer 105
accumulation. 106
107
Materials and Methods 108
Microorganisms, plasmids and oligonucleotides 109
All applied bacterial strains, plasmids, and oligonucleotides are listed in Table 1. For routine 110
cloning, plasmids were introduced into and isolated from Escherichia coli TOP10. E. coli S17-1 111
was used for the transfer of derivatives of the suicide vector pJQ200mp18 into R. rubrum strains. 112
Cultivation of bacteria 113
Strains of E. coli were cultivated in 5 mL test tubes with lysogeny broth (LB) (21) at 37 °C and 114
an agitation of 120 rpm. Cells of R. rubrum were grown in a modified medium by Bose et al. 115
(22). Here, DL(-)malic acid was omitted, the amount of (NH4)2SO4 was reduced to 1 g L-1, and 1 116
g L-1 of yeast extract as well as 2 g L-1 of disodium succinate x 6 H2O were added to the medium. 117
Additionally, the medium contained 10 g L-1 of D(-)fructose when heterotrophic synthesis of 118
PHA in recombinant R. rubrum strains was examined. For cultivations with CO-containing gas 119
mixtures, 9.75 mg L-1 of NiCl2 was added to the medium. When necessary, gentamicin (20 µg 120
mL-1) or kanamycin (50 µg mL-1 for E. coli; 25 µg mL-1 for R. rubrum) were added to the media. 121
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
7
R. rubrum cells were cultivated anaerobically in the dark in 300 mL baffled Erlenmeyer flasks 122
containing 50 mL medium at 30°C and an agitation of 120 rpm. For cultivations with gas 123
mixtures, 300 mL baffled Duran flasks with butyl rubber plugs were applied, and the agitation 124
speed was increased to 150 rpm. To establish an artificial syngas atmosphere, flasks were flushed 125
with nitrogen, which was then evacuated and replaced by an artificial syngas-mixture containing 126
40 vol% CO, 40 vol% H2, 10 vol% CO2 and 10 vol% N2. Alternatively, flasks were filled with 127
pure CO to a concentration of 40 vol%. For this, the respective amount of nitrogen was evacuated 128
from flasks prior to the addition of CO. Gas atmospheres and kanamycin were restored after 3 129
days of cultivation. Pre-cultures were grown for 24 h in 100 ml baffled Erlenmeyer flasks with a 130
culture volume of 20 mL containing succinate as the sole carbon source in all cases. 131
Growth of R. rubrum strains was determined by measuring the optical density of the culture broth 132
at 680 nm. Cells were harvested by centrifugation at 4,000 g for 20 min. Cultivations were 133
carried out in triplicate over the course of at least two separate experiments. 134
Construction of vectors and generation of recombinant strains of E. coli and R. rubrum 135
Methods comprising the amplification, isolation and manipulation of DNA were carried out as 136
described by Sambrook et al. (21). Respective DNA fragments were amplified from genomic 137
DNA of R. rubrum S1 and P. putida KT2440 using the Phusion High-Fidelity DNA Polymerase 138
(New England Biolabs, Ipswich, MA, USA) and oligonucleotides listed in Table 1. T4 DNA 139
ligase (Thermo Scientific, Waltham, MA, USA) was applied for ligating amplified and digested 140
DNA fragments. For validation, replication and isolation of the generated constructs, chemically 141
competent E. coli TOP10 cells were transformed (23) and the resulting strains were verified by 142
colony PCR as well as isolation and digestion of the generated vectors with restriction 143
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
8
endonucleases. Applying the protocol of Aneja et al. (24), the verified hybrid plasmids were 144
transferred into strains of R. rubrum via electroporation. 145
In order to yield the expression vector pBBR1MCS-2::phaG::phaC::PP_0763, the empty 146
pBBR1MCS-2 was initially digested with HindIII and BamHI and ligated with a likewise 147
digested phaC1 fragment. An XhoI/HindIII digested phaG fragment was then inserted into the 148
corresponding site of the vector pBBR1MCS-2::phaC1, resulting in pBBR1MCS-149
2::phaG::phaC1. This construct was linearized with SpeI before ligating a SpeI-cleaved PP_0763 150
fragment. The PcooF-promoter region was inserted upstream of the three genes by ligating an 151
ApaI/XhoI fragment into the similarly digested pBBR1MCS-2::phaG::phaC::PP_0763, yielding 152
pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763. 153
Site directed mutagenesis of phaZ2 in R. rubrum 154
In order to exchange cysteine at position 176 of PhaZ2R. rubrum with alanine, leading to an inactive 155
PhaZ2, miss-matched oligonucleotides (Table 1) causing a codon exchange in the respective gene 156
were applied. DNA fragments hybridizing up- and downstream of the modified codon, which 157
overlapped for 24 bp, were amplified from R. rubrum S1 genomic DNA. In a following fusion-158
PCR a single 1206 bp phaZ2-fragment containing the altered codon was amplified from the two 159
fragments. The product was cleaved with XbaI and ligated into a likewise linearized 160
pJQ200mp18. The resulting pJQ200mp18::phaZ2C176A was mobilized from E. coli S17-1 into 161
R. rubrum ΔphaC1/ΔphaC2 by conjugation via the spot agar mating technique (25). R. rubrum 162
mutants were isolated on sucrose (10% wt/vol) containing agar plates with the media composition 163
described above, but excluding yeast extract and fructose. R. rubrum 164
ΔphaC1/ΔphaC2/phaZ2C176A mutants were confirmed by sequencing of phaZ2 genes with the 165
same primers used for amplifying the fragments. 166
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
9
In an alternate approach, phaZ2R. rubrum was deleted. For this flanking regions of 403 and 635 bp 167
up- and downstream of phaZ2 were amplified by PCR, adding XbaI and PstI sites to the 168
fragments. Upon cleavage with PstI, ligation and amplification of the fused ΔphaZ2-fragment, 169
the fragment was digested with XbaI and ligated into a similarly linearized pJQ200mp18. Then, 170
deletion of phaZ2 in R. rubrum ΔphaC1/ΔphaC2 through homologous recombination was carried 171
out as described above. Marker-less gene-deletion was confirmed by PCR-analysis of the phaZ2-172
region, using internal- and flanking-primers of phaZ2 (Table 1). 173
Analysis of protein patterns 174
Cells were lysed by sonication, and the cell extract was separated from the cell debris by 175
centrifugation (10 min, 13,000 g, 4 °C). Upon measuring the protein concentration (26) 40 µg of 176
protein was mixed with denaturing buffer, incubated for 10 min at 95 °C and separated by 177
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) according to Laemmli 178
(27) and stained with Coomassie brilliant blue R-250. 179
