24
Synthetic Biology Open Language (SBOL): Community- Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy, Goksel Misirli, Nicholas Roehner (Editors), Herbert Sauro (Chair), & SBOL community SEED Conference Boston, MA June, 2015

Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Embed Size (px)

Citation preview

Page 1: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi-cation of Synthetic Biology DesignsJacob Beal, Bryan Bartley, Kevin Clancy, Goksel Misirli, Nicholas Roehner (Editors), Herbert Sauro (Chair), & SBOL community

SEED ConferenceBoston, MAJune, 2015

Page 2: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

The SBOL Community

• 100+ people from all around the world• 30 universities, 14 companies, 8 others• Ongoing development starting 2008

Majorfunders:

Page 3: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Synthetic Biology Open Language

FASTA

GenBank

SBOL 1.1

SBOL 2.0

ACTGTGCCGTTAAACGTGATTAAATCCGTACTGATAT…

TetR GFPpTet

aTcGFP

aTc detector GFP reporter

TetR GFPpTet

aTc detector GFP reporter

TetR GFPpTet

TetR

Page 4: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Purpose of SBOL 2.0

Lots of different synthetic biology resources…

GenBank

Measurement Data

Strain Data

LIMSLab Automation

HT Assays

Repositories & Databases Automation & Integration

Modeling

Sequencing & Synthesis

Emerging Approaches

some icons

… SBOL is a "hub" for linking them togetherBioPAX BioModels.Net

SOChEBI

Page 5: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Components of SBOL

SBOLv Glyphs

Tool

Tool

Tool

Tool

Tool

SBOL 2.0Data Model

Developer Community

fonts

examples

serialization

ontologies

images

libSBOL

SBOLdocuments

SBOLdocuments

SBOLdocuments

Other standards& resources

GenBank

Page 6: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

What SBOL 2.0 Represents

• Sequence structure• Incomplete designs• Qualitative function

TetRpTet

aTc detector aTc

TetR

GFP

GFP

GFP reporter

• Heterarchical composition

• Links to other information

GenBankMeasurement Data

Strain Information

Page 7: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Integration with non-SBOL Data

TetR GFPpTet

aTcGFP

aTc detector GFP reporter

TetR

Strain Information

• Embed SBOL in data• Embed data in SBOL

• Link SBOL to data• Links data to SBOL

Whatever model works best for the tools…

Page 8: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

SBOL supports many workflows

UserRepositories

Automation Vendors

User

Page 9: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

SBOL supports many workflows

• Reuse/Share

UserRepositories

Automation Vendors

User

Page 10: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

SBOL supports many workflows

UserRepositories

Automation Vendors

User

• Reuse/Share• Visualize

Page 11: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

SBOL supports many workflows

• Reuse/Share• Visualize• Design/Model

UserRepositories

Automation Vendors

User

Page 12: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

SBOL supports many workflows

• Reuse/Share• Visualize• Design/Model• Synthesize/Build

UserRepositories

Automation Vendors

User

Page 13: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

SBOL supports many workflows

• Reuse/Share• Visualize• Design/Model• Synthesize/Build• Automate

UserRepositories

Automation Vendors

User

Page 14: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Workflow: Reuse & Share

SBOLhub• Searchable repository for

public, private designs• Journal integration for

"one-click" private review

• Import SBOL/FASTA/GenBank, Export SBOL

Page 15: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Workflow: Reuse & Share

ICE• Web of integrated public and

private design registries• Sequences, plasmids,

strains, visualization• SBOL, Genbank, FASTA

Page 16: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Workflow: Visualize

Pigeon• Input simple network

description language• Design visualization

using SBOL glyphs

http://pigeoncad.org/

Page 17: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Workflow: Design & Model

iBioSim• Graphical design of

reaction networks• Import or export both

SBML and SBOL 2.0• Simulate ODE, SSAwww.async.ece.utah.edu/iBioSim/

Page 18: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Workflow: Design & Model

TinkerCell• Modular graphical

design of GRNs• SBOL import/export• Simulate ODE, SSA

http://www.tinkercell.com/

Page 19: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Workflow: Design & Model

BioCompiler• Generate GRN design

from functional program• SBOL visualization and

design output• ODE simulationshttps://synbiotools.bbn.com/

Page 20: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Workflow: Design & Model

Cello• Generate repressor

design from logic spec• SBOL encodes gate

library and outputs• Used w. TetR homologs

Page 21: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Workflow: Synthesize/Build

waiting for picture/movie from kevin

VectorNTI• SBOL import/export• features to

highlight?

Page 22: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

j5• Import SBOL designs• Generate assembly

plans, oligos, protocols• Support for onward

laboratory automation

Workflow: Automate

http://www.teselagen.com

Page 23: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Resources for Users/Developers

http://sbolstandard.org/

Page 24: Synthetic Biology Open Language (SBOL): Community-Driven Standard for Communi- cation of Synthetic Biology Designs Jacob Beal, Bryan Bartley, Kevin Clancy,

Call to Action!

• Tool builders, use SBOL• Laboratory practitioners, come

talk about what tools you need• NIST S.B. Standards Consortium

– Digital Biological Information WG

• Community meeting at IWBDA– August 19-21, Seattle

http://sbolstandard.org/