Isolation and Determination of PHA 180
In order to determine the PHA content of cells, 5-10 mg freeze dried cell matter were 181
methanolyzed, and the resulting methylesters were identified and quantified by gas 182
chromatography (GC) and GC-mass spectrometry as described previously (28). PHA was 183
isolated from cells with chloroform in a Soxhlet apparatus. Upon evaporation of excess 184
chloroform, PHA was precipitated in 20 volumes of ice cold methanol. The precipitate was 185
dissolved in chloroform and once more precipitated in methanol. The isolate was again dissolved 186
in chloroform and cast in a glass petri dish to dry. Hydroxyalkanoic acids were identified and 187
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
10
quantified with standards provided by Bioplastech (Dublin, IRE). For observation of PHA 188
granules under the fluorescence microscope, cells were stained with Nile red (29). 189
Characterization of PHA 190
The mass average molar mass (Mw) and the number average molar mass (Mn) of isolated PHA 191
were determined by gel permeation chromatography (GPC) with a PL gel 5 mm mixed-C + PL 192
gel column (Perkin-Elmer, Waltham, MA, USA) and a PELV 290 UV-vis detector operating at 193
254 nm. Samples were injected at a concentration of 1% (wt/vol) in volumes of 500 µL. 194
Spectroscopic grade chloroform was used as the mobile phase with a flow rate of 1.0 mL min-1. 195
Molecular weights were calculated using a standard curve, which was prepared with polystyrene 196
samples of low polydispersity. 197
Differential scanning calorimetry (DSC) was carried out to determine the melting- (Tm) and glass 198
transition temperatures (Tg) of isolated PHA. For this a Perkin Elmer (Waltham, MA, USA) 199
Pyris-Diamond Calorimeter calibrated to Indium standards was used. Samples were heated in 200
hermetically sealed aluminum pans from -90 to 100 °C at 10 °C min-1. The Tg was obtained by 201
holding the sample at 100 °C for 1 min and rapidly lowering the temperature to -90 °C. To 202
determine the Tm, samples were then reheated from -90 to 100 °C. 203
204
Results 205
PHA accumulation in cells of engineered R. rubrum strains from different feedstocks 206
As R. rubrum is capable of converting carbon monoxide and carbon dioxide to acetyl-CoA, the 207
goal was to establish a synthetic pathway from this central metabolite to PHAMCL (Fig. 1). 208
Furthermore, the natural synthesis of PHASCL in R. rubrum had to be inhibited in order to 209
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
11
synthesize solely PHAMCL in a recombinant R. rubrum strain. For this, the phaC1 and phaC2 210
genes coding for the two PHA-synthases in this bacterium, which are essential for polymerization 211
of 3-hydroxybutyryl-CoA and 3-hydroxyvaleryl-CoA, were deleted. This resulted in a 212
R. rubrum ΔphaC1/ΔphaC2 strain incapable of synthesizing PHASCL (30, 31). Applying the 213
findings of previous studies, three genes of the known PHAMCL-producer P. putida KT2440 were 214
cloned into the broad-host-range expression vector pBBR1MCS-2 and overexpressed in R. 215
rubrum ΔphaC1/ΔphaC2: (i) phaG, originally described as a 3-hydroxyacyl-acyl ACP-CoA 216
transferase (4), but recently identified as a 3-hydroxyacyl-acyl ACP thioesterase (5); (ii) the 217
PP_0763 gene, predicted to code for an MCL fatty-acid-CoA ligase (5) and (iii) phaC1, which 218
codes for a PHA-synthase with a high specificity for C6-C14 substrates (18). Additionally, a CO-219
inducible promoter from R. rubrum itself (19) was applied to potentially establish a CO-mediated 220
induction of gene expression of vector-bound heterologous genes and PHAMCL synthesis. Upon 221
cloning of the respective DNA fragments into the expression vector, R. rubrum ΔphaC1/ΔphaC2 222
was transformed with the two generated plasmids and, as a control, with the empty pBBR1MCS-223
2 vector. With the media described above, the recombinant strains were cultivated in (i) an 224
artificial syngas atmosphere resembling a possible composition of actual synthesis gas (CO, 40 225
vol%; H2, 40 vol%; CO2, 10 vol%; N2, 10 vol%), (ii) “pure” CO (CO, 40 vol%; N2, 60 vol%), or, 226
to comparably test the synthesis of PHAMCL from a heterotrophic unrelated carbon source, (iii) 227
with fructose (1% wt/vol). Additionally, the media contained 0.2% (wt/vol) of disodium 228
succinate hexahydrate, which proved to be beneficial for growth of R. rubrum under various 229
conditions without affecting PHA synthesis, as the generated strains did not synthesize any PHA 230
when only succinate was present in the media during preliminary cultivations (Fig. S1). 231
Cells of the engineered R. rubrum strains were cultivated for five days with carbon monoxide or 232
artificial syngas as described above (Fig. 2). The strain harboring the CO-inducible PcooF 233
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
12
unexpectedly showed a reduced growth with either gas composition when compared to the 234
R. rubrum ΔphaC1/ΔphaC2 strain harboring an empty vector or the strain expressing phaG, 235
phaC and PP_0763 under control of the vector-own Plac, which cannot be induced in R. rubrum, 236
but shows basal activity without induction of IPTG or lactose that cannot enter the cell. This was 237
reflected in the specific growth rates of the strain carrying pBBR1MCS-2-238
PcooF::phaG::phaC1::PP_0763 (Syngas, 0.024 h-1 ± 0.003 h-1; CO, 0.020 h-1 ± 0.004 h-1), which 239
were decreased by approximately 20% as compared to R. rubrum ΔphaC1/ΔphaC2 pBBR1MCS-240
2::phaG::phaC1::PP_0763 (Syngas, 0.029 h-1 ± 0.005 h-1; CO, 0.027 h-1 ± 0.006 h-1) and 25% 241
as compared to R. rubrum ΔphaC1/ΔphaC2 harboring the empty pBBR1MCS-2 (Syngas, 0.029 242
h-1 ± 0.003 h-1; CO, 0.030 h-1 ± 0.004 h-1). By means of an unpaired t test, the impact on growth 243
between pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763 and pBBR1MCS-2 could be regarded as 244
significant (p < 0.05), at least, when pure CO was applied in the gas phase of flasks. In contrast, 245
all three strains grew similarly when cultivated with fructose as the main source of carbon (data 246
not shown). Gas chromatographic analysis revealed that the recombinant strains of R. rubrum 247
harboring the three genes of P. putida KT440 synthesized a polymer, which solely consisted of 248
MCL 3-hydroxyalkanoic acids, from all of the given unrelated carbon sources: Syngas, carbon 249
monoxide and fructose (Table 2). In contrast, R. rubrum ΔphaC1/ΔphaC2 pBBR1MCS-2 250
remained PHASCL- and PHAMCL-negative. The predominant constituents of the synthesized 251
polymer were 3-hydroxyoctanoic- (3HO) and 3-hydroxydecanoic acid (3HD). When cultivated 252
with fructose or artificial syngas, both of the strains harboring phaG, phaC1 and PP_0763 from 253
P. putida incorporated also traces of 3-hydroxyhexanoate (3HH) into the polymer, which, 254
however, accounted for less than 0.2 mol%. Although the PcooF-promoter had a negative effect on 255
the optical density, indicating slower growth when cultivated in presence of CO, the strain 256
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
13
carrying pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763 showed the highest production of 257
PHAMCL under these conditions, synthesizing the heteropolymer to 6.7 % (wt/wt) of the cell dry 258
weight when cultivated in syngas atmosphere. This was a significant increase as compared to 259
cultivations of this strain with fructose or to the other strains cultivated in presence of any carbon 260
source (Table 2). Moreover, the applied PcooF affected the composition of the polymer synthesized 261
by the respective strain, as the 3HO-fraction of the accumulated poly(3HD-co-3HO) was 262
significantly increased to 42.8 mol% (Syngas) and 48.2 mol% (CO) when compared to the 263
polymer synthesized upon heterologous gene expression via the pBBR1MCS-2 standard Plac-264
promoter (Syngas, 31.8 mol% 3HO; CO, 33.5 mol% 3HO). A SDS-PAGE of samples taken from 265
syngas cultures after two days of growth showed a distinct protein spot at 29 kDa for the PcooF-266
harboring recombinant R. rubrum strain, similar to the previously purified PhaG (7). This 267
suggested a strong overexpression of phaG in this strain, as compared to the strain expressing the 268
genes under control of the Plac promoter and the strain carrying the empty vector (Fig. 3). 269
Microscopic observation of strain R. rubrum ΔphaC1/ΔphaC2 pBBR1MCS-2-270
PcooF::phaG::phaC1::PP_0763 revealed the presence of 2-4 granules in many of the cells (Fig. 4). 271
They appeared to be smaller than the 6-8 granules, which were displayed by the PHASCL-272
accumulating wild-type strain R. rubrum S1 harboring the empty vector. As expected, cells of the 273
PHASCL-negative strain R. rubrum ΔphaC1/ΔphaC2 pBBR1MCS-2 did not contain any granules. 274
Additionally, strains of R. rubrum ΔphaC1/ΔphaC2 appeared shorter than the spiral-shaped wild-275
type cells, measuring a length of approximately 4 µm in comparison to the length of 6-8 µm of 276
the wild type cells. 277
Analysis of PHAMCL degradation in engineered R. rubrum strains 278
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
14
As polymer-degradation by producing strains is crucial for the efficiency of PHA-production 279
processes, it was examined if a recombinant strain of R. rubrum was able to degrade the PHAMCL, 280
which it was genetically engineered to synthesize. Furthermore, mutageneses of the phaZ2 gene 281
in R. rubrum were carried out to study the effect of a putatively intracellular PHASCL-282
depolymerase (PhaZ2) on PHAMCL-accumulation. 283
Most probably, there are three PHA-depolymerases (PhaZ1/PhaZ2/PhaZ3) encoded in the 284
genome of R. rubrum. PhaZ1 was shown to be located in the cell´s periplasm and is unlikely 285
physically involved in in vivo PHB degradation (20). In vitro studies on the gene product of 286
phaZ3 showed that this PHA-depolymerase was specific for amorphous PHASCL but was 287
predicted to be inactive at cytoplasm-typical concentrations of divalent cations such as Mg2+ (32). 288
In contrast, PhaZ2 shows significant homologies to the well characterized intracellular PHASCL-289
depolymerase of R. eutropha (PhaZ1) and was therefore predicted to be responsible for 290
intracellular PHA-degradation in R. rubrum (20, 32, 33). Thus, phaZ2 (locus_tag: Rru_A3356) 291
was (i) chosen for deletion in R. rubrum ΔphaC1/ΔphaC2, as well as (ii) directed mutagenesis 292
leading to an amino acid exchange in the putative active site of PhaZ2. The putative active site of 293
PhaZ2R. rubrum was identified by a sequence alignment with the known PHA-depolymerase 294
PhaZ1R. eutropha, whose catalytic triad was identified by Kobayashi & Saito (34). Using the 295
BLAST algorithm (35), a catalytic triad of cysteine (C176), aspartate (D349) and histidine 296
(H382) was identified for PhaZ2R. rubrum (Fig. S2). Therefore, an exchange of cysteine for alanine 297
at amino acid position 176 would possibly inhibit the thiolyzing activity of PhaZ2 and disturb the 298
binding of potential PhaZ2-isoenzymes to the PHA granule surface, but still allow putative 299
protein-protein interactions. 300
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
15
Upon generation of the mutants R. rubrum ΔphaC1/ΔphaC2/ΔphaZ2 and R. rubrum 301
ΔphaC1/ΔphaC2/phaZ2C176A, these strains were transformed with pBBR1MCS-2-302
PcooF::phaG::phaC1::PP_0763, as this construct led to the highest amounts of synthesized 303
PHAMCL in the foregoing cultivations. To compare the PHA accumulation and degradation of the 304
generated strains with the phaZ2-wildtype genotype, the three strains were cultivated for five 305
days in artificial syngas atmosphere, which proved to be the most suitable feedstock (Table 2), as 306
described above. In order to stimulate potential degradation of synthesized polymer by limiting 307
available carbon, the syngas- was replaced by a nitrogen-atmosphere, and the cultures were 308
incubated for two additional days. The PHA contents were measured from 20 mL samples, which 309
were obtained prior to- and after the gas exchange. The three cultivated engineered strains of 310
R. rubrum grew equally and showed optical densities, which were similar to the foregoing 311
cultivations with artificial syngas (Fig. 2). GC-analyses of cell material obtained from the three 312
cultivated strains revealed that the PHAMCL contents of the recombinant strains of R. rubrum had 313
decreased over two days of carbon-limited cultivation, suggesting partial polymer degradation. In 314
the remaining polymer the fractions of 3HO and 3HD occurred in a similar ratio as in the sample 315
taken prior to carbon starvation. The deletion of phaZ2R. rubrum did not have a positive effect on 316
the accumulation of PHAMCL and did not result in a reduced degradation of the polymer, as 317
compared to the strain carrying the wild type phaZ2. Although the strain R. rubrum 318
ΔphaC1/ΔphaC2/phaZ2C176A carrying pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763 319
accumulated slightly more PHA (7.1 % ± 0.5 % wt/wt of CDW) than the strain carrying the 320
wildtype phaZ2 (6.5% ± 0.3%), a significantly reduced degradation of the polymer was not 321
observed either, as approximately 21 % of the accumulated polymer was degraded within two 322
days without carbon supply (Fig. 5). This was slightly less than measured for the two other tested 323
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
16
strains harboring the plasmid (R. rubrum ΔphaC1/ΔphaC2 24%; R. rubrum 324
ΔphaC1/ΔphaC2/ΔphaZ2, 25% degradation). 325
Isolation and analysis of PHAMCL derived from syngas cultivations 326
In order to isolate PHAMCL, synthesized from CO- and CO2- containing synthesis gas, cells of the 327
strain accumulating the highest amount of PHAMCL over the course of the conducted cultivation 328
experiments was chosen. This was R. rubrum ΔphaC1/ΔphaC2/phaZ2C176A pBBR1MCS-2-329
PcooF::phaG::phaC1::PP_0763. To obtain a sufficient amount of cell mass, 50 mL cultures were 330
inoculated to an increased initial optical density of about 0.8 and again cultivated for 5 days as 331
described above. About 91 mg of synthesized polymer were isolated from 2.9 g of dried cells that 332
were harvested from a total of 3 L of culture broth. The precipitated and dried polymer appeared 333
as a gluey, rubber-like material (Fig. S3). GC-analysis confirmed the composition that was 334
previously determined from dried cell mass, as the polymer-isolate fractions were 55.6 mol% 335
3HD, 44.2 mol% 3HO and less than 0.2 mol% 3HH. GPC analysis of the isolated polymer 336
revealed a mass average molar mass (Mw) of 124.3 kDa, with a polydispersity index (PDI, Mw/ 337
number average molar mass Mn) of 2.62. Furthermore, calorimetric analysis determined a melting 338
point (Tm) of 49.6 °C and a glass transition temperature (Tg) of -41.1 °C. 339
340
Discussion 341
Despite the numerous studies pursuing the production of PHAMCL from cheap and abundant 342
carbon sources, so far no approach to utilize CO or CO2 for the microbial production of these 343
polyesters exists. The purple non-sulfur alphaproteobacterium R. rubrum presents a promising 344
candidate for this strategy, as it has comparably high CO-uptake and -utilization rates, harbors a 345
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
17
complete PHA-synthesis and -granule apparatus and is amenable to genetic modification (36-38). 346
In this study, an engineered R. rubrum strain synthesized PHAMCL up to 7.1 % (wt/wt of CDW) 347
consisting predominantly of 3-hydroxyoctanoate (3HO) and 3-hydroxydecanoate (3HD) with 348
traces of 3-hydroxyhexanoate (3HH) from an artificial syngas mixture. Expectedly, this amount 349
of synthesized PHA together with the produced biomass is less than reported in foregoing studies 350
focusing on the production of PHAMCL from heterotrophic unrelated carbon sources in 351
recombinant E. coli or various strains of Pseudomonas (4, 39-41). However, the feedstocks used 352
in these studies differ significantly from the newly applied potential waste gases in the present 353
study. A clear bottle neck for productivity arising from the basic technical setup in the cultivation 354
experiments is the low hydrostatic pressure in the applied shake flasks, which is limiting the mass 355
transfer of CO and CO2 into the liquid phase. Therefore, great potential lies in the scale up of the 356
process to a suitable bioreactor, in which hydrostatic pressure is elevated, as this would likely 357
result in an increased availability of the substrate leading to higher yield (12). Due to the 358
technical limitations of the pilot setup applied in this study, the exact percentage of available CO 359
or CO2 converted into PHA could not be determined. Cultivations comparing the PHAMCL-360
synthesis from pure CO with the syngas mixture containing CO and CO2 showed that the added 361
10% (vol/vol) of CO2 in the gas phase lead to a significant increase in accumulated polymer 362
when compared to cultivations with pure CO (Table 2). This indicated that CO2 present in syngas 363
can be more readily converted into acetyl-CoA, which is then subjected to fatty acid synthesis, 364
than CO, which has to be oxidized by the CO-dehydrogenase in R. rubrum to CO2 at first (42). 365
Recently, Revelles et al. (16) showed an upregulation of genes coding for additional 366
carboxylases, other than Rubisco, which play a major role in the fixation of CO2 in R. rubrum 367
when acetate was present in the cultivation medium, but not with malate. Therefore, the use of 368
another citric acid cycle intermediate as succinate as an auxiliary carbon source should likewise 369
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
18
not lead to an upregulation of the acetate assimilation routes ethylmalonyl-CoA pathway, or 370
acetyl-CoA carboxylation via PFOR (Fig. 1). Thus, available CO2 is likely to be assimilated via 371
the Calvin cycle, or alternatively, by a 2-oxoglutarate synthase via the reductive citric acid cycle 372
(Fig. 1; 16). Apart from that, any polymer synthesized in these cultivations resulted from CO and 373
CO2 dissolved in the media, as the recombinant strains did not synthesize any PHA from the 374
applied media, when syngas or pure CO were omitted. 375
The application of the PcooF-promoter showed that the level of heterologous expression of 376
especially phaG as indicated by the protein patterns of strains (Fig. 3) was crucial for the amount 377
of PHA-precursors, which were subtracted from fatty acid synthesis for PHA formation (Table 378
2). Interestingly, this also had an impact on the constituent fractions of the synthesized polymer 379
(Table 2), as higher quantities of PhaG molecules presumably resulted in an earlier withdrawal of 380
3-hydroxyacyl-ACP from the fatty acid de novo synthesis pathway. This may have caused the 381
increased incorporation of 3HO. The regulation of heterologous gene expression through PcooF 382
also reduced growth of the strain. As this strong promoter has been applied in genetically 383
modified R. rubrum strains without affecting growth before (43), the hampering effect might be 384
due to the considerable interaction of PhaG with the organism´s fatty acid metabolism. 385
Further cultivations with recombinant PHAMCL-producing strains of R. rubrum showed that the 386
strains were able to partially degrade the synthesized polymer (Fig. 5), regardless of a mutated 387
phaZ2R. rubrum. PhaZ2, described as an intracellular PHA-depolymerase (20), therefore likely acts 388
specifically on PHASCL, which are synthesized by the wild type of R. rubrum. The partial 389
degradation of the accumulated polymer might be attributed to the activity of a lipase present in 390
R. rubrum, as these enzymes have been shown to degrade PHAs of varying chain-lengths as well 391
(44). Nevertheless, the phaZ2C176A-mutation, leading to an amino acid exchange in the therefore 392
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
19
inactive catalytic site of the enzyme caused a slight increase in accumulated PHAMCL possibly 393
due to hitherto unknown interactions on the PHA granule surface. 394
The isolated poly(3HD-co-3HO) exhibited properties similar to those of PHA produced from 395
P. putida. The detected Mw of 124.3 kDa was in the range of the Mw of PHAMCL(-co-SCL) produced 396
by different recombinant strains in previous studies (45-48), but was lower than PHAMCL 397
commonly produced by the Pseudomonas wild type strains (2, 49). The quantities of PhaC-398
molecules, which catalyze polymerization, have shown to be related to the number of polymer 399
chains and consequently also influence the individual molecular weight of each chain. Therefore, 400
further genetic engineering leading to a reduced expression of heterologous phaC1Pp could 401
increase the Mw of the synthesized polymer (50). 402
Additional metabolic engineering, leading e. g. to an enhanced flux of acetyl-CoA, derived from 403
CO and CO2 assimilation, to fatty acid synthesis and foremost, a scale-up that optimizes the 404
cultivation conditions and increases gas-liquid mass transfer would most likely result in a higher 405
productivity of the process. Moreover, the approach of activating gene expression in the 406
recombinant R. rubrum strain with a CO-inducible promoter could be applied in a potential two-407
step process, in which an aerobic, heterotrophic cultivation phase to gain high cell density could 408
be followed by a anaerobic, syngas-mediated PHAMCL production phase. By this, the relatively 409
slow cell growth with CO or CO2 as energy- and carbon sources would be encountered. A further 410
alternative process modification might be the cultivation in the presence of light, which has 411
shown to promote growth of the phototrophic R. rubrum under varying conditions (51). However, 412
due to the intracellular accumulation of PHA, high cell density fermentation in a large vessel 413
volume is required for productivity. This, along with the need for high hydrostatic pressure to 414
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
20
maximize gas-solubility would make the use of an e.g. loop-reactor unpractical in most potential 415
scale-up approaches. 416
This study has demonstrated in principle the possibility to synthesize PHAMCL directly from the 417
renewable feedstock synthesis gas. The results presented here contribute to the goal of extending 418
the potential applications of second-generation biopolymers from toxic- (CO) and greenhouse- 419
(CO2) waste gases, which do not compete with human nutrition, by completely altering the 420
monomer composition of PHA produced by the industrially promising bacterium 421
Rhodospirillum rubrum. 422
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
21
References 423
1. Tan GYA, Chen CL, Li L, Ge L, Wang L, Razaad IMN, Li Y, Zhao L, Mo Y, Wang 424
JY. 2014. Start a research on biopolymer polyhydroxyalkanoate (PHA): A review. 425
Polymers 6:706-754. 426
2. Rai R, Keshavarz T, Roether JA, Boccaccini AR, Roy I. 2011. Medium chain length 427
polyhydroxyalkanoates, promising new biomedical materials for the future. Mater Sci Eng 428
R 72:29-47. 429
3. Tappel RC, Pan W, Bergey NS, Wang Q, Patterson IL, Ozumba OA, Matsumoto K, 430
Taguchi S, Nomura CT. 2014. Engineering Escherichia coli for improved production of 431
short-chain-length-co-medium-chain-length poly[(R)-3-hydroxyalkanoate] (SCL-co-MCL 432
PHA) Copolymers from renewable nonfatty acid feedstocks. ACS Sustain Chem Eng. 433
2:1879-1887. 434
4. Rehm BHA, Krüger N, Steinbüchel A. 1998. A new metabolic link between fatty acid de 435
Novo synthesis and polyhydroxyalkanoic acid synthesis. J Biol Chem 273:24044-24051. 436
5. Wang Q, Tappel RC, Zhu C, Nomura CT. 2012. Development of a new strategy for 437
production of medium-chain-length polyhydroxyalkanoates by recombinant Escherichia 438
coli via inexpensive non-fatty acid feedstocks. Appl Environ Microbiol 78:519-527. 439
6. Da Silva DA, Antonio RV, Rossi JM, Pena RS. 2015. Production of medium-chain-length 440
polyhydroxyalkanoate by Pseudomonas oleovorans grown in sugary cassava extract 441
supplemented with andiroba oil. Food Sci Technol 34:738-745. 442
7. Cerrone F, Choudhari SK, Davis R, Cysneiros D, O’Flaherty V, Duane G, Casey E, 443
Guzik MW, Kenny ST, Babu RP, O’Connor KE. 2014. Medium chain length 444
polyhydroxyalkanoate (mcl-PHA) production from volatile fatty acids derived from the 445
anaerobic digestion of grass. Appl Microbiol Biotechnol 98:611-620. 446
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
22
8. Guzik MW, Kenny ST, Duane GF, Casey E, Woods T, Babu RP, Nikodinovic-Runic J, 447
Murray M, O’Connor KE. 2014. Conversion of post consumer polyethylene to the 448
biodegradable polymer polyhydroxyalkanoate. Appl Microbiol Biotechnol 98:4223-4232. 449
9. Ward PG, de Roo G, O’Connor KE. 2005. Accumulation of polyhydroxyalkanoate from 450
styrene and phenylacetic acid by Pseudomonas putida CA-3. Appl Environ Microbiol 451
71:2046-2052. 452
10. Do Sul JAI, Costa MF. 2014. The present and future of microplastic pollution in the 453
marine environment. Environ Pollut 185:352-364. 454
11. Drzyzga O, Revelles O, Durante-Rodriguez G, Díaz E, Garcia JL, Prieto A. 2015. New 455
challenges for syngas fermentation: Towards production of biopolymers. J Chem Technol 456
Biot 90:1735-1751. 457
12. Choi DW, Chipman DC, Bents SC, Brown RC. 2009. A techno-economic analysis of 458
polyhydroxyalkanoate and hydrogen production from syngas fermentation of gasified 459
biomass. Appl Biochem Biotechnol 160:1032-1046. 460
13. Do YS, Smeenk J, Broer KM, Kisting CJ, Brown R, Heindel TJ, Bobik TA, DiSpirito 461
AA .2007. Growth of Rhodospirillum rubrum on synthesis gas: Conversion of CO to H2 and 462
poly-β-hydroxyalkanoate. Biotechnol Bioeng 97:279-286. 463
14. Brandl HB, Knee Jr EJ, Fuller C, Gross RA, Lenz RW. 1989. Ability of the 464
phototrophic bacterium Rhodospirillum rubrum to produce various poly(β-465
hydroxyalkanoates): potential sources for biodegradable polyesters. Appl Environ Microbiol 466
33:296-301. 467
15. Heinrich D, Raberg M, Steinbüchel A. 2015. Synthesis of poly(3-hydroxybutyrate-co-3-468
hydroxyvalerate) from unrelated carbon sources in engineered Rhodospirillum rubrum. 469
FEMS Microbiol Lett 362:fnv038. 470
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
23
16. Revelles O, Tarazona N, Garcia JL, Prieto MA. 2016. Carbon roadmap from syngas to 471
polyhydroxyalkanoates in Rhodospirillum rubrum. Environ Microbiol 18:708-720. 472
17. Kerby RL, Ludden PW, Roberts GP. 1995. Carbon monoxide-dependent growth of 473
Rhodospirillum rubrum. J Bacteriol 177:2241-2244. 474
18. Huisman GW, Wonink E, Meima R, Kazemier B, Terpstra P, Witholt B. 1991. 475
Metabolism of poly(3-hydroxyalkanoates) (PHAs) by Pseudomonas oleovorans. 476
Identification and sequences of genes and function of the encoded proteins in the synthesis 477
and degradation of PHA. J Biol Chem 266:2191-2198. 478
19. He Y, Gaal T, Karls R, Donohue TJ, Gourse RL, Roberts GP. 1999. Transcription 479
activation by CooA, the CO-sensing factor from Rhodospirillum rubrum. J Biol Chem 480
274:10840-10845. 481
20. Handrick R, Reinhardt S, Kimmig P, Jendrossek D. 2004. The “intracellular” poly(3-482
hydroxybutyrate (PHB) depolymerase of Rhodospirillum rubrum is a periplasm-located 483
protein with specificity for native PHB and with structural similarity to extracellular PHB 484
depolymerases. J Bacteriol 186:7243-7253. 485
21. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: A laboratory manual. Cold 486
Spring Harbor, NY: Cold spring harbor laboratory press. 487
22. Bose SK, Gest H, Ormerod JG. 1961. Light-activated hydrogenase activity in a 488
photosynthetic bacterium: A permeability phenomenon. J Biol Chem 236:13-14. 489
23. Hanahan D. 1983. Studies on transformation of Escherichia coli with plasmids. J Mol Biol 490
166:557-580. 491
24. Aneja KK, Ashby RD, Solaiman DKY. 2009. Altered composition of Ralstonia eutropha 492
poly(hydroxyalkanoate) through expression of PHA synthase from Allochromatium vinosum 493
ATCC 35206. Biotechnol Lett 31:1601-1612. 494
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
24
25. Hogrefe C, Römermann D, Friedrich B. 1984. Alcaligenes eutrophus hydrogenase genes 495
(Hox). J Bacteriol 158:43-48. 496
26. Bradford, MM. 1976. A rapid and sensitive method for the quantification of microgram-497
quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-498
254. 499
27. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of 500
bacteriophage T4. Nature 227:680-685. 501
28. Timm A, Byrom D, Steinbüchel A. 1990. Formation of blends of various poly(3-502
hydroxyalkanoic acids) by a recombinant strain of Pseudomonas oleovorans. Appl 503
Microbiol Biotechnol 33:296-301. 504
29. Spiekermann P, Rehm BHA, Kalscheuer R, Baumeister D, Steinbüchel A. 1999. A 505
sensitive viable-colony staining method using Nile red for direct screening of bacteria that 506
accumulate polyhydroxyalkanoic acids and other lipid storage compounds. Arch Microbiol 507
171:73-80. 508
30. Jin H, Nikolau BJ. 2012. Role of genetic redundancy in polyhydroxyalkanoate (PHA) 509
polymerases in PHA biosynthesis in Rhodospirillum rubrum. J Bacteriol 194:5522-5529. 510
31. Klask C, Raberg M, Heinrich D, Steinbüchel A. 2015. Heterologous expression of 511
various PHA synthase genes in Rhodospirillum rubrum. Chem Biochem Eng Q 29:75-85. 512
32. Sznajder A, Jendrossek D. 2011. Biochemical characterization of a new type of 513
intracellular PHB depolymerase from Rhodospirillum rubrum with high hydrolytic activity 514
on native PHB granules. Appl Microbiol Biotechnol 89:1487-1495. 515
33. Uchino K, Saito T, Gebauer B, Jendrossek D. 2007. Isolated poly(3-hydroxybutyrate) 516
(PHB) granules are complex bacterial organelles catalyzing formation of PHB from acetyl 517
coenzyme A (CoA) and degradation of PHB to acetyl-CoA. J Bacteriol 189:8250-8256. 518
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
25
34. Kobayashi T, Saito T. 2003. Catalytic triad of intracellular poly(3-hydroxybutyrate) 519
depolymerase (PhaZ1) in Ralstonia eutropha H16. J Biosci Bioeng 96:487-492. 520
35. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 521
1997. Gapped BLAST and PSI-BLAST: A new generation of protein database search 522
programs. Nucleic Acids Res 25:3389-3402. 523
36. Bonam D, Lehman L, Roberts GP, Ludden PW. 1989. Regulation of carbon monoxide 524
dehydrogenase and hydrogenase in Rhodospirillum rubrum: Effects of CO and oxygen on 525
synthesis and activity. J Bacteriol 171:3102-3107. 526
37. Handrick R, Reinhardt S, Schultheiss D, Reichart T, Schüler D, Jendrossek V, 527
Jendrossek D. 2004b. Unraveling the function of the Rhodospirillum rubrum activator of 528
polyhydroxybutyrate (PHB) degradation: The activator is a PHB-granule-bound protein 529
(phasin). J Bacteriol 186:2466-2475. 530
38. Younesi H, Najafpur G, Ismail KSK, Mohamed AR, Kamaruddin AH. 2007. 531
Biohydrogen production in a continuous stirred tank bioreactor from synthesis gas by 532
anaerobic photosynthetic bacterium Rhodospirillum rubrum. Bioresource Technol 99:2612-533
2619. 534
39. Agnew DE, Stevermer AK, Youngquist JT, Pfleger BF. 2012. Engineering Escherichia 535
coli for production of C12-C14 polyhydroxyalkanoates from glucose. Metab Eng 14:705-713. 536
40. Borrero-de Acuna JM, Bielecka A, Häussler S, Schobert M, Jahn M, Wittmann C, 537
Jahn D, Poblete-Castro I. 2014. Production of medium chain length polyhydroxyalkanoate 538
in metabolic flux optimized Pseudomonas putida. Microb Cell Fact 13:88. 539
41. Huijberts GNM, Eggink G, De Ward P, Huisman GW, Witholt B. 1992. Pseudomonas 540
putida KT2442 cultivated on glucose accumulates poly(3-hydroxyalkanoates) consisting of 541
saturated and unsaturated monomers. Appl Environ Microbiol 58:536-544. 542
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
26
42. Bonam D, Murrell SA, Ludden PW. 1994. Carbon monoxide dehydrogenase from 543
Rhodospirillum rubrum. J Bacteriol 159:693-699. 544
43. Jin H, Nikolau BJ. 2014. Evaluating PHA productivity of bioengineered Rhodospirillum 545
rubrum. Plos One 9:e96621. 546
44. Jaeger KE, Steinbüchel A, Jendrossek D. 1995. Substrate specificities of bacterial 547
polyhydroxyalkanoate depolymerases and lipases: Bacterial lipases hydrolyze poly(ω-548
hydroxyalkanoates). Appl Environ Microbiol 61:3113-3118. 549
45. Hokamura A, Wakida I, Miyahara Y, Tsuge T, Shiratsuchi H, Tanaka K, Matsusaki 550
H. 2015. Biosynthesis of poly(3-hydroxybutyrate-co-3-hydroxyalkanoates) by recombinant 551
Escherichia coli from glucose. J Biosci Bioeng 120:305-310. 552
46. Matsumoto K, Nakae S, Taguchi K, Matsusaki H, Seki M, Doi Y. 2001. Biosynthesis of 553
poly(3-hydroxybutyrate-co-3-hydroxyalkanoates) copolymers from sugars by recombinant 554
Ralstonia eutropha harboring the phaC1Ps and the phaGPs genes of Pseudomonas sp. 61-3. 555
Biomacromolecules 2:934-939. 556
47. Tappel RC, Pan W, Bergey, NS, Wang Q, Patterson IL, Ozumba OA, Matsumoto K, 557
Taguchi S, Nomura CT. 2014. Engineering Escherichia coli for improved production of 558
short-chain-length-co-medium-chain-length poly[(R)-3-hydroxyalkanoate] (SCL-co-MCL 559
PHA) copolymers from renewable nonfatty acid feedstocks. ACS Sustain Chem Eng 560
2:1879-1887. 561
48. Prieto MA, Kellerhals MB, Bozzatto GB, Radnovic D, Witholt B, Kessler B. 1999. 562
Engineering of stable recombinant bacteria for production of chiral medium-chain-length 563
poly-3-hydroxyalkanoates. Appl Environ Microbiol. 65:3265-3271. 564
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
27
49. Jiang X, Sun Z, Marchessault RH, Ramsay JA, Ramsay BA. 2012. Biosynthesis and 565
properties of medium-chain-length polyhydroxyalkanoates with enriched content of the 566
dominant monomer. Biomacromolecules 13:2926-2932. 567
50. Sim SJ, Snell KD, Hogan SA, Stubbe J, Rha C, Sinskey AJ. 1996. PHA synthase activity 568
controls the molecular weight and polydispersity of polyhydroxybutyrate in vivo. Nat 569
Biotechnol 15:63-67. 570
51. Najafpour, GD, Younesi H. 2007. Bioconversion of synthesis gas to hydrogen using a 571
light-dependent photosynthetic bacterium, Rhodospirillum rubrum. World J Microbiol 572
Biotechnol 23:275-284. 573
52. Simon R, Priefer U, Pühler A. 1983. A broad host range mobilization system for in vivo 574
genetic engineering: Transposon mutagenesis in Gram negative bacteria. Bio/Technology 575
1:784-791. 576
53. Esmarch E. 1887. Über die Reinkultur eines Spirillum. Zentbl Bakteriolog 1:225-230. 577
54. Molisch H. 1987. Die Purpurbakterien nach neuen Untersuchungen. Jena: Fischer, 1907:1-578
95. 579
55. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop II RM, Peterson KM. 580
1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying 581
different antiviotic-resistance casettes. Gene 166:175-176. 582
56. Quandt J, Hynes MF. 1993. Versatile suicide vectors which allow direct selection for gene 583
replacement in gram-negative bacteria. Gene 127:15-21. 584
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
28
Legends to figures 585
Fig. 1: Synthesis of PHAMCL from CO and CO2 in recombinant R. rubrum. Upon entrance of 586
both gases into the cell through the cytoplasmic membrane, carbon monoxide is oxidized 587
with water to carbon dioxide and hydrogen by the carbon monoxide dehydrogenase CODHR. 588
rubrum (). CO2 is fixed via ribulose 1,5-bisphosphate carboxylase (Rubisco; Rru_A1998; ) 589
through the Calvin cycle of which the intermediate glyceraldehyde-3-phosphate (G3P) is 590
subsequently converted to the central metabolite acetyl-CoA. Acetyl-CoA is subjected to 591
fatty acid de novo synthesis cycle. The thiolysis of 3-hydroxyacyl-ACP is catalyzed by the 3-592
hydroxyacyl-ACP thioesterase PhaGP. putida (). MCL fatty acid CoA-ligase PP_0763P. putida 593
() catalyzes the activation of free 3-hydroxy fatty acids by CoA addition. Resulting 3-594
hydroxyacyl-CoA precursors are polymerized to poly-3-hydroxyalkanoate (PHAMCL) by 595
PHA-Synthase PhaC1P.putida (). Synthesis of poly(3-hydroxybutyrate) [poly(3HB)] is 596
deactivated by the deletion of phaC1R. rubrum and phaC2R. rubrum, which code for PHASCL-597
synthases (). Additional carboxylases, which might be also involved in assimilating 598
additional CO2 (16), include a pyruvate synthase (Rru_A2398; ), a crotonyl-CoA reductase 599
(Rru_A3063; ), a propionyl-CoA carboxylase (Rru_A1943; ), and a 2-oxoglutarate 600
synthase (Rru_A2721; ). 601
602
Fig. 2: Cultivation of strains of R. rubrum ΔphaC1/ΔphaC2, harboring pBBR1MCS-2 603
(empty vector, triangles), pBBR1MCS-2::phaG::phaC1::PP_0763 (circles) or pBBR1MCS-604
2-PcooF::phaG::phaC1::PP_0763 (squares). Cells were cultivated in media modified from 605
Bose et al. (22) with an artificial syngas atmosphere of 40 vol% CO, 40 vol% H2, 10 vol% 606
CO2 and 10 vol% N2 (black) or of 40 vol% CO and 60 vol% N2 (gray) for five days. Optical 607
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
29
densities of samples, whose standard deviations are represented by error bars, were measured 608
at 680 nm. 609
610
Fig. 3: Proteins in crude extracts of cells of R. rubrum ΔphaC1/ΔphaC2, harboring 611
pBBR1MCS-2 (empty vector, A), pBBR1MCS-2::phaG::phaC1::PP_0763 (B) or 612
pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763 (C). Cells were harvested after two days of 613
cultivation in media modified from Bose et al. (22) with an artificial syngas atmosphere of 614
40 vol% CO, 40 vol% H2, 10 vol% CO2 and 10 vol% N2. An amount of 40 µg of protein was 615
separated in an 11.5% (wt/vol) SDS-polyacrylamide gel and stained with Coomassie brilliant 616
blue. Molecular masses (in kDa) are indicated on the left. 617
618
Fig. 4: Polymer accumulation of R. rubrum S1 pBBR1MCS-2 (empty vector, A), R. rubrum 619
ΔphaC1/ΔphaC2 pBBR1MCS-2 (empty vector, B) and R. rubrum ΔphaC1/ΔphaC2 620
pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763 (C). Cells were stained with Nile red and 621
observed with a fluorescence microscope after 3 days of cultivation in media modified from 622
Bose et al. (22) with an artificial syngas atmosphere of 40 vol% CO, 40 vol% H2, 10 vol% 623
CO2 and 10 vol% N2 applying phase contrast (left) or fluorescence microscopy (right). 624
625
Fig. 5: PHAMCL synthesis and degradation of R. rubrum ΔphaC1/ΔphaC2 (squares), 626
R. rubrum ΔphaC1/ΔphaC2/ΔphaZ2 (triangles) and R. rubrum ΔphaC1/ΔphaC2/phaZC176A 627
(circles) harboring pBBR1MCS-2-PcooF::phaG::phaC1::PP_0763. Cells were cultivated in 628
media modified from Bose et al. (22) with an artificial syngas atmosphere of 40 vol% CO, 40 629
vol% H2, 10 vol% CO2 and 10 vol% N2 for five days and for further two days in pure N2. 630
Optical densities of samples, whose standard deviations are represented by error bars, were 631
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
30
measured at 680 nm. 3HO (light gray) and 3HD (dark gray) contents were measured by GC 632
analysis of dried cell matter from samples taken after five and seven days of cultivation. 633
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 1: Microorganisms, plasmids, and oligonucleotides, which were used in this study. All
heterologously overexpressed genes were amplified from genomic DNA of P. putida KT2440.
The PcooF-promoter and the codon-exchanged phaZ2 were amplified from genomic DNA of
R. rubrum S1. Utilized restriction sites are underlined in the oligonucleotide sequences.
Modifications in the resulting proteins, caused by the applied oligonucleotides are in bold type.
Organisms, plasmids, or oligonucleotides Relevant characteristics or sequence (5‘3‘) Source or
reference
E. coli TOP10
F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(StrR)
endA1 λ-
Life Technologies (Darmstadt, D)
E. coli S17-1 recA1, thi1, hsdR17(rk-, mk+), proA, tra (pRP4) 52
R. rubrum S1 (ATCC11170) Wild type DSM467; 53, 54
R. rubrum ΔphaC1/ΔphaC2 PHA-negative deletion mutant 31
R. rubrum ΔphaC1/ΔphaC2/ ΔphaZ2 PHA-negative phaZ2 deletion mutant This study
R. rubrum
ΔphaC1/ΔphaC2/phaZ2C176A
PHA-negative deletion mutant, amino acid exchange in PhaZ2 (Position 176 cysteine alanine)
This study
pBBR1MCS-2 Kmr 55
pBBR1MCS-2-PcooF Kmr, PcooF This study
pBBR1MCS-2::phaG::phaC1::pp0763
Kmr, P. putida KT2440 phaG, phaC1 & pp0763 This study
pBBR1MCS-2-PcooF::phaG::phaC1::pp0763
Kmr, PcooF, P. putida KT2440 phaG, phaC1 & pp0763 This study
pJQ200mp18 Gmr, sacB 56
pJQ200mp18::phaZ2C176A Gmr, R. rubrum phaZ2C176A This study
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
phaG_fwd_XhoI TTCTCGAGAGGAGGGATGACATGAGGCCAGAAATCG This study
phaG_rev_HindIII CGAAGCTTTCAGATGGCAAATGCATGC This study
phaC1_fwd_HindIII CAGAAGCTTAGGAGGTCGTAGATGAGTAACAAGAAC This study
phaC1_rev_BamHI CAGGATCCTGTAACTCAACGCTCGTG This study
PP_0763_fwd_SpeI TTACTAGTAGGAGGATCCCCATGTTGCAGACACG This study
PP_0763_rev_SpeI GTACTAGTCCCGCACAATGGTTACAACGTG This study
PcooF_fwd_ApaI AAGGGCCCTGGCGCGTTCCCACCTATATGAACTGGG This study
PcooF_rev_XhoI AACTCGAGTTCGTCGCCCTTCAGACCGGG This study
C176A_us_fwd_XbaI ATATCTAGAGGCGCGTGGCCGCACACTCGGTCCATACCCTTTACACCTGTCCG This study
C176A_us_rev CGCTGGGTTGGGCAACCGCCAACAGGTGGGTATCGGG This study
C176A_ds_fwd_XbaI GTTGGCGGTTGCCCAACCCAGCGTGCCGGTGCTGAC This study
C176A_ds_rev_XbaI ATATCTAGATGGCACCGCCGCGCTCCGCTTCAAGAATGAACGCACGGACATGG This study
phaZ2_us_fwd_XbaI TCTAGAGCGGTGGCGACGAACAG This study
phaZ2_us_rev_PstI CTGCAGTTTTCGTTAGCCGCGTTCC This study
phaZ2_ds_fwd_PstI CTGCAGTTGGGAAACCAAGACGCTGAAG This study
phaZ2_ds_rev_XbaI TCTAGATGGGGATCAAGACGCAGGG This study
phaZ2_int_fwd CCTTCGGCTTTGACACCTATGTCG This study
phaZ2_int_rev CGCGCTCCGCTTCAAGAATG This study
phaZ2_flank_fwd CAGGTGATGAAGGAACAGGCG This study
phaZ2_flank_rev GCACCCAGTCGGATTTATCGG This study
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 2: Cell dry weight (CDW) and PHA accumulation of recombinant strains of R. rubrum
ΔphaC1/ΔphaC2 cultivated with different carbon sources. Cells were cultivated in media
modified from Bose et al. (22) with an artificial syngas atmosphere (40% CO, 40% H2, 10% CO2,
10% N2), carbon monoxide (40% CO, 60% N2), or 1% (wt/vol) of fructose. 3HO and 3HD
contents were measured by GC analysis of dried cell matter from samples taken after five days of
gas-cultivation, or two days when cultivated with fructose. Standard deviations of measurements
are indicated. N.d.: Not detected.
R. rubrum ΔphaC1/ΔphaC2
pBBR1MCS-2
Carbon source CDW
(g/L)
PHA
(wt%)
3HO
(mol%)
3HD
(mol%)
phaG::phaC1::PP_0763 Syngas mixture 1.1 ± 0.2 1.4 ± 0.3 31.8 ± 1.1 68.1 ± 1.1
Carbon
monoxide
1.0 ± 0.1 1.0 ± 0.2 33.5 ± 1.5 66.5 ± 1.5
Fructose 3.6 ± 0.2 2.4 ± 0.4 30.1 ± 0.9 69.8 ± 0.9
PcooF::phaG::phaC1::PP_0763 Syngas mixture 1.0 ± 0.0 6.7 ± 0.8 42.8 ± 1.5 57.0 ± 1.5
Carbon
monoxide
0.8 ± 0.1 4.9 ± 0.3 48.2 ± 2.8 51.8 ± 2.8
Fructose 3.5 ± 0.3 2.1 ± 0.3 31.3 ± 1.7 68.6 ± 1.7
(empty vector) Syngas mixture 1.2 ± 0.0 N.d. N.d. N.d.
Carbon
monoxide
1.1 ± 0.1 N.d. N.d. N.d.
Fructose 3.8 ± 0.1 N.d. N.d. N.d.
on Novem
ber 9, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